WO2007093133A1

WO2007093133A1 - Sars vaccine based on replicative vaccinia virus vector

Info

Publication number: WO2007093133A1
Application number: PCT/CN2007/000585
Authority: WO
Inventors: Yiming Shao; Ying Liu; Yong Liu; Meng Sun; Jianyuan Liu; Ning Wang
Original assignee: Chinese Center For Disease Control And Prevention Center For Aids/Std Control And Prevention
Priority date: 2006-02-16
Filing date: 2007-02-16
Publication date: 2007-08-23
Also published as: CN101020055B; CN101020055A; HK1108115A1

Abstract

Recombinant SARS vaccine expressing nucleocapsid protein and spike protein of SARS-CoV and its application are provided. Said SARS vaccine is constructed on the basis of replicative vaccinia virus, such as vaccinia virus Tian Tan strain. The carrier for constructing said SARS vaccine, DNA vaccine encoding SARS nucleocapsid protein and spike protein, and immunization procedure using said DNA vaccine and said SARS vaccine are also provided.

Description

SARS vaccine based on replicating vaccinia virus vector

The invention relates to the field of antiviral immunology. More specifically, the present invention relates to a vaccine against SARS-CoV based on a replicating vaccinia virus vector, a preparation method and use thereof. Background technique

Since the first case of SARS was discovered in Guangdong Province in November 2002, the epidemic has been widely prevalent throughout the world. The World Health Organization issued a warning to the world in March 2003 and named it severe acute respiratory syndrome (SARS). ₀ SARS is mainly transmitted through the respiratory tract. It is highly contagious and has a mortality rate of 5%-15. %, seriously endangering people's lives and health. The World Health Organization announced on April 16, 2003 that the pathogen causing SARS belongs to a new variant of coronavirus and was named "SARS-CoV" (Peiris JSM, Lai ST, Poon MLL, et al. Coronavirus as a possible The Lancet. 2003, April 8) ₀ The sequencing of the SARS-CoV genome has been completed through the joint efforts of scientists from various countries including China. Sequence analysis shows that the SARS-CoV genome contains 5 A major open reading frame (OR) encoding DNA polymerase protein, protuberance protein (S protein), envelope protein (E protein), membrane glycoprotein (M protein), and nucleocapsid protein (NC protein).

Protuberance proteins are the major cellular receptor-binding proteins of coronavirus, and their amino acid changes can significantly affect the virulence of the virus. In addition, the functional site of SARS-CoV protuberance protein was predicted, and it was found that there may be multiple antigenic determinants in the protein, and the protuberance proteins of SARS-CoV, which are currently prevalent in the world, are highly conserved and can be used as important for vaccine research. Target (Walgate R. SARS vaccine race: US and European groups moving Forward, but WHO would rather put SARS "back in the box", Available May 2 at http: //www. Biomedcentral. Com/news/20030502/03) o

The nucleocapsid protein is another important structural protein in the coronavirus. It is located at the core of the virus particle and is important for the accurate assembly of the virus particle. Chinese researchers obtained lymphocytes from the recovery phase of SARS patients, and humanized Fab antibodies obtained by genetic engineering could specifically bind to SARS-CoV nucleocapsid protein, indicating that nucleocapsid protein is also an important antigen of SARS-CoV. Sites (Du Runlei, Yu Jianshi, Liang Mifang et al. Preliminary study on genetically engineered antibodies against human acute severe respiratory syndrome (SARS) virus. Acta. 2003, 19 (2): 104-108).

Although the SARS epidemic has been effectively controlled worldwide, the possibility of a renewed outbreak is not ruled out. The anti-SARS-CoV vaccine is the most effective way to prevent the prevalence of SARS. At present, the SARS whole virus inactivated vaccine developed in China has entered the clinical experiment stage. The vaccine carries all the antigens of the virus and has good immunogenicity. However, from the pathology of SARS, the SARS whole virus inactivated vaccine has the potential risk of causing autoimmune response of the body; in addition, the conditions for producing such a vaccine are high, and there are hidden dangers in biosafety. Therefore, it is imperative to develop a new generation of safe and effective SARS genetic engineering vaccines.

The types of vaccines currently available include the following: traditional vaccines (inactivated vaccines and live attenuated vaccines), synthetic peptide and protein subunit vaccines, DNA vaccines, and live vector vaccines. Compared with other types of vaccines, the advantages of live vector vaccines are as follows: (1) It can actively infect target tissues or cells, and improve the efficiency of foreign genes entering cells; (2) The carrier itself has an adjuvant effect and can induce cytokines. And the production of chemokines; (3) most can induce long-term immune response. In the field of live vector vaccines against SARS, non-replicating vectors are currently used. Summary of the invention

It is an object of the present invention to provide new vaccines and immunization methods for SARS-CoV infection to provide a solution to the problems of the prior art mentioned above.

It is an object of the present invention to provide a replication-based vaccinia virus A vaccine of SARS-CoV comprising a replicating vaccinia virus as a vector, and a thymidine kinase (TK) region of the replication vaccinia virus genome is inserted into a polynucleotide encoding a nucleocapsid protein and a protuberance protein of SARS-CoV.

In a preferred embodiment of the present invention, the replicative vaccinia virus is a vaccinia virus Tiantan strain, and preferably the vaccine does not contain a selectable marker gene.

In a preferred embodiment of the present invention, the polynucleotide encoding the nucleocapsid protein and the protuberance protein of SARS-CoV inserted into the TK region of the vaccinia virus Tiantan strain is codon-optimized and suitable for high in mammalian cells. Efficiency expression. In a specific embodiment, the polynucleotide encoding the nucleocapsid protein of SARS-CoV inserted into the TK region of the vaccinia virus Tiantan strain has the nucleotide sequence shown in SEQ ID NO: 1 and/ Or the polynucleotide encoding the protuberance protein of SARS-CoV has the nucleotide sequence as shown in SEQ ID NO: 2.

The vaccine of the present invention may further comprise a suitable adjuvant and/or carrier which is acceptable for pharmaceutical use. Another object of the present invention is to provide a DNA vaccine against SARS-CoV comprising a vector comprising a polynucleotide encoding a nucleocapsid protein of SARS-CoV operably linked to a promoter and/or Or a polynucleotide encoding a protuberance protein of SAFLS-CoV. In a specific embodiment of the DNA vaccine of the present invention, the polynucleotide encoding a nucleocapsid protein of SARS-CoV has a nucleotide sequence as shown in SEQ ID NO: 1, and the encoding SARS-CoV The polynucleotide of the protuberance protein has the nucleotide sequence as shown in SEQ ID NO: 2.

Another object of the present invention is to provide an immunization method for SARS-CoV which comprises administering to an individual an immunologically effective amount of the replication-type vaccinia virus of the present invention, particularly a vaccinia virus Tiantan strain, as a carrier for SARS-CoV Vaccine. The immunological inoculation method of the present invention may further comprise administering to the individual one or more DNA vaccines against SARS-CoV prior to administration of the vaccine, such as the DNA vaccine of the invention described herein.

The invention also provides an immunization kit comprising one or more DNA vaccines against SARS-CoV, such as the DNA vaccine of the invention described herein, further comprising The vaccine against SARS-CoV of the present invention using a replicating vaccinia virus as a vector. Optionally, the kit further comprises directing immunization with the one or more DNA vaccines against SARS-CoV, and then boosting the vaccine against SARS-CoV using the replication-type vaccinia virus of the invention as a vector Immunization program instructions.

Further, the present invention provides a universal transfer vector pVTT 1.0 of vaccinia virus, which has a accession number of CGMCC No. 1458. DRAWINGS

Figure 1: shows the construction route of the vaccinia virus universal transfer vector pVTTl.O.

Figure 2: shows the construction route of the transfer plasmid pVTT-NS.

Figure 3: shows the results of prion virus universal transfer vector pVTTl.O digestion analysis. Lane M is shown as DNA Marker of molecular weight marker DL15000 (purchased from Dalian Bioengineering Co., Ltd.); lanes 1, 2, and 3 show the results of cleavage of the vaccinia virus universal transfer vector pVTTl.O by Kpnl, Ndel or EcoRV, respectively.

Figure 4: PCR amplification of the coding sequence of the SARS-CoV nucleocapsid protein and the coding sequence of the PCR fusion amplification promoter P E/L + P7.5 and SARS-CoV nucleocapsid protein. Lane M is the DNA marker of molecular weight marker DL2000 (purchased from Dalian Bao Bioengineering Co., Ltd.); Lane 1 shows the band of the coding sequence of the PCR-amplified SARS-CoV nucleocapsid protein; Lane 2 shows the PCR fusion amplification promoter PE a band of coding sequences for /L + P7.5 and SARS-CoV nucleocapsid protein.

Figure 5: shows the results of T-NC plasmid digestion analysis. Lane 1 shows the results of double digestion of the T-NC plasmid by Spe I and Not I; Lane 2 shows the result of single digestion of the T-NC plasmid by Sal I.

Figure 6: shows the results of T-NC+P+S plasmid digestion analysis. Lane M is DNAMarker with molecular weight marker DL15000 (purchased from Dalian Bao Bioengineering Co., Ltd.); Lanes 1-4 show the picked T-NC+P+S plasmid (1-4) by Sac I and Not I double digestion result.

Figure 7: shows the results of the vaccinia virus universal transfer vector pVTTl.O and the vaccinia virus transfer vector pVTT-NS. Lane M shows DNA as molecular weight marker DL15000 Marker (purchased from Dalian Bao Bioengineering Co., Ltd.); Lane 1 shows the vaccinia virus universal transfer vector pVTTl.O double-digested with Sac II and Spe I; Lane 2 shows vaccinia virus transfer vector pVTT-NS via Sac II and Spe I Double digestion results.

Figure 8: shows that nine sixth-generation white virus clones were randomly picked from the fifth generation rVTT-NS, and the viral DNA template was extracted. The NC primer 1 and NC primer 2 were used as primers to amplify the SARS-CoV nucleocapsid protein coding. Test the results of the sequence. Lanes M are shown as DNAMarker with molecular weight marker DL15000 (purchased from Dalian Bao Bioengineering Co., Ltd.); Lane N shows PCR amplification results for wild-type virus negative controls; Lanes 1-9 show random selection of 9 sixth-generation white viruses The genomic PCR amplification of the NC protein coding sequence (1.2 Kb) of SARS-CoV was performed.

Figure 9: shows that nine sixth-generation white virus clones were randomly picked from the fifth generation rVTT-NS, and the viral DNA template was extracted. S-primer 1 and S-primer 2 were used as primers to amplify the S protein encoding of SARS-CoV. Test the results of the sequence. Lane M is shown as DNA Marker of molecular weight marker DL15000 (purchased from Dalian Bao Bioengineering Co., Ltd.); Lane P shows the result of positive control using plasmid pSK-S as template; Lane N shows PCR amplification result of wild type virus negative control Lanes 1-9 show the results of PCR-amplified SAS-CoV S protein coding sequence (3.6 Kb) from nine sixth-generation white virus clones.

Figure 10: CEF cells were infected with each generation of rVTT-NS. Cells and supernatants were harvested 48 hours later, and Western Blot analysis was performed with human polyclonal antiserum (provided by the Chinese Center for Disease Control and Prevention, Chinese Center for Disease Control and Prevention). Lane N shows the results of immunological hybridization of the wild-type virus negative control; Lane M shows the pre-stained protein Marker; Lanes 1, 3, 5, and 6 show the immunity of the first, third, fifth, and sixth generations of rVTT-NS infected CEF cells, respectively. Hybrid strips.

Figure 11: shows that ELISPOT detects in vitro N-epitope peptide (A) and S-epitope peptide (B) T-lymphocyte responses that secrete IFN-γ after stimulation. The spleen cells of 1×10 ⁶ mice per well were stimulated with NC protein-stimulating peptide and S-protein stimulating peptide for 30 hours, and the number of T lymphocytes secreting IFN-γ was detected.

Figure 12: Titer levels of NC protein (A) and S protein (B) specific antibody IgG indicating serum SARS-CoV in experimental animals. Figure 13: Schematic diagram of the SARS-CoV DNA vaccines pDRVISVl.OS and pDRVISV1.0-N. Deposit

The transfer plasmid pVTT 1.0 was deposited with the General Microbiology Center (CGMCC) of the China Microbial Culture Collection Management Committee on September 19, 2005, under the accession number CGMCC No. 1458.

The plasmid pSC65 was deposited with the General Microbiology Center (CGMCC) of the China Microbial Culture Collection Management Committee on February 24, 2004. The accession number is: CGMCC No.l097.

The plasmid pSK-Ν was deposited with the General Microbiology Center (CGMCC) of the China Microbial Culture Collection Management Committee on September 19, 2005. The accession number is: CGMCC Νο.1459.

The plasmid pSK-S was deposited with the General Microbiology Center (CGMCC) of the China Microbial Culture Collection Management Committee on September 19, 2005. The accession number is: CGMCC Νο.1457. detailed description

The vaccine against SARS-CoV of the present invention is constructed based on a replicating vaccinia virus vector, which is different from the non-replicating vaccinia virus vectors currently used conventionally, such as MVA (Modified virus Ankara), YYAC (New York Vaccinia) and ALVAC (avipoxvirus canarypox) (Paoletti E. Applications of poxvirus vectors to vaccination: An update. Proc. Natl. Acad. Sci. USA. Vol. 93, pp. 11349-11353). In the vaccine of the present invention, the TK region of the replicating vaccinia virus is inserted with a polynucleotide encoding a nucleocapsid protein (NS) and a neurite protein (S) of SARS-CoV, which, when administered, can elicit an individual to produce SARS- Protective immune response of CoV.

The term "replicating" refers to a vaccinia virus vector that can be replicated in humans. In a preferred embodiment of the present invention, the replicative vaccinia virus vector is a vaccine virus TianTan strain (VTT). The vaccinia virus Tiantan strain has made great contributions to the eradication of smallpox in China. Its application in live vector vaccine research is also very active. It has the advantages of good safety, convenient vaccination and no adjuvant. Preferably, the polynucleotide encoding the nucleocapsid protein and the protuberance protein of SARS-CoV inserted into the TK region of the replication vaccinia virus genome can be codon-optimized. The term "codon optimization" refers to the reverse translation of the amino acid sequence of a polypeptide back to a nucleotide sequence based on the frequency of use of the genetic code in the human genetic codon preference table, selecting the human's most preferred genetic codon. To make the nucleotide sequence suitable for efficient expression in human and mammalian cells. In the present invention, the amino acid sequence of the nucleocapsid protein and the protuberance protein of the known SARS-CoV (refer to the amino acid sequence of the SARS-CoV Hong Kong strain HKU-39849 isolate published by Genebank) is reversed by a codon optimization strategy. Translation can result in a codon-optimized nucleotide sequence encoding the nucleocapsid protein and the protuberance protein. Small adjustments and modifications can be made to the obtained nucleotide sequence, using the degeneracy of the genetic code to eliminate redundant restriction enzyme recognition sites, and eliminating potential nucleic acid secondary structures and other sequences that are not conducive to gene synthesis. In a specific embodiment, the polynucleotide encoding a nucleocapsid protein of SARS-CoV has a nucleotide sequence as set forth in SEQ ID NO: 1, and the polynucleoside encoding the protuberance protein of SARS-CoV The acid has the nucleotide sequence as shown in SEQ ID NO: 2.

In the present invention, a polynucleotide encoding a nucleocapsid protein and a protuberance protein of SARS-CoV is inserted into a thymidine kinase (TK) gene in a vaccinia virus genome by a suitable method such as homologous recombination to form a carrying purpose. Recombinant replication-type vaccinia virus of the gene. Preferably, the vaccine of the present invention, i.e., the recombinant replicative vaccinia virus, does not contain a selectable marker gene.

To this end, the present invention provides a universal transfer vector for vaccinia virus to recombine a gene of interest into the TK region of vaccinia virus genomic DNA. In a specific embodiment, the vaccinia virus universal transfer vector of the present invention is a transfer plasmid pVTT 1.0 (CGMCC No. 1458) containing a double screening marker for the neo gene and the lacZ gene. The transfer plasmid vector contains the following elements: 1 three selection markers: Amp resistance gene, lacZ gene and neo gene. The lacZ gene initiated by the p7.5 promoter was used for blue-white spot screening of recombinant vaccinia virus, and the neo gene initiated by the PE6 promoter was used for purification of recombinant vaccinia virus carrying both the selection marker and the gene of interest (in G418 The proliferation of the vaccinia virus wild-type strain will be inhibited. In order to make the neo gene function better, the neo gene has a 200 bp poly(A) sequence at its tail. 2 with Source arm tkL and tkR sequences: tkL and tkR are partial fragments of vaccinia virus thymidine kinase (TK), which are homologous sequences of intermolecular homologous recombination of vaccinia virus and transfer plasmid. 3 lacZ, sequence - This 200 bp sequence is completely homologous to the 200 bp sequence at the tail of the lacZ gene, allowing intramolecular homologous recombination of the recombinant vaccinia virus carrying both the selection marker and the gene of interest, thereby discarding the screening marker. 4 early and late promoter pE/L of vaccinia virus. 5 multiple cloning site, located downstream of the promoter pE/L.

Using the universal transfer vector pVTT 1.0 of the present invention, the gene of interest can be recombined into the TK region of vaccinia genomic DNA, and the vaccinia virus genome does not contain a selectable marker gene. Accordingly, the present invention also provides a method for constructing a vaccine against SARS-CoV based on a replicating vaccinia virus, the method comprising: encoding a SARS-CoV nucleocapsid protein using a transfer plasmid pVTT 1.0 (CGMCC No. 1458) The NS) and the raised protein (S) polynucleotides were placed under the pETT 1.0 promoter pE/L to construct the recombinant plasmid pVTT-NS; pVTT-NS homologously recombined with the vaccinia virus Tiantan strain in chicken embryo cells, The target gene of SARS-CoV was recombined into the TK region of vaccinia virus genomic DNA together with the double screening marker containing the neo gene and the kcZ gene; under the antibiotic G418 selection pressure, a low melting point agar with X-gal and neutral red was added. Sugar spotting, picking blue recombinant vaccinia virus containing both the gene of interest and the screening marker, after three rounds of single spot purification; then, without G418 pressure selection, the blue recombinant vaccinia virus itself will be due to a small segment of the transfer plasmid The about 200 bp lacZ' fragment undergoes intramolecular homologous recombination with the entire lacZ gene, thereby losing the neo gene and the kcZ gene, thereby obtaining a nucleocapsid protein containing only SARS-CoV and Recombinant vaccinia VTT protein coding sequences.

The vaccine of the present invention may further comprise a pharmaceutically acceptable suitable adjuvant, carrier and/or excipient, and suitable adjuvants, carriers and excipients are known in the art.

The invention also provides a DNA vaccine against SARS-CoV, the DNA vaccine comprising a vector comprising a polynucleotide encoding a nucleocapsid protein of SARS-CoV operably linked to a promoter and/or Or a polynucleotide encoding a protuberance protein of SARS-CoV. Vectors for constructing DNA vaccines are known in the art, such as the eukaryotic expression vector pcDNA3.1. After obtaining the gene of interest, the DNA vaccine can be constructed by ligating the sequence of the gene of interest into a suitable vector by a known method. In a specific embodiment of the DNA vaccine of the present invention, the polynucleotide encoding a nucleocapsid protein of SARS-CoV has a nucleotide sequence as shown in SEQ ID NO: 1, and the encoding SARS-CoV The polynucleotide of the protuberance protein has the nucleotide sequence as shown in SEQ ID NO: 2.

Another object of the present invention is to provide an immunization method for SARS-CoV which comprises administering to an individual an immunologically effective amount of the replication-type vaccinia virus of the present invention, particularly a vaccinia virus-based Tiantan strain, for SARS-CoV vaccine. The term "effective amount" refers to an amount of a vaccine of the invention sufficient to stimulate an individual to produce cellular and/or humoral immunity against a pathogen, the particular amount of administration and the rate of administration and time of administration will depend on the condition of the individual and may be Make judgments based on the situation. The immunization method of the present invention may further comprise administering to the individual one or more DNA vaccines against SARS-CoV prior to administration of the vaccine, such as the DNA vaccine of the invention described herein. The present inventors have found that an initial immunization by using a DNA vaccine containing a coding sequence of a SARS-CoV nucleocapsid protein and/or a protuberance protein, and an immunization protocol using a SARS-CoV Tiantan recombinant vaccinia virus vaccine (ie, Prime) -boost strategy), can successfully induce high levels of humoral and cellular immune responses and high titer neutralizing antibodies.

The invention also provides an immunization kit comprising one or more DNA vaccines against SARS-CoV, such as the DNA vaccine of the invention described herein, further comprising a replication-type vaccinia virus according to the invention Vaccine against SARS-CoV. Optionally, the kit further comprises indicating initial immunization with the one or more DNA vaccines against SARS-CoV, and then boosting the vaccine against SARS-CoV based on the replication-type vaccinia virus of the invention. Vaccination instructions.

The invention is further illustrated below in conjunction with specific embodiments.

Example

Example 1: Construction of vaccinia virus universal transfer vector pVTT 1.0 1. Construction of recombinant plasmid pSC-neo

The plasmid pIRESneo (purchased from Clontech) was first digested with Xhol, digested with Smal (reaction temperature was 25 ° C), Klenow enzyme was filled in, and the target fragment neo-polyA of ^1.2 kb was recovered; the transition vector plasmid pSC65 ( Deposit number: CGMCC No.1097) Digested with Bglll, Klenow enzyme was filled, dephosphorylation enzyme (CIAP) treatment, and the vector was recovered; the two were ligated at 16 °C for 4 h, and transformed into E. coli TOP10. Multiple single colonies were picked and plasmids were extracted in small amounts and identified by Xbal and Pstl. The correct recombinant clone was named pSC-neo.

2. Synthetic vaccinia virus vector early promoter PE6 and lacZ fusion fragment.

The gene was synthesized by the method of overlapping PCR. First, the positive and negative strands of the sequence PE6 and lacZ fusion polynucleotide fragments are listed separately, and then the positive and negative strand sequences are divided into 50 bp oligonucleotides according to the length of the gene (the 5' end of the two strands) A length of about 25 bp), except for the sequences at both ends, each of the positive and negative strand sequences has a complement of about 25 b _P with the oligonucleotides of the two complementary strands. Eight oligonucleotides were mixed with the same number of complementary oligonucleotides to form an annealing system, which was first heated in a PCR tube and then slowly annealed. The annealing product was used as a template, and the paired upstream and downstream primers were used for PCR amplification to obtain 429 bp PE6 and lacZ fusion polynucleotide fragments. The synthetic vaccinia vector early promoter PE6 and lacZ fusion fragments were ligated into the T-easy universal sequencing vector to obtain plasmid pT-lacZ'-PE6, and the sequencing results were in accordance with the intended design (SEQ ID NO: 9).

3. Obtain the vaccinia virus transfer vector pVTT 1.0.

The plasmid pT-kcZ, -PE6 prepared above was digested with Smal + HindIII to recover a 0.4 kb lacZ'-PE6 fragment; ligated into the plasmid pSC-neo to obtain a vaccinia virus transfer vector pVTT 1.0 (see Fig. 1 for the construction process). Ascertained by Kpnl, Ndel and EcoRV, the results are shown in Figure 3.

Example 2: Codon optimization of the nucleocapsid protein and overhang protein coding sequences of SARS-CoV and construction of DNA vaccines: 1. Genetic codon optimization. According to the frequency of use of the genetic code in the human genetic codon preference table, the most preferred genetic codon is selected according to the amino acid sequence of the nucleocapsid protein and the protuberance protein of SARS-CoV (refer to the SARS-CoV Hong Kong strain HKU-39849 published by Genebank). The isolate amino acid sequence), and its reverse translation back to the nucleotide sequence.

2. Gene sequence modification and adjustment. Small adjustments and modifications, using the degeneracy of the genetic code to eliminate redundant restriction enzyme recognition sites, eliminate potential nucleic acid secondary structures and other sequences that are not conducive to gene synthesis.

3. Synthesize the gene of interest. The gene was synthesized by overlapping PCR. First, the positive and negative strands of the nucleocapsid protein and the protuberance gene sequence are listed separately, and then the positive and negative strand sequences are divided into 50 bp oligonucleotides according to the length of the gene (the length of the 5' end of the two strands) It is about 25 bp), except for the sequences at both ends, each of the positive and negative strand sequences has a complement of about 25 bp with the oligonucleotides of the two complementary strands. Each of the 10 or so oligonucleotides is mixed with the same number of complementary oligonucleotides to form an annealing system, which is first heated in a PCR tube and then slowly annealed. The annealing product was used as a template, and the paired upstream and downstream primers were used for PCR amplification to obtain a gene fragment of about 500 bp. A plurality of overlapping fragments are first mixed, then heated, annealed, and an annealing system is used as a template, and PCR amplification is performed with the primers at both ends to obtain a longer gene fragment. A fragment of more than 1 Kb is subjected to PCR splicing through a predetermined restriction site to obtain a full-length gene sequence.

4. The synthetic target gene encoding the nucleocapsid protein (N) and the protuberance protein (S) of SARS-CoV was ligated into the pSK universal sequencing vector, and the sequencing results were in accordance with the expected design (codon-optimized N and S of SARS-CoV) The gene sequences of interest are shown in SEQ ID ΝΟ: 1 and SEQ ID ΝΟ.. 2, respectively. The plasmid pSK-S was obtained and deposited at the General Microbiology Center (CGMCC) of the China Microbial Culture Collection Management Committee on September 19, 2005. The accession number is: CGMCC No.l4 ⁵ 7. The plasmid pSK-N was deposited with the General Microbiology Center (CGMCC:) of the China Microbial Culture Collection Management Committee on September 19, 2005, and the accession number is: CGMCC No.l459.

Then Smal+Sall double-cleaves the plasmids pSK-S and pSK-N, and the resulting polynucleotide encoding the nucleocapsid protein (NC) and the protuberance protein (S) of SARS-CoV is linked to Smal+Sall. The double-enzyme-treated DNA vaccine vector pDRVISVl.O (Chinese Patent Application: 200410028280.3) obtained the SARS-CoV DNA vaccines pDRVISVl.OS and pDRVISV1.0-N (Fig. 13).

Example 3: Construction of target gene expression element and vaccinia virus transfer vector

1. PCR amplification of fusion promoter P E/L + P7.5 sequence

Design primers:

P 7.5 Primer 1: 5,- GA AGATCTGTCGACTTCGAGCTTATTT-3 ' (SEQ ID NO: 3) _;

PE/L primer 2: 5,- GAGAATTCGTTTAAACCGATGC -3, (SEQ ID NO : 4)

The pE/L + p7.5 PCR amplification reaction was carried out using the kit of Dalian Bao Bioengineering Co., Ltd. The reaction system was as follows:

Plasmid pSC65 (The accession number of plasmid pSC65 is: CGMCC No.l097.) 1 μ 1, positive and reverse primers (Ρ 7.5 primer 1, PE/L primer 2) 1 μl each, lO XPyrobest buffer 5 μ 1, dNTP mixture (2.5 mM each) 5 μ 1, Pyrobest DNA polymerase (5 U/ml) 0.5 μ 1, ddH ₂ 0 37.5 L PCR reaction conditions: pre-denaturation at 94 ° C for 2 min; 94 ° C for 30 s, 58 ° C for 30 s, 72 ° C 30s, a total of 30 cycles; 72 ° C 7 min; 4 ° (.

The pE/L + p7.5 PCR amplification reaction extension product was purified and recovered by Omega's E.Z.N.A Cycle-Pure Kit.

2. PCR amplification of the nucleocapsid protein (NC) coding sequence of SARS-CoV

Design primers:

NC primer 1 : 5'-CATCGGTTmAACGAATTCTCACC^TGAGCGAIAATGGCCC-3' (SEQ ID NO: 5);

NC primer 2: 5,- CCGGATCCTTATCAGGCCTGTGTAGAATC-3, (SEQ ID NO: 6)

The NC gene PCR amplification reaction of SARS-CoV uses the kit of Dalian Bao Bioengineering Co., Ltd. The reaction system is as follows:

Plasmid pSK-N (The accession number of plasmid pSK-N is: CGMCC No.l459) lwl, positive, Reverse primer (NC primer 1, NC primer 2) 1 μl each, lOXPyrobest buffer 5 μl, dNTP mixture (2.5 mM each) 5 μl, Pyrobest DNA polymerase (5 U/ml) 0.5 l, ddH ₂ 037.5 l ₀

PCR reaction conditions: pre-denaturation at 94 ° C for 2 min; 94 ° C for 30 s, 58 ° C for 30 s, 72 ° C lmin, a total of 30 cycles; 72 ° C 7 min; 4 ° C.

The NC PCR amplification reaction extension product was purified and recovered by Omega's E.Z.N.A Cycle-Pure Kit (nucleoprotein coding sequence is shown in SEQ ID NO: 1).

3. PCR fusion amplification promoter nucleocapsid coding sequence of PE/L + P7.5 and SARS-CoV

The reaction system is as follows:

pE/L + _P 7.5 PCR reaction recovery template 5 μ 1, SARS-CoV nucleocapsid protein coding gene PCR reaction recovery template 5μ1, positive and negative primers (Ρ7.5 primer 1, NC primer 2) 1 μl each lOXPyrobest buffer 5 μ 1, dNTP mixture (2.5 mM each) 5 μ 1, Pyrobest DNA polymerase (5U/ml) 0.5 μ 1, ddH ₂ 037.5pL

PCR reaction conditions: pre-denaturation at 94 °C for 2 min; 94 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min 30 s, 30 cycles; 72 ° C for 7 min; 4 ° C.

Fusion of nucleocapsid protein coding sequences of P E/L + P7.5 and SARS-CoV PCR amplification products were purified and recovered by Omega's E.Z.N.A Cycle-Pure Kit. The results are shown in Figure 4. Product Linking Promega's T-easy universal vector gave the T-NC plasmid and the sequencing results were correct. It was identified by restriction endonuclease digestion analysis, and the results of enzyme digestion identification are shown in Figure 5, respectively.

4. Acquisition of 8, RS gene expression elements of SARS-CoV

p pSK-S (SEQ ID NO: 2) pSK-S (reservation number of plasmid pSK-S: CGMCC No. 1457) was ligated with Sail and Sacl, and SARS was obtained by enzyme digestion. The CoV-protuberance coding sequence of CoV was ligated into the T-NC plasmid of Sail and Sacl double digestion, and the S and NC gene expression elements with SARS-CoV were obtained. The plasmid T-NC+P+S (see Figure 2 for the construction process). The plasmid was extracted and identified by restriction endonuclease digestion analysis. The results of enzyme digestion identification are shown in Figure 6.

5. SARS-CoV S, NC gene vaccinia virus transfer vector plasmid pVTT-NS construction

The plasmid carrying the expression gene of interest T-NC+P+S was digested with Spel and digested with SacII. The OMG Glue Recovery Kit was used to recover the restriction fragment of S and NC gene expression elements of SARS-CoV, and then ligated into the vaccinia virus universal transfer vector pVTT 1.0 double-digested with Smal and SacII to obtain SARS-CoV. The vaccinia virus transfer vector plasmid pVTT-NS of the S and NC gene expression elements (see Fig. 2 for the construction process). The plasmid was extracted and identified by restriction endonuclease digestion. The results of enzyme digestion were shown in Figure 9. Example 4: Construction and screening of recombinant vaccinia virus vaccine rVTT-NS containing the nucleotide sequence encoding the nucleocapsid protein and the protuberance protein of SARS-CoV

The vaccinia virus Tiantan strain infects 80% of the chicken embryo cells CEF with 0.1~0.01 pfu/cell virus, and after the cells are adsorbed for l~1.5h, the recombinant plasmid pVTT is transfected by liposome transfection technology (INVITROGEN Lipofectin kit). NS was transfected into CEF cells, and the S and NC gene expression elements of SARS-CoV were homologously recombined with the neo- and lacZ gene dual selection markers into the TK region sequence of vaccinia virus genomic DNA. The first three rounds of recombinant vaccinia virus selection was performed after 400 ug/ml G 418 pressure screening, using low-melting agarose spiked with X-gal and neutral red, so that both the target gene and the selection marker can be picked. The blue recombinant vaccinia virus (the wild-type strain that has not been recombined is inhibited from growing due to the presence of G418). Then, under the antibiotic-free G418 pressure selection, the blue recombinant vaccinia virus itself will be homologous to the intact lacZ gene by a small segment of about 200 bp lacZ' fragment upstream of the S and NC gene expression elements of the SARS-CoV of the transfer plasmid. Recombination, thereby losing the neo gene and the lacZ gene, and obtaining a recombinant vaccinia virus containing only SAS-CoV 8, NC gene expression elements, can be picked with a low melting point agarose stained with X-gal and neutral red. Take a white recombinant virus containing only the gene of interest. Initial The white spot virus obtained by sieving is further purified by five rounds of single spot, and the single clone can be obtained.

SAV-CoV S, NC gene expression component of recombinant vaccinia virus vaccine rVTT-NS. Example 5: PCR, Western blot detection, rVTT-NS passaging stability

After rVTT-NS was subcultured, 9 sixth-generation white viruses were randomly picked and the viral DNA template was extracted (Hangzhou Weitejie Biotechnology Co., Ltd. extracted viral genome kit), and NC primer 1 and NC primer 2 were used to amplify NC target gene. (The primer sequence and method are referred to in Example 3); S-I1: 5'-CTCTACGTAGCGGCCGCTAACC3⁄4X TTTATCTTTCTGCTG-3' (SEQ ID NO: 7); and S-I 2: 5,- TCCCCCGGGTT3⁄4TC3⁄4GGTGTAG-3 ' (SEQ ID NO: 8) To amplify the S gene of the primer, the reaction system is as follows: rVTT-NS DNA 5 yl; positive and reverse primers (S primer 1, S primer 2) each 1 μ 1; lO XPyrobest buffer 5 μ 1 ; dNTP mixture (each 2.5πιΜ) 5 μ 1; LADNA polymerase (5U/ml) 0.5 μ 1; dd3⁄40 32.5 μ ΐο

PCR reaction conditions: pre-denaturation at 94 ° C for 2 min; 94 ° C for 30 s, 58 ° C for 30 s, 72 ° C for 3 min, a total of 30 cycles; 72 ° C for 7 min; C.

Agarose gel electrophoresis showed that a positive target band was amplified from the randomly selected viral genome, with an NC gene of 1.2 kb and an S gene of 3.6 kb. As shown in Figures 6 and 7.

The fifth generation rVTT-NS was infected with CEF cells. After 48 hours, the cells and supernatant were harvested. Western Blot analysis was performed with human polyclonal antiserum (provided by Capital Institute of Pediatrics). A specific positive reaction band appeared, and the NC protein was 4.4 KDa. The S protein was 120 KDa, indicating that the constructed rVTT-NS vaccine can stably express the target gene, as shown in Figure 10. Example 6: DNA vaccine and SANK vaccinia virus vaccine containing SARS-CoV NC and S coding sequences Prime-Boost immunoassay of rVTT-NS

1. DNA vaccine containing SARS-CoV NC and S coding sequences and the Prime-Boost immunization strategy of the vaccinia vaccine of the genus vaccinia rVTT-NS.

In this example, 6-8 week old BALB/c (H-2d) female mice (body weight 19-25 g, purchased from China National Institute for the Control of Pharmaceutical and Biological Products) were used to test the efficacy of the vaccine of the present invention. The inclusion of Example 2 A DNA vaccine of the NC and S genes of SARS-CoV was prepared as an injection of 1 mg/ml using I XPBS. Recombinant vaccinia virus rVTT-NS l X 10 ⁸ pfo/mL. Immunize 4 groups of 6 mice per group. The vaccination strategies of each immunization group are shown in Table 1. DNA vaccine The tibialis anterior muscle was injected with lOOiig/mouse/time (50 ug per hind limb). The dose of rVTT-NS recombinant vaccinia virus was 10 ⁷ pfb/mouse/time. The immunoassay was performed at week 10. The vaccinia virus Tiantan strain using the pCDN A empty vector and the target gene was not used for comparison. Table 1. Prime-Boost immunization protocol for DNA vaccine against SARS-CoV and the vaccinia virus vaccine rVTT-NS:

Immunization group and number of animals Week 0 Week 2 Week 8

LOO ug / rat / time lOO ug / mouse / time 10 ⁷ pfo / mouse / empty vector control group pVRCl.O pVRCl.O Tiantan rVTT Group one: two needles SARS-CoV NC+S SARS-CoV NC+S SARS- CoV NC+S

DNA vaccine group DNA vaccine DNA vaccine Group 2: Single needle NC+S DNA vaccine + SARS-CoV NC+S rVTT-NS Vaccinia rVTT-NS group DNA vaccine

Group 3: Double needle NC+S DNA vaccine + SARS-CoV NC+S SARS-CoV NC+S rVTT-NS Vaccinia rVTT-NS Group DNA vaccine DNA vaccine

Group 4: Single needle vaccinia rVTT-NS group rVTT-NS

2. ELISPOT detects in vitro epitope peptides and secretes IFN-γ-secreting T lymphocytes. The ELISPOT assay for IFN-γ uses the kit from U-CyTech, the Netherlands. Refer to U-CyTech's instruction manual for the procedure. The 16 peptides which stimulate the polypeptide to be S protein (Sl, VFNATKFPS VYAWERKKI; S2, SVYAWERKKISNCVADY; S3, STFFSTFKCYGVSAT L; S4, KCYGVSATKLNDLCFSNV; S5, NIDATSTGNYNYKYRYLR; S6, NYNYKYRYLRHGKLRPF; S7, RASA LAATKMSECVL; S8, AATKMSECVLGOSKRVDF; S9, LMSFPQAAPHGVVFLHV; , APHGVVFLHVTYVPSQER) and 1 peptide of NC protein (Nl, QIGYYRRATR VRGGDGK). The results showed that the single- or double-needle SARS-CoV (NC and S gene) DNA vaccine was initially immunized, and then the mice immunized with the vaccinia virus vaccine against SARS-CoV of the present invention were able to induce a high level of T lymphocyte immune response in the body. The specific results are shown in Figure 11.

3. Detection of specific anti-SARS-CoV nucleocapsid protein and IgG-binding antibodies in the serum of immunized mice

To detect specific humoral immunity levels induced by SARS-CoV recombinant vaccinia virus alone and booster immunization, mouse sera were taken at week 10 using SARS-CoV nucleocapsid protein and protuberance antigen (National Institutes of Health vaccine study) Center gift) The level of SARS-CoV nucleocapsid protein and gloid-specific IgG antibody was detected by indirect ELISA. The SARS-CoV nucleocapsid protein and the protein-specific IgG antibody titers of each immunization group are shown in Fig. 12.

4. SARS-CoV neutralizing antibody titers in the serum of immunized mice.

Neutralizing antibody assays were performed on sera of immunized mice using a plaque reduction neutralization assay to evaluate their immunological effects. Two wells of plastic cell culture plates were seeded with Ver ₀ -E6 cells, and two layers of agarose-containing medium were added. A plaque test was established using neutral red as a staining agent. The anti-SARS-CoV BJ 01 strain neutralizing antibody was determined on the basis of a plaque capable of reducing 50%. The test results of each group are shown in Table 2. Table 2 The titer of neutralizing SARS-CoV antibody in serum of experimental group animals:

The above examples are merely illustrative of the invention and are not intended to limit the scope of the invention in any way. It is apparent that various modifications and changes can be made to the present invention without departing from the spirit and scope of the invention, and such modifications and variations are also within the scope of the present invention.

Claims

Claim

A vaccine against SARS-CoV based on a replicating vaccinia virus comprising a replication-type vaccinia virus as a vector, wherein a thymidine kinase (TK) region of the vaccinia virus genome is inserted with a ribosomal protein encoding SARS-CoV and A polynucleotide of a raised protein.

2. The vaccine of claim 1 wherein said replicative vaccinia virus is a vaccinia virus Tiantan strain.

3. The vaccine of claim 1 or 2, wherein the vaccine does not contain a selectable marker gene.

4. The vaccine of any of claims 1-3, wherein the polynucleotide is codon optimized for efficient expression in mammalian cells.

The vaccine according to claim 4, wherein said polynucleotide encoding a SARS-CoV nucleocapsid protein has a nucleotide sequence as shown in SEQ ID NO: 1 and/or said polynucleoside encoding a SARS-CoV protuberance protein. The acid has the nucleotide sequence as shown in SEQ ID NO: 2.

6. The vaccine of any of claims 1-5, further comprising a pharmaceutically acceptable adjuvant and/or carrier.

7. A DNA vaccine against SARS-CoV comprising a vector comprising a polynucleotide encoding a SARS-CoV nucleocapsid protein operably linked to a promoter, said polynucleotide having SEQ. ID NO: The nucleotide sequence shown by l.

8. A DNA vaccine against SARS-CoV comprising a vector comprising a polynucleotide encoding a SARS-CoV protuberance protein operably linked to a promoter, the polynucleotide having SEQ ID NO: The nucleotide sequence shown in 2.

9. An immunization method for SARS-CoV, which comprises administering to an individual an immunologically effective amount of the vaccine of any one of claims 1-6.

10. The method of immunization of claim 9, further comprising administering to the individual one or more DNA vaccines against SARS-CoV prior to administering the vaccine.

The vaccination method according to claim 10, wherein said one or more DNA vaccines against SARS-CoV are the DNA vaccines of claim 7 and/or claim 8.

12. An immunization kit comprising one or more DNAs against SARS-CoV The vaccine, further comprising the vaccine of any one of claims 1 to 6, and optionally comprising instructing the first immunization with the one or more DNA vaccines against SARS-CoV, and then using any of claims 1-6 The vaccination program instructions for the immunization of the vaccine.

The kit according to claim 12, wherein said DNA vaccine against SARS-CoV is the DNA vaccine of claims 7 and/or 8.

14. A universal transfer plasmid pVTT 1.0 for vaccinia virus, the accession number is 1458.