WO2007090401A2 - Calving characteristics - Google Patents

Calving characteristics Download PDF

Info

Publication number
WO2007090401A2
WO2007090401A2 PCT/DK2007/000060 DK2007000060W WO2007090401A2 WO 2007090401 A2 WO2007090401 A2 WO 2007090401A2 DK 2007000060 W DK2007000060 W DK 2007000060W WO 2007090401 A2 WO2007090401 A2 WO 2007090401A2
Authority
WO
WIPO (PCT)
Prior art keywords
region
genetic marker
markers
genetic
bovine chromosome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2007/000060
Other languages
English (en)
French (fr)
Other versions
WO2007090401A3 (en
WO2007090401A8 (en
Inventor
Mogens Sandø LUND
Christian Bendixen
Helle Jensen
Bo Thomsen
Peter Sørensen
Søren SVENDSEN
Jørn Rind THOMASEN
Vivi Hunnicke Nielsen
Bente Flügel MAJGREN
Bernt Guldbrandtsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aarhus Universitet
Kvaegavlsforeningen Dansire
Original Assignee
Aarhus Universitet
Kvaegavlsforeningen Dansire
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aarhus Universitet, Kvaegavlsforeningen Dansire filed Critical Aarhus Universitet
Priority to US12/223,773 priority Critical patent/US20090181386A1/en
Priority to AU2007214120A priority patent/AU2007214120A1/en
Priority to JP2008553617A priority patent/JP2009525734A/ja
Priority to EP07702478A priority patent/EP2032717A2/en
Publication of WO2007090401A2 publication Critical patent/WO2007090401A2/en
Publication of WO2007090401A3 publication Critical patent/WO2007090401A3/en
Anticipated expiration legal-status Critical
Publication of WO2007090401A8 publication Critical patent/WO2007090401A8/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to calving characteristics in bovine subjects.
  • the invention relates to genetic markers for the determination of calving characteristics in a bovine subject and a diagnostic kit for detection of genetic marker(s) associated with calving characteristics.
  • QTL Quantitative trait locus
  • a QTL is not necessarily a gene itself, but rather a DNA region that is closely linked to the genes that underlie the trait in question. Most likely, a QTL is a set of genes that collectively encode a quantitative trait that varies continuously across a population. Thus, the allelic variation of the QTL is associated with variation in a quantitative trait.
  • the presence of QTL is inferred from genetic mapping, in which the genetic location of the QTL is determined relative to known genetic markers.
  • Linkage disequilibrium reflects recombination events dating back in history and the use of LD mapping within families increases the resolution of mapping.
  • LD exists when observed haplotypes in a population do not agree with the haplotype frequencies predicted by multiplying together the frequency of individual genetic markers in each haplotype.
  • haplotype means a set of closely linked genetic markers present on one chromosome which tend to be inherited together.
  • the density of genetic markers needs to be compatible with the distance across which LD extends in the given population.
  • QTL have been detected for calving traits in other Holstein populations (e.g. K ⁇ hn et al., 2003; Schrooten et al., 2000; EIo et al., 1999). Some QTL may affect more than one trait, and some QTL may even be located at the same chromosomal position for different traits. If the QTL affects multiple traits then it is important, for e.g. selection purposes, to test if it is a pleiotropic or linked QTL affecting the traits.
  • One aspect of the present invention relates to a method of determining calving characteristics in a bovine subject, comprising detecting in a sample from said bovine subject the presence or absence of at least one genetic marker that is linked to at least one trait indicative of increased risk of stillbirth and/or increased risk of calving difficulties and/or increased risk of non-desired calf size, wherein said at least one genetic marker is located on the bovine chromosome BTA3 in a region flanked by and including polymorphic microsatellite markers INRA006 and BM7225 and/or
  • BTA9 in a region flanked by and including polymorphic microsatellite markers BMS2151 and BMS1967 and/or,
  • BTA10 in a region flanked by and including polymorphic microsatellite markers
  • BTA11 in the region flanked by and including polymorphic microsatellite markers BM716 and HEL13 and/or, BTA12 in a region flanked by and including polymorphic microsatellite markers
  • BTA18 in a region flanked by and including polymorphic microsatellite markers IDVGA-31 and DIK4013 and/or, BTA19 in a region flanked by and including polymorphic microsatellite markers
  • BM3517 and UWCA26 and/or, BTA21 in a region flanked by and including polymorphic microsatellite markers
  • BTA24 in a region flanked by and including polymorphic microsatellite markers BMS917 and BMS3024 and/or,
  • BMC6020 and BMC2208 wherein the presence of said at least one genetic marker is indicative of calving characteristics of said bovine subject and/or offspring therefrom.
  • a second aspect of the present invention relates to diagnostic kit for use in detecting the presence in a bovine subject of at least one genetic marker associated with bovine calving characteristics, comprising at least one oligonucleotide sequence, wherein the nucleotide sequences are selected from any of SEQ ID NO.: 1 to SEQ ID NO.: 558 and/or any combination thereof.
  • Fig. 1 Genome scan of BTA3 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits. Fig.
  • Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 4 Genome scan of BTA7 in relation to calving characteristics.
  • Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 5 Genome scan of BTA8 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 6 Genome scan of BTA8 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 7 Genome scan of BT A9 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 8 Genome scan of BTA10 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits. Fig.
  • Fig. 10 Genome scan of BTA12 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 11 Genome scan of BTA15 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 12 Genome scan of BTA18 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 13 Genome scan of BTA18 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits. Fig.
  • Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 16 Genome scan of BTA19 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 17 Genome scan of BTA20 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 18 Genome scan of BTA21 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits. Fig.
  • Genome scan of BTA22 in relation to calving characteristics Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 20 Genome scan of BTA22 in relation to calving characteristics.
  • Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 21 Genome scan of BTA24 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 22 Genome scan of BTA25 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 23 Genome scan of BTA25 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits. Fig.
  • Fig. 24 Genome scan of BTA26 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 25 Genome scan of BTA26 in relation to calving characteristics.
  • Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size.
  • the number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 26 Genome scan of BTA26 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 27 Genome scan of BTA28 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively. Calving parameters are designated by D: Direct effect, M Maternal effect, while LK corresponds to stillbirth, FL correspond to calving difficulty, and ST correspond to calf size. The number 1 in calving parameter designates that data is derived from first calving.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 28 Genome scan of BT A5 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • Fig. 29 Genome scan of BTA11 in relation to calving characteristics. Numbers refer to 'herdbook number' and calving parameter, respectively.
  • the X-axis represents the distance of the chromosome expressed in Morgan according to the positions employed in this analysis.
  • the Y-axis represents the test-statistics of the QTL analysis expressed in the F-value. High F-values are indicative of genes, which affect the investigated calving traits.
  • the present invention relates to genetic determinants of calving characteristics in dairy cattle.
  • Calving traits such as calving difficulties, stillbirths and calf size are economically important factors in the dairy industry. Therefore, it is of economic interest to identity those bovine subjects that have a genetic predisposition for specific calving characteristics.
  • Bovine subjects with genetic predisposition for calving characteristics are carriers of non-desired traits, which both complicate calving, and can be passed on to their offspring.
  • bovine subject refers to cattle of any breed and is meant to include both cows and bulls, whether adult or newborn animals. No particular age of the animals are denoted by this term.
  • a bovine subject is a member of the Holstein breed.
  • the bovine subject is a member of the Holstein-Friesian cattle population.
  • the bovine subject is a member of the Holstein Swartbont cattle population.
  • the bovine subject is a member of the Deutsche Holstein Schwarzbunt cattle population.
  • the bovine subject is a member of the US Holstein cattle population.
  • the bovine subject is a member of the Red and White Holstein breed.
  • the bovine subject is a member of the Deutsche Holstein Schwarzbunt cattle population.
  • the bovine subject is a member of any family, which include members of the Holstein breed.
  • the bovine subject is a member of the Danish Red population.
  • the bovine subject is a member of the Finnish Ayrshire population.
  • the bovine subject is a member of the Swedish Red population.
  • the bovine subject is a member of the Danish Holstein population.
  • the bovine subject is a member of the Swedish Red and White population.
  • the bovine subject is a member of the Nordic Red population.
  • the bovine subject is selected from the group consisting of Swedish Red and White, Danish Red, Finnish Ayrshire, Holstein- Friesian, Danish Holstein and Nordic Red. In another embodiment of the present invention, the bovine subject is selected from the group consisting of Finnish Ayrshire and Swedish Red cattle. In another embodiment of the present invention, the bovine subject is selected from the group consisting of Finnish Ayrshire and Swedish Red cattle.
  • the bovine subject is selected from the group of breeds shown in table 1a
  • the bovine subject is a member of a breed selected from the group of breeds shown in table 1 b
  • the bovine subject is a member of a breed selected from the group of breeds shown in table 1 c
  • variable nucleotide sequence refers to a variable nucleotide sequence (polymorphism) of the DNA on the bovine chromosome.
  • the variable nucleotide sequence can be identified by methods known to a person skilled in the art, for example by using specific oligonucleotides in for example amplification methods and/or hybridization techniques and/or observation of a size difference. However, the variable nucleotide sequence may also be detected by sequencing or for example restriction fragment length polymorphism analysis.
  • the variable nucleotide sequence may be represented by a deletion, an insertion, repeats, and/or a point mutation.
  • a genetic marker comprises a variable number of polymorphic alleles.
  • Microsatellite markers refer to short sequences repeated after each other. In short sequences are for example one nucleotide, such as two nucleotides, for example three nucleotides, such as four nucleotides, for example five nucleotides, such as six nucleotides, for example seven nucleotides, such as eight nucleotides, for example nine nucleotides, such as ten nucleotides.
  • changes sometimes occur and the number of repeats may increase or decrease.
  • the specific definition and locus of the polymorphic microsatellite markers can be found in the USDA genetic map (Kappes et al. 1997; or by following the link to U.S. Meat Animal Research Center http://www.marc.usda.gov/).
  • specific marker alleles are linked to quantitative trait loci affecting calving characteristics.
  • nucleotide sequences of the genetic markers of the present invention are genetically linked to traits for calving in a bovine subject. Consequently, it is also understood that a number of genetic markers may be generated from the nucleotide sequence of the DNA region(s) flanked by and including the genetic markers according to the method of the present invention.
  • Calving in a bovine subject is affected by a number of characteristics. Traits that affect calving according to the present invention are for example the occurrence of stillbirth (SB), calving difficulty (CD) and the size of the calf at birth (CS).
  • the traits are assessed by a direct effect (D) of the sire in the calf. However, the traits are also assessed as a maternal effect (M) of the sire in the mother of the calf.
  • calving characteristics is meant traits which affect calving in the bovine subject or its off-spring. Thus, calving characteristics of a bull are physically manifested by its off-spring - both female and male.
  • calving characteristics comprise the traits SB, CD, and CS, which refer to the following characteristics:
  • the method and kit described herein relates to still births, calving difficulties as categorized herein and/or calf size. In one embodiment of the present invention, the method and kit described herein relates to still births. In another embodiment, the method and kit of the present invention pertains to calving difficulties, such as detected by the calving difficulty categories described above. In yet another embodiment, the method and kit of the present invention relates to calf size. In another embodiment of the present invention, the method and kit described herein relates to any combination of still birth, calving difficulties and/or calf size.
  • Granddaughter design includes analysing data from DNA-based markers for grandsires that have been used extensively in breeding and for sons of grandsires where the sons have produced offspring.
  • the phenotypic data that are to be used together with the DNA-marker data are derived from the daughters of the sons.
  • Such phenotypic data could be for example milk production features, features relating to calving, meat quality, or disease.
  • One group of daughters has inherited one allele from their father whereas a second group of daughters has inherited the other allele from their father.
  • By comparing data from the two groups information can be gained whether a fragment of a particular chromosome is harbouring one or more genes that affect the trait in question. It may be concluded whether a QTL is present within this fragment of the chromosome.
  • DNA markers can be used directly to provide information of the traits passed on from parents to one or more of their offspring when a number of DNA markers on a chromosome have been determined for one or both parents and their offspring. The markers may be used to calculate the genetic history of the chromosome linked to the DNA markers.
  • the frequency of recombination is the likelihood that a recombination event will occur between two genes or two markers.
  • the frequency of recombination may be calculated as the genetic distance between the two genes or the two markers. Genetic distance is measured in units of centiMorgan (cM). One centiMorgan is equal to a 1% chance that a marker at one genetic locus will be separated from a marker at a second locus due to crossing over in a single generation. One centiMorgan is equivalent, on average, to one million base pairs.
  • One aspect of the present invention relates to a method of determining calving characteristics in a bovine subject, comprising detecting in a sample from said bovine subject the presence or absence of at least one genetic marker that is linked to at least one trait indicative of increased risk of stillbirth and/or increased risk of calving difficulties and/or increased risk of non-desired calf size, wherein said at least one genetic marker is located on the bovine chromosome BT A3 in a region flanked by and including polymorphic microsatellite markers INRA006 and BM7225 and/or BTA4 in the region flanked by and including polymorphic microsatellite markers BMS1788 and MGTG4B and/or, BTA5 in the region flanked by and including polymorphic microsatellite markers BMS 1095 and BM2830 and/or, BTA7 in a region flanked by and including polymorphic microsatellite markers BM7160 and BL1043 and/or, BT A8 in a
  • the at least one genetic marker may be a combination of at least two or more genetic markers such that the accuracy may be increased, such as at least three genetic markers, for example four genetic markers, such as at least five genetic markers, for example six genetic markers, such as at least seven genetic markers, for example eight genetic markers, such as at least nine genetic markers, for example ten genetic markers.
  • the at least one genetic marker may be located on at least one bovine chromosome, such as two chromosomes, for example three chromosomes, such as four chromosomes, for example five chromosomes, and/or such as six chromosomes.
  • the at least one marker is selected from any of the individual markers of the tables shown herein.
  • the at least one genetic marker is located on the bovine chromosome BTA3. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 17.1 cM to about 101.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A3. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA3 in the region flanked by and including the markers INRA006 and BM7225.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 2a: Table 2a
  • the at least one genetic marker is located in the region from about 34.6 cM to about 87.3 cM (http://www.marc.usda. ⁇ ov ⁇ on the bovine chromosome BTA3.
  • the at least one genetic marker is located on the bovine chromosome BTA3 in the region flanked by and including the markers FCGR1 and HUJI177.
  • the at least one genetic marker is selected from the group of markers shown in Table 2b: Table 2b
  • the at least one genetic marker is located in the region from about 32.5 cM to about 59.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA3 in the region flanked by and including the markers DIK4403and INRA003. The at least one genetic marker is selected from the group of markers shown in Table 2c: Table 2c
  • the at least one genetic marker is located in the region from about 77.6 cM to about 101.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3.
  • the at least one genetic marker is located on the bovine chromosome BT A3 in the region flanked by and including the markers DIK2702 and BM7225.
  • the at least one genetic marker is selected from the group of markers shown in Table 2d: Table 2d
  • the at least one genetic marker is located in the region from about 52.5 cM to about 68.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA3 in the region flanked by and including the markers DIK4353and DIK4664. The at least one genetic marker is selected from the group of markers shown in Table 2e: Table 2e
  • the at least one genetic marker is located in the region from about 59.4 cM to about 66.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3.
  • the at least one genetic marker is located on the bovine chromosome BT A3 in the region flanked by and including the markers INRA003 and INRA123.
  • the at least one genetic marker is selected from the group of markers shown in Table 2f: Table 2f
  • the at least one genetic marker is located in the region from about 32.5 cM to about 52.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A3 in the region flanked by and including the markers DIK4403 and DIK4353.
  • the at least one genetic marker is selected from the group of markers shown in Table 2g: Table 2g
  • the at least one genetic marker is located in the region from about 77.6 cM to 101.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA3. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A3 in the region flanked by and including the marker FCGR1 and HUJII77. The at least one genetic marker is selected from the group of markers shown in Table 2h: Table 2h
  • the at least one genetic marker is located on the bovine chromosome BTA4. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 12.5 cM to about 112.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A4. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA4 in the region flanked by and including the markers BMS1788 and MGTG4B.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 3a: Table 3a
  • the at least one genetic marker is located in the region from about 12.5 cM to about 91.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA4 in the region flanked by and including the markers BMS1788 and BMS648. The at least one genetic marker is selected from the group of markers shown in Table 3b: Table 3b
  • the at least one genetic marker is located in the region from about 43.2 cM to about 91.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA4 in the region flanked by and including the markers BMS2646 and BMS648. The at least one genetic marker is selected from the group of markers shown in Table 3c: Table 3c
  • the at least one genetic marker is located in the region from about 43.2 cM to about 63.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA4 in the region flanked by and including the markers BMS2646 and INRA072. The at least one genetic marker is selected from the group of markers shown in Table 3d: Table 3d
  • the at least one genetic marker is located in the region from about 52.2 cM to about 73.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A4 in the region flanked by and including the markers TGLA1 16 and BM8233. The at least one genetic marker is selected from the group of markers shown in Table 3e: Table 3e
  • the at least one genetic marker is located in the region from about 63.0 cM to about 91.2 cM (http://www.marc.usda.aov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA4 in the region flanked by and including the markers INRA072 and BMS648. The at least one genetic marker is selected from the group of markers shown in Table 3f: Table 3f
  • the at least one genetic marker is located in the region from about 63.0 cM to about 73.4 cM (http ://www. marc. usda.gov/) on the bovine chromosome BTA4. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A4 in the region flanked by and including the markers INRA072 and BM8233.
  • the at least one genetic marker is selected from the group of markers shown in Table 3g: Table 3g
  • the at least one genetic marker is located on the bovine chromosome BTA5. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 116.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A5. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A5 in the region flanked by and including the markers BMS1095 and BM2830.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 4a: Table 4a
  • the at least one genetic marker is located in the region from about 0.0 cM to about 103.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A5 in the region flanked by and including the markers BMS1095 and BM315. The at least one genetic marker is selected from the group of markers shown in Table 4b: Table 4b
  • the at least one genetic marker is located in the region from about 30.1 cM to about 103.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers DIK2718 and BM315. The at least one genetic marker is selected from the group of markers shown in Table 4c: Table 4c
  • the at least one genetic marker is located in the region from about 30.1 cM to about 78.2 cM (http://www.marc.usda.gov ⁇ on the bovine chromosome BT A5.
  • the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers DIK2718 and BMS1216.
  • the at least one genetic marker is selected from the group of markers shown in Table 4d: Table 4d
  • the at least one genetic marker is located in the region from about 18.3 cM to about 56.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers DIK4747 and RM500. The at least one genetic marker is selected from the group of markers shown in Table 4e: Table 4e
  • the at least one genetic marker is located in the region from about 17.3 cM to about 33.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers BP1 and DIK5002. The at least one genetic marker is selected from the group of markers shown in Table 4f: Table 4f
  • the at least one genetic marker is located in the region from about 45.5 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A5 in the region flanked by and including the markers CSSM034 and DIK2943. The at least one genetic marker is selected from the group of markers shown in Table 4g: Table 4g
  • the at least one genetic marker is located in the region from about 45.5 cM to about 66.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers CSSM034 and DIK5046.
  • the at least one genetic marker is selected from the group of markers shown in Table 4h: Table 4h
  • the at least one genetic marker is located in the region from about 66.2 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers DIK5046 and DIK2943. The at least one genetic marker is selected from the group of markers shown in Table 4i: Table 4i
  • the at least one genetic marker is located in the region from about 71.8 cM to about 90.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA5. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA5 in the region flanked by and including the markers ETH10 and BMS1248. The at least one genetic marker is selected from the group of markers shown in Table 4j: Table 4j
  • the at least one genetic marker is located on the bovine chromosome BTA7. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 135.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA7 in the region flanked by and including the markers BM7160 and BL1043.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 5a: Table 5a
  • the at least one genetic marker is located in the region from about 30.2 cM to about 95.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA7 in the region flanked by and including the markers DIK5412 and OARAE129. The at least one genetic marker is selected from the group of markers shown in Table 5b: Table 5b
  • the at least one genetic marker is located in the region from about 30.2 cM to about 55.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A7 in the region flanked by and including the markers DIK5412 and DIK4606. The at least one genetic marker is selected from the group of markers shown in Table 5c: Table 5c
  • the at least one genetic marker is located in the region from about 58.6 cM to about 95.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA7 in the region flanked by and including the markers UWCA20 and OARAE129. The at least one genetic marker is selected from the group of markers shown in Table 5d: Table 5d
  • the at least one genetic marker is located in the region from about 77.2 cM to about 135.6 cM (http://www.marc. usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA7 in the region flanked by and including the markers BMS2258 and BL1043. The at least one genetic marker is selected from the group of markers shown in Table 5e: Table 5e
  • the at least one genetic marker is located in the region from about 77.2 cM to about 116.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A7.
  • the at least one genetic marker is located on the bovine chromosome BTA7 in the region flanked by and including the markers BMS2258 and ILSTS006.
  • the at least one genetic marker is selected from the group of markers shown in Table 5f: Table 5f
  • the at least one genetic marker is located in the region from about 77.2 cM to about 95.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA7. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A7 in the region flanked by and including the markers BMS2258 and OARAE 129. The at least one genetic marker is selected from the group of markers shown in Table 5g: Table 5g
  • the at least one genetic marker is located on the bovine chromosome BTA8. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 11.3 cM to about 122.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA8. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA8 in the region flanked by and including the markers IDVGA-11 and BMS836.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 6a: Table 6a
  • the at least one genetic marker is located in the region from about 11.3 cM to about 71.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A8. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA8 in the region flanked by and including the markers IDVGA-11 and MCM64. The at least one genetic marker is selected from the group of markers shown in Table 6b: Table 6b
  • the at least one genetic marker is located in the region from about 41.6 cM to about 66.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA8. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA8 in the region flanked by and including the markers BMS678 and BMS2072. The at least one genetic marker is selected from the group of markers shown in Table 6c: Table 6c
  • the at least one genetic marker is located in the region from about 71.1 cM to about 122.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA8. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA8 in the region flanked by and including the markers MCM64 and BMS836. The at least one genetic marker is selected from the group of markers shown in Table 6d: Table 6d
  • the at least one genetic marker is located in the region from about 11.3 cM to about 41.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BT A8.
  • the at least one genetic marker is located on the bovine chromosome BTA8 in the region flanked by and including the markers IDVGA-11 and BMS678.
  • the at least one genetic marker is selected from the group of markers shown in Table 6e: Table 6e
  • the at least one genetic marker is located on the bovine chromosome BT A9. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 8,49 cM to about 109.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA9 in the region flanked by and including the markers BMS2151 and BMS1967.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 7a: Table 7a
  • the at least one genetic marker is located in the region from about 12.8 cM to about 90.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A9 in the region flanked by and including the markers ETH225 and BM4208. The at least one genetic marker is selected from the group of markers shown in Table 7b: Table 7b
  • the at least one genetic marker is located in the region from about 12.8 cM to about 64.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BT A9 in the region flanked by and including the markers ETH225 and BMS 1290. The at least one genetic marker is selected from the group of markers shown in Table 7c: Table 7c
  • the at least one genetic marker is located in the region from about 50.0 cM to about 91.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA9 in the region flanked by and including the markers UWCA9 and BMS2819. The at least one genetic marker is selected from the group of markers shown in Table 7d: Table 7d
  • the at least one genetic marker is located in the region from about 50.0 cM to about 79.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9.
  • the at least one genetic marker is located on the bovine chromosome BT A9 in the region flanked by and including the markers UWCA9 and BMS2753.
  • the at least one genetic marker is selected from the group of markers shown in Table 7e: Table 7e
  • the at least one genetic marker is located in the region from about 45.7 cM to about 68.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA9 in the region flanked by and including the markers DIK5364 and DIK2816. The at least one genetic marker is selected from the group of markers shown in Table 7f: Table 7f
  • the at least one genetic marker is located in the region from about 12.8 cM to about 43.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA9. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA9 in the region flanked by and including the markers ETH225 and DIK5142. The at least one genetic marker is selected from the group of markers shown in Table 7g: Table 7g
  • the at least one genetic marker is located on the bovine chromosome BTA10. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 2.7 cM to about 104.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 8a: Table 8a
  • the at least one genetic marker is located in the region from about 9.0 cM to about 35.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers DIK2503 and MB077. The at least one genetic marker is selected from the group of markers shown in Table 8b: Table 8b
  • the at least one genetic marker is located in the region from about 11.0 cM to about 37.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers CSSM38 and DIK2000. The at least one genetic marker is selected from the group of markers shown in Table 8c: Table 8c
  • the at least one genetic marker is located in the region from about 24.0 cM to about 35.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers BMS528 and MB077. The at least one genetic marker is selected from the group of markers shown in Table 8d: Table 8d
  • the at least one genetic marker is located in the region from about 37.5 cM to about 80.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers DIK2000 and BMS1620. The at least one genetic marker is selected from the group of markers shown in Table 8e: Table 8e
  • the at least one genetic marker is located in the region from about 44.3 cM to about 74.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers BMS2742 and TGLA433. The at least one genetic marker is selected from the group of markers shown in Table 8f: Table 8f
  • the at least one genetic marker is located in the region from about 56.5 cM to about 74.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers DIK2361 and TGLA433. The at least one genetic marker is selected from the group of markers shown in Table 8g: Table 8g
  • the at least one genetic marker is located in the region from about 74.0 cM to about 87.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers TGLA433 and BMS2641. The at least one genetic marker is selected from the group of markers shown in Table 8h: Table 8h
  • the at least one genetic marker is located in the region from about 87.5 cM to about 109.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA10. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA10 in the region flanked by and including the markers BMS2641 and BMS2614. The at least one genetic marker is selected from the group of markers shown in Table 8i: Table 8i
  • the at least one genetic marker is located on the bovine chromosome BTA11. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 19.4 cM to about 122.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM716 and HEL13.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table ⁇ a: Table 9a
  • the at least one genetic marker is located in the region from about 19.4 cM to about 92.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM716 and BMS989. The at least one genetic marker is selected from the group of markers shown in Table 9b: Table 9b
  • the at least one genetic marker is located in the region from about 19.4 cM to about 50.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM716 and BM7169. The at least one genetic marker is selected from the group of markers shown in Table 9c: Table 9c
  • the at least one genetic marker is located in the region from about 30.0 cM to about 50.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM2818 and BM7169. The at least one genetic marker is selected from the group of markers shown in Table 9d: Table 9d
  • the at least one genetic marker is located in the region from about 34.8 cM to about 47.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers INRA177-2 and INRA131. The at least one genetic marker is selected from the group of markers shown in Table 9e: Table 9e
  • the at least one genetic marker is located in the region from about 50.3 cM to about 92.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM7169 and BMS989. The at least one genetic marker is selected from the group of markers shown in Table 9f: Table 9f
  • the at least one genetic marker is located in the region from about 61.6 cM to about 92.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers BM6445 and BMS989. The at least one genetic marker is selected from the group of markers shown in Table 9g: Table 9g
  • the at least one genetic marker is located in the region from about 73.3 cM to about 92.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers TGLA58 and BMS989. The at least one genetic marker is selected from the group of markers shown in Table 9h: Table 9h
  • the at least one genetic marker is located in the region from about 92.2 cM to about 109.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA11. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the markers HUJV174 and BMS460. The at least one genetic marker is selected from the group of markers shown in Table 9i: Table 9i
  • the at least one genetic marker is located on the bovine chromosome BTA12. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 109.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA12. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA12 in the region flanked by and including the markers BMS410 and BMS2724.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table 10a: Table 10a
  • the at least one genetic marker is located in the region from about 50.4 cM to about 109.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA12. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA12 in the region flanked by and including the markers BM860 and BMS2724. The at least one genetic marker is selected from the group of markers shown in Table 10b: Table 10b
  • the at least one genetic marker is located in the region from about 50.4 cM to about 102.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA12. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA12 in the region flanked by and including the markers BM860 and BMS1316. The at least one genetic marker is selected from the group of markers shown in Table 10c: Table 10c
  • the at least one genetic marker is located in the region from about 63.8 cM to about 102.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA12. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA12 in the region flanked by and including the markers BMS975 and BMS1316.
  • the at least one genetic marker is selected from the group of markers shown in Table 1Od: Table 1Od
  • the at least one genetic marker is located on the bovine chromosome BTA15. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 9.4 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BR3510 and BMS429.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Tablei 1a: Table 11a
  • the at least one genetic marker is located in the region from about 48.2 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS2684 and BMS429. The at least one genetic marker is selected from the group of markers shown in Table 11 b: Table 11b
  • the at least one genetic marker is located in the region from about 48.2 cM to about 91.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS2684 and BMS2076. The at least one genetic marker is selected from the group of markers shown in Table 11c: Table 11c
  • the at least one genetic marker is located in the region from about 77.9 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers 77.9 and 109.8. The at least one genetic marker is selected from the group of markers shown in Table 11d: Table 11d
  • the at least one genetic marker is located in the region from about 84.9 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS812 and BMS429. The at least one genetic marker is selected from the group of markers shown in Table 11e: Table 11 ⁇
  • the at least one genetic marker is located in the region from about 84.9 cM to about 94.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS812 and BL1095. The at least one genetic marker is selected from the group of markers shown in Table 11f: Table 11f
  • the at least one genetic marker is located in the region from about 91.8 cM to about 105.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS2076 and BMS927. The at least one genetic marker is selected from the group of markers shown in Table 11g: Table 11g
  • the at least one genetic marker is located in the region from about 98.2 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS820 and BMS429. The at least one genetic marker is selected from the group of markers shown in Table 11 h: Table 11h
  • the at least one genetic marker is located in the region from about 105.0 cM to about 109.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA15. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA15 in the region flanked by and including the markers BMS927 and BMS429. The at least one genetic marker is selected from the group of markers shown in Table 11i: Table 11i
  • the at least one genetic marker is located on the bovine chromosome BTA18. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 84.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers IDVGA-31 and DIK4013.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table12a: Table 12a
  • the at least one genetic marker is located in the region from about 0.0 cM to about 13.5 cM (http://www.marc.usda.qov ⁇ on the bovine chromosome BTA18.
  • the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers IDVGA-31 and BMS1322.
  • the at least one genetic marker is selected from the group of markers shown in Table 12b: Table 12b
  • the at least one genetic marker is located in the region from about 2.9 cM to about 13.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BMS1355 and BMS1322. The at least one genetic marker is selected from the group of markers shown in Table 12c: Table 12c
  • the at least one genetic marker is located in the region from about 30.2 cM to about 61.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers INRA121 and DIK4232. The at least one genetic marker is selected from the group of markers shown in Table 12d: Table 12d
  • the at least one genetic marker is located in the region from about 33.4 cM to about 54.7 cM (http://www.marc.usda.aov/') on the bovine chromosome BTA18.
  • the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BR4406 and ILSTS002.
  • the at least one genetic marker is selected from the group of markers shown in Table 12e: Table 12e
  • the at least one genetic marker is located in the region from about 57.6 cM to about 84.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18.
  • the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BMON 1 17 and DIK4013.
  • the at least one genetic marker is selected from the group of markers shown in Table 12f: Table 12f
  • the at least one genetic marker is located in the region from about 61.2 cM to about 84.4 cM (http://www.marc.usda.oov/) on the bovine chromosome BTA18.
  • the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers DIK4232 and DIK4013.
  • the at least one genetic marker is selected from the group of markers shown in Table 12g: Table 12g
  • the at least one genetic marker is located in the region from about 72.0 cM to about 76.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BMS2785 and BM2078. The at least one genetic marker is selected from the group of markers shown in Table 12h: Table 12h
  • the at least one genetic marker is located in the region from about 76.8 cM to about 84.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BM2078 and DIK4013. The at least one genetic marker is selected from the group of markers shown in Table 12i: Table 12i
  • the at least one genetic marker is located in the region from about 76.8 cM to about 78.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BM2078 and BM6507. The at least one genetic marker is selected from the group of markers shown in Table 12j: Table 12j
  • the at least one genetic marker is located in the region from about 78.8 cM to about 84.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA18. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA18 in the region flanked by and including the markers BM6507 and DIK4013. The at least one genetic marker is selected from the group of markers shown in Table 12k: Table 12k
  • the at least one genetic marker is located on the bovine chromosome BTA19. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 108.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers BM9202 and BMS601.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table13a: Table 13a
  • the at least one genetic marker is located in the region from about 0.0 cM to about 90.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers BM9202 and ETH3. The at least one genetic marker is selected from the group of markers shown in Table 13b: Table 13b
  • the at least one genetic marker is located in the region from about 0.0 cM to about 45.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers BM9202 and BP20. The at least one genetic marker is selected from the group of markers shown in Table 13c: Table 13c
  • the at least one genetic marker is located in the region from about 16.0 cM to about 45.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers BMS745 and BP20. The at least one genetic marker is selected from the group of markers shown in Table 13d: Table 13d
  • the at least one genetic marker is located in the region from about 47.0 cM to about 90.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers IDVGA-46 and ETH3. The at least one genetic marker is selected from the group of markers shown in Table 13e: Table 13e
  • the at least one genetic marker is located in the region from about 52.2 cM to about 108.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers BMS2389 and BMS601. The at least one genetic marker is selected from the group of markers shown in Table 13f: Table 13f
  • the at least one genetic marker is located in the region from about 69.8 cM to about 90.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA19.
  • the at least one genetic marker is located on the bovine chromosome BTA19 in the region flanked by and including the markers CSSM065 and ETH3.
  • the at least one genetic marker is selected from the group of markers shown in Table 13g: Table 13g
  • the at least one genetic marker is located on the bovine chromosome BTA20. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 77.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BM3517 and UWCA26.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table14a: Table 14a
  • the at least one genetic marker is located in the region from about 0.0 cM to about 71.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BM3517 and BM5004. The at least one genetic marker is selected from the group of markers shown in Table 14b: Table 14b
  • the at least one genetic marker is located in the region from about 0.0 cM to about 26.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BM3517 and BMS1754. The at least one genetic marker is selected from the group of markers shown in Table 14c: Table 14c
  • the at least one genetic marker is located in the region from about 0.6 cM to about 19.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers HEL12 and BMS1282. The at least one genetic marker is selected from the group of markers shown in Table 14d: Table 14d
  • the at least one genetic marker is located in the region from about 19.1 cM to about 55.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BMS1282 and AGLA29. The at least one genetic marker is selected from the group of markers shown in Table 14e: Table 14e
  • the at least one genetic marker is located in the region from about 31.9 cM to about 49.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers TGLA126 and BMS2361. The at least one genetic marker is selected from the group of markers shown in Table 14f: Table 14f
  • the at least one genetic marker is located in the region from about 49.7 cM to about 55.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BMS2361 and AGLA29. The at least one genetic marker is selected from the group of markers shown in Table 14g: Table 14g
  • the at least one genetic marker is located in the region from about 55.1 cM to about 77.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers AGLA29 and UWCA26. The at least one genetic marker is selected from the group of markers shown in Table 14h: Table 14h
  • the at least one genetic marker is located in the region from about 60.1 cM to about 71.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA20. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA20 in the region flanked by and including the markers BMS703 and BM5004. The at least one genetic marker is selected from the group of markers shown in Table 14i: Table 14i
  • the at least one genetic marker is located on the bovine chromosome BTA21. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 5.6 cM to about 76.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers DIK5182 and IDVGA-30.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table15a: Table 15a
  • the at least one genetic marker is located in the region from about 11.0 cM to about 61.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers BMS1117 and BM846. The at least one genetic marker is selected from the group of markers shown in Table 15b: Table 15b
  • the at least one genetic marker is located in the region from about 18.3 cM to about 57.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers DIK2492 and DIK2913. The at least one genetic marker is selected from the group of markers shown in Table 15c: Table 15c
  • the at least one genetic marker is located in the region from about 18.3 cM to about 30.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21.
  • the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers DIK2492 and D1K4001.
  • the at least one genetic marker is selected from the group of markers shown in Table 15d: Table 15d
  • the at least one genetic marker is located in the region from about 30.9 cM to about 47.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers IDVGA-45 and DIK3036. The at least one genetic marker is selected from the group of markers shown in Table 15e: Table 15e
  • the at least one genetic marker is located in the region from about 33.7 cM to about 41.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers DIK2481 and BMS2815. The at least one genetic marker is selected from the group of markers shown in Table 15f: Table 15f
  • the at least one genetic marker is located in the region from about 5.5 cM to about 61.2 cM (http://www.marc. usda.gov/) on the bovine chromosome BTA21. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA21 in the region flanked by and including the markers DIK5182 and BM846. The at least one genetic marker is selected from the group of markers shown in Table 15g: Table 15g
  • the at least one genetic marker is located on the bovine chromosome BTA22. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 0.0 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers CSSM26 and BM4102.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table16a: Table 16a
  • the at least one genetic marker is located in the region from about 2.9 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers INRA026 and BM4102. The at least one genetic marker is selected from the group of markers shown in Table 16b: Table 16b
  • the at least one genetic marker is located in the region from about 2.9 cM to about 47.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers INRA026 and BM3628. The at least one genetic marker is selected from the group of markers shown in Table 16c: Table 16c
  • the at least one genetic marker is located in the region from about 19.1 cM to about 47.1 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers BM1558 and BM3628. The at least one genetic marker is selected from the group of markers shown in Table 16d: Table 16d
  • the at least one genetic marker is located in the region from about 19.1 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers BM 1558 and BM4102. The at least one genetic marker is selected from the group of markers shown in Table 16e: Table 16e
  • the at least one genetic marker is located in the region from about 47.1 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers BM3628 and BM4102. The at least one genetic marker is selected from the group of markers shown in Table 16f: Table 16f
  • the at least one genetic marker is located in the region from about 64.1 cM to about 82.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA22. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA22 in the region flanked by and including the markers BMS875 and BM4102. The at least one genetic marker is selected from the group of markers shown in Table 16g: Table 16g
  • the at least one genetic marker is located on the bovine chromosome BTA24. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 6.2 cM to about 65.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BMS917 and BMS3024.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table17a: Table 17a
  • the at least one genetic marker is located in the region from about 8.2 cM to about 65.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BM7151 and BMS3024. The at least one genetic marker is selected from the group of markers shown in Table 17b: Table 17b
  • the at least one genetic marker is located in the region from about 8.2 cM to about 35.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BM7151 and BMS1862. The at least one genetic marker is selected from the group of markers shown in Table 17c: Table 17c
  • the at least one genetic marker is located in the region from about 11.1 cM to about 23.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers TGLA351 and BMS2270. The at least one genetic marker is selected from the group of markers shown in Table 17d: Table 17d
  • the at least one genetic marker is located in the region from about 35.5 cM to about 65.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BMS1862 and BMS3024. The at least one genetic marker is selected from the group of markers shown in Table 17e: Table 17e
  • the at least one genetic marker is located in the region from about 48.8 cM to about 61.2 cM (http://www.marc. usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BMS466 and BMS1926. The at least one genetic marker is selected from the group of markers shown in Table 17f: Table 17f
  • the at least one genetic marker is located in the region from about 48.8 cM to about 56.3 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers BMS466 and INRA090.
  • the at least one genetic marker is selected from the group of markers shown in Table 17g: Table 17g
  • the at least one genetic marker is located in the region from about 56.3 cM to about 61.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA24. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA24 in the region flanked by and including the markers INRA090 and BMS1926. The at least one genetic marker is selected from the group of markers shown in Table 17h: Table 17h
  • the at least one genetic marker is located on the bovine chromosome BTA25. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 7.2 cM to about 61.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers ILSTS102 and AF5.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table18a: Table 18a
  • the at least one genetic marker is located in the region from about 7.2 cM to about 31.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers ILSTS102 and BM737. The at least one genetic marker is selected from the group of markers shown in Table 18b: Table 18b
  • the at least one genetic marker is located in the region from about 7.2 cM to about 22.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers ILSTS102 and BMS2843. The at least one genetic marker is selected from the group of markers shown in Table 18c: Table 18c
  • the at least one genetic marker is located in the region from about 31.6 cM to about 61.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers BM737 and AF5. The at least one genetic marker is selected from the group of markers shown in Table 18d: Table 18d
  • the at least one genetic marker is located in the region from about 33.3 cM to about 46.4 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers ILSTS046 and BMS1353. The at least one genetic marker is selected from the group of markers shown in Table 18e: Table 18e
  • the at least one genetic marker is located in the region from about 46.4 cM to about 61.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA25. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA25 in the region flanked by and including the markers BMS1353 and AF5. The at least one genetic marker is selected from the group of markers shown in Table 18f: Table 18f
  • the at least one genetic marker is located on the bovine chromosome BTA26. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 2.8 cM to about 66.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers BMS651 and BM7237.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD 1 for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table19a: Table 19a
  • the at least one genetic marker is located in the region from about 2.8 cM to about 60.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers BMS651 and BM804. The at least one genetic marker is selected from the group of markers shown in Table 19b: Table 19b
  • the at least one genetic marker is located in the region from about 2.8 cM to about 37.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers BMS651 and RM026. The at least one genetic marker is selected from the group of markers shown in Table 19c: Table 19c
  • the at least one genetic marker is located in the region from about 22.9 cM to about 31.7 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers HEL11 and BMS332. The at least one genetic marker is selected from the group of markers shown in Table 19d: Table 19d
  • the at least one genetic marker is located in the region from about 31.7 cM to about 41.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers BMS332 and BM9284. The at least one genetic marker is selected from the group of markers shown in Table 19e: Table 19e
  • the at least one genetic marker is located in the region from about 37.6 cM to about 66.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers RM026 and BM7237. The at least one genetic marker is selected from the group of markers shown in Table 19f: Table 19f
  • the at least one genetic marker is located in the region from about 37.6 cM to about 43.2 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers RM026 and RME40. The at least one genetic marker is selected from the group of markers shown in Table 19g: Table 19g
  • the at least one genetic marker is located in the region from about 43.2 cM to about 66.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers RME40 and BM7237. The at least one genetic marker is selected from the group of markers shown in Table 19h: Table 19h
  • the at least one genetic marker is located in the region from about 53.1 cM to about 60.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA26. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA26 in the region flanked by and including the markers IDVGA-59 and BM804. The at least one genetic marker is selected from the group of markers shown in Table 19i: Table 19i
  • the at least one genetic marker is located on the bovine chromosome BTA28. In one specific embodiment of the present invention, the at least one genetic marker is located in the region from about 8.0 cM to about 59.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers BMC6020 and BMC2208.
  • the at least one genetic marker is significant for the calving traits SB, CD and/or CS. In a particular embodiment the at least one genetic marker is significant for for example the trait SB, such as CD, for example CS. However, in a further embodiment the at least one genetic marker is significant for the traits in any combination.
  • the at least one genetic marker is selected from the group of markers shown in Table20a: Table 20a
  • the at least one genetic marker is located in the region from about 8.0 cM to about 24.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers BMC6020 and BL25. The at least one genetic marker is selected from the group of markers shown in Table 20b: Table 20b
  • the at least one genetic marker is located in the region from about 16.9 cM to about 24.8 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers ETH1112 and BL25. The at least one genetic marker is selected from the group of markers shown in Table 20c: Table 20c
  • the at least one genetic marker is located in the region from about 24.8 cM to about 50.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers BL25 and DIK5056. The at least one genetic marker is selected from the group of markers shown In Table 2Od: Table 2Od
  • the at least one genetic marker is located in the region from about 38.0 cM to about 45.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers DIK2955 and DIK713. The at least one genetic marker is selected from the group of markers shown in Table 2Oe: Table 2Oe
  • the at least one genetic marker is located in the region from about 38.0 cM to about 43.0 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers DIK2955 and BMS2658. The at least one genetic marker is selected from the group of markers shown in Table 2Of: Table 2Of
  • the at least one genetic marker is located in the region from about 43.0 cM to about 59.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers BMS2658 and BMC2208. The at least one genetic marker is selected from the group of markers shown in Table 2Og: Table 2Og
  • the at least one genetic marker is located in the region from about 45.9 cM to about 55.9 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers DIK713 and DIK5323. The at least one genetic marker is selected from the group of markers shown in Table 2Oh: Table 2Oh
  • the at least one genetic marker is located in the region from about 49.4 cM to about 50.5 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers BMS1714 and DIK5056. The at least one genetic marker is selected from the group of markers shown in Table 2Oi: Table 2Oi
  • the at least one genetic marker is located in the region from about 55.9 cM to about 59.6 cM (http://www.marc.usda.gov/) on the bovine chromosome BTA28. In one embodiment the at least one genetic marker is located on the bovine chromosome BTA28 in the region flanked by and including the markers DIK5323 and BMC2208. The at least one genetic marker is selected from the group of markers shown in Table 2Oj: Table 20j
  • the at least one genetic marker is a combination of markers, as indicated in tables 20k1 to 20k19. It is understood that the term BTA3, BTA4. BTA5, BTA7, BTA8, BTA9, BTA10, BTA11 , BTA12, BTA15, BTA18, BTA19, BTA20, BTA21 , BTA22, BTA24, BTA25, BTA26, and BTA28 in tables 20k1 to 20k19 is meant to comprise any regions and genetic markers located on the bovine chromosomes, respectively, as described elsewhere herein.
  • the tables 20k1 to 20k19 show different embodiments, wherein the combination of markers is a multiplicity of bovine chromosomes, wherein the specific chromosome in each embodiment is indicated with X. Table 20k1.
  • the detection of the presence or absence of a genetic marker allele according to the present invention may be conducted on the DNA sequence of the bovine chromosomes BTA3, BTA4, BTA5, BTA7, BTA8, BTA9, BTA10, BTA11. BTA12, BTA15, BTA18, BTA19, BTA20, BTA21 , BTA22, BTA24, BTA25, BTA26, and/or BTA28 specified elsewhere herein according to the present invention or a complementary sequence as well as on transciptional (mRNA) and translational products (polypeptides, proteins) therefrom.
  • mRNA transciptional
  • translational products polypeptides, proteins
  • Table 21 A number of mutation detection techniques are listed in Table 21. Some of the methods listed in Table 21 are based on the polymerase chain reaction (PCR), wherein the method according to the present invention includes a step for amplification of the nucleotide sequence of interest in the presence of primers based on the nucleotide sequence of the variable nucleotide sequence. The methods may be used in combination with a number of signal generation systems, a selection of which is also listed in Table 22. Table 21
  • the detection of genetic markers can according to one embodiment of the present invention be achieved by a number of techniques known to the skilled person, including typing of microsatellites or short tandem repeats (STR), restriction fragment length polymorphisms (RFLP), detection of deletions or insertions, random amplified polymorphic DNA (RAPIDs) or the typing of single nucleotide polymorphisms by methods such as restriction fragment length polymerase chain reaction, allele-specific oligomer hybridisation, oligomer-specific ligation assays, hybridisation with PNA or locked nucleic acids (LNA) probes.
  • STR microsatellites or short tandem repeats
  • RFLP restriction fragment length polymorphisms
  • RAPIDs random amplified polymorphic DNA
  • LNA locked nucleic acids
  • a primer of the present invention is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficiently length to selectively hybridise to the corresponding region of a nucleic acid molecule intended to be amplified.
  • the primer is able to prime the synthesis of the corresponding region of the intended nucleic acid molecule in the methods described above.
  • a probe of the present invention is a molecule for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid sequence of interest which selectively binds to the nucleic acid sequence of interest under high or low stringency conditions.
  • the method according to the present invention includes analyzing a sample of a bovine subject, wherein said sample may be any suitable sample capable of providing the bovine genetic material for use in the method.
  • the bovine genetic material may for example be extracted, isolated and purified if necessary from a blood sample, a tissue samples (for example spleen, buccal smears), clipping of a body surface (hairs or nails), milk and/or semen.
  • the samples may be fresh or frozen.
  • sequence polymorphisms of the invention comprise at least one nucleotide difference, such as at least two nucleotide differences, for example at least three nucleotide differences, such as at least four nucleotide differences, for example at least five nucleotide differences, such as at least six nucleotide differences, for example at least seven nucleotide differences, such as at least eight nucleotide differences, for example at least nine nucleotide differences, such as 10 nucleotide differences.
  • the nucleotide differences comprise nucleotide differences, deletion and/or insertion or any combination thereof.
  • the primers that may be used according to the present invention are shown in Table 22.
  • the in Table 22 specified primer pairs may be used individually or in combination with one or more primer pairs of Table 22.
  • the design of such primers or probes will be apparent to the molecular biologist of ordinary skill.
  • Such primers are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8- 15 bases in length.
  • primers will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the region. However, if required one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected.
  • the primers/probes of the invention may carry one or more labels to facilitate detection.
  • the primers and/or probes are capable of hybridizing to and/or amplifying a subsequence hybridizing to a single nucleotide polymorphism containing the sequence delineated by the markers as shown herein.
  • the primer nucleotide sequences of the invention further include: (a) any nucleotide sequence that hybridizes to a nucleic acid molecule of the delineated region(s) or its complementary sequence or RNA products under stringent conditions, e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2x SSC/0.1% Sodium Dodecyl Sulfate (SDS) at about 50-65 0 C, or (b) under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 6x SSC at about 45°C followed by one or more washes in 0.1 x SSC/0.2% SDS at about 68 0 C, or under other hybridization conditions which are apparent to those of skill in the art (see, for example, Ausubel F.
  • stringent conditions e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium
  • nucleic acid molecule that hybridizes to the nucleotide sequence of (a) and (b), above, is one that comprises the complement of a nucleic acid molecule of the region s or r or a complementary sequence or RNA product thereof.
  • nucleic acid molecules comprising the nucleotide sequences of (a) and (b) comprises nucleic acid molecule of RAI or a complementary sequence or RNA product thereof.
  • oligos deoxyoligonucleotides
  • TM melting temperature
  • Exemplary highly stringent conditions may refer for example to washing in 6x SSC/0.05% sodium pyrophosphate at 37°C (for about 14-base oligos), 48 0 C (for about 17-base oligos), 55°C (for about 20-base oligos), and 6O 0 C (for about 23-base oligos).
  • the invention further provides nucleotide primers or probes which detect the r region polymorphisms of the invention.
  • the assessment may be conducted by means of at least one nucleic acid primer or probe, such as a primer or probe of DNA, RNA or a nucleic acid analogue such as peptide nucleic acid (PNA) or locked nucleic acid (LNA).
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • the allele-specific oligonucleotide probe is preferably 5-50 nucleotides, more preferably about 5-35 nucleotides, more preferably about 5-30 nucleotides, more preferably at least 9 nucleotides.
  • a permutation test can be applied when the regression method is used (Doerge and Churchill, 1996), or the Piepho-method can be applied (Piepho, 2001) when the variance components method is used.
  • the principle of the permutation test is well described by Doerge and Churchill (1996), whereas the Piepho-method is well described by Piepho (2001).
  • Significant linkage in the within family analysis using the regression method a 1000 permutations were made using the permutation test (Doerge and Churchill, 1996).
  • a threshold at the 5% chromosome wide level was considered to be significant evidence for linkage between the genetic marker and the calving traits.
  • the QTL was confirmed in different sire families, For the across family analysis and multi-trait analysis with the variance component method the piepho method was used to determine the significance level (Piepho, 2001).
  • a threshold at the 5% chromosome wide level was considered to be significant evidence for linkage between the genetic marker and the calving traits.
  • Another aspect of the present invention relates to a diagnostic kit for use in detecting the presence or absence in a bovine subject of at least one genetic marker associated with bovine calving characteristics, comprising at least one oligonucleotide sequence, wherein the nucleotide sequences are selected from any of SEQ ID NO.: 1 to SEQ ID NO.: 558 and/or any combination thereof.
  • Genotyping of a bovine subject in order to establish the genetic determinants of calving traits for that subject according to the present invention can be based on the analysis of genomic DNA which can be provided using standard DNA extraction methods as described herein.
  • a diagnostic kit for establishing calving characteristics comprises, in a separate packing, at least one oligonucleotide sequence selected from the group of sequences shown in table 23 and any combinations thereof.
  • the tubes are incubated over night with slow rotation where after 180 ⁇ l saturated NaCI is added followed by vigorous agitation for 15 seconds.
  • the tube is the centrifuged for 15 minutes at 11000 rpm.
  • 0.4 ml of the supernatant is transferred to a 2 ml tube and 1 ml of 96% ethanol is added, mixing is achieved by slow rotation of the tube.
  • the tube is then centrifuged for 10 minutes at 11000 rpm. Remove the supernatant by pouring away the liquid, wash the pellet with 70% ethanol (0.2 ml) and centrifuge again for 10 minutes at 11000 rpm. Pour away the ethanol, dry the pellet and resuspend in 0.5 ml of TE-buffer) for 30 minutes at 55°C.
  • PCR reactions were run in a volume of 8 ⁇ l using TEMPase (GeneChoice) polymerase and reaction buffer I as provided by the supplier (GeneChoice). Usually 5 different markers are included in each multiplex PCR. 1 ⁇ l DNA, 0.1 ⁇ l TEMPase enzyme, 0.2 mM dNTPs, 1.2 mM MgCI2, 0.3 ⁇ M each primer.
  • the PCR mixtures were subjected to initial denaturation at 94°C for 15 min (for TEMPase). Subsequently, the samples were cycled for 10 cycles with touchdown, i.e. the temperature is lowered 1 °C at each cycle (denaturation at 94°C 30", annealing at 67°C 45", elongation 72 0 C 30"), after which the samples were cycled for 20 cycles with normal PCR conditions (denaturation at 94°C 30", annealing at 58 0 C 45", elongation 72°C 30) PCR cycling was terminated by 1 cycle at 72°C 30' and the PCR machine was programmed to cooling down the samples at 4 0 C for ' ever ' .
  • nucleotide sequence of the primers used for detecting the markers is shown in Table 23. The sequence is listed from the 5' end.
  • BMS1788 R GGAGAGGAATCTTGCAAAGG SEQ ID NO.: 48 BMS2646 F CAAAGCCATAAGAAGCAATTATG SEQ ID NO.: 49 BMS2646 R CCTTCTATAGTGTGGTGACTACCC SEQID NO.: 50 F GCACAGTAATAAGAGTGATGGCAGA SEQID NO.: 51 TGLA116 R TGGAGAAGATTTGGCTGTGTACCCA SEQID NO.: 52 F CTTAACTCATTCACCTCAACTG SEQID NO.: 53
  • DDC5002 R TGCAGGAATATGAGAGCTGAGA SEQID NO.: 80 F AGTTGGACCTGCCATTGTTC SEQID NO.: 81
  • DQC5321 R CCCATCTCTTGTGCCAAATC SEQID NO.:114 F CATCTGAATGGCCAGAATGA SEQID NO.:115
  • DIK2915 R GTGGAGCCAAGGTGAAAGAA SEQID NO.:140
  • OARAE 129 R GTAGATCAAGATATAGAATATTTTTCAACACC SEQID NO.:144
  • DDC5364 AAAAACCCAAAACAACACACAA SEQID NO.:192 F CCTTCTCTGAATTTTTGTTGAAAGC SEQID NO.:193
  • BMS 1620 R TTGCCCAAAAATAGACCTTAAA SEQID NO.:240 F GGTATTTTGAGAATGTGGGC SEQID NO.:241
  • ILSTS070 R TCTTTGACCACTACCTATCC SEQID NO.. -242 F GTGCGGAAAGGAACAGAGTC SEQID NO.:243
  • ILSTS036 R AGACAGGATGGGAAGTCACC SEQID NO.:268
  • BMS 1822 F AAAGGCTTCTATTTGTGGTGG SEQID NO.:269 R TTGATGCTTTATTGTTTTCCTCT SEQ ID NO.:270 F TTCTACTCTCCAGCCTCCTCC SEQ ID NO.:271
  • BMS410 R TTGCCACATTTACCTTCTTTCA SEQ ID NO.:290 F TTCTAATGTAGAGCAAAGTGATTGA SEQ ID NO.:291
  • BR3510 R ACCCCGTGGACTGTAGTCTG SEQ ID NO.:302 F TGAAGTAAGTAAGCACACAAGCA SEQ ID NO.:303
  • DIKl 106 R TCTACCTTTTGATAGCGTGAGC SEQID NO.:312
  • BMS 1355 R ATATTTGCGACATTGGATGAA SEQID NO.:338 F TGATGCTGATTGATTTTGTGTG SEQID NO.:339 BMS 1322 R TATCTTTGCTCACTCTTTCCCC SEQID NO.:340 F TGTGGCTAGGTTCAAGCTCC SEQID NO.:341 TEXAN-10 R TCTCTTCTGGTGCATCCATTG SEQID NO.:342 F ATGGGCAGCTTAGGGATTG SEQID NO.:343
  • BMS601 R TCACAAGAGCAATGACGAGG SEQID NO.:396 BTA20:
  • HEL12 R CAGACTTGTCAGACTCCATA SEQID NO.:400
  • BMS 1862 R ACCAGAGATGATGAAGAATCCC SEQID NO.:492 F AGCAGAGGGCAAATGTTATG SEQID NO.:493 BMS466 R GGATGTAAGAGGATGCAGACC SEQID NO.:494 F GGTCATTTTCCATTATGACAGCAG SEQID NO.:495 INRA090 R GGTGTTACCTTTTTTAGTCTCC SEQID NO.:496 F CAACTAGCTTCTCAATGCCTTT SEQID NO.:497 BMS 1926 R TTCTCCCAATCTGTAACTGCA SEQID NO.:498 F CCAAACCAGTGTGACTGACA SEQID NO.:499
  • ILSTS 102 R AGGAGACAGCTACAAACCCC SEQID NO.:502 F ATCCAAGGAGGTCCCAGG SEQID NO.:503
  • BMS332 R AATTGCATGGAAAGTTCTCAGC SEQID NO.:518 F TTGTACATTTCTGTCAATGCCTT SEQID NO.:519
  • RME40 CTCACAGGTAAATTTGGGTGAT SEQID NO.:524 IDVGA-59 F AACCCAAATATCCATCAATAG SEQID NO.:525 R CAGTCCCTCAACCCTCTTTTC SEQ ID NO.:526 F TAGTGTCCACCAGAGACCCC SEQ ID NO.:527
  • BMC6020 R AAGTGGGTGGCTTCAACACT SEQ ID NO.-.534 F AGTGGATCCTGCATGTTATGCCG SEQ ID NO.:535
  • ETHl 112 R CCAGACGGACCTTTGTGGGCAA SEQ ID NO.:536 F AACAGTGGCAATGGAAGTGG SEQ ID NO.:537
  • D1K5323 R ATGGACCAGATGGTGGAAAT SEQ ID NO.:552 F CTTTCCCATCCTTTCACCAA SEQ ID NO.:553
  • DIK4862 R AAGTAGGGTGTGTGGGGGTA SEQ ID NO.:554 F GTTGAGCAGGGGGTAACAAG SEQ ID NO.:555
  • PCR-product 0.5 ⁇ l PCR-product is added to 9.5 ⁇ l formamide and analysed on an ABI-3730XL sequencing Instrument (Applied Biosystems Inc.).
  • Phenotype data The calving traits considered were stillbirth (SB), calving difficulty (CD) and the size of calf at birth (CS) after first calving.
  • the traits were assessed both as a "direct' effect (D) of the sire in the calf and as a "maternal" effect (M) of the sire in the mother of the calf, giving a total of 6 traits for the QTL analysis.
  • Breeding values for each trait were obtained from the Danish Agricultural Advisory Service database. The breeding values were obtained from the routine breeding value estimation procedure by the exception that information from correlated traits and pedigree information were ignored.
  • the calving traits were analyzed using the linear regression mapping procedure of Haley & Knott (1992). Significant QTL were found by using permutation tests developed by Churchill & Doerge (1994). In this procedure traits and chromosomes were analyzed separately and tested for the presence of a single QTL affecting a particular trait. If the test: (1) exceeds the 5% chromosome-wise significance threshold and (2) the QTL-region affecting two or more traits, then the QTL is retained for further characterization. The variance component QTL mapping approach was used to test if it is a single pleiotropic QTL affecting two traits or two linked QTL affecting different traits.
  • the QTL is modeled as a random effect in a bivariate linear mixed model that adjusts for polygenenic and overall trait means.
  • the IBD matrices were computed using a recursive algorithm (S ⁇ rensen et al., 2003, Wang et al., 1995), conditional on the most likely marker linkage phase in the sire.
  • the IBD matrices were computed for every 2 cM along the chromosomes and used in the subsequent variance component estimation procedure.
  • Baysian information criterion (BIC) and correlation between the QTL (r q ) were used to compare the pleiotropic and linked model.
  • the chromosome-wise regression test (table 24) showed a total of 27 significant QTL for calving traits in first lactation on 17 different chromosomes. 15 of the QTL were related to direct calving ease and 12 QTL was related to the maternal effects.
  • Average number of informative markers per grandsire family varied from 3.0 (BTA25) to 8.5 (BT A3) informative markers per chromosome.
  • Table 24 Chromosome wise regressions analysis across families for calving traits after first calving. QTL are shown for traits that exceed 5 % chromosome wise threshold level. Numbers of segregating families are shown in brackets for each trait and chromosome.
  • Table 25 shows results of tests to distinguish between pleiotropic and linked QTL.
  • Two regions (BTA 12, BTA25) indicate QTL with pleiotropic effects with strong correlations between the traits (close to 1 or -1 ).
  • BTA7 and BTA26 the linkage model is in favor with correlations closer to 0 and high BIC-values.
  • the analysis on BTA22 and BTA28 could not clarify whether it is linked or pleiotropic QTL.
  • BTA8 did not give useful results because the likelihood did not converge to a maximum.
  • On BTA 18 there may be a pleiotropic QTL affecting all the direct calving traits and probably one QTL affecting maternal stillbirth (M_SB).
  • D__CD direct calving difficulty
  • D_SB direct stillbirth
  • D_CS direct calf size
  • M_CD maternal calving difficulty
  • M_SB maternal stillbirth
  • M_CS maternal calf size.
  • a average number of informative markers between QTL
  • b probability of a pleiotropic model over the linked model

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/DK2007/000060 2006-02-08 2007-02-05 Calving characteristics Ceased WO2007090401A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US12/223,773 US20090181386A1 (en) 2006-02-08 2007-02-05 Calving Characteristics
AU2007214120A AU2007214120A1 (en) 2006-02-08 2007-02-06 Calving characteristics
JP2008553617A JP2009525734A (ja) 2006-02-08 2007-02-06 出産特性
EP07702478A EP2032717A2 (en) 2006-02-08 2007-02-06 Calving characteristics

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA200600181 2006-02-08
DKPA200600181 2006-02-08
DKPA200700165 2007-01-31
DKPA200700165 2007-01-31

Publications (3)

Publication Number Publication Date
WO2007090401A2 true WO2007090401A2 (en) 2007-08-16
WO2007090401A3 WO2007090401A3 (en) 2007-11-08
WO2007090401A8 WO2007090401A8 (en) 2008-09-25

Family

ID=37946083

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2007/000060 Ceased WO2007090401A2 (en) 2006-02-08 2007-02-05 Calving characteristics

Country Status (6)

Country Link
US (1) US20090181386A1 (enExample)
EP (1) EP2032717A2 (enExample)
JP (1) JP2009525734A (enExample)
AR (1) AR059367A1 (enExample)
AU (1) AU2007214120A1 (enExample)
WO (1) WO2007090401A2 (enExample)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107760789B (zh) * 2017-09-18 2021-03-02 中国农业科学院兰州畜牧与兽药研究所 一种用于牦牛亲子鉴定和个体识别的基因分型检测试剂盒
AU2023250649A1 (en) 2022-04-04 2024-11-14 The Regents Of The University Of California Genetic complementation compositions and methods

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
WO1992013102A1 (en) * 1991-01-15 1992-08-06 Genmark Polymorphic dna markers in bovidae

Also Published As

Publication number Publication date
US20090181386A1 (en) 2009-07-16
AU2007214120A1 (en) 2007-08-16
AR059367A1 (es) 2008-03-26
JP2009525734A (ja) 2009-07-16
EP2032717A2 (en) 2009-03-11
WO2007090401A3 (en) 2007-11-08
WO2007090401A8 (en) 2008-09-25

Similar Documents

Publication Publication Date Title
US20150232949A1 (en) Methods for detecting dna originating from different individuals
WO2010065470A2 (en) Compositions and methods for detecting background male dna during fetal sex determination
US20100016653A1 (en) Quantitative Trait Loci and Somatostatin
US8715925B2 (en) Genetic test for the identification of carriers of complex vertebral malformations in cattle
Khatib et al. Association of the protease inhibitor gene with production traits in Holstein dairy cattle
AU2009275988B2 (en) A genetic marker test for Brachyspina and fertility in cattle
CN103370456A (zh) 限定母体循环血液中保守的游离浮动胎儿dna的诊断性和治疗性靶物
Kakoi et al. Genetic diagnosis of sex chromosome aberrations in horses based on parentage test by microsatellite DNA and analysis of X‐and Y‐linked markers
EP2069531B1 (en) Qtls for mastitis resistance in cattle
EP2032717A2 (en) Calving characteristics
EP1609876A1 (en) Identification of the gene and mutation for progressive rod-cone degeneration in dog and method for testing same
US20090176224A1 (en) Udder Health Characteristics
WO2008014550A1 (en) Markers for pigmentation
US7833710B2 (en) Polynucleotide associated with breast cancer comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for diagnosing breast cancer using the same
WO2009097862A1 (en) Genetic markers for fertility
US20080118914A1 (en) Follistatin gene as a genetic marker for first parity litter size in pigs
WO2010108498A1 (en) Genetic markers for mastitis resistance
JP7602893B2 (ja) イヌ白内障の検査方法、イヌ白内障の検査をするための試薬、及びイヌ白内障の検査キット
CA2647224C (en) Identification of a novel gene underlying familial spastic paraplegia
JP3948702B2 (ja) ウシのＣｌａｕｄｉｎ−１６欠損症タイプ２の遺伝子診断法
AU2007281024B2 (en) Markers for pigmentation
WO2009142474A1 (en) Genetic markers predicting age at menopause
CN101415840A (zh) 产犊特征
WO2010008809A2 (en) Compositions and methods for early stage sex determination

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2008553617

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007214120

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 571107

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2007214120

Country of ref document: AU

Date of ref document: 20070205

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 200780011252.2

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 12223773

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2007702478

Country of ref document: EP