WO2007088531A2 - Pem-3-like polypeptides, complexes, and related methods - Google Patents

Abstract

The present disclosure relates to the discovery that PEM-3-LIKE (also known as RKHD2) interacts with three polypeptides: p32, FNBP3 and PCBP1 . Given that PEM-3-LIKE participates in viral replication, the polypeptide complexes and methods disclosed herein may, for example, be used in the identification of antiviral agents. The present disclosure also relates to novel compositions and methods for treating HIV infection. The disclosure relates to the discovery that reduced expression of p32 or PEM-3-LIKE results in decreased expression of the HIV-1 structural protein GAG.

Description

PEM-3-LIKE POLYPEPTIDES, COMPLEXES, AND RELATED METHODS

RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No.

60/764732, filed February 2, 2006 and U.S. Provisional Application No. 60/839158, filed August 21, 2006; each application is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] Potential drug target validation involves determining whether a DNA, RNA or protein molecule is implicated in a disease process and is therefore a suitable target for development of new therapeutic drugs. Drug discovery, the process by which bioactive compounds are identified and characterized, is a critical step in the development of new treatments for human diseases. The landscape of drug discovery has changed dramatically due to the genomics and proteomics revolutions. DNA and protein sequences are yielding a host of new drug targets and an enormous amount of associated information.

[0003] The identification of genes and proteins involved in various disease states or key biological processes, such as inflammation and immune response, is a vital part of the drug design process. Many diseases and disorders could be treated or prevented by decreasing the expression of one or more genes involved in the molecular etiology of the condition if the appropriate molecular target could be identified and appropriate antagonists developed. For example, cancer, in which one or more cellular oncogenes become activated and result in the unchecked progression of cell cycle processes, could be treated by antagonizing appropriate cell cycle control genes. Furthermore many human genetic diseases, such as Huntington's disease, and certain prion conditions, which are influenced by both genetic and epigenetic factors, result from the inappropriate activity of a polypeptide as opposed to the complete loss of its function. Accordingly, antagonizing the aberrant function of such mutant genes would provide a means of treatment. Additionally, infectious diseases such as HIV have been successfully treated with molecular antagonists targeted to specific essential retroviral proteins such as HIV protease or reverse transcriptase. Drug therapy strategies for treating such diseases and disorders have frequently employed molecular antagonists, which target the polypeptide product of the disease gene(s). However the discovery of relevant gene or protein targets is often difficult and time consuming.

[0004] One area of particular interest is the identification of host genes and proteins that are co-opted by viruses during the viral life cycle. The serious and incurable nature of many viral diseases, coupled with the high rate of mutations found in many viruses, makes the identification of antiviral agents a high priority for the improvement of world health. Genes and proteins involved in a viral life cycle are also appealing as a subject for investigation because such genes and proteins will typically have additional activities in the host cell and may play a role in other non- viral disease states.

[0005] Viral maturation involves the proteolytic processing of the Gag proteins, organization of viral proteins and RNA to form a ribonucleoparticle, and the activity of various host proteins. It is believed that cellular machineries for exo/endocytosis and for ubiquitin conjugation may be involved in the maturation. In particular, the assembly, budding and subsequent release of retroid viruses, RNA viruses and envelope viruses, such as various retroviruses, rhabdoviruses, lentiviruses, and filoviruses may involve the Gag polyprotein. After its synthesis, Gag is targeted to the plasma membrane where it induces budding of nascent virus particles. [0006] The role of ubiquitin in virus assembly was suggested by Dunigan et al. (1988, Virology 165, 310, Meyers et al. 1991, Virology 180, 602), who observed that mature virus particles were enriched in unconjugated ubiquitin. More recently, it was shown that proteasome inhibitors suppress the release of HIV-I, HIV-2 and virus-LIKE particles derived from SIV and RSV Gag. Also, inhibitors affect Gag processing and maturation into infectious particles (Schubert et al 2000, PNAS 97, 13057, Harty et al. 2000, PNAS 97, 13871, Stack et al. 2000, PNAS 97, 13063, Patnaik et al. 2000, PNAS 97, 13069).

[0007] It is well known in the art that ubiquitin-mediated proteolysis is the major pathway for the selective, controlled degradation of intracellular proteins in eukaryotic cells. Ubiquitin modification of a variety of protein targets within the cell appears to be important in a number of basic cellular functions such as regulation of gene expression, regulation of the cell-cycle, modification of cell surface receptors, biogenesis of ribosomes, and DNA repair. One major function of the ubiquitin-mediated system is to control the half-lives of cellular proteins. The half-life of different proteins can range from a few minutes to several days, and can vary considerably depending on the cell-type, nutritional and environmental conditions, as well as the stage of the cell-cycle.

[0008] Targeted proteins undergoing selective degradation, presumably through the actions of a ubiquitin-dependent proteosome, are covalently tagged with ubiquitin through the formation of an isopeptide bond between the C-terminal glycyl residue of ubiquitin and a specific lysyl residue in the substrate protein. This process is catalyzed by a ubiquitin-activating enzyme (El) and a ubiquitin- conjugating enzyme (E2), and in some instances may also require auxiliary substrate recognition proteins (E3s). Following the linkage of the first ubiquitin chain, additional molecules of ubiquitin may be attached to lysine side chains of the previously conjugated moiety to form branched multi-ubiquitin chains. [0009] The conjugation of ubiquitin to protein substrates is a multi-step process. In an initial ATP requiring step, a thioester is formed between the C-terminus of ubiquitin and an internal cysteine residue of an El enzyme. Activated ubiquitin is then transferred to a specific cysteine on one of several E2 enzymes. Finally, these E2 enzymes donate ubiquitin to protein substrates, typically with the assistance of an E3 protein, also known as a ubiquitin enzyme. In certain instances, substrates are recognized directly by the ubiquitin-conjugated E2 enzyme. Substrates are recognized either directly by ubiquitin-conjugated enzymes or by associated substrate recognition proteins, the E3 proteins, also known as ubiquitin ligases. [0010] The conjugation of ubiquitin to protein substrates is a multi-step process. In an initial ATP requiring step, a thioester is formed between the C-terminus of ubiquitin and an internal cysteine residue of an El enzyme. Activated ubiquitin may then be transferred to a specific cysteine on one of several E2 enzymes. [00H] It is also known that the ubiquitin system plays a role in a wide range of cellular processes including cell cycle progression, apoptosis, and turnover of many membrane receptors. In viral infections, the ubiquitin system is involved not only with assembly, budding and release, but also with repression of host proteins such as p53, which may lead to a viral-induced neoplasm. The HIV Vpu protein interacts with an E3 protein that regulates IKB degradation and is thought to promote apoptosis of infected cells by indirectly inhibiting NF-κB activity (Bour et al. (2001) J Exp Med 194:1299-311; U.S. Patent No. 5,932,425). The ubiquitin system regulates protein function by both mono-ubiquitination and poly-ubiquitination, and poly-ubiquitination is primarily associated with protein degradation. [0012] In addition to the ubiquitin system, proteins involved in RNA metabolism and regulation may be targets in antiviral therapies. Certain viruses, such as RNA viruses, require specific RNA replication strageties for infectivity. For positive- stranded RNA viruses, such as poliovirus, the virion (or genomic) RNA is the same sense as mRNA and therefore functions as mRNA transcripts and can be translated directly. The RNA of negative-stranded RNA viruses such as influenze virus, however, must be copied into the complementary plus-sense mRNA before it can code for protein products. Negative-stranded viruses therefore require an RNA- dependent RNA polyperase and must package it in the virion so that mRNAs can be synthesized upon infection. The virion of RNA viruses may also be doube-stranded, in which case the viruses also require an RNA polymerase to make single-stranded mRNA. Other RNA viruses include retroviruses and use reverse transcriptase (which is packaged in the virion) to copy their RNA into DNA. In addition to RNA polymerase and reverse transcriptase, viruses employ other regulatory proteins that act in RNA metabolism and regulate splicing and translocation of RNA species. For example, RNA metabolism of human immunodeficiency virus type 1 (HIV-I) RNA involves intron sequences and splice sites along with Rev protein in determining the subcellular distribution of the RNA (Seguin et al. J Virology (1998) 72: 9503-9513). [0013] It would be beneficial to identify proteins involved in one or more of these processes for use in, among other things, drug screening methods and antiviral therapies.

SUMMARY OF THE INVENTION

[0014] The present disclosure relates to the discovery that PEM-3-LIKE (also known, in certain variations, as RKHD2) interacts with three polypeptides: p32, FNBP3 and PCBPl. Therefore, the disclosure provides, in part, novel polypeptide complexes and methods that may be used to identify modulators of the function of PEM-3-LIKE, p32, FNBP3 and PCBPl. Given that PEM-3-LIKE participates in viral replication, the polypeptide complexes and methods disclosed herein may, for example, be used in the identification of antiviral agents.

[0015] In certain embodiments, the disclosure provides an isolated, purified, or recombinant complex comprising a PEM-3-LIKE polypeptide and an interacting polypeptide. The PEM-3-LIKE polypeptide may comprise an amino acid sequence that is at least 90%, 95%, 98% or 100% identical to the amino acid sequence selected from SEQ ID NOS: 2, 4, 5, 6, 7, 8, 21, and 23, or any naturally occurring PEM-3-LIKE amino acid sequence. A PEM-3-LIKE polypeptide may also comprise an amino acid sequence corresponding to a functional domain of PEM-3-LIKE, such as a p32-interacting domain (e.g., amino acids 1-230 of SEQ ID NO: 4), a RING domain (e.g., amino acids 604-648 of SEQ ID NO: 4) or a KH domain (e.g., amino acids 229-291 or 342-385 of SEQ ID NO: 4). A PEM-3-LIKE interacting polypeptide may be selected from the group consisting of: a p32 polypeptide, a PCBPl polypeptide and an FNBP3 polypeptide. A p32 polypeptide may comprise an amino acid sequence that is at least 90%, 95%, 98% or 100% identical to the amino acid sequence of SEQ ID NO: 16, or a naturally occurring p32 polypeptide. An FNBP3 polypeptide may comprise an amino acid sequence that is at least 90%, 95%, 98% or 100% identical to the amino acid sequence of SEQ ID NO: 18, or a naturally occurring FNBP3 polypeptide. A PCBPl polypeptide may comprise an amino acid sequence that is at least 90%, 95%, 98% or 100% identical to the amino acid sequence of SEQ ID NO: 20, or a naturally occurring PCBPl polypeptide. The PEM-3-LIKE polypeptide may comprise a full-length protein, or it can comprise a fragment of, for instance, at least 5, 10, 20, 50, 100, 150, 200, or more amino acids in length. The PEM-3-LIKE interacting polypeptide may comprise a full-length protein, or it can comprise a fragment of, for instance, at least 5, 10, 20, 50, 100, 150, 200, or more amino acids in length.

[0016] In certain embodiments, the disclosure provides an isolated, purified, or recombinant complex comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide, wherein the PEM-3-LIKE polypeptide is encoded by a nucleic acid sequence that is at least 90%, 95%, 98% or 100% identical to a nucleic acid sequence selected from among SEQ ID NOS: 1, 3, 22, and 24, or any naturally occurring PEM-3-LIKE nucleic acid sequence or a sequence complementary thereto. A PEM-3-LIKE interacting polypeptide may be encoded by a nucleic acid sequence that is at least 90%, 95%, 98%, or 100% identical to a nucleic acid sequence selected from among SEQ ID NOS: 9, 10, 11, 12, 13, 14, 15, 17, and 19, or any naturally occurring p32, FNBP3, or PCBPl nucleic acid sequence, or any sequence complementary thereto. The PEM-3-LIKE polypeptide may be encoded by a nucleic acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence corresponding to at least about 12, at least about 15, at least about 25, at least about 40, at least about 100, or at least about 300 consecutive nucleotides, up to the full length of any of SEQ ID NOS: 1, 3, 22, or 24, or any naturally occurring PEM-3-LIKE nucleic acid or a sequence complementary thereto. Further, a PEM-3-LIKE polypeptide may be encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from among SEQ ID NOS: 1, 3, 22, and 24, or any naturally occurring PEM-3-LIKE nucleic acid sequence or complement thereto. A PEM-3-LIKE interacting polypeptide may be encoded by a nucleic acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence corresponding to at least about 12, at least about 15, at least about 25, at least about 40, at least about 100, or at least about 300 consecutive nucleotides, up to the full length of a any of SEQ ID NOS: 9, 10, 11, 12, 13, 14, 15, 17, or 19, or any naturally occurring nucleic acid sequence of p32, FNBP3, or PCBPl, or any sequence complementary thereto. In addition, a PEM-3-LIKE interacting polypeptide may be encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from among SEQ ID NOS: 9, 10, 11, 12, 13, 14, 15, 17, or 19, or any naturally occurring p32, FNBP3, or PCBPl nucleic acid sequence or complement thereto.

[0017] In certain embodiments, the disclosure provides an isolated, purified, or recombinant complex comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide wherein the PEM-3-LIKE polypeptide and/or the PEM-3- LIKE interacting polypeptide is a fusion polypeptide. PEM-3-LIKE polypeptides, PEM-3-LIKE interacting polypeptides and complexes thereof may be isolated or purified from cells.

[0018] In additional embodiments, the disclosure provides a method for identifying an agent that modulates a complex comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide. In further embodiments, the disclosure provides a method for identifying an agent that interferes with, inhibits, or prevents an association or interaction comprising a PEM-3 -LIElE polypeptide and a PEM-3-LIKE interacting polypeptide. In further embodiments, the disclosure relates to a method for identifying an agent that enhances, potentiates, promotes, or facilitates an association or interaction comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide. In additional embodiments, the disclosure relates to a method for identifying an agent that modulates a complex comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide, wherein the agent that modulates the complex is an agent that modulates an activity or function of the PEM-3-LIKE polypeptide. In further embodiments, the disclosure provides a method for identifying an agent that modulates the association of PEM-3-LIKE polypeptide with a PEM-3-LIKE interacting polypeptide, wherein the agent is an antiviral agent. [0019] In further embodiments, the disclosure provides a method for identifying an agent that modulates the association of PEM-3-LIKE polypeptide with a PEM-3- LIKE interacting polypeptide, wherein the PEM-3-LIKE polypeptide has an amino acid sequence that is at least 90%, 95%, 98% or 100% identical to an amino acid sequence selected from among SEQ ID NOS: 2, 4, 5, 6, 7, 8, 21, and 23, or any fragment thereof, or is encoded by a nucleic acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence selected from SEQ ID NOS: 1, 3, 22, and 24, or any naturally occurring PEM-3-LIKE nucleic acid sequence, or fragment thereof or complement thereto. In further embodiments, the disclosure provides a method for identifying an agent that modulates the association of PEM-3-LIKE polypeptide with a p32 polypeptide, wherein the p32 polypeptide has an amino acid sequence that is at least 90%, 95%, 98%, or 100% identical to an amino acid sequence of SEQ ID NO: 16 or any naturally occurring p32 amino acid sequence or fragment thereof, or is encoded by a nucleic acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence selected from among SEQ ID NOS: 9, 10, 11, and 15 or any naturally occurring p32 nucleic acid sequence, or fragment thereof or complement thereto. In additional embodiments, the disclosure provides a method for identifying an agent that modulates the association of PEM-3-LIKE polypeptide with FNBP3 polypeptide, wherein the FNBP3 polypeptide has an amino acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence of SEQ ID NO: 18 or any naturally occurring FNBP3 amino acid sequence or fragment thereof, or is encoded by a nucleic acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence selected from among SEQ ID NOS: 12 and 17, or any naturally occurring FNBP3 nucleic acid sequence, or fragment thereof or complement thereto. In other embodiments, the invention provides a method for identifying an agent that modulates the association of PEM-3-LIKE polypeptide with PCBPl polypeptide, wherein the PCBPl polypeptide has amino acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence of SEQ ID NO: 20 or any naturally occurring PCBPl amino acid sequence or fragment thereof, or is encoded by a nucleic acid sequence that is at least 90%, 95%, 98%, or 100% identical to a sequence selected from among SEQ ID NOS: 13, 14, and 19, or any naturally occurring PCBPl nucleic acid sequence, or fragment thereof or complement thereto. [0020] Accordingly, in certain embodiments, the disclosure provides a method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions with a PEM-3-LIKE interacting polypeptide. The PEM-3-LIKE interacting polypeptide may be selected from the group consisting of p32 polypeptide, FNBP3 polypeptide, and PCBPl polypeptide. In additional embodiments, the disclosure provides a method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions comprising the addition of a test agent to a pre-formed complex comprising a PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide. The pre-formed complex may be isolated from cells or be formed using isolated, purified individual PEM-3-LIKE and PEM-3-LIKE interacting polypeptides. In further embodiments, the disclosure provides a method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions with a PEM-3-LIKE interacting polypeptide comprising the addition of a test agent with uncomplexed, individually isolated PEM-3-LIKE and PEM-3-LIKE interacting polypeptides. [0021] In certain embodiments, the disclosure provides a method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions with a PEM-3-LIKE interacting polypeptide wherein modulation is measured by an increase or decrease in complex formation. In other embodiments, the disclosure provides a method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions with a PEM-3-LIKE interacting polypeptide wherein modulation is determined by the ability to isolate complexes comprising a PEM-3-LIKE polypeptide and a PEM-3- LIKE interacting polypeptide from cells. Agents found to modulate PEM-3-LIKE polypeptide interactions with PEM-3-LIKE interacting polypeptides may include, but are not limited to, small molecules, single- or double-stranded RNA or DNA (such as in RNA interference or antisense), monoclonal or polyclonal antibodies, chemicals, and metals such as, for example, inorganic and organometallic molecules. Agents found to modulate PEM-3-LIKE polypeptide interactions with PEM-3-LIKE interacting polypeptides may also be useful as antiviral agents. [0022] In certain aspects, the present invention also relates to methods and compositions for inhibiting viral infections. In some aspects, such methods and compositions target the host protein PEM-3-LIKE and/or PEM-3-LIKE -related processes. Additionally or alternatively, the methods and compositions target the host protein p32 and/or p32-related processes.

[0023] Accordingly, in certain embodiments, methods of inhibiting a viral infection comprise administering to a subject with a viral infection an agent that decreases the expression, function, or activity of a PEM-3-LIKE or p32 polypeptide. The viral infection may be a lentiviral infection. In some embodiments, the infection is a human immunodeficiency virus type 1 or type 2 (HIV- l/HIV-2) infection.

[0024] In further embodiments, a decrease in the expression, function, or activity of a PEM-3-LIKE or p32 polypeptide results in a decrease or reduction in the expression or levels of the viral protein Gag. In particular embodiments, the methods of the present invention result in a decrease in the HIV Gag protein. Additionally or alternatively, a decrease in the expression, function, or activity of a p32 polypeptide results in a disruption or inhibition of p32 interactions with other proteins involved in the viral life cycle, including viral and/or host proteins (for example, PEM-3-LIKE).

[0025] The present disclosure relates to compositions and methods of inhibiting a viral infection involving the modulation of the expression or an activity of PEM-3- LIKE (e.g., PEM-3-LIKE antagonists). Accordingly, the disclosure relates to a method of inhibiting a viral infection in a subject in need of such treatment comprising administering to the subject an agent that decreases the expression or activity of a PEM-3-LIKE polypeptide. In certain embodiments, the viral infection is a human immunodeficiency virus type 1 or type 2 (HIV- l/HIV-2) infection. In further embodiments, a decrease in the activity or expression of a PEM-3-LIKE polypeptide results in decreased expression of a Gag viral protein. In particular embodiments, the Gag viral protein is a Gag protein from HIV-I or HIV-2. [0026] PEM-3-LIKE antagonists of the present invention include, for example, polypeptides, antibodies or antigen-binding fragments, small molecules, nucleic acid molecules, aptamers, DNA enzymes, ribozymes, chemicals, prodrugs, peptidomimetic compounds, and organometallic compounds. In particular embodiments, the agent or PEM-3-LIKE antagonist comprises an antibody or antigen-binding fragment that specifically binds a PEM-3-LIKE polypeptide (including, for example, chimeric, humanized or human antibodies or antigen- binding fragments such as Fv, scFv, Fab', and F(ab')₂).

[0027] In other embodiments the agent or PEM-3-LIKE antagonist is a small molecule that inhibits the activity of a PEM-3-LIKE polypeptide. In alternative embodiments the agent decreases the expression of a PEM-3-LIKE polypeptide. Such an agent may comprise a nucleic acid molecule (e.g., a molecule comprising DNA, RNA, or a mixture of both DNA and RNA). In particular embodiments the nucleic acid molecule specifically hybridizes to a transcript encoding a PEM-3- LIKE polypeptide. In further aspects of the invention, the nucleic acid molecule comprises ribonucleic acids that mediate RNA interference of a PEM-3-LIKE transcript. Nucleic acid molecules that specifically hybridize to a transcript encoding a PEM-3-LIKE polypeptide include but are not limited to sequences that are approximately 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical or homologous to a sequence of SEQ ID NOS: 1, 3, 22, or 24, including complements thereto and fragments thereof.

[0028] The present invention also relates to methods for identifying an antiviral agent. Such methods comprise the steps of (a) transfecting mammalian cells with a proviral genome; and (b) decreasing the expression, function, or activity of a PEM- 3 -LIKE polypeptide by the addition of a test agent, and (c) determining viral transcript or protein levels or viral infectivity, wherein a decrease in the level of viral transcript or protein or a decrease in viral infectivity indicates that the test agent is an antiviral agent. In some embodiments step (b) is performed before step (a). In some aspects of the invention, the test agent is a nucleic acid molecule that mediates RNA interference of PEM-3-LIKE, and in further embodiments the viral transcript or protein measured in step (c) is a Gag viral transcript or protein. In still further embodiments, the proviral genome is the genome of a human immunodeficiency virus (HIV) and the viral transcript or protein level determined in step (c) is the level of HIV Gag.

[0029] Agents of the present invention also include agents that decrease the expression, function, or activity of a p32 polypeptide and are referred to herein as p32 antagonists. Such agents include, but are not limited to, polypeptides, antibodies and antigen-binding fragments, small molecules, nucleic acid molecules, aptamers, DNA enzymes, ribozymes, chemicals, prodrugs, peptidomimetic compounds, and organometallic compounds. In certain embodiments, the agent is an antibody or antigen-binding fragment that specifically binds a p32 polypeptide. The antibody or antigen-binding fragment may be a chimeric, humanized or human antibody or antigen-binding fragment (e.g., Fv, scFv, Fab', and F(ab')₂). In other embodiments, the agent is a small molecule that inhibits the function or activity of a p32 polypeptide. In alternative embodiments, an antiviral agent of the invention comprises a nucleic acid molecule that decreases the expression or function of a p32 polypeptide. The nucleic acid molecule may specifically hybridize to a transcript encoding the p32 polypeptide. A transcript or mRNA encoding a p32 polypeptide is provided in SEQ ID NO: 15, for example. The present invention also encompasses nucleic acid molecules that specifically hybridize to sequences that are variants of SEQ ID NO: 15, including sequences that are approximately 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical or homologous to the nucleic acid sequence set forth in SEQ ID NO. 15 or any fragment thereof. Accordingly, nucleic acid molecules that specifically hybridize to a transcript encoding a p32 polypeptide include but are not limited to sequences that are approximately 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical or homologous to a sequence of SEQ ID NO: 15, including complements thereto and fragments thereof. In certain embodiments the nucleic acid molecule mediates RNA interference of p32. Exemplary nucleic acid molecules that mediate RNA interference are set forth in SEQ ID NOS: 27 and 28, and SEQ ID NOS: 29 and 30, for example.

[0030] The present invention also relates to methods for identifying an antiviral agent. Such methods comprise the steps of (a) transfecting mammalian cells with a proviral genome; and (b) decreasing the expression, function, or activity of a p32 polypeptide by the addition of a test agent, and (c) determining viral transcript or protein levels or viral infectivity, wherein a decrease in the level of viral transcript or protein or a decrease in viral infectivity indicates that the test agent is an antiviral agent. In some embodiments step (b) is performed before step (a). In some aspects of the invention, the test agent is a nucleic acid molecule that mediates RNA interference of p32, and in further embodiments the viral transcript or protein measured in step (c) is a Gag viral transcript or protein. In still further embodiments, the proviral genome is the genome of a human immunodeficiency virus (HIV) and the viral transcript or protein level determined in step (c) is the level of HIV Gag.

[0031] The PEM-3-LIKE and p32 antagonists of the present invention may be formulated in a pharmaceutical composition suitable for the methods disclosed herein. Therefore other aspects of the invention relate to pharmaceutical compositions or medicaments comprising an antiviral agent, wherein the antiviral agent is a PEM-3-LIKE or p32 antagonist. The invention also relates to PEM-3- LIKE and/or p32 antagonists for the use in the treatment of viral disorders. [0032] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figs. IA-B provide predicted nucleotide sequences of human RKHD2 (PEM-3-LIKE) variant 1, SEQ. ID. NO. 1 (IA) and variant 2, SEQ ID NO. 24 ( IB). [0034] Figs. 2A-B provide predicted amino acid sequences of human RKHD2 (PEM-3-LIKE) variant I₃ SEQ. ID. NO. 2 (2A) and variant 2, SEQ ID NO. 4 (2B). [0035] Fig. 3 provides a nucleotide sequence of of human RKHD2 (PEM-3-LIKE) that has been sequenced (SEQ ID NO. 3).

[0036] Fig. 4 provides an amino acid sequence of human RKHD2 (PEM-3-LIKE) polypeptide (SEQ ID NO. 4).

[0037] Fig. 5 provides a nucleotide sequence of Bait A (SEQ. ID. NO. 5) used to clone a fragment of PEM-3-LIKE polypeptide corresponding to amino acids 214- 400.

[0038] Fig. 6 provides a nucleotide sequence of Bait B (SEQ. ID. NO. 6) used to clone a fragment of PEM-3-LIKE polypeptide corresponding to amino acids 1-230. [0039] Fig. 7 provides a nucleotide sequence of Bait C (SEQ. ID. NO. 7) used to clone a fragment of PEM-3-LIKE polypeptide corresponding to amino acids 1-400. [0040] Fig. 8 provides a nucleotide sequence of Bait D (SEQ. ID. NO. 8) used to clone a fragment of PEM-3-LIKE polypeptide corresponding to amino acids 1-604. [0041] Figs. 9A-C show nucleotide sequences provided as part of a human cDNA library that correspond to fragments of the p32 nucleotide sequence (sample prey clone sequences yielding positive hits for baits B, C, and D in the yeast-two-hybrid screen: 4BDl 1, SEQ ID NO. 9 (Fig. 9A); 4CDl, SEQ. ID. NO. 10 (Fig. 9B); and 4DDl 1, SEQ. ID. NO. 11 (Fig. 9C); clones correspond to ClQBP/SF2p32 NM_001212.3)

[0042] Fig. 10 shows a nucleotide sequence provided as part of a human cDNA library that corresponds to a fragment of the FNBP3 nucleotide sequence (prey clone sequence for an interaction with the minimal bait B; clone corresponds to FNBP3 XM_371575. 4BDl 5-1 (4BDl 5-1, SEQ. ID. NO. 12).

[0043] Figs. 11 A-B show nucleotide sequences provided as part of a human cDNA library that correspond to fragments of the PCBPl nucleotide sequence(prey clone for an interaction with the minimal bait B; clone corresponds to PCBPl NM_006196: 4BD24, SEQ. ID. NO. 13 (Fig. HA) and 4DD3, SEQ. ID. NO. 14

(Fig. HB).

[0044] Fig. 12 provides a nucleotide sequence encoding p32 polypeptide: human ClQBP (p32) mRNA sequence (public gi: 28872801) (SEQ. ID. NO. 15). [0045] Fig. 13 provides an amino acid sequence for p32 polypeptide: human ClQBP (p32) protein sequence (public gi: 4502491) (SEQ. ID. NO. 16). [0046] Fig. 14 provides a nucleotide sequence encoding FNBP3 polypeptide: human FNBP3 mRNA sequence (public gi: 51460875) (SEQ. ID. NO. 17). [0047] Fig. 15 provides an amino acid sequence for FNBP3 polypeptide: human FNBP3 protein sequence (public gi: 51460876) (SEQ. ID. NO. 18). [0048] Fig. 16 provides a nucleotide sequence encoding PCBPl polypeptide: human PCBPl mRNA sequence (public gi: 14141164) (SEQ. ID. NO. 19). [0049] Fig. 17 provides an amino acid sequence for PCBPl polypeptide: human PCBPl protein sequence (public gi: 5453854) (SEQ. ID. NO. 20). [0050] Figs. 18A-B show the results of FRET analysis in which PEM-3-LIKE and p32 polypeptide interact in vitro. Fig. 18A depicts a binding curve of PEM-3-LIKE and p32 determined by FRET. Fig. 18B depicts PEM-3-LIKE and p32 interaction in vitro.

[0051] Fig. 19 shows an amino acid sequence of a PEM-3-LIKE polypeptide with point mutations within the KH domains: KH mutant of PEM-3-LIKE (G246D, G340D) (SEQ. ID. NO. 21).

[0052] Fig. 20 shows the in vivo interaction between PEM-3-LIKE and p32 in which the complexed polypeptides are co-immunoprecipitated. [0053] Fig. 21 shows a diagram of the different domains of PEM-3-LIKE polypeptide (from WO 2005/001485).

[0054] Fig. 22 shows a method for the identification of agents that modulate PEM- 3-LIKE polypeptide associations with a PEM-3-LIKE interacting polypeptides, by complex formation or the interactions between PEM-3-LIKE polypeptide and interacting polypeptides (p32 or a different PEM-3-LIKE interacting polypeptide). [0055] Fig. 23 provides the mRNA nucleotide sequence of RKHD2 (PEM-3- LIKE) that is available in the public domain (NM_016626, gi:39545576) (SEQ ID NO 22). [0056] Fig. 24 provides the amino acid sequence of RKHD2 (PEM-3-LIKE) that is available in the public domain (NP_057710, gi:39545577) (SEQ ID NO 23). [0057] Fig. 25 shows the effects of reduced expression of ρ32 or PEM-3-LIKE on HIVl Gag levels in HeLa cells transfected with plasmid encoding the HIVl pro viral genome.

DETAILED DESCRIPTION OF THE INVENTION 1. Definitions

[0058] The term "binding" refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, ionic and/or hydrogen- bond interactions under physiological conditions.

[0059] The term "interaction" includes a direct or indirect association between two molecules and includes, for example, associations described by binding as well as associations between two molecules that may occur indirectly via a third molecule (e.g., a scaffold protein, DNA, RNA, or other molecule or combination of molecules).

[0060] "Cells," "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. [0061] A "chimeric protein" or "fusion protein" is a fusion of a first amino acid sequence encoding a polypeptide with a second amino acid sequence defining a domain foreign to and not substantially homologous with any domain of the first amino acid sequence. A chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", "intergenic", etc. fusion of protein structures expressed by different kinds of organisms.

[0062] As used herein, the term "nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0063] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar amino acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. A sequence which is "unrelated" or "non-homologous" shares less than 40% identity, though preferably less than 25% identity with a sequence of the present invention. In comparing two sequences, the absence of residues (amino acids or nucleic acids) or presence of extra residues also decreases the identity and homology/similarity. [0064] The term "homology" describes a mathematically based comparison of sequence similarities which is used to identify genes or proteins with similar functions or motifs. The nucleic acid and protein sequences of the present invention may be used as a "query sequence" to perform a search against public databases to, for example, identify other family members, related sequences or homologs. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J MoI. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used. See http://www.ncbi.nlm.nih.gov.

[0065] As used herein, "identity" means the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., talcing into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs. Computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al, Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. MoI. Biol. 215: 403-410 (1990). The well known Smith Waterman algorithm may also be used to determine identity.

[0066] The term "isolated", as used herein with reference to the subject proteins and protein complexes, refers to a preparation of protein or protein complex that is essentially free from contaminating proteins that normally would be present with the protein or complex, e.g., in the cellular milieu in which the protein or complex is found endogenously. Thus, an isolated protein complex is isolated from cellular components that normally would "contaminate" or interfere with the study of the complex in isolation, for instance while screening for modulators thereof. It is to be understood, however, that such an "isolated" complex may incorporate other proteins or agents that are intentionally included, usually as part of an assay. [0067] The term "isolated" as also used herein with, respect to nucleic acids, such as DNA or RNA, refers to molecules in a form which does not occur in nature. Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.

[0068] The term "purified protein" refers to a preparation of a protein or proteins which are preferably isolated from, or otherwise substantially free of, other proteins normally associated with the protein(s) in a cell or cell lysate. The term "substantially free of other cellular proteins" (also referred to herein as "substantially free of other contaminating proteins") is defined as encompassing individual preparations of each of the component proteins comprising less than 20% (by dry weight) contaminating protein, and preferably comprises less than 5% contaminating protein. Functional forms of each of the component proteins can be prepared as purified preparations by using a cloned gene as described in the attached examples. By "purified", it is meant, when referring to component protein preparations used to generate a reconstituted protein mixture, that the indicated molecule is present in the substantial absence of other biological macromolecules, such as other proteins (particularly other proteins which may substantially mask, diminish, confuse or alter the characteristics of the component proteins either as purified preparations or in their function in the subject reconstituted mixture). The term "purified" as used herein preferably means at least 80% by dry weight, more preferably in the range of 85% by weight, more preferably 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present). The term "pure" as used herein preferably has the same numerical limits as "purified" immediately above.

[0069] A "KH domain" or "K homology domain" is a protein domain associated with RNA-binding. The KH domain was first identified as a 45 amino acid repeat in the heterogeneous nuclear ribonucleoprotein K. A KH domain typically contains the consensus RNA-binding motif represented by VIGXXGXXI. [0070] Lentiviruses include primate lentiviruses, e.g., human immunodeficiency virus types 1 and 2 (HIV- l/HIV-2); simian immunodeficiency virus (SIV) from Chimpanzee (SIVcpz), Sooty mangabey (SIVsmm), African Green Monkey (SIVagm), Syke's monkey (SIVsyk), Mandrill (SIVmnd) and Macaque (SIVmac). Lentiviruses also include feline lentiviruses, e.g., Feline immunodeficiency virus (FIV); Bovine lentiviruses, e.g., Bovine immunodeficiency virus (BIV); Ovine lentiviruses, e.g., Maedi/Visna virus (MVV) and Caprine arthritis encephalitis virus (CAEV); and Equine lentiviruses, e.g., Equine infectious anemia virus (EIAV). All lentiviruses express at least two additional regulatory proteins (Tat, Rev) in addition to Gag, Pol, and Env proteins. Primate lentiviruses produce other accessory proteins including Nef, Vpr, Vpu, Vpx, and Vif. Generally, lentiviruses are the causative agents of a variety of disease, including, in addition to immunodeficiency, neurological degeneration, and arthritis. Nucleotide sequences of the various lentiviruses can be found in Genbank under the following Accession Nos. (from J. M. Coffm, S. H. Hughes, and H. E. Varmus, "Retroviruses" Cold Spring Harbor Laboratory Press, 199,7 p 804): 1) HIV-I: K03455, M19921, K02013, M3843 1, M38429, K02007 and M17449; 2) HIV-2: M30502, J04542, M30895, J04498, M15390, M31113 and L07625; 3) SIV:M29975, M30931, M58410, M66437, L06042, M33262, M19499, M32741, M31345 and L03295; 4) FIV: M25381, M36968 and Ul 1820; 5)BIV. M32690; O)ElAV: M16575, M87581 and U01866; 6)Visna: M10608, M51543, L06906, M60609 and M60610; 7) CAEV: M33677; and 8) Ovine lenti virus M31646 and M34193. Lenti viral DNA can also be obtained from the American Type Culture Collection (ATCC). For example, feline immunodeficiency virus is available under ATCC Designation No. VR-2333 and VR-3112. Equine infectious anemia virus A is available under ATCC Designation No. VR-778. Caprine arthritis-encephalitis virus is available under ATCC Designation No. VR-905. Visna virus is available under ATCC Designation No. VR-779.

[0071] The term "maturation" as used herein refers to the production, post- translational processing, assembly and/or release of proteins that form a viral particle. Accordingly, this includes the processing of viral proteins leading to the pinching off of nascent virion from the cell membrane. [0072] A "PEM-3-LIKE nucleic acid" is a nucleic acid comprising a sequence as represented in any of SEQ ID NOS: 1, 3 and 22 ,as well as any of the variants described herein, including but not limited to fragments thereof and complements thereto, and sequences with at least 90% identity or homology to the sequences given in SEQ ID NOS: 1, 3, and 22.

[0073] A "PEM-3-LIKE polypeptide" or "PEM-3-LIKE protein" is a polypeptide comprising a sequence as represented in any of SEQ ID NOS: 2, 4, 5, 6, 7, and 8 as well as any of the variations described herein, including but not limited to fragments thereof and sequences with at least 90% identity to the sequences given in SEQ ID NOS: 2, 4, 5, 6, 7, and 8.

[0074] A "PEM-3-LIKE-associated protein," "PEM-3 -LIKE-AP," or PEM-3- LIKE interactor" refers to a protein capable of interacting with and/or binding to a PEM-3-LIKE polypeptide. Generally, the PEM-3-LIKE interactor may associate directly or indirectly with the PEM-3-LIKE polypeptide. Preferred PEM-3-LIKE interactors or PEM-3-LIKE interacting proteins include p32, FNBP3, and/or PCBPl polypeptides, and any fragments or variants thereof.

[0075] The term "prodrug" is intended to encompass compounds that, under physiological conditions, are converted into the therapeutically active agents of the present invention. A common method for making a prodrug is to include selected moieties that are hydrolyzed under physiological conditions to reveal the desired molecule. In other embodiments, the prodrug is converted by an enzymatic activity of the host animal.

[0076] A "recombinant nucleic acid" is any nucleic acid that has been placed adjacent to another nucleic acid by recombinant DNA techniques. A "recombined nucleic acid" also includes any nucleic acid that has been placed next to a second nucleic acid by a laboratory genetic technique such as, for example, transformation and integration, transposon hopping or viral insertion. In general, a recombined nucleic acid is not naturally located adjacent to the second nucleic acid. [0077] The term "recombinant protein" refers to a protein of the present invention which is produced by recombinant DNA techniques, wherein generally DNA encoding the expressed protein is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. Moreover, the phrase "derived from", with respect to a recombinant gene encoding the recombinant protein is meant to include within the meaning of "recombinant protein" those proteins having an amino acid sequence of a native protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions of a naturally occurring protein.

[0078] A "RING domain" or "Ring Finger" is a zinc-binding domain with a defined octet of cysteine and histidine residues. Certain RING domains comprise the consensus sequences as set forth below (amino acid nomenclature is as set forth in Table 1): Cys Xaa Xaa Cys Xaa₁₀.₂o Cys Xaa His Xaa_2-5 Cys Xaa Xaa Cys Xaa_{13- 5}o Cys Xaa Xaa Cys or Cys Xaa Xaa Cys Xaa₁₀.₂₀ Cys Xaa His Xaa_2-5 His Xaa Xaa Cys Xaa_13-5o Cys Xaa Xaa Cys. Preferred RING domains of the invention bind to various protein partners to form a complex that has ubiquitin ligase activity. RING domains preferably interact with at least one of the following protein types: F box proteins, E2 ubiquitin conjugating enzymes and cullins.

[0079] The term "RNA interference" or "RNAi" refers to any method by which expression of a gene or gene product is decreased by introducing into a target cell one or more double-stranded RNAs which are homologous to the gene of interest (particularly to the messenger RNA of the gene of interest). RNAi may also be achieved by introduction of an RNA:RNA or DNA:RNA hybrid wherein the antisense strand (relative to the target) is RNA. Either strand may include one or more, modifications to the base or sugar-phosphate backbone. Any nucleic acid preparation designed to achieve an RNA interference effect is referred to herein as an "RNAi construct". RNAi constructs include small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs.

[0080] "Small molecule" as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5 kD and most preferably less than about 2.5 kD. Small molecules can be nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic (carbon containing) or inorganic molecules. Many pharmaceutical companies have extensive libraries of chemical and/or biological mixtures comprising arrays • of small molecules, often fungal, bacterial, or algal extracts, which can be screened with any of the assays of the invention.

[0081] As used herein, the term "specifically hybridizes" refers to the ability of a nucleic acid probe/primer of the invention to hybridize to at least 12, 15, 20, 25, 30, 35, 40, 45, 50 or 100 consecutive nucleotides of a PEM-3-LIKE (or, in certain embodiments, a p32) sequence, or a sequence complementary thereto, or naturally occurring mutants thereof, such that it has less than 15%, preferably less than 10%, and more preferably less than 5% background hybridization to a cellular nucleic acid (e.g., mRNA or genomic DNA) other than the PEM-3-LIKE (or alternatively p32) gene. A variety of hybridization conditions may be used to detect specific hybridization, and the stringency is determined primarily by the wash stage of the hybridization assay. Generally high temperatures and low salt concentrations give high stringency, while low temperatures and high salt concentrations give low stringency. Low stringency hybridization is achieved by washing in, for example, about 2.0 x SSC at 50 ⁰C, and high stringency is achieved with about 0.2 x SSC at 50 ⁰C. Further descriptions of stringency are provided below. [0082] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto. [0083] A "virion" is a complete viral particle; nucleic acid and capsid (and a lipid envelope in some viruses. [0084] The term "envelope virus" as used herein refers to any virus that uses cellular membrane and/or any organelle membrane in the viral release process.

Table 1: Abbreviations for classes of amino acids*

* Abbreviations as adopted from http://smart.embl- heidelberg.de/SMART_DATA/alignments/consensus/grouping.html.

2. Overview

[0085] In certain aspects, the disclosure relates to the discovery of novel associations between PEM-3-LIKE protein and the proteins p32, FNBP3, and PCBPl. Accordingly, the disclosure provides complexes comprising PEM-3-LIKE and p32, PEM-3-LIKE and FNBP3, and PEM-3-LIKE and PCBPl. In other aspects, the disclosure relates to novel associations among certain disease states, PEM-3- LIKE nucleic acids and proteins, and the nucleic acids and proteins of p32, FNBP3, or PCBPl.

[0086] In certain aspects, by identifying proteins associated with PEM-3-LIKE, and particularly human PEM-3-LIKE, the present disclosure provides a conceptual link between PEM-3-LIKE and the PEM-3-LIKE interactors and cellular processes and disorders associated with PEM-3-LIKE-interactors. Accordingly, in certain embodiments of the disclosure, agents that modulate PEM-3-LIKE interactors, such as p32, FNBP3, and PCBPl, may now be used to modulate PEM-3-LIKE functions and disorders associated with PEM-3-LIKE function, such as viral disorders. Additionally, test agents may be screened for an effect on PEM-3-LIKE-interactors, such as p32, FNBP3, and PCBPl, and then further tested for an effect on a PEM-3- LIKE function or a disorder associated with PEM-3-LIKE function. Likewise, in certain embodiments of the disclosure, agents that modulate PEM-3-LIKE may now be used to modulate PEM-3-LIKE interactors, such as p32, FNBP3, and PCBPl, and functions and disorders associated with these PEM-3-LIKE interactors, such as viral and genetic disorders. Additionally, test agents may be screened for an effect on ρ32, FBP3, or PCBPl and then further tested for an effect on a PEM-3-LIKE interactor function or a disorder associated with PEM-3-LIKE interactor function. In further aspects, nucleic acid agents (e.g., RNAi probes, antisense nucleic acids), antibody-related agents, small molecules and other agents may be used to affect PEM-3-LIKE function, and the use of the same agents may be used to modulate PEM-3-LIKE and/or the activity of proteins that interact with PEM-3-LIKE. [0087] In certain embodiments, the disclosure relates to the discovery that one or more PEM-3-LIKE polypeptides interact with one or more p32 polypeptides. Accordingly, the disclosure provides complexes comprising PEM-3-LIKE and ρ32. In one embodiment, the disclosure relates to the discovery that PEM-3-LIKE binds directly with p32. This interaction was identified by Inventors in a yeast two-hybrid assay. In another embodiment, the disclosure relates to the discovery that PEM-3- LIKE associates with p32 in cells. Accordingly, the disclosure relates to isolated, purified, or recombinant complexes comprising a PEM-3-LIKE polypeptide and a p32 polypeptide.

[0088] The term p32, and its synonyms [complement component 1, q subcomponent binding protein (ClQBP, GClQBP, gClqBP, gClqR, gC IQ-R), p33, TAP, hyaluronic acid binding protein 1 (HABPl), and SF2p32] are used herein to refer to p32 as well as to various naturally occurring p32 homologs, as well as functionally similar variants and fragments that retain at least 80%, 90%, 95%, or 99% sequence identity to a naturally occurring p32. The term specifically includes human p32 nucleic acid and amino acid sequences and the sequences presented in the Examples and Figures. The term also refers to isoforms of p32 that may result from, for example, alternative splicing. The term p32 also includes any post- translational modifications of p32 polypeptide, including but not limited to glycosylation, phosphorylation, and myristylation.

[0089] In certain embodiments, the disclosure relates to the discovery that one or more PEM-3-LIKE polypeptides interact with one or more FNBP3 polypeptides. Accordingly, the disclosure provides complexes comprising PEM-3-LIKE and FNBP3. In one aspect, the disclosure relates to the discovery that PEM-3-LIKE binds directly with FNBP3. This interaction was identified by Inventors in a yeast two-hybrid assay. Thus, in certain aspects, the disclosure relates to isolated, purified, or recombinant complexes comprising a PEM-3-LIKE polypeptide and a FNBP3 polypeptide. [0090] The term FNBP3 is used herein to refer to FNBP3 as well as to various naturally occurring FNBP3 homologs, as well as functionally similar variants and fragments that retain at least 80%, 90%, 95%, or 99% sequence identity to a naturally occurring FNBP3. The term specifically includes human FNBP3 nucleic acid and amino acid sequences and the sequences presented in the Examples and Figures. The term FNBP3 also includes different splice variants and polypeptides with different post translational modifications. FNBP3 is also referred to as Huntingtin yeast partner A, FBP-11, Fas-ligand associated factor 1, and NY-REN-6 antigen, and these terms are used interchangeably herein.

[0091] In certain embodiments, the disclosure relates to the discovery that one or more PEM-3-LIKE polypeptides interacts with one or more PCBPl polypeptides. Accordingly, the disclosure provides complexes comprising PEM-3-LIKE and PCBPl. In one embodiment, the disclosure relates to the discovery that PEM-3- LIKE binds directly with PCBPl. This interaction was identified by Inventors in a yeast two-hybrid assay. Accordingly, certain aspects of the disclosure relate to isolated, purified, or recombinant complexes comprising a PEM-3-LIKE polypeptide and a PCBPl polypeptide.

[0092] The term PCBPl is used herein to refer to PCBPl as well as to various naturally occurring PCBPl homologs, as well as functionally similar variants and fragments that retain at least 80%, 90%, 95%, or 99% sequence identity to a naturally occurring PCBPl. The term specifically includes human PCBPl nucleic acid and amino acid sequences and the sequences presented in the Examples and Figures. The term PCBPl also includes different isoforms of the PCBPl protein, splice variants, and PCBPl polypeptides that carry post-translational modifications. PCBPl is also referred to as hnRNP El or αCPl, and these terms are used interchangeably herein.

[0093] The discovery of the aformentioned novel PEM-3-LIKE interactions permits the identification of new drug targets. For example, the discovery of the interaction between PEM-3-LIKE and p32, and the knowledge of the effects of PEM-3-LIKE inhibition on HIV biogenesis (WO 2005/001485), facilitated tests of siRNA targeted to p32, thereby revealing the effect of p32 inhibition on HIV Gag expression and HFV propagation. Accordingly, the present invention also relates to the discovery that inhibition of p32 or PEM-3-LIKE results in decreased levels of the HIV-I protein Gag in viral infected cells. This discovery identifies and validates p32 as a novel target in the treatment of viral infections such as, for example, HIV infection. Accordingly, the present invention also relates to antagonists of PEM-3- LIKE and/or p32 that are useful in the treatment or inhibition of viral infections. Exemplary antagonists include siRNAs and RNAi constructs targeted to PEM-3- LIKE or p32.

3. Exemplary nucleic acids and polypeptides

[0094] In certain aspects the disclosure provides nucleic acids encoding PEM-3- LIKE polypeptides, such as, for example, SEQ ID NOS: 1, 3, 22, 24 and fragments thereof. Nucleic acids of the disclosure are further understood to include nucleic acids that comprise variants of any of SEQ ID NOS: 1, 3, 22, or 24. Variant nucleotide sequences include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants, and will, therefore, include coding sequences that differ from the nucleotide sequence of the coding sequence designated in SEQ ID NOS: 1, 3, 22, and 24, e.g., due to the degeneracy of the genetic code. In other embodiments, variants will also include sequences that will hybridize under highly stringent conditions to a nucleotide sequence of a coding sequence designated in any of SEQ ID NOS: 1, 3, 22, and 24. Preferred nucleic acids employed by methods of the disclosure are human PEM-3-LIKE sequences, including, for example, any of SEQ ID NOS: 1, 3, 22, and 24, and variants thereof and nucleic acids encoding an amino acid sequence selected from among SEQ ID NOS: 2, 4, 5, 6, 7, 8, 21, 23, and any variants or fragments thereof. [0095] Isolated nucleic acids which differ from SEQ ID NOS: 1, 3, 22, or 24, due to degeneracy in the genetic code are also within the scope of the invention. Likewise, isolated nucleic acids which differ from SEQ ID NOS: 9, 10, 11, 12, 13, 14, 15, 17, and 19 due to degeneracy in the genetic code are also within the scope being employed by methods of the invention. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC are synonyms for histidine) may result in "silent" mutations which do not affect the amino acid sequence of the protein. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the subject proteins will exist among mammalian cells. One skilled in the art will appreciate that these variations in one or more nucleotides (up to about 3-5% of the nucleotides) of the nucleic acids encoding a particular protein may exist among individuals of a given species due to natural allelic variation. Any and all such nucleotide valuations and resulting amino acid polymorphisms are within the scope of this invention.

[0096] In certain aspects the disclosure provides methods employing nucleic acids encoding PEM-3-LIKE polypeptides such as, for example, SEQ ID NOS: 2, 4, 5, 6, 7, 8, 21, and 23. In other aspects the disclosure provides methods employing nucleic acids encoding polypeptides that interact with PEM-3-LIKE such as, for example, SEQ ID NOS: 16, 18, and 20, or any variants or fragments thereof. Nucleic acids encoding PEM-3-LIKE interacting polypeptides include SEQ. ID. NOS: 9, 10, 11, 12, 13, 14, 15, 17, and 19 and variants or fragments thereof. In certain aspects, the disclosure relates to methods employing a nucleic acid that is provided in an expression vector comprising a nucleotide sequence encoding a PEM-3-LIKE polypeptide, p32 polypeptide, FNBP3 polypeptide, or a PCBPl polypeptide, operably linked to at least one regulatory sequence. Regulatory sequences are art- recognized and are selected to direct expression of the PEM-3-LIKE polypeptide or PEM-3-LIKE interacting polypeptide. Accordingly, the term regulatory sequence includes promoters, enhancers and other expression control elements. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding a PEM-3-LIKE polypeptide. Such useful expression control sequences, include, for example, the early and late promoters of SV40, tet promoter, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast α-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should also be considered.

[0097] In certain embodiments, the disclosure relates to methods employing a nucleic acid that is provided in an expression vector comprising a nucleotide sequence encoding a PEM-3-LIKE polypeptide, a p32 polypeptide, a FNBP3 polypeptide, or a PCBPl polypeptide operably linked to a fragment of a gene or nucleic acid sequence encoding a portion or a domain of a protein that is required for the expression and/or transcriptional activation of a reporter gene. Reporter gene systems allow the visualization or detection of the transcriptional activity from promoter regions preceding the reporter genes. A reporter gene is a gene or nucleotide sequence encoding a protein that when expressed, can be detected or assayed by conventional methods in molecular and cell biology or by other means. Typically the reporter gene protein product is not expressed or is expressed at low levels in the transformed cell. Reporter genes include nucleotides encoding proteins that result in fluorescence or bioluminescence, such as fluorescent proteins and luciferases, or proteins required for the expression and activation of enzymes whose activities can be assayed, such as E. coli β-galactosidase and β -glucuronidase genes. [0098] This disclosure also pertains to the use of a host cell transfected with a recombinant gene including a coding sequence for a PEM-3-LIKE polypeptide or PEM-3-LIKE interacting polypeptide. The host cell may be any prokaryotic or eukaryotic cell. For example, a polypeptide of the present invention may be expressed in bacterial cells such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells. Other suitable host cells are known to those skilled in the art. As will be apparent, the gene constructs can be used to cause expression of a PEM-3-LIKE polypeptide or a PEM-3-LIKE interacting polypeptide in cells propagated in culture, e.g., to produce proteins or polypeptides, including fusion proteins or polypeptides, for purification.

[0099] Accordingly, the present disclosure further pertains to methods of isolating PEM-3-LIKE polypeptides in complex with a p32, FNBP3, or PCBPl polypeptide. For example, a host cell transfected with an expression vector encoding a PEM-3- LIKE polypeptide or a PEM-3-LIKE fusion polypeptide is cultured under appropriate conditions to allow expression of the polypeptide to occur. In one embodiment, a different host cell is transfected with an expression vector encoding a PEM-3-LIKE interacting protein selected from the group consisting of p32, FNBP3, and PCBPl. The PEM-3-LIKE interacting polypeptide may also be a fusion polypeptide. The polypeptides expressed in cells may be secreted and isolated from a mixture of cells and medium containing the polypeptides. The isolated individual polypeptides are then mixed to form protein complexes. Alternatively, the same host cell may be transfected with two expression vectors: an expression vector encoding PEM-3-LIKE polypeptide and another vector encoding a polypeptide that interacts with PEM-3-LIKE (for example ρ32, FNBP3, or PCBPl). The polypeptides may be retained cytoplasmically and the cells harvested, lysed and the protein complex isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The polypeptide complex can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, non-denaturing electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of the polypeptides or a fusion polypeptide. In a preferred embodiment, the PEM-3-LIKE polypeptide is a fusion protein containing a domain which facilitates its purification, such as a PEM-3-LIKE-protein-GST fusion protein, PEM-3-LIKE-protein-intein fusion protein, PEM-3-LIKE-protein-cellulose binding domain fusion protein, PEM-3-LIKE-protein-polyhistidine (HIS) fusion protein, or a PEM-3-LIKE-protein- DYKDDDDK -or FLAG tag. Likewise, the PEM-3-LIKE interacting polypeptide may be a fusion protein containing one of the aforementioned domains. The PEM-3-LIKE interacting polypeptide also includes all isoforms including but not limited to isoforms resulting from splice variants and mutant proteins, as well as modifications of the interacting polypeptide including but not limited to polypeptides with post-translational modifications such as glycosylation, phosphorylation, myristylation and/or other modifications. [0100] A nucleotide sequence encoding a PEM-3-LIKE polypeptide can be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial) cells, are standard procedures.

[0101] A recombinant PEM-3-LIKE nucleic acid or recombinant nucleic acid for a PEM-3-LIKE interacting protein can be produced by ligating the cloned gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both. Expression vehicles for production of recombinant polypeptides include plasmids and other vectors. For instance, suitable vectors for the expression of a PEM-3-LIKE polypeptide or PEM-3-LIKE interacting polypeptide include plasmids of the types: pBR322-derived plasmids, pEMBL- derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.

[0102] A number of vectors exist for the expression of recombinant proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2, and YRP 17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al., (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein). These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used.

[0103] The preferred mammalian expression vectors contain both prokaryotic sequences to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells. Alternatively, derivatives of viruses such as the bovine papilloma virus (BPV-I), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells. Examples of other viral (including retroviral) expression systems can be found below in the description of gene therapy delivery systems. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989) Chapters 16 and 17. In some instances, it may be desirable to express the recombinant PEM-3-LIKE polypeptide by the use of a baculo virus expression system. Examples of such baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the β-gal containing pBlueBac III).

[0104] It is well known in the art that a methionine at the N-terminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat et al., (1987) J Bacterial. 169:751-757) and Salmonella typhimurium and its in vitro activity has been demonstrated on recombinant proteins (Miller et al., (1987) PNAS USA 84:2718- 1722). Therefore, removal of an N-terminal methionine, if desired, can be achieved either in vivo by expressing such recombinant polypeptides in a host which produces MAP (e.g., E. coli or CM89 or S. cerevisiae), or in vitro by use of purified MAP (e.g., procedure of Miller et al.).

[0105] Alternatively, the coding sequences for the subject polypeptides can be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al, John Wiley & Sons: 1992). [0106] In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N- terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni^⁺ metal resin. The purification leader sequence can then be subsequently removed by treatment with enteroldnase to provide the purified PEM-3-LIKE polypeptide (e.g., see Hochuli et al., (1987) J. Chromatography 411:177; and Janknecht et al., PNAS USA 88:8972).

4. Identification and isolation of novel PEM-3-LIKE interactions [0107] In one embodiment, the invention relates to the isolation and use of novel associations involving PEM-3-LIKE polypeptides. PEM-3-LIKE, which is also referred to, in certain variations, as RKHD2, is a polypeptide originally isolated and characterized as described in WO 2005/001485. PEM-3-LIKE protein bears a unique composition of KH domains and RING domains (Figure 22) and is predicted to localize to the nucleoplasm and to the cytoplasm, and PEM-3-LIKE polypeptides intersect with and regulate a wide range of key cellular functions. For example, PEM-3-LIKE polypeptides function as E3 enzymes in the ubiquitination system. A ubiquitin ligase, such as PEM-3-LIKE protein, may participate in biological processes including, for example, one or more of the various stages of a viral lifecycle, such as viral entry into a cell, production of viral proteins, assembly of viral proteins and release of viral particles from the cell. [0108] PEM-3-LIKE polypeptides may be involved in the CRMl pathway and may play a role in the post-transcriptional regulation of HIV-I and in the replication of other viruses. The protein SAM68, for example, and homologous proteins containing a KH domain, play an important role in the post-transcriptional regulation of HIV-I replication. These proteins are involved in the CRMl pathway and have been found to interact with viral RNA. CRMl is a receptor protein normally involved in the nuclear export of certain RNAs and proteins. HIV-I matrix (MA), the amino-terminal domain of the Pr55 gag polyprotein, is involved in directing unspliced viral RNA from the nucleus to the plasma membrane. Although MA does not contain the canonical leucine-rich nuclear export signal, nuclear export is mediated through the conserved CRMIp pathway (Dupont, S et al. (1999) Nature 402:681-685). Nuclear export of another retroviral Gag polyprotein, the Rous sarcoma vims Gag polyprotein, is mediated by a CRMl -dependent nuclear export pathway (Scheifele, LZ et al. (2002) Proc Natl Acad Sd USA 99:3944-3949). [0109] As described in WO 2005/001485, PEM-3-LIKE polypeptides participate in viral maturation, including the production, post-translational processing, assembly and/or release of proteins in a viral particle. For example, a reduction of PEM-3- LIKE polypeptide inhibited viral release and infectivity. Accordingly, viral infections may be ameliorated by inhibiting an activity (e.g., ubiquitin ligase activity or target protein interaction) of PEM-3-LIKE polypeptides. Possible viral infections that may be ameliorated by inhibiting PEM-3-LIKE include viruses that employ a Gag protein, such as HIV, SIV, Ebola or functional homologs such as VP40 for Ebola.

[0110] The presence of a RING finger domain in PEM-3-LIKE suggested that it might be a ubiquitin protein ligase (E3) (Pickart, 2001). Three enzymes carry out covalent attachment of ubiquitin to target proteins: the ubiquitin-activating enzyme, El; a ubiquitin-conjugating enzyme, E2; and an E3. The E3 serves two roles: it specifically recognizes ubiquitination substrates and simultaneously recruits an E2. Ligation of ubiquitin is initiated by the formation of an isopeptide bond between the carboxyl terminus of ubiquitin and an ε-amino group of a lysine residue on the target protein. Additional ubiquitin molecules can then be ligated to the initial ubiquitin molecule to form a poly-ubiquitinated protein (Hershko and Ciechanover, 1998). In the absence of an external substrate, E3's can catalyze self-ubiquitination, that is, transfer activated ubiquitin to a lysine side chain in the E3 polypeptide itself. Similar to trans-ubiquitination, self-ubiquitination is also dependent on the action of El and an E2 (Lorick et al., 1999). PEM-3-LIKE polypeptide may also participate in neddylation. NEDD8, a member of ubiquitin-LIKE proteins, modifies proteins in a manner similar to ubiquitination. Neddylation involves the activity of an El, e.g., APP-BPl/Uba3, and an E2, e.g., UBC12.

[0111] While certain PEM-3-LIKE polypeptides function as ubiquitin ligases, PEM-3-LIKE proteins may also participate in diseases characterized by the accumulation of ubiquitinated proteins, such as dementias (e.g., Alzheimer's and Pick's), inclusion body myositis and myopathies, polyglucosan body myopathy, and certain forms of amyotrophic lateral sclerosis. Similarly, PEM-3-LIKE polypeptides may participate in diseases characterized by excessive or inappropriate ubiquitination and/or protein degradation.

[0112] The yeast two-hybrid assay (Fields and Song (1989) Nature 340:245-6; and Fields and Sternglanz (1994) Trends in Genetics 10:286-92) was used to identify direct interactions between PEM-3-LIKE polypeptides and polypeptides encoded by a library of human cDNAs. Nucleic acids encoding portions of PEM-3-LIKE polypeptide corresponding to SEQ ID NOS: 5, 6, 7, and 8 were cloned in frame with the DNA binding domain of GAL4 (the reporter gene) into plasmids that were transfected into yeast cells. A different yeast strain was transformed with plasmids containing vectors with various cDNAs from the human genome fused to the GAL4 activating domain. The two yeast strains were mated and successful crosses were tested for beta-galactosidase activity, which requires both the DNA binding and activation domains of GAL4 for transcriptional activation. While the two GAL4 domains are transcribed separately, beta-galactosidase expression thus requires that the polypeptides fused to the domains of GAL4 interact in order to bring the GAL4 DNA binding and activating domains into close proximity. GAL4 expression is therefore indicative of a direct interaction between the two polypeptides encoded by the cloned PEM-3-LIKE and human library cDNAs.

[0113] The PEM-3-LIKE cDNAs used to screen for interacting polypeptides correspond to portions of the full length PEM-3-LIKE protein and include cDNAs encoding amino acids 214-400, 1-230, 1-400, and 1-604, corresponding to SEQ ID NOS: 5-8. Human library cDNAs encoding polypeptides that interacted with PEM- 3-LIKE included SEQ ID NOS: 9, 10, 11, 12, 13, and 14. These cDNAs encode fragments of full length proteins that are sufficient for an interaction with a given fragment of PEM-3-LIKE polypeptide. SEQ ID NOS: 9, 10, and 11 correspond to the polypeptide p32, which is also known as CIqBP, gClq-R, p33, TAP, and HABPl. Approximately 50% of the positive yeast two-hybrid hits detected using cDNAs encoding amino acids 1-230, 1-400, and 1-604 of PEM-3-LIKE polypeptide correspond to p32. Thus the portion of PEM-3-LIKE required and sufficient for an interaction with p32 is contained within amino acids 1-230 (see Figure 21 for PEM- 3-LIKE protein). This PEM-3-LIKE fragment was also sufficient to detect an interaction with polypeptides encoded by cDNAs designated as SEQ ID NO 12 and SEQ ID NOS: 13 and 14 encoding fragments of FNBP3 polypeptide (SEQ ID NO 18) and PCBPl polypeptide (SEQ ID NO 20) respectively.

5. Isolation of a PEM-3-LIKE and p32 polypeptide complex [0114] In vitro verification of an interaction between PEM-3-LIKE and p32 showed that these two polypeptides indeed form a complex when full length recombinant proteins are expressed. Fluorescence Resonance Energy Transfer (FRET) using recombinant fusion PEM-3 -LIKE-FLAG polypeptide and recombinant fusion p32-HIS polypeptide (see Example 2) demonstrated an interaction between PEM-3-LIKE and p32 polypeptides. Furthermore, the level of complex formation increased with increasing concentrations of polypeptides. The interaction between PEM-3-LIKE and p32 polypeptides also occurs in cells. Complexes containing PEM-3-LIKE and p32 polypeptides were isolated by co- immunoprecipitation from HeLa cells transfected with plasmid vectors encoding fusion PEM-3-LIKE-V5 polypeptide and fusion HA-p32 polypeptide (see Example 3). The in vivo interaction between PEM-3-LIKE polypeptide and p32 polypeptide occurred with wildtype PEM-3-LIKE polypeptide as well as with a PEM-3-LIKE polypeptide with a mutant KH domain. Thus in one embodiment, the disclosure relates to the isolation of a complex comprising a PEM-3-LIKE polypeptide and a p32 polypeptide. This complex may be formed in vitro using individually purified PEM-3-LIKE and p32 polypeptides (as in Example 2) or be isolated from cells (as in Example 3). In addition, the complex may comprise any portion of PEM-3-LIKE polypeptide or any variant thereof. Likewise the complex may comprise any portion of p32 polypeptide and any variant thereof, including but not limited to different isoforms of p32 polypeptide and p32 polypeptides containing post-translational modifications such as, for example, phosphorylation and glycosylation. The complex may also comprise PEM-3-LIKE polypeptides and/or p32 polypeptides and any fragments or variants thereof that have been chemically or otherwise synthesized.

[0115] P32, which is also called complement component 1, q subcomponent binding protein (gClqBP or gC Iq-R), p33, TAP, or hyaluronic acid binding protein 1 (HABPl), is a multifunctional protein expressed in all compartments of the cell, including the mitochondria and extracellular surface. The amino acid sequence contains three consensus N-glycosylation sites (residues 114, 136, and 223), a protein kinase C phosphorylation site (residue 207), a tyrosine kinase recognition site (position 268), and a myristylation site (position 252) (Ghebrehiwet et al., Immunol. Rev. (2001) 180: 65-77). This multiligand protein forms a doughnut- shaped homotrimer (Jianzhong PNAS 1999 96:3572) and plays a role in inflammation and infection as well as tumorigenesis, RNA processing and transcription (Chattopadhyay et al., Nucleic Acids Research 2004 (32): 3632-3641; Ohrmalm and Akusjarvi 2006 J Virology (80): 5010-5020). P32 has been shown to interact with various plasma and microbial antigens; ligands of p32 include herpes simplex virus 1 Orf-P (Bruni and Roisman (1996) PNAS 93: 10423-10427), the adenovirus polypeptide V (Matthews and Russell, 1998), Epstein-Barr virus EBNA I protein (Wang et al. (1997) Virology 236: 18-29), hepatitis C vims core protein (Kittlesen et al., J Clin Invest 2000; 106; 1239-1249), rubella virus capsid (Beatch and Hobman, J. Virology 74, 2000: 5569-5576 and Mohan et al.(2002) Virus Res. 85: 151-161) and various plasma proteins including the complement component CIq (a protein that mediates immune effector functions (J Immunology 1997; 159; 1429)), HK/FII, vitronectin, thrombin, and fibrinogen (Ghebrehiwet and Peerschke Immunology 1998; 199: 225-238 and Ghebrehiwet et al., Immun. Rev. 180; 2001: 65-77). P32 also interacts with lamin B receptor (Simos and Georgatos, 1994), Oc_1B- adrenergic receptor (Xu et al., JBC 1999; 274; 21149-21154), protein kinase C μ (Storx et al., JBC 2000; 275; 24601-24607), and cClq-R/CR (calreticulin), the 60 kDa portion of C 1 q-R exhibiting specificity for the collagen domain of C 1 q. [0116] P32 also interacts with the human immunodeficiency virus (HIV) regulator of virion gene expression (Rev) (Luo at Ia. (1994) J Virol 68: 3850-3856 and Tange et al., JBC (1996) 271 :10066-10072) and HIV viral transactivator Tat (Yu et al. (1995) 69: 3017-3023; Berro et al. J Virology 2006 (7): 3189-3204) proteins. Rev transports the full-length unspliced 9-kp HIV transcript (encoding structural Gag (group-specific antigen) and enzymatic Pol (polymerase) polyprotein precursors) and the singly spliced 4-kb transcript (encoding Vif (viral infectivity factor), Vpr (viral protein) and Enc (envelope)) to the cytoplasm before further splicing (Pollard and Malim (1998) Annu. Rev. Microbiol. 52: 491-532). The interaction between p32 and HIV Rev was originally proposed to inhibit HIV pre-mRNA splicing, thus promoting transport of unprocessed HIV RNA (Tange et Ia., 1996); Zheng et al. later showed that indeed human p32, by inhibiting splicing factors, restores the effects of Rev and subsequent Gag synthesis and thereby increases the level of HIV viral genomic transcripts and the release of infectious progeny virions (Zheng et al. (2003) Nat. Cell Biol. 5: 611-618).

[0117] It has also been shown that P32 interacts with ASF/SF2 and SRp30c and plays a role in regulating cellular RΝA splicing (Petersen-Marht et al. EMBO J. (1999) 18: 1014-1024). ASF/SF2 and SRp30c are members of the SR family of splicing factors, which stimulate constitutive splicing and can either positively or negatively regulate alternative RΝA splicing. P32 can block ASF/SF2 protein interaction with RΝA, thereby inactivating ASF/SF2 enhancer and repressor activities and altering splice site usage. P32 also acts as an antagonist to ASF/SF2 by blocking ASF/SF2 phosphorylation, which regulates ASF/SF2 subcellular localization and is required for ASF/SF2 protein-protein interactions during spliceosome assembly. The interaction of p32 with SRp30c, however, does not elicit such antagonistic effects.

[0118] In addition to its role in immunity and RΝA processing, p32 is implicated in cellular signaling events and transformation. P32 is a substrate of the mitogen activated kinase ERK and was shown to undergo ERK-dependent translocation from the cytoplasm to the nucleus (Majumdar et al. Biochem Biophys Res Commun (2002) 291: 829-837). In addition, P32 interacts with one of the major components of the extracellular matrix, hyalouronan (HA), which promotes anchorage independent cell-proliferation when expressed at high levels (Laurent et al, Ann Med (1996) 28: 241-253). The levels of p32 in mouse epithelial carcinoma were shown to accumulate in proliferating compact metastatic islands while the surrounding tissue exhibited decreased p32 (Ghosh et al. MoI Cell Biochem (2004) 267: 133-139). The changes in p32 levels that occur during tumor progression and metastasis may disrupt tissue organization and promote invasion. In accordance with this hypothesis, recent data has demonstrated marked differential expression of p32 in thyroid, colon, pancreatic, gastric, esophageal and lung adenocarcinomas compared to their nonmalignant histological counterparts (Rubenstein et al., Int J Cancer (2004) 110: 741-750).

[0119] The novel finding that PEM-3-LIKE and p32 proteins interact both in vitro and in vivo raises the possibility that these two proteins are involved in a common pathway(s) and participate, and perhaps cooperate, in shared cellular functions and/or disease states. For example, both of these proteins are implicated in viral maturation and viral infectivity. Importantly, the roles of these two proteins in viral disorders have been independently discovered. Therefore the novel interaction described herein between PEM-3-LIKE and p32 polypeptides suggests that the functions of these proteins may intersect at a common point, or that these proteins may cooperate or act by a common pathway in promoting viral infectivity. In addition, although PEM-3-LIKE has thus far been studied in the context of ubiquitin ligase function, its interaction with p32 raises the question as to which cellular functions, in addition to viral disorders, that involve p32 (e.g., RNA splicing regulation, tumorigenesis, etc.) also involve PEM-3-LIKE. Likewise, p32 may be involved in as yet un-prescribed functions of PEM-3-LIKE. In the context of viral disorders as well as other possible functions and activities of PEM-3-LIKE, the association of p32 with PEM-3-LIKE may serve a regulatory role, such as the inhibition or enhancement of activity, or the regulation of subcellular localization, for the latter protein. Conversely, the association of PEM-3-LIKE with p32 may serve to regulate activity, localization, and/or transport of p32.

6. Identification of a PEM-3-LIKE and FNBP3 polypeptide complex [0120] In another embodiment, the invention relates to the isolation of a complex comprising PEM-3-LIKE polypeptide and FNBP3 polypeptide. The complex may comprise any portion of PEM-3-LIKE polypeptide or any variant thereof. Likewise the complex may comprise any portion of FNBP3 polypeptide or any variant thereof, including but not limited to different FNBP3 polypeptide isoforms and FNBP3 polypeptides with post-translational modifications. The PEM-3-LIKE and FNBP3 polypeptide complex may be formed from individually purified polypeptides or be isolated from cells. The complex may also comprise PEM-3-LIKE polypeptides and/or FNBP3 polypeptides and any fragments or variants thereof that have been chemically or otherwise synthesized.

[0121] FNBP3 is a spliceosome protein. The FNBP3 gene (also known as HYPA (Huntingtin yeast partner A/FBP-11, Fas-ligand associated factor 1, and NY- REN-6 antigen) encodes two different isoforms due to alternative splicing. The two FNBP3 isoforms differ in regard to a 126-bp region in the 3 '-part of exon 1; isoform 2 (without the 126-bp region) is the major transcript (Katoh and Katoh, Int J MoI Med 2003 12: 651-656). The FNBP3 protein contains two WW domains (a domain found in a subclass of formin-binding proteins), two FF domains (a phosphopeptide- binding module), and two bipartite nuclear localization signals. The WW and FF protein interaction modules bind to splicing factors to form a pre-spliceosome complex (Lin et al., MoI Cell Biol. 2000; 24: 9176-9185). The WW domain of FNBP3 is important for several protein-protein interactions, including binding to the morphogenic protein formin (Bedford et al., EMBO J. 1997; 16: 2376-2383) and Neural Wiskott-Aldrich syndrome protein (N-WASP) — a protein involved in cortical actin cytoskeleton reorganization. FNBP3 was shown to inhibit translocation of N-WASP from the nucleus to the cytoplasm, thus negatively regulating the function of N-WASP in the cytoplasm (Mizutani et al., Biochem. Biophys. Res. Common. 2004; 313: 468-474). FNBP3, through its WW domain, also binds to Huntingtin, a protein important in the etiology of Huntington's disease, and may be involved in Huntington pathogenesis (Faber et al., Hum MoI Genet. 1998; 7: 1463-1474 and Passani et al., Hum MoI Genet. 2000: 9: 2175-2182). [0122] FNBP3 has heretofore been associated with certain disease states, such as Huntington's disease, but has not been associated with viral disorders. Thus the present disclosure, by demonstrating an interaction between PEM-3-LIKE polypeptide — a protein with previously demonstrated roles in viral disorders — and FNBP3, implicates the latter protein in additional functions that may include viral disorders. Similarly, PEM-3-LIKE activities may be involved in disorders and disease states involving FNBP3, including but not limited to Huntington's disease.

7. Identification of a PEM-3-LIKE and PCBPl polypeptide complex [0123] In another embodiment, the invention relates to the isolation of a complex comprising a PEM-3-LIKE polypeptide and a PCBPl polypeptide. The complex may comprise any portion of PEM-3-LIKE polypeptide or any variant thereof. Likewise the complex may comprise any portion of PCBPl polypeptide and any variant thereof, including but not limited to different isoforms of PCBPl polypeptide and PCBPl polypeptides containing post-translational modifications such as, for example, phosphorylation and glycosylation. This complex may be formed in vitro or be purified from cells. The complex may also comprise PEM-3-LIKE polypeptides and/or PCBPl polypeptides and any fragments and variants thereof that have been chemically or otherwise synthesized.

[0124] This third protein presently shown to interact with PEM-3-LIKE is the RNA-binding protein poly r(C) binding protein 1 (PCBPl), which is also referred to as hnRNP El or αCPl. PCBPl contains three RNA-binding K homologous (KH) domains, each capable of independently binding RNA. This protein, along with a closely related protein PCBP2, interacts with cellular mRNAs and can participate in the post-transcriptional regulation of endogenous RNAs by imparting mRNA stability and by translational control (Ostareck-Lederer et al., 1998; Trends Biochem. Sci. 23: 409-411). In addition, PCBPl is required for poliovirus translation initiation (Andino et al., 1999 Trends Microbiol. 76:76-82) and may be important in the positive and/or negative translational regulation of other viral RNAs including hepatitis A virus and human papilloma virus type 16. PCBPl can facilitate translation initiation of both viral and cellular RNAs by binding the internal ribosome entry segment (IRES) of the RNAs. For example, PCBPl binds to the IRES of both human Bag-1 (Bcl-2 associated anthanogene) (Pickering et al., 2003, NAR, 31: 639-646) and c-myc (Evans et al., Oncogene 2003; 22: 8012-8020), thereby stimulating translation initiation of these mRNAs by internal ribosome entry.

8. Identification of agents that modulate PEM-3-LIKE polypeptide associations

[0125] In one aspect, the disclosure relates to a method of using novel PEM-3- LIKE polypeptide interactions to identify agents that modulate these interactions. The testing and identification of agents that interfere with, inhibit, and/or prevent, or conversely agents that enhance, promote or otherwise facilitate, the PEM-3-LIKE protein associations with the PEM-3-LIKE interacting polypeptides described herein requires the isolation of PEM-3 -LIK-E complexes and/or the formation of PEM-3- LIKE complexes in vitro using purified polypeptides (see Example 4). For example, agents may be screened in vitro by the addition of an agent to a pre-formed PEM-3-LIKE polypeptide complex. Agents that disrupt the association would be identified as potential inhibitors. To identify agents that prevent PEM-3-LIKE complex formation, the test agent could be added to a mixture of individually purified or isolated PEM-3-LIKE and PEM-3-LIKE interacting polypeptides and the level and rate of complex formation can be measured. The latter assay can also be used to identify agents that promote or enhance PEM-3-LIKE polypeptide complex formation.

[0126] In another aspect, isolated complexes comprising PEM-3-LIKE polypeptide and a PEM-3-LIKE interacting polypeptide may be used to screen for agents that modulate complex formation in cells. Agents may be tested for in vivo effects by treating cells or organisms (including single-celled organisms and transgenic animals) expressing PEM-3-LIKE protein (or PEM-3-LIKE fusion protein) and the PEM-3-LIKE interacting protein (or a PEM-3-LIKE interacting fusion protein) with a test agent and isolating PEM-3-LIKE polypeptide complexes. The amount of PEM-3-LIKE polypeptide complexes isolated from control cells or organisms that did not receive the test agent would be compared to the amount of complex isolated from cells or organisms treated with the agent. The ability to isolate complexes from cells or organisms that received the test agent and the comparative level of isolated complex from these cells or organisms would identify those agents that may modulate PEM-3-LIKE interactions in vivo. The screening of agents therefore requires the isolated and/or purified PEM-3-LIKE and PEM-3- LIKE interacting polypeptide complex or the isolation of this complex from cells or organisms; the complex and the determination of any changes in complex formation are required to identify those test agents that elicit such changes. An agent as described herein includes but is not limited to small molecules, single- or double- strand RNA and/or DNA, monoclonal and/or polyclonal antibodies, chemicals, metals, and metallorganic and inorganic molecules.

9. Effects of modulating PEM-3-LIKE interactions

[0127] In one aspect, this disclosure relates to the use and/or modulation of novel PEM-3-LIKE polypeptide interactions. Through the use of isolated or purified PEM-3-LIKE complexes, agents that either inhibit or enhance complex formation can be identified as described above. While PEM-3-LIKE polypeptide and its interactors discovered herein participate in a multitude of cellular functions and serve many different roles in cellular metabolism, including functions and roles in disease states, modulation of the interactions between PEM-3-LIKE polypeptide and the PEM-3-LIKE polypeptide interactors is expected to elicit many effects, including but not limited to the amelioration of viral disorders and/or other disease states. Thus in one embodiment, the disclosure relates to the effects of modulating the novel interactions between PEM-3-LIKE polypeptides and the PEM-3-LIKE interacting polypeptides described herein, as such effects attributed to the modulation of PEM-3-LIKE interactions are identified by testing the level and/or rate at which PEM-3-LIKE interactions occur. Such tests require the isolation and/or purification of PEM-3-LIKE polypeptide complexes and are therefore within the scope of the invention.

[0128] As mentioned above, PEM-3-LIKE polypeptide contains KH domains, which are domains that bind to single-stranded RNA. In addition, the newly discovered PEM-3-LIKE interactors each play a role in RNA metabolism; specifically p32 and PCBPl are involved in viral RNA metabolism and/or the translation of viral transcripts. Taken together, these findings suggest that PEM-3- LIKE polypeptide, in addition to its role as a ubiquitin ligase, may play an important role in RNA processing and/or translation, and perhaps in the processing of viral RNA. Accordingly PEM-3-LIKE polypeptide may affect viral maturation by an activity involved in RNA metabolism. Such an activity of PEM-3-LIKE is further supported by its direct interaction with p32, which binds to HIV Rev and is involved in the regulation of mammalian cell splicing and the inhibition of viral splicing. Thus modulation of the PEM-3-LIKE/p32 polypeptide complex may produce desirable effects such as, for example, an inhibition of viral infectivity. Such an outcome from PEM-3-LIKE/p32 complex modulation would be consistent with findings that overexpression of p32 enhances the viral infectivity of rubella virus (Mohan et al. Virus Research (2002) 85: 151-161) and that the p32-binding site of capsid is important for virus replication (Beatch et al. J Virology (2005) 79: 10807- 10820). Modulation of the other PEM-3-LIKE complexes described herein may also elicit desirable antiviral effects or serve to abrogate or suppress disease states.

10. Methods and compositions for inhibiting viral infections

[0129] Fully satisfactory treatments for Human Immunodeficiency Virus (HIV) have not yet been discovered. Mixtures of agents that target the reverse transcriptase and the protease have proven to be highly effective. However, patients are forced to self-administer a large number of medications on a tightly regulated schedule. Failure to follow the prescribed regimen results in rapid generation of drug-resistant HIV mutants. Antiviral agents taken individually are ineffective, largely because of the rapid rate at which the infecting virus population becomes resistant. For this reason, single and multiple drug therapies are often denied to patients that seem unlikely to be able to follow the required dosing schedule. In addition, many protease inhibitors are expensive to manufacture and are not widely available in regions where HIV is rampant, including sub-Saharan Africa and South- East Asia.

[0130] In certain embodiments, the disclosure relates to the discovery that decreasing the levels of PEM-3-LIKE or p32 results in a reduction of the levels of HIV Gag protein; the present disclosure demonstrates that a reduction in PEM-3- LIKE or p32 leads to a subsequent reduction in Gag protein levels. The Gag protein is an essential structural polyprotein required for virus assembly in the retroviral life cycle; in the absence of other viral proteins, Gag proteins are sufficient for the assembly of virus-like particles (Freed 1998 Virology 251: 1-15). The viral protease cleaves Gag into the mature Gag proteins (matrix, capsid, and nucleocapsid proteins) during or shortly after budding from the host cell. For HIV-I, the protease cleaves the HIV-I Gag protein, Pr55^Gag, into pi 7 matrix, p24 capsid, p7 nucleocapsid, and p6; mature Gag proteins rearrange to form infectious virions under a process referred to as maturation (Freed supra). The average immature HIV particle contains approximately 5,000 copies of Gag, which is then processed to form the mature HIV particle (Briggs et al. Nat Struct MoI Biol 2004 (11): 672-675). As Gag proteins are essential in forming mature and infectious virions in the retroviral life cycle, the present disclosure, by demonstrating that a reduction in PEM-3-LIKE or p32 results in a decrease in Gag protein levels, provides a novel approach for inhibiting retroviral infections. Accordingly, the disclosure provides compositions for decreasing the level of PEM-3-LIKE or p32 mRNA and/or protein levels in cells and for inhibiting the function or activity of PEM-3-LIKE or p32. A reduction in PEM-3-LIKE and/or p32 expression or an inhibition of PEM-3-LIKE and/or p32 activity is useful as a therapeutic strategy to treat or inhibit viral infections, including HIV infection.

[0131] The present disclosure provides novel agents for the treatment of HIV and other lentiviral infections. In certain embodiments, therapeutics of the invention function by disrupting the biological activity of a PEM-3-LIKE polypeptide or a function of a PEM-3-LIKE -related process. Additionally or alternatively, therapeutics of the invention function by disrupting or inhibiting the biological activity of a p32 polypeptide or a function of a p32-related process. [0132] Exemplary therapeutics of the invention include nucleic acid therapies such as, for example, RNAi constructs, antisense oligonucleotides, ribozyme, and DNA enzymes. Other therapeutics of the present invention include polypeptides, peptidomimetics, antibodies and small molecules.

11. Exemplary PEM-3-LIKE and p32 antagonists

PEM-3-LIKE antagonists [0133] In certain respects the disclosure relates to PEM-3-LIKE antagonists. Antagonists of PEM-3-LIKE, or agents that inhibit or reduce the expression, function, or activity of a PEM-3-LIKE polypeptide, are useful as antiviral agents, such as in the treatment of lentiviruses, including retroviral infections (e.g., HIV infection). Antagonists of PEM-3-LIKE include, among other agents, polypeptides, antibody and antigen-binding fragments, small molecules, aptamers, ribozymes, and chemicals. In certain embodiments, modulation of PEM-3-LIKE mRNA and/or protein levels is used to manipulate PEM-3-LIKE function. Accordingly, the invention provides nucleic acid therapies (e.g., antisense, RNAi, etc.) for manipulating PEM-3-LIKE mRNA and/or protein levels. In one embodiment, the invention provides a nucleic acid (e.g., a ribonucleic acid or a molecule comprising both RNA and DNA) comprising between 5 and 1000 consecutive nucleotides of a nucleic acid sequence that is at least 90%, 95%, 98%, 99% or optionally 100% identical to a sequence of SEQ ID NOS: 1, 3, 22, 24 or a complement thereof. Optionally the nucleic acid comprises at least 10, 15, 20, 25, or 30 consecutive nucleotides, and no more than 1000, 750, 500 and 250 consecutive nucleotides of a PEM-3-LIKE nucleic acid or a complement thereto. In certain embodiments the nucleic acid is an RNAi oligomer or a ribozyme. In one embodiment, the nucleic acid decreases the level of a PEM-3-LIKE mRNA and/or protein. Exemplary nucleic acids comprise a sequence selected from any of SEQ ID NOS: 271-292. Altering the levels of PEM-3-LIKE are useful in the treatment of viral infections. For example, down-regulation of PEM-3-LIKE expression by various agents (e.g., agents that mediate RNA interference) may be used as a treatment for HIV infection.

p32 antagonists

[0134] Other aspects of the invention relate to the finding that a reduction in p32 also results in a subsequent reduction in viral Gag. Accordingly, in certain aspects the disclosure relates to p32 antagonists. Antagonists of p32, or agents that inhibit or reduce the expression, function, or activity of a p32 polypeptide, are useful as antiviral agents, such as in the treatment of lentiviruses, including retroviral infections (e.g., HIV infection). Antagonists of p32 include, among other agents, polypeptides, antibody and antigen-binding fragments, small molecules, aptamers, DNA enzymes, ribozymes, and chemicals. In certain embodiments, modulation of p32 mRNA and/or protein levels is used to manipulate p32 function. Accordingly, the invention provides nucleic acid therapies (e.g., antisense, RJNAi, etc.) for manipulating p32 mRNA and/or protein levels. In one embodiment, the invention provides a nucleic acid comprising between 5 and 1000 consecutive nucleotides of a nucleic acid sequence that is at least 90%, 95%, 98%, 99% or optionally 100% identical to a sequence of SEQ ID NO: 15 or a complement thereof. Optionally the nucleic acid comprises at least 10, 15, 20, 25, or 30 consecutive nucleotides, and no more than 1000, 750, 500 and 250 consecutive nucleotides of a p32 nucleic acid or a complement thereto. In certain embodiments the nucleic acid is an RNAi oligomer or a ribozyme. In one embodiment, the nucleic acid decreases the level of a p32 mRNA and/or protein. Exemplary nucleic acids comprise a sequence selected from any of SEQ ID NOS: 27-30. Additional exemplary nucleic acids are set forth in SEQ ID NOS: 153-270. Altering the levels of p32 is useful in the treatment of viral infections. For example, down-regulation of p32 expression by various agents (e.g., agents that mediate RNA interference) may be used as a treatment of HIV infection. [0135] Screening methods may be used to identify and select agents that inhibit PEM-3-LIKE or p32 biological activity. Nucleic acid molecules, for example, can be isolated from random-sequence libraries by in vitro selection. As another example, assays similar to the assay provided in the Examples, wherein inhibition or reduction of PEM-3-LIKE or p32 activity results in a measurable decrease in viral protein levels, may identify agents that inhibit PEM-3-LIKE and/or p32 function and that are therefore useful as an antiviral therapy. Alternatively, viral replication or infectivity assays, as are known in the art, may be useful for screening agents. [0136] In view of the aforementioned activities of PEM-3-LIKE and the interaction of PEM-3-LIKE with p32, it is envisioned that p32 antagonists may act as antiviral agents, at least in part, by disrupting an association or interaction between PEM-3-LIKE and p32. The disruption of PEM-3-LIKE:ρ32 interactions may contribute to the antiviral activity of p32 antagonists alone or in conjunction with the disruption or inhibition of other activities that result from p32 antagonism. Polypeptide antagonists

[0137] Polypeptide inhibitory agents of the present invention include, for example, mutant PEM-3-LIKE or p32 polypeptides. A mutant polypeptide may exhibit a dominant negative effect, or may compete with the non-mutant polypeptide for binding to PEM-3-LIKE or p32 binding partners (which may include other proteins, RNA, etc.).

[0138] An exemplary mutant p32 polypeptide is a p32 polypeptide carrying a mutation at residue GIy 35 (Zheng et al. 2003 Nat Struct Biol 5: 611-618). Polypeptide p32 inhibitors also include p32 mutants that are fragments of the full- length p32 polypeptide and that therefore lack certain functionalities required for p32 biological activity but that may still compete with full-length p32 for binding partners. Therapeutic polypeptides may therefore be generated by designing polypeptides to mimic certain protein domains or fragments important in p32 activity.

[0139] In alternative embodiments of the present invention, polypeptide inhibitors of PEM-3-LIKE or p32 may bind to a PEM-3-LIKE or p32 polypeptide, occupying sites required for polypeptide activity and/or altering the conformation of the polypeptidie, thereby preventing it from functioning normally. There are many well known methods for obtaining mutants or polypeptides with a desired activity. [0140] Methods for generating large pools of mutant proteins are well known in the art. In one embodiment, the invention contemplates using mutant PEM-3-LIKE or p32 polypeptides generated by combinatorial mutagenesis. Such methods, as are known in the art, are convenient for generating both point and truncation mutants, and can be especially useful for identifying potential variant sequences (e.g., homologs) that are functional in binding to binding partner for PEM-3-LIKE or p32 proteins. The purpose of screening such combinatorial libraries is to generate, for example, novel PEM-3-LIKE or p32 homologs that can act as antagonists. To illustrate, p32 homologs can be generated by the present combinatorial approach to act as antagonists, in that they are able to mimic, for example, binding to other proteins or cellular molecules (such as p32 binding partners, RNA, etc.), yet not induce any biological response, thereby inhibiting the action of authentic p32. [0141] To further illustrate the state of the art of combinatorial mutagenesis, it is noted that the review article of Gallop et al. (1994) J Med Chem 37:1233 describes the general state of the art of combinatorial libraries as of the earlier 1990's. In particular, Gallop et al. state at page 1239 "[sjcreening the analog libraries aids in determining the minimum size of the active sequence and in identifying those residues critical for binding and intolerant of substitution". In addition, the Ladner et al. PCT publication WO90/02809, the Goeddel et al. U.S. Patent 5,223,408, and the Markland et al. PCT publication WO92/15679 illustrate specific techniques which one skilled in the art could utilize to generate libraries of PEM-3-LIKE or p32 variants which can be rapidly screened to identify variants/fragments which retained a particular activity of the native polypeptides. These techniques are exemplary of the art and demonstrate that large libraries of related variants/truncants can be generated and assayed to isolate particular variants without undue experimentation. Gustin et al. (1993) Virology 193:653, and Bass et al. (1990) Proteins: Structure, Function and Genetics 8:309-314 also describe other exemplary techniques from the art which can be adapted as means for generating mutagenic variants of PEM-3- LIKE or p32 polypeptides.

[0142] It is plain from the combinatorial mutagenesis art that large scale mutagenesis of PEM-3-LIKE or p32 proteins, without any preconceived ideas of which residues are critical to the biological function, can generate wide arrays of variants. Indeed, it is the ability of combinatorial techniques to screen billions of different variants by high throughout analysis that removes any requirement of a priori understanding or knowledge of critical residues.

Antibody antagonists

[0143] It is anticipated that antibodies can act as antagonists. Accordingly, in additional embodiments, the present invention relates to antibodies and antigen- binding fragments that specifically bind to PEM-3-LIKE and inhibit PEM-3-LIKE function. Additionally, the present invention relates to antibodies and antigen- binding fragments that specifically bind to p32 and inhibit p32 function. Antibodies and antigen-binding fragments include Fv, scFv, Fab', and F(ab')₂, as well as murine, chimeric, humanized, and fully human antibodies and antigen-binding fragments. It is well within the purview of the skilled artisan to generate and screen antibodies and antigen-binding fragments that specifically bind to PME-3-LIKE and inhibit PEM-3-LIKE activity, or that alternatively bind p32 and inhibit p32 activity, Antibodies with PEM-3-LIKE or p32 antagonist activity can be identified in much the same way as other PEM-3-LIKE or p32 antagonists. For example, candidate antibodies can be administered to cells infected with a virus, and antibodies that cause a decrease in production of viral proteins or viral infectivity are antagonists. [0144] In one variation, antibodies of the invention can be single chain antibodies (scFv), comprising variable antigen binding domains linked by a polypeptide linker. Single chain antibodies are expressed as a single polypeptide chain and can be expressed in bacteria and as part of a phage display library. In this way, phage that express the appropriate scFv will have p32 antagonist activity, for example. The nucleic acid encoding the single chain antibody can then be recovered from the phage and used to produce large quantities of the scFv. Construction and screening of scFv libraries is extensively described in various publications (U.S. Patents 5,258,498; 5,482,858; 5,091,513; 4,946,778; 5,969,108; 5,871,907; 5,223,409; 5,225,539).

Chemical and small molecule antagonists

[0145] The invention further contemplates inhibitors of PEM-3-LIKE or p32 polypeptides that are chemicals or small molecules. Chemical and small molecule libraries may be screened to identify PEM-3-LIKE or p32 inhibitory agents. For example, a person may acquire, from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to identify useful compounds by "brute force." Screening of such libraries, including combinatorially generated libraries, is a rapid and efficient way to screen a large number of related (and unrelated) compounds for activity.

[0146] Any of the forgoing exemplary PEM-3-LIKE or p32 antagonists may be screened to select those agents with a particular desired effect. Small molecules of the invention may be identified for their ability to inhibit PEM-3-LIKE or p32 activity. Such methods of screening and selecting compounds are well-known in the art. Levels of the protein Gag, for example, can be measured in order to determine the ability of a particular chemical or small molecule antagonist to inhibit the activity of PEM-3-LIKE and/or p32 in viral-infected cells.

Nucleic acid antagonists: Antisense, ribozyme and triplex techniques [0147] In certain respects the invention relates to the use of an isolated nucleic acid in "antisense" therapy. As used herein, "antisense" therapy refers to administration or in situ generation of oligonucleotide molecules or their derivatives which specifically hybridize (e.g., bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding a polypeptide so as to inhibit expression of the polypeptide, e.g., by inhibiting transcription and/or translation. The binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix. In general, "antisense" therapy refers to the range of techniques generally employed in the art, and includes any therapy that relies on specific binding to oligonucleotide sequences. Accordingly, the present invention relates to antisense therapy to inhibit expression of PEM-3-LIKE, p32, or expression of any of the other interactors described herein.

[0148] An antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a PEM-3-LIKE, or alternatively a p32, polypeptide. Alternatively, the antisense construct is an oligonucleotide probe that is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a PEM-3-LIKE or p32 gene. Such oligonucleotide probes are preferably modified oligonucleotides that are resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, and are therefore stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) BioTechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659- 2668. With respect to antisense DNA, oligodeoxyribonucleotides derived from the translation initiation site, e.g., between the -10 and +10 regions of a PEM-3-LIKE or p32 gene nucleotide sequence of interest, are preferred.

[0149] Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to mRNA encoding a PEM-3-LIKE or p32 polypeptide. The antisense oligonucleotides will bind to the mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required. In the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). A person skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

[0150] Oligonucleotides that are complementary to the 5' end of the mRNA, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. (Wagner, R. 1994. Nature 372:333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non- coding regions of a gene could be used in an antisense approach to inhibit translation of that mRNA. Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could also be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or coding region of mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably less that about 100 and more preferably less than about 50, 25, 17 or 10 nucleotides in length. [0151] Regardless of the choice of target sequence, it is preferred that in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide. It is preferred that the control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.

[0152] The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553- 6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. W088/09810, published December 15, 1988) or the blood- brain barrier (see, e.g., PCT Publication No. W089/10134, published April 25, 1988), hybridization- triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958- 976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

[0153] The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5- (carboxyhydroxytriethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5- carboxymethylaminornethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3- methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, S'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio- N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-tliiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- methyluracil, uracil-5- oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5- methyl-2-thiouracil, 3-(3-amino-3- N-2-carboxypropyl) uracil, (acp3)w, and 2,6- diaminopurine.

[0154] The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2- fluoroarabinose, xylulose, and hexose.

[0155] The antisense oligonucleotide can also contain a neutral peptide-like backbone. Such molecules are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:14670 and in Eglom et al. (1993) Nature 365:566. One advantage of PNA oligomers is their capability to bind to complementary DNA essentially independently from the ionic strength of the medium due to the neutral backbone of the DNA. In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.

[0156] In yet a further embodiment, the antisense oligonucleotide is an -anomeric oligonucleotide. An -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).

[0157] Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.

[0158] While antisense nucleotides complementary to the coding region of an mRNA sequence can be used, in certain embodiments antisense nucleotides complementary to the transcribed untranslated region and to the region comprising the initiating methionine are used.

[0159] The antisense molecules can be delivered to cells that are infected with a retrovirus. A number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into tissue, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically. [0160] In certain instances, however, it may be difficult to achieve intracellular concentrations of the antisense sufficient to suppress translation on endogenous mRNAs. Therefore an alternative approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter. The use of such a construct to transfect target cells in a patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous p32 transcripts and thereby prevent translation. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA. Such a vector can remain episomal or become chromosonially integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al, 1982, Nature 296:39-42), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systematically).

[0161] Ribozyme molecules designed to catalytically cleave PEM-3-LIKE or p32 mRNA transcripts can also be used to prevent translation of mRNA (see, e.g., PCT International Publication WO90/11364, published October 4, 1990; Sarver et al., 1990, Science 247:1222-1225 and U.S. Patent No. 5,093,246). While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591. [0162] The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231 :470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207- 216). The Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes that target eight base-pair active site sequences.

[0163] As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.). A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.

[0164] Alternatively, endogenous PEM-3-LIKE or p32 gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the gene (i.e., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body. (See generally, Helene, C. 1991, Anticancer Drug Des., 6(6):569-84; Helene, C₅ et al., 1992, Ann. N. Y. Acad. Sci., 660:27-36; and Maher, L. J., 1992, Bioassays 14(12):807-15).

[0165] Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides. The base composition of these oligonucleotides should promote triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules may be chosen that are purine- rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.

[0166] Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a so-called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex. [0167] Antisense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.

[0168] Moreover, various well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone. [0169] In general, it is anticipated that methods decreasing the presence or translation of PEM-3-LIKE mRNA will act as PEM-3-LIKE antagonists. In certain embodiments, the subject antagonists can be chosen on the basis of their selectively for PEM-3-LIKE. This selectivity can be tested using gene reporter assays, for example.

[0170] In certain embodiments, the subject antagonists inhibit PEM-3-LIKE expression by at least 2-fold relative to the endogenous PEM-3-LIKE expression levels of a particular cell type. In other embodiments, the PEM-3-LIKE antagonists decrease expression of a PEM-3-LIKE polypeptide by 3 -fold, 5 -fold, and in certain embodiments by 10-fold. In other embodiments, a PEM-3-LIKE antagonist results in no measurable or detectable levels of a PEM-3-LIKE polypeptide or of a PEM-3- LIKE transcript. In certain systems, the activity of a PEM-3-LIKE antagonist may be demonstrated by examining the levels of a PEM-3-LIKE polypeptide in a cell engineered to express exogenous PEM-3-LIKE (for example, PEM-3-LIKE expressed from an expression vector transfected into cells). [0171] Similarly, methods that decrease the presence or translation of p32 will act as p32 antagonists. In certain embodiments, the subject antagonists inhibit p32 expression by at least 2-fold relative to the endogenous p32 expression levels of a particular cell type. In other embodiments, the p32 antagonists decrease expression of a p32 polypeptide by 3-fold, 5-fold, and in certain embodiments by 10-fold. In other embodiments, a p32 antagonist results in no measurable or detectable levels of a p32 polypeptide or of a p32 transcript. In certain systems, the activity of a p32 antagonist may be demonstrated by examining the levels of a p32 polypeptide in a cell engineered to express exogenous p32 (for example, p32 expressed from an expression vector transfected into cells).

Exemplary nucleic acid antagonists that mediate RNAi

[0172] In certain embodiments of the present invention, PEM-3-LIKE or p32 mRNA or protein levels are modulated in order to inhibit PEM-3-LIKE and/or p32 function. Various compositions for modulating mRNA or protein levels may be used as discussed above. These compositions include, for example, nucleic acid molecules (e.g., antisense molecules, siRNA molecules, etc.). Accordingly, in certain embodiments, the present invention relates to a nucleic acid molecule that specifically hybridizes to a PEM-3-LIKE nucleic acid, thereby preventing transcription, translation, or processing of the PEM-3-LIKE nucleic acid. Alternatively, in certain embodiments, the present invention relates to a nucleic acid molecule that specifically hybridizes to a p32 nucleic acid, thereby preventing transcription, translation, or processing of the p32 nucleic acid. In a particular embodiment, the nucleic acid molecule comprises ribonucleic acids and mediates RNA interference of a p32 mRNA or transcript. A nucleic acid molecule that mediates RNA intereference of PEM-3-LIKE or p32 may comprise a RNA:DNA hybrid duplex or may comprise RNA but not DNA. Likewise, the molecule may comprise sequences that are RNA:DNA chimeric mixtures. The duplex may be formed by the hybridization of two individual nucleic acid molecules. Alternatively, the nucleic acid molecule may be a duplex formed by the self-hybridization of a single RNA molecule that forms a hairpin or stem-loop structure. The RNA molecule may be approximately 100-300, 200, or 100 or less nucleotides long, forming a hairpin duplex that is approximately 50-150, 100, or 50 or less base pairs long (taking into account bases forming the loop structure). In particular embodiments, the nucleic acid molecule that mediates RNA interference of a PEM- 3 -LIKE or p32 niRNA or transcript is 30 or less base pairs long. In certain embodiments, the nucleic acid molecule is 19, 20, or 21 base pairs long. [0173] RNAi constructs comprise double stranded RNA that can specifically block expression of a target gene. Accordingly, RNAi constructs can act as antagonists by specifically blocking expression of a particular gene. "RNA interference" or "RNAi" is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post- transcriptional manner. Without being bound by theory, RNAi appears to involve mRNA degradation; however, the biochemical mechanisms are currently an active area of research. Despite some uncertainty regarding the mechanism of action, RNAi provides a useful method of inhibiting gene expression in vitro or in vivo. [0174] As used herein, the phrase "mediates RNAi" refers to (indicates) the ability to distinguish which RNAs are to be degraded by the RNAi process, e.g., degradation occurs in a sequence-specific manner rather than by a sequence- independent dsRNA response, e.g., a PKR response.

[0175] As used herein, the term "RNAi construct" is a generic term used throughout the specification to include small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs. RNAi constructs herein also include expression vectors (also referred to as RNAi expression vectors) capable of giving rise to transcripts which form dsRNAs or hairpin RNAs in cells, and/or transcripts which can produce siRNAs in vivo. [0176] An RNAi expression vector refers to replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed. Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences. The choice of promoter and other regulatory elements generally varies according to the intended host cell.

[0177] Regulatory sequences are art-recognized and are selected to direct expression of the nucleic acid. Accordingly, the term regulatory sequence includes promoters, enhancers and other expression control elements. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express sequences that hybridize to a p32 nucleotide sequence. Such useful expression control sequences, include, for example, the early and late promoters of SV40, tet promoter, adenovirus or cytomegalovirus immediate early promoter^ the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast α-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.

[0178] The RNAi constructs contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (i.e., the "target" gene). The double-stranded RNA need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi. Thus, the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence. The number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3' end of the siRNA strand that is complementary to the target RNA does not significantly contribute to specificity of the target recognition.

[0179] Sequence identity between the siRNA construct and the target sequence may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 niM PIPES pH 6.4, 1 mM EDTA, 50 ⁰C or 70 ⁰C hybridization for 12-16 hours; followed by washing).

[0180] Production of RNAi constructs can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro. The RNAi constructs may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties. For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA. Likewise, bases may be modified to block the activity of adenosine deaminase. The RNAi construct may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.

[0181] Methods of chemically modifying RNA molecules can be adapted for modifying RNAi constructs (see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) JM?/ Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61). Merely to illustrate, the backbone of an RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2 '-substituted ribonucleosides, a- configuration). In certain cases, the dsRNAs of the disclosure lack 2'-hydroxy (2'- OH) containing nucleotides.

[0182] The double-stranded structure may be formed by a single self- complementary RNA strand or by two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell. The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.

[0183] In certain embodiments, the subject RNAi constructs are "small interfering RNAs" or "siRNAs." These nucleic acids are around 19-30 nucleotides in length, and even more preferably 21-23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease "dicing" of longer double-stranded RNAs. The siRNA are double stranded, and may include short overhangs at each end. Preferably, the overhangs are 1-6 nucleotides in length at the 3' end and may comprise DNA. It is known in the art that the siRNAs can be chemically synthesized, or derived from a longer double-stranded RNA or a hairpin RNA. The siRNAs have significant sequence similarity to a target RNA so that the siRNAs can pair to the target RNA and result in sequence-specific degradation of the target RNA through an RNA interference mechanism. The siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex. In a particular embodiment, the 21-23 nucleotides siRNA molecules comprise a 3' hydroxyl group.

[0184] The siRNA molecules of the present invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA can be chemically synthesized or recombinantly produced using methods known in the ait. For example, short sense and antisense RNA oligomers can be synthesized and annealed to form double-stranded RNA structures with 2-nucleotide overhangs at each end (Caplen, et al. (2001) Proc Natl Acad Sd USA, 98:9742-9747; Elbashir, et al. (2001) EMBO J, 20:6877-88). These double-stranded siRNA structures can then be directly introduced to cells, either by passive ^uptake or a delivery system of choice, such as described below.

[0185] In certain embodiments, the siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer. In one embodiment, the Drosophila in vitro system is used. In this embodiment, dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides.

[0186] The siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.

[0187] In certain preferred embodiments, at least one strand of the siRNA molecules has a 3' overhang from about 1 to about 6 nucleotides in length, though the overhang may be from 2 to 4 nucleotides in length. More preferably, the 3' overhangs are 1-3 nucleotides in length. In certain embodiments, one strand may have a 3' overhang and the other strand may have a blunt-end or may also have an overhang. The length of the overhangs may be the same or different for each strand. In order to further enhance the stability of the siRNA, the 3' overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium and may be beneficial in vivo.

[0188] In other embodiments, the RNAi construct is in the form of a long double- stranded RNA. In certain embodiments, the RNAi construct is at least 25, 50, 100, 200, 300 or 400 bases. In certain embodiments, the RNAi construct is 400-800 bases in length. The double-stranded RNAs may be digested intracellularly, e.g., to produce siRNA sequences in the cell. However, use of long double-stranded RNAs in vivo is not always practical, presumably because of deleterious effects which may be caused by the sequence-independent dsRNA response. In such embodiments, the use of local delivery systems and/or agents which reduce the effects of interferon or PKR (RNA-activated protein kinase) are preferred.

[0189] In certain embodiments, the RNAi construct is in the form of a hairpin or stemloop structure (i.e., hairpin RNA). The hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature, 2002, 418:38-9; McManus et al., RNA, 2002, 8:842-50; Yu et al., Proc Natl Acad Sd USA, 2002, 99:6047-52). Preferably, such hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that siRNAs can be produced by processing a hairpin RNA in the cell.

[0190] In yet other embodiments, a plasmid is used to deliver the double-stranded RNA, e.g., as a transcriptional product. In such embodiments, the plasmid is designed to include a "coding sequence" for each of the sense and antisense strands of the RNAi construct. The coding sequences can be the same sequence, e.g., flanked by inverted promoters, or can be two separate sequences each under transcriptional control of separate promoters. After the coding sequence is transcribed, the complementary RNA transcripts base-pair to form the double- stranded RNA.

[0191] PCT application WO01/77350 describes an exemplary vector for bidirectional (or convergent) transcription of a transgene to yield both sense and antisense RNA transcripts of the same transgene in a eukaryotic cell. Accordingly, in certain embodiments, the present invention provides a recombinant vector having the following unique characteristics: it comprises a viral replicon having two overlapping transcription units arranged in an opposing orientation and flanking a transgene for an RNAi construct of interest, wherein the two overlapping transcription units yield both sense and antisense RNA transcripts from the same transgene fragment in a host cell. Also see Tran et ah, BMC Biotechnology 3: 21, 2003 (incorporated herein by reference).

[0192] RNAi constructs can comprise either long stretches of double stranded RNA identical or substantially identical to the target nucleic acid sequence or short stretches of double stranded RNA identical to substantially identical to only a region of the target nucleic acid sequence. Exemplary methods of making and delivering either long or short RNAi constructs can be found, for example, in WOO 1/68836 and WOO 1/75164.

[0193] Accordingly, in certain embodiments, PEM-3-LIKE RNAi antagonists of the invention are siRNA, either transcribed from a DNA vector encoding a short hairpin (stem-loop) siRNA, a synthetic siRNA, or longer dsRNA which can be further processed into shorter siRNA (such as, e.g., 21-23 nucleotides). Likewise, in certain embodiments, p32 RNAi antagonists of the invention are siRNA, either transcribed from a DNA vector encoding a short hairpin (stem-loop) siRNA, a synthetic siRNA, or longer dsRNA which can be further processed into shorter siRNA (such as, e.g., 21-23 nucleotides).

[0194] In general, it is anticipated that any of the foregoing RNAi antagonists that decrease the presence or translation of a PEM3-LIKE or p32 polypeptide may be screened for their relative effectiveness (i.e., in the case of p32 RNAi antagonists, their ability to inhibit or decrease the expression of p32 mRNA or a p32 polypeptide, or their ability to inhibit or decrease an activity of p32). In certain embodiments, an RNAi antagonist may decrease expression of a PEM-3-LIKE or p32 polypeptide by approximately 2-fold. In other embodiments, an RNAi antagonist decreases expression of a PEM-3-LIKE or p32 polypeptide by 4-fold, 6-fold, 8-fold, 10-fold, or more.

[0195] Accordingly, in certain aspects the disclosure provides methods employing nucleic acids that hybridize to nucleic acid molecules encoding PEM-3-LIKE polypeptides such as, for example, SEQ ID NOS. 1, 3, 22, or 24, and variants and fragments thereof and complements thereto. Exemplary nucleic acids that mediate RNAi of PEM-3-LIKE may comprise sequences as set forth in SEQ ID NOS: 25 and 26. Additional nucleic acids are sent forth in SEQ ID NOS: 271-292, wherein the sequence given an even SEQ ID number is the complement of the sequence set forth in the preceding odd SEQ ID number. In certain aspects, the disclosure relates to methods employing nucleic acid that is provided in an expression vector comprising a nucleotide sequence that hybridizes to a sequence encoding a PEM-3-LIKE polypeptide, as described above. The nucleic acid may be operably linked to at least one regulatory sequence.

[0196] Additionally, in certain aspects the disclosure provides methods employing nucleic acids that hybridize to nucleic acid molecules encoding p32 polypeptides such as, for example, SEQ ID NO. 15 and variants and fragments thereof and complements thereto. Exemplary nucleic acids that mediate RNAi of p32 may comprise sequences as set forth in SEQ ID NOS: 27 and 28, or SEQ ID NOS: 29 and 30. Additional nucleic acids are sent forth in SEQ ID NOS: 153-270, wherein the sequence given an even SEQ ID number is the complement of the sequence set forth in the preceding odd SEQ ID number. In certain aspects, the disclosure relates to methods employing nucleic acid that is provided in an expression vector comprising a nucleotide sequence that hybridizes to a sequence encoding a p32 polypeptide, as described above. The nucleic acid may be operably linked to at least one regulatory sequence.

[0197] In view of the teachings herein, one of skill in the art will understand that the methods and compositions of the invention are applicable to a wide range of viruses such as for example retroid viruses, RNA viruses, and envelop viruses. In a preferred embodiment, the present invention is applicable to retroid viruses. In a more preferred embodiment, the present invention is further applicable to retroviruses (retro viridae). In another more preferred embodiment, the present invention is applicable to lentivirus, including primate lentivirus group. In one embodiment, the present invention is applicable to Human Immunodeficiency virus (HIV), Human Immunodeficiency virus type-1 (HIV-I), Hepatitis B Virus (HBV) and Human T-cell Leukemia Virus (HTLV).

[0198] While not intended to be limiting, relevant retroviruses include: C-type retrovirus which causes lymphosarcoma in Northern Pike, the C-type retrovirus which infects mink, the caprine lentivirus which infects sheep, the Equine Infectious Anemia Virus (EIAV), the C-type retrovirus which infects pigs, the Avian Leukosis Sarcoma Virus (ALSV), the Feline Leukemia Virus (FeLV), the Feline Aids Virus, the Bovine Leukemia Virus (BLV), the Simian Leukemia Virus (SLV), the Simian Immuno-deficiency Virus (SIV), the Human T-cell Leukemia Vims type-I (HTLV- I), the Human T-cell Leukemia Virus type-II (HTLV-II), Human Immunodeficiency virus type-2 (HIV-2) and Human Immunodeficiency virus type-1 (HIV-I). The method and compositions of the present invention are further applicable to any virus that employs a Gag protein.

[0199] The present invention also relates to RNA viruses, including ssRNA negative-strand viruses and ssRNA positive-strand viruses, that may involve p32 in RNA processing. The ssRNA positive-strand viruses include Hepatitis C Virus (HCV). In one embodiment, the present invention is applicable to mononegavirales, including filo viruses. FiIo viruses further include Ebola viruses and Marburg viruses.

[0200] Other RNA viruses include picornaviruses such as enterovirus, poliovirus, coxsackievirus and hepatitis A virus, the caliciviruses, including Norwalk-like viruses, the rhabdoviruses, including rabies virus, the togaviruses including alphaviruses, Semliki Forest virus, denguevirus, yellow fever virus and rubella virus, the orthomyxoviruses, including Type A, B, and C influenza viruses, the bunyaviruses, including the Rift Valley fever virus and the hantavirus, the filoviruses such as Ebola virus and Marburg virus, and the paramyxoviruses, including mumps virus and measles virus. Additional viruses that may be treated include herpes viruses.

[0201] In another aspect, the present invention provides for the use of one or more PEM-3-LIKE and/or p32 RNAi antagonists in the manufacture of a medicament for treating a viral infection in a patient. In another aspect, the present invention provides for the use of one or more PEM-3-LIKE and/or p32 RNAi antagonists in the manufacture of a medicament for decreasing viral infectivity of a virus that has infected a patient. Further, the present invention provides PEM-3-LIKE antagonists (e.g., RNAi antagonists) for use in the treatment of viral disorders, such as, for example, HIV. Additionally, the present invention provides p32 antagonists (e.g., RNAi antagonists) for use in the treatment of viral disorders, including but not limited to HIV.

[0202] The invention contemplates the use of any combinations of PEM-3-LIKE and p32 antagonists regardless of the mechanism(s) of action of that antagonist. Additionally, any of the antagonists described herein may be used in combination with other antiviral agents. Non-limiting examples include nucleic acid therapies against viral proteins.

11. Effective Dose

[0203] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining The Ld50 (The Dose Lethal To 50% Of The Population) And The Ed50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50- Compounds which exhibit large therapeutic indexes are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0204] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half- maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. [0205] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0206] The selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular p32 antagonist employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

[0207] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. [0208] In general, a suitable daily dose of an RNAi antagonist of the invention will be that amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. Generally, intravenous, intracerebroventricular and subcutaneous doses of the compounds of this invention for a patient will range from about 0.0001 to about 100 mg per kilogram of body weight per day.

[0209] If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.

[0210] The term "treatment" is intended to encompass also prophylaxis, therapy and cure.

[0211] The patient receiving this treatment is any animal in need, including primates, in particular humans.

12. Pharmaceutical Compositions and Formulations

[0212] While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition). The PEM-3-LIKE and p32 antagonists according to the invention may be formulated for administration in any convenient way for use in human or veterinary medicine. In certain embodiments, the compound included in the pharmaceutical preparation may be active itself, or may be a prodrug, e.g., capable of being converted to an active compound in a physiological setting. [0213] Thus, another aspect of the present invention provides pharmaceutically acceptable compositions comprising a therapeutically effective amount of one or more of the PEM-3-LIKE or p32 antagonists described above, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. As described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; or (4) intravaginally or intrarectally, for example, as a pessary, cream or foam. However, in certain embodiments the subject compounds may be simply dissolved or suspended in sterile water. In certain embodiments, the pharmaceutical preparation is non-pyrogenic, i.e., does not elevate the body temperature of a patient.

[0214] Accordingly, in certain aspects, the present invention provides pharmaceutical preparations comprising PEM-3-LIKE and/or p32 antagonists. The antagonists for use in the subject methods may be conveniently formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof. The optimum concentration of the active ingredient(s) in the chosen medium can be determined empirically, according to procedures well known to medicinal chemists.

[0215] As used herein, "biologically acceptable medium" includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. Likewise, the phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The use of such media for pharmaceutically active substances is known in the art. For example, a "pharmaceutically acceptable carrier", or a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject antagonists from one organ, or portion of the body, to another organ, or portion of the body, and which is "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient, include, as examples: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations. [0216] Except insofar as any conventional media or agent is incompatible with the activity of the PEM-3-LIKE and/or p32 antagonist, its use in the pharmaceutical preparation of the invention is contemplated. Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations".

[0217] Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically or pharmaceutically acceptable carriers or excipients. Thus, the compounds and their pharmaceutically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.

[0218] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion. [0219] The phrases "systemic administration," "administered systemically," "peripheral administration" and "administered peripherally" as used herein mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration. [0220] For such therapy, the compounds of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. [0221] The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0222] The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

[0223] For therapies involving the administration of nucleic acids, the oligomers of the invention can be formulated for a variety of modes of administration, including systemic and topical or localized administration. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, intranodal, and subcutaneous for injection, the oligomers of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. [0224] Systemic administration can also be by transmucosal or transdermal means, or the compounds can be administered orally. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For oral administration, the oligomers are formulated into conventional oral administration forms such as capsules, tablets, and tonics. For topical administration, the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.

[0225] An exemplary composition of the invention comprises an RNAi mixed with a delivery system, such as a liposome system, and optionally including an acceptable excipient. Regardless of the route of administration selected, the RNAi antagonists of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms such as described below or by other conventional methods known to those of skill in the art.

[0226] The RNAi or other antagonists of the invention can be administered as such or in admixtures with pharmaceutically acceptable and/or sterile carriers and can also be administered in conjunction with other agents, including but not limited to other antiviral agents, antimicrobial agents, and immunomodulatory agents (e.g., cyclosporin A). Conjunctive therapy thus includes sequential, simultaneous and separate administration of the active compound in a way that the therapeutic effects of the first administered one is not entirely disappeared when the subsequent is administered.

[0227] The RNAi constructs of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, polymers, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. The subject RNAi constructs can be provided in formulations also including penetration enhancers, carrier compounds and/or transfection agents.

[0228] Representative United States patents that teach the preparation of uptake, distribution and/or absorption assisting formulations which can be adapted for delivery of RNAi constructs include, but are not limited to, U.S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291;51543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330;4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,17055,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978;5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.

[0229] Certain embodiments of the present PEM-3-LIKE and/or p32 antagonists may contain a basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable acids. The term "pharmaceutically acceptable salts" in this respect, refers to the relatively non-toxic, inorganic and organic acid addition salts of compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or by separately reacting a purified compound of the invention in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like. (See, for example, Berge et al. (1977) "Pharmaceutical Salts", J P 'harm. ScI 66:1-19)

[0230] The pharmaceutically acceptable salts of the subject compounds include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from non-toxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like. [0231] In other cases, the compounds of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable bases. The term "pharmaceutically acceptable salts" in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of compounds of the present invention. These salts can likewise be prepared in situ during the final isolation and purification of the compounds, or by separately reacting the purified compound in its tree acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like. (See, for example, Berge et al., supra).

[0232] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N,NI-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. of Pharma ScL 1977, 66,1-19). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids. [0233] For siRNA oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0234] Wetting agents, emulsifϊers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0235] Examples of pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0236] The formulations of the present invention may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated and the particular mode of administration (e.g., oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration). The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 1 per cent to about ninety-nine percent of active ingredient, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent. [0237] Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0238] Formulations of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in- water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouthwashes and the like, each containing a predetermined amount of a compound of the present invention as an active ingredient. A compound of the present invention may also be administered as a bolus, electuary or paste.

[0239] In solid dosage forms of the invention for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

[0240] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

[0241] The tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

[0242] Liquid dosage forms for oral administration of the compounds of the invention include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifϊers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

[0243] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

[0244] Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

[0245] It is known that sterols, such as cholesterol, will form complexes with cyclodextrins. Thus, in preferred embodiments, where the inhibitor is a steroidal alkaloid, it may be formulated with cyclodextrins, such as α-, β- and γ-cyclodextrin, dimethyl- β cyclodextrin and 2-hydroxypropyl-β-cyclodextrin. [0246] Formulations of the pharmaceutical compositions of the invention for rectal or vaginal administration may be presented as a suppository or retention enema, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter or other glycerides, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active p32 antagonist. [0247] Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate. [0248] Dosage forms for the topical or transdermal administration of a compound of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that may be required.

[0249] The ointments, pastes, creams and gels may contain, in addition to an active compound of this invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof. [0250] Powders and sprays can contain, in addition to a compound of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofmorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane. [0251] Transdermal patches have the added advantage of providing controlled delivery of a compound of the present invention to the body. Such dosage forms can be made by dissolving or dispersing the PEM-3-LIKE or p32 antagonists in the proper medium. Absorption enhancers can also be used to increase the flux of the p32 antagonists across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel.

[0252] Another aspect of the invention provides aerosols for the delivery of RNAi constructs to the respiratory tract. The respiratory tract includes the upper airways, including the oropharynx and larynx, followed by the lower airways, which include the trachea followed by bifurcations into the bronchi and bronchioli. The upper and lower airways are called the conductive airways. The terminal bronchioli then divide into respiratory bronchioli which then lead to the ultimate respiratory zone, the alveoli, or deep lung. For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0253] Herein, administration by inhalation may be oral and/or nasal. Examples of pharmaceutical devices for aerosol delivery include metered dose inhalers (MDIs), dry powder inhalers (DPIs), and air-jet nebulizers. Exemplary nucleic acid delivery systems by inhalation which can be readily adapted for delivery of the subject RNAi constructs are described in, for example, U.S. patents 5,756,353; 5,858,784; and PCT applications WO98/31346; WO98/10796; WO00/27359; WO01/54664; WO02/060412. Other aerosol formulations that may be used for delivering the double-stranded RNAs are described in U.S. Patents 6,294,153; 6,344,194; 6,071,497, and PCT applications WO02/066078; WO02/053190; WO01/60420; WO00/66206. Further, methods for delivering RNAi constructs can be adapted from those used in delivering other oligonucleotides (e.g., an antisense oligonucleotide) by inhalation, such as described in Templin et al., Antisense Nucleic Acid Drug Dev, 2000, 10:359-68; Sandrasagra et al., Expert Qpin Biol Ther, 2001, 1 :979-83; Sandrasagra et al., Antisense Nucleic Acid Drue Dev. 2002, 12:177-81. [0254] The human lungs can remove or rapidly degrade hydrolytically cleavable deposited aerosols over periods ranging from minutes to hours. In the upper airways, ciliated epithelia contribute to the "mucociliary excalator" by which particles are swept from the airways toward the mouth. Pavia, D., "LungMucociliary Clearance," in Aerosols and the Lung: Clinical and Experimental Aspects, Clarke, S. W. and Pavia, D., Eds., Butterworths, London, 1984. In the deep lungs, alveolar macrophages are capable of phagocytosing particles soon after their deposition. Warheit et al. Microscopy Res. Tech., 26: 412-422 (1993); and Brain, J. D., "Physiology and Pathophysiology of Pulmonary Macrophages," in The Reticuloendothelial System, S. M. Reichard and J. Filkins, Eds., Plenum, New. York., pp. 315-327, 1985. The deep lung, or alveoli, are the primary target of inhaled therapeutic aerosols for systemic delivery of RNAi constructs. [0255] In preferred embodiments, particularly where systemic dosing with the RNAi construct is desired, the aerosoled RNAi constructs are formulated as microparticles. Microparticles having a diameter of between 0.5 and ten microns can penetrate the lungs, passing through most of the natural barriers. A diameter of less than ten microns is required to bypass the throat; a diameter of 0.5 microns or greater is required to avoid being exhaled.

[0256] Pharmaceutical formulations of the present invention can also include veterinary compositions, e.g., pharmaceutical preparations of PEM-3-LIKE or p32 antagonists suitable for veterinary uses. When p32 antagonists are designed for inhibiting viral infections in non-human animals (e.g., primates), the nucleic acid and amino acid sequences of the non-human homologs of p32 may be used to select such agents.

EXEMPLIFICATION

[0257] The invention now being generally described, it will be more readily understood b}' reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

EXAMPLES

1. Yeast two-hybrid screen for the identification of PEM-3-LIKE polypeptide interactors

[0258] The yeast two-hybrid assay (Fields S, Song O.K. (1989). Nature 340:245-6 and Fields S, Sternglanz R. (1994) Trends in Genetics 10:286-92) revealed novel protein-protein interactions involving PEM-3-LIKE. Bait plasmids carried PEM-3- LIKE cDNA encoding different portions of the PEM-3-LIKE polypeptide. cDNA was amplified by PCR and cloned in frame with the GAL4 DNA binding domain (BD) into vector pGBK-T7 (Clontech). Four different bait vectors encoding amino acids 214-400 (bait A, SEQ ID NO 5, Fig. 5), 1-230 (bait B, SEQ ID NO 6, Fig. 6), 1-400 (bait C, SEQ ID NO 7, Fig. 7), or 1-604 (bait D, DEQ ID NO 8, Fig. 8) of PEM-3-LIKE protein (Fig. 4, SEQ. ID. NO. 4) allowed the identification of interacting proteins as well as the determination of which PEM-3-LIKE domains are required for the newly identified interactions.

[0259] Bait plasmids were transformed into yeast strain AH 109 (Clontech) and transformants were selected on defined media lacking tryptophan. Yeast strain Yl 87 containing pre-transformed HeLa cDNA prey library (Clontech) was mated according to Clontech's protocol with bait containing yeast strains and plated on defined media lacking tryptophan, leucine, histidine and containing 2 mM 3 -amino triazol. Colonies that grew on the selective media were tested for beta-galactosidase activity and positive clones were further characterized. Prey clones were identified by amplifying the cDNA insert and sequencing the insert using vector derived primers.

[0260] Plasmid was recovered from yeast colonies and transformed into E. coll DH5alpha strain. After ampicillin selection plasmid was prepared from bacterial colonies and transformed back into the yeast strain AHl 09 together with bait plasmid or empty bait vector and colonies selected on defined media lacking leucine and tryptophan and then scored for growth on media lacking tryptophan, leucine, histidine and containing 5 mM 3 -amino triazol. True hits were scored as only those prey clones for which growth on this media was dependent on bait plasmid. [0261] About 50% of prey clones identified using baits B, C and D contained cDNA clones of ClQBP / SF2p32 (Figs. 9A-C, SEQ. ID. NOS: 9, 10, and 11), indicating that the region 1-230 is required and sufficient for interaction with SF2p32 polypeptide (SEQ. ID NO 16, Fig. 13). Another cDNA clone encoding a protein interactor of PEM-3-LIKE is given in Fig. 10 (SEQ. ID NO. 12) and corresponds to FNBP3 mRNA (SEQ. ID. NO 17, Fig. 14) encoding the FNBP3 polypeptide (SEQ ID NO 18, Fig. 15). This prey also interacts with bait A containing amino acids 1-230 of PEM-3-LIKE. The hybrid screen also identified a third interactor, PCBPl (poly(rC) binding protein 1) (SEQ. ID. NO 20, Fig. 17). The prey clone sequences corresponding to PCBPl (SEQ. ID. NOS: 13 and 14) also interact with bait A containing amino acids 1-230 of PEM-3-LIKE.

2. PEM-3-LIKE and p32 interact in vitro

[0262] Fluorescence Resonance Energy Transfer (FRET) permitted verification of the interaction between PEM-3-LIKE and p32. FRET is a technique for measuring interactions between two proteins. In this technique, one flourophore absorbs electromagnetic energy at one wavelength (the excitation frequency) and re-emits that energy at a different wavelength (the emission frequency). The emission frequency of this first fluorophore (or the donor fluorophore) overlaps with the excitation frequency of a second fluorophore (the acceptor). The acceptor then re- emits the light at its own emission wavelength. An interaction between two proteins can therefore be determined when flourophores linked to the proteins are in close proximity and elicit FRET. In the present disclosure, the fluorophores cryptate and XL are fused to anti-HIS and anti-FLAG respectively. These two tags HIS and FLAG are fused to the recombinant proteins p32 and PEM-3-LIKE, respectively.

Materials and solutions

1) DTT - Sigma, Cat. # D-5545.

2) His-P32 * (affinity purified).

3) Flag-PEM-3-LIKE* (purified).

4) Flag-XL: Conjugated anti FLAG XL 665 Cis Bio, Cat # 61FG2XLA.

5) His-K: Conjugated anti HIS cryptate Cis Bio, Cat # 61HISKLB .

6) HPLC water (H₂O) - JT Baker, 'baker HPLC analyzed' Cat. # 4218.

7) KH₂PO₄ - Sigma Cat # P0662.

8) KF - Riedel De Han, Cat# 1133.

9) Na₂HPO₄ Merck Cat # 6579.

10) NaOH 1 ON Prepared from NaOH - Sigma Cat. # S-8045.

11 ) Tween 20 (Polysorbate) - Spectrum, # PO 135.

12) Tris (pH=7.6) - Sigma, Cat. # T2788. * Keep at -80 ⁰C stock aliquots.

Tween 20 -6% w/v

• Prepare Daily.

• Keep at 4 ⁰C through the day.

IM DTT

• Weigh the DDT, add water and vortex until dissolved.

• Keep at -80 ⁰C up to 6 months.

Discard after thaw.

*Dilution buffer

6XPEM-3-LIKE

Volume of Dilution Final

Stock Cone Final cone 6 X Reagent Buffer Volume

2200 ug/mL 50 ug/mL 300 ug/mL 13.6 uL 86 uL 100 uL

300 ug/mL 25 ug/mL 150 ug/mL 100 uL 100 uL 200 uL

150 ug/mL 13 ug/mL 75 ug/mL 200 uL 200 uL 400 uL

75 ug/mL 6.3 ug/mL 38 ug/mL 400 uL 400 uL 800 uL

38 ug/mL 3.1 ug/mL 19 ug/mL 800 uL 800 uL 1600 uL

19 ug/mL 1.6 ug/mL 9 ug/mL ### uL 1600 uL 3200 uL

9 ug/mL 0.8 ug/mL 5 ug/mL #ffl uL 3200 uL 6400 uL

5 ug/mL 0 ug/mL 0 ug/mL 0 uL 50 uL 50 uL

• Prepare Daily.

• Keep at 4 ⁰C through the day.

Reconstitution buffer

Check pH = 7.0 in the pH meter (25⁰C). ^■ Keep at -80 ⁰C up to 6 months. Discard after thaw

Solutions prepared fresh on the day of the assay.

Prepare daily and through the day keep in 4⁰C.

B. Equipment

1) PP microplates U bottom (96 wells polypropylene) manufacturer Greiner Cat. No650201.

2) Black micro plates (96 wells) manufacturer Costar Cat. No 3694.

3) Sealing foil- USA scientific, Cat # 2923-0100 (TempPlate).

4) Barcode reader.

5) Microplates Labels (numeric) Sidewall Cryo-Tags — Diversified Biotech, Cat. side- 1000.

6) Dispenser-digital -Bio control fϊnpipette Cat # 4520

7) Multichannel (xl2) module 5-50ul pipettors - fmpipette Cat # 2205680.

8) Tips 250 μl - Medax, Cat. 123211C or equivalent.

9) Pipettor 5-50 fmpipette, Cat # 4500 or equivalent.

10) Fluorimeter - BMG Inc, Ruby STAR reader.

11) Freezer -8O⁰C (Revco) or equivalent.

12) Incubator 37⁰C (essential that temperature recovery be less than 1 minute, following door opening).

13) pH meter - Orion (Cat. # 420A) or equivalent. 14)pH "Tris electrode" - Russell (Cat. # TR/CW711/TB₃ or TR\CMAW71 IYTB) or equivalent.

15) Microspin - Biosan, Cat. # FV-2400. or equivalent.

16) Plates vortex - Labnet, model Orbit P4. or equivalent.

17) Dessicator - Sanplatec Corp or equivalent. C. Procedure

1 ) Stage 1 - Addition of 6X PEM-3-LIKE. a. 20 μl samples of dilute /DMSO into black micro plate b. Add 5 μl 6x PEM-3-LIKE mixture to wells c. (Negative control- Posh (see US 2005/0214751) instead of PEM- 3-LIKE) lOul dilution buffer d. Mix by shaking 30 seconds. e. Incubate for 10 minutes at RT.

2) Stage 2 - Addition of 6X P32 solution. a. Add 5-μl 3X P32 mixture b. Mix by shaking 30 seconds. c. Incubate for 10 minutes at RT. d. Stage 3 will be referred to as "P32-PEM-3-LIKE".

3) Stage 3 : Incubate 30 minutes at 37⁰C.

4) Stage 4 - Detection step. a. Add 30 μl HIS -K₃ FLAG-Xl 665 in reconstitution buffer to black plate. b. Seal plates with sealing foil. c. Mix by shaking 30 seconds. d. Read after 2 hours.

5) Stage 5 - Reading stage a. Read the fluorescence in the RUBY-star, reading explanations: Reading the fluorescence Emission at 620 nm and 665 nm is obtained after excitation at 320 nm in a fluorescence reader.

The binding of PEM-3-LIKE-p32 is determined by calculating the fluorescence resonance energy transfer (FRET=AF) using the following formula:

AF= [(S₆₆₅ZS₆₂₀ - B₆₆₅/B₆₂₀)]/[(C₆₆₅/C₆20 - B₆₆₅ZB₆₂₀)] S= Actual fluorescence.

B= Fluorescence obtained in parallel incubation without PEM- 3-LIKE C= Fluorescence obtained in reaction without added compounds. b. Record the results in the computer, add the path program.

D. Results

[0263] Results are shown in Figure 14. Various concentrations (0-50 μg/ml) of recombinant FLAG-tagged PEM-3-LIKE and various concentrations (0-50 μg/ml) of HIS-tagged P32 were incubated 30 minutes at 37 °C, followed by addition of anti- HIS-Cryptate (FRET donor) and anti-FLAG-XL (FRET acceptor) and incubated in 4 ⁰C for 1 hour (Panel A). Binding is expressed as delta F (the ratio between positive control and negative control, described in Stage 5a above).

3. In vivo interaction between PEM-3-LIKE and p32

[0264] HeLa-SSo cells were transfected as indicated in Fig. 20 with pCDNA3.1 vector encoding V5-tagged WT or KH mutant (niKH; G246D, G340D) PEM-3- LIKE, HA-tagged p32 and vector encoding HIV pro viral genome (pNLenv-1). Cell lysates prepared 24 hours later were immunoprecipitated with anti-HA antibody (Roche) and analyzed by Western-blot using anti-V5 antibody (Invitrogen) or anti- HA antibody. Total cell extracts were analyzed by Western-blot using anti-V5 antibody to determine PEM-3-LIKE expression level (lower panel). As is shown in the bottom two panels of Fig. 20, both p32 and PEM-3-LIKE tagged proteins were expressed in HeLa cells.

4. Identification of agents that modulate PEM-3-LIKE protein associations [0265] Agents that interfere with, inhibit, or prevent PEM-3-LIKE polypeptide from interacting with any or all of the interacting polypeptides described herein can be determined in vitro by FRET analysis (Fig. 22). Similarly, FRET can be used to identify agents that promote or enhance PEM-3-LIKE associations with p32, FNBP3, and/or PCBPl. In addition to FRET, agents may be tested in vivo by treating cells or organisms expressing PEM-3-LIKE protein (or PEM-3-LIKE fusion protein) and the PEM-3-LIKE interacting protein (or a PEM-3-LIKE interacting fusion protein) with the test agent and isolating PEM-3-LIKE polypeptide complexes. PEM-3-LIKE polypeptide complexes would be isolated from control cells or organisms that did not receive the test agent. The ability to isolate complexes from cells or organisms that received the test agent would identify those agents that may modulate PEM-3-LIKE interactions in vivo. The screening of agents therefore requires the isolated and/or purified PEM-3-LIKE and PEM-3- LIKE interacting polypeptide complex; the complex and the determination of any changes in complex formation are required to identify those test agents that elicit such changes.

5. Inhibition of PEM-3-LIKE or p32 reduces HIV Gag protein level. [0266] HeIa SS6 cells were transfected with 10OnM siRNA directed against scramble control (Sc), PEM-3-LIKE (X37) or ρ32 (X160 and X161) using SaintRed reagent (Synvolux Therapeutics):

X37 PEM-3-LIKE siRNA: 5'-CCACCGUCCAAGUCAGGGUCCCUdTdA-S' (SEQ ID NO: 25) and 5'- UAAGGGACCCUGACUUGGACGGUGGUU-3 ' (SEQ ID NO: 26).

X160 p32 siRNA: 5'-GGUUGAAGAACAGGAGCCUGAACdTdG-SXSEQ ID NO: 27) and 5'- CAGUUCAGGCUCCUGUUCUUCAACCUU-3 ' (SEQ ID NO: 28).

X161 p32 siRNA: 5'-TUrGrGrGrArCAGAAGCGAAAUUAGUGCdGdG-S' (SEQ ID NO: 29) and 5'-CCGCACUAAUUUCGCUUCUGUCCCAUU-S' (SEQ ID NO: 30).

[0267] Twenty-four hours later the cells were transfected with plasmid encoding HIVl pro viral genome (pNLenv-1) using Lipofectamin 2000 reagent (Invitrogen). Twenty-four hours post-HIVl transfection, levels of HIVl Gag p55 and p24 proteins were determined by immunoblot with anti-p24 specific antibodies (Seramun). Actin (Sigma) and p32 (Acris Antibodies) level were determined by immunoblot with specific antibodies (Fig. 25). Inhibition of p32 or PEM-3-LIKE reduced expression of HIVl Gag. siRNA directed against p32 reduced expression of HIVl Gag significantly, and the results observed show that p32 inhibition as well as PEM-3-LIKE inhibition may be effective strategies for treating HIV infection. Further, as the Gag proteins from HIV-I and HIV-2 — two distinct Antiviruses that can both infect humans and ultimately case AIDS — can coassemble into the same viral particle and can functionally complement each other during viral replication, the results demonstrated herein show that PEM-3-LIKE and/or p32 antagonists may be useful as a treatment for both HIV-I and HIV-2 infections, in addition to perhaps other retroviral infections.

Table 2: Sequences for p32 (C IQBP; Accession No. NM_001212.3) siRNA Start Position N19 Primer N25 Primer

264 GA-TGAAATTAAGGAGGAAAGA TGAAATTAAGGAGGAAAGAAAAATT

(SEQ ID NO: 31) (SEQ ID NO: 32)

266 TG-AAATTAAGGAGGAAAGAAA AAATTAAGGAGGAAAGAAAAATTCA

(SEQ ID NO: 33) (SEQ ID NO: 34)

299 TA-AAACCCTCCCTAAGATGTC AAACCCTCCCTAAGATGTCTGGAGG

(SEQ ID NO: 35) (SEQ ID NO: 36)

300 AA-AACCCTCCCTAAGATGTCT AACCCTCCCTAAGATGTCTGGAGGT

(SEQ ID NO: 37) (SEQ ID NO: 38)

303 AC-CCTCCCTAAGATGTCTGGA CCTCCCTAAGATGTCTGGAGGTTGG

(SEQ ID NO: 39) (SEQ ID NO: 40)

305 CC-TCCCTAAGATGTCTGGAGG TCCCTAAGATGTCTGGAGGTTGGGA

(SEQ ID NO: 41) (SEQ ID NO: 42)

309 CC-TAAGATGTCTGGAGGTTGG TAAGATGTCTGGAGGTTGGGAGCTG

(SEQ ID NO: 43) (SEQ ID NO: 44)

311 TA-AGATGTCTGGAGGTTGGGA AGATGTCTGGAGGTTGGGAGCTGGA

(SEQ ID NO: 45) (SEQ ID NO: 46)

317 GT-CTGGAGGTTGGGAGCTGGA CTGGAGGTTGGGAGCTGGAACTGAA

(SEQ ID NO: 47) (SEQ ID NO: 48)

322 GA-GGTTGGGAGCTGGAACTGA GGTTGGGAGCTGGAACTGAATGGGA

(SEQ ID NO: 49) (SEQ ID NO: 50)

327 TG-GGAGCTGGAACTGAATGGG GGAGCTGGAACTGAATGGGACAGAA

(SEQ ID NO: 51) (SEQ ID NO: 52)

328 GG-GAGCTGGAACTGAATGGGA GAGCTGGAACTGAATGGGACAGAAG

(SEQ ID NO: 53) (SEQ ID NO: 54)

^"337 ^" AA-CTΘAATGGGACAGAAGCGA CfGAATGGGACAGAAGCGAAATfAG

, ^' (SEQ ID NO: 55) (S^'EQ ID NO: 56)

338 AC-TGAAfGGGACAGAAGCGAA TGAATGGGACAGAAGCGAAATTAGf

(SEQ ID NO: 57) (SEQ ID NO: 58)

339 CT-GAATGGGACAGAAGCGAAA GAATGGGACAGAAGCGAAATTAGTG

(SEQ ID NO: 59) (SEQ ID NO: 60)

342 AA-TGGGACAGAAGCGAAATTA TGGGACAGAAGCGAAATTAGTGCGG

(SEQ ID NO: 61) (SEQ ID NO: 62)

343 AT-GGGACAGAAGCGAAATTAG GGGACAGAAGCGAAATTAGTGCGGA

(SEQ ID NO: 63) (SEQ ID NO: 64)

344 TG-GGACAGAAGCGAAATTAGT GGACAGAAGCGAAATTAGTGCGGAA

(SEQ ID NO: 65) (SEQ ID NO: 66)

349 CA-GAAGCGAAATTAGTGCGGA GAAGCGAAATTAGTGCGGAAAGTTG

(SEQ ID NO: 67) (SEQ ID NO: 68)

350 AG-AAGCGAAATTAGTGCGGAA AAGCGAAATTAGTGCGGAAAGTTGC (SEQ ID NO: 69) (SEQ ID NO: 70)

351 GA-AGCGAAATTAGTGCGGAAA AGCGAAATTAGTGCGGAAAGTTGCC

(SEQ ID NO: 71) (SEQ ID NO: 72) 353 AG-CGAAATTAGTGCGGAAAGT CGAAATTAGTGCGGAAAGTTGCCGG

(SEQ ID NO: 73) (SEQ ID NO: 74) 357 AA-ATTAGTGCGGAAAGTTGCC ATTAGTGCGGAAAGTTGCCGGGGAA

(SEQ ID NO: 75) (SEQ ID NO: 76) 383 AA-AAATCACGGTCACTTTCAA AAATCACGGTCACTTTCAACATTAA

(SEQ ID NO: 77) (SEQ ID NO: 78) 387 AT-CACGGTCACTTTCAACATT CACGGTCACTTTCAACATTAACAAC

(SEQ ID NO: 79) (SEQ ID NO: 80) 407 TA-ACAACAGCATCCCACCAAC ACAACAGCATCCCACCAACATTTGA

(SEQ ID NO: 81) (SEQ ID NO: 82)

409 AC-AACAGCATCCCACCAACAT AACAGCATCCCACCAACATTTGATG

(SEQ ID NO: 83) (SEQ ID NO: 84)

410 CA-ACAGCATCCCACCAACATT ACAGCATCCCACCAACATTTGATGG

(SEQ ID NO: 85) (SEQ ID NO: 86)

412 AC-AGCATCCCACCAACATTTG AGCATCCCACCAACATTTGATGGTG

(SEQ ID NO: 87) (SEQ ID NO: 88)

413 CA-GCATCCCACCAACATTTGA GCATCCCACCAACATTTGATGGTGA

(SEQ ID NO: 89) (SEQ ID NO: 90) 418 TC-CCACCAACATTTGATGGTG CCACCAACATTTGATGGTGAGGAGG

(SEQ ID NO: 91) (SEQ ID NO: 92) 426 AC-ATTTGATGGTGAGGAGGAA ATTTGATGGTGAGGAGGAACCCTCG

(SEQ ID NO: 93) (SEQ ID NO: 94) 430 TT-GATGGTGAGGAGGAACCCT GATGGTGAGGAGGAACCCTCGCAAG

(SEQ ID NO: 95) (SEQ ID NO: 96)

439 AG-GAGGAACCCTCGCAAGGGC GAGGAACCCTCGCAAGGGCAGAAGG

(SEQ ID NO: 97) (SEQ ID NO: 98)

440 GG-AGGAACCCTCGCAAGGGCA AGGAACCCTCGCAAGGGCAGAAGGT

(SEQ ID NO: 99) (SEQ ID NO: 100)

442 AG-GAACCCTCGCAAGGGCAGA GAACCCTCGCAAGGGCAGAAGGTTG

(SEQ ID NO: 101) (SEQ ID NO: 102)

443 GG-AACCCTCGCAAGGGCAGAA AACCCTCGCAAGGGCAGAAGGTTGA

(SEQ ID NO: 103) (SEQ ID NO: 104)

449 CT-CGCAAGGGCAGAAGGTTGA CGCAAGGGCAGAAGGTTGAAGAACA

(SEQ ID NO: 105) (SEQ ID NO: 106)

450 TC-GCAAGGGCAGAAGGTTGAA GCAAGGGCAGAAGGTTGAAGAACAG

(SEQ ID NO: 107) (SEQ ID NO: 108)

452 GC-AAGGGCAGAAGGTTGAAGA AAGGGCAGAAGGTTGAAGAACAGGA

(SEQ ID NO: 109) (SEQ ID NO: 110)

453 CA-AGGGCAGAAGGTTGAAGAA AGGGCAGAAGGTTGAAGAACAGGAG

(SEQ ID NO: 111) (SEQ ID NO: 112) 455 AG-GGCAGAAGGTTGAAGAACA GGCAGAAGGTTGAAGAACAGGAGCC

(SEQ ID NO: 113) (SEQ ID NO: 114)

4S7 AA-GGTTGAAGAACAGGAGCCt GGTTGAAGAACAGGAGCCTGAACTG

Sunayama et (SEQ ID NO: 115) (SEQ ID NO: 116)

470 AG-AACAGGAGCCTGAACTGAC ^"AACAGbAGCCTGAACTGACATCAAC ^"

(SEQ ID NO: 117) (SEQ ID NO: 118)

471 GA-ACAGGAGCCTGAACTGACA ACAGGAGCCTGAACTGACATCAACT

(SEQ ID NO: 119) (SEQ ID NO: 120) 475 AG-GAGCCTGAACTGACATCAA GAGCCTGAACTGACATCAACTCCCA

(SEQ ID NO: 121) (SEQ ID NO: 122) 480 CC-TGAACTGACATCAACTCCC TGAACTGACATCAACTCCCAATTTC (SEQ ID NO: 123) (SEQ ID NO: 124) 487 TG-ACATCAACTCCCAATTTCG ACATCAACTCCCAATTTCGTGGTTG

(SEQ ID NO: 125) (SEQ ID NO: 126) 489 AC-ATCAACTCCCAATTTCGTG ATCAACTCCCAATTTCGTGGTTGAA

(SEQ ID NO: 127) (SEQ ID NO: 128)

494 AA-CTCCCAATTTCGTGGTTGA CTCCCAATTTCGTGGTTGAAGTTAT

(SEQ ID NO: 129) (SEQ ID NO: 130)

495 AC-TCCCAATTTCGTGGTTGAA TCCCAATTTCGTGGTTGAAGTTATA

(SEQ ID NO: 131) (SEQ ID NO: 132) 497 TC-CCAATTTCGTGGTTGAAGT CCAATTTCGTGGTTGAAGTTATAAA

(SEQ ID NO: 133) (SEQ ID NO: 134) 499 CC-AATTTCGTGGTTGAAGTTA AATTTCGTGGTTGAAGTTATAAAGA

(SEQ ID NO: 135) (SEQ ID NO: 136)

501 AA-TTTCGTGGTTGAAGTTATA TTTCGTGGTTGAAGTTATAAAGAAT

(SEQ ID NO: 137) (SEQ ID NO: 138)

502 AT-TTCGTGGTTGAAGTTATAA TTCGTGGTTGAAGTTATAAAGAATG

(SEQ ID NO: 139) (SEQ ID NO: 140)

503 TT-TCGTGGTTGAAGTTATAAA TCGTGGTTGAAGTTATAAAGAATGA

(SEQ ID NO: 141) (SEQ ID NO: 142)

505 TC-GTGGTTGAAGTTATAAAGA GTGGTTGAAGTTATAAAGAATGATG

(SEQ ID NO: 143) (SEQ ID NO: 144)

506 CG-TGGTTGAAGTTATAAAGAA TGGTTGAAGTTATAAAGAATGATGA

(SEQ ID NO: 145) (SEQ ID NO: 146)

507 GT-GGTTGAAGTTATAAAGAAT GGTTGAAGTTATAAAGAATGATGAT

(SEQ ID NO: 147) (SEQ ID NO: 148) 531 GA-TGGCAAGAAGGCCCTTGTG TGGCAAGAAGGCCCTTGTGTTGGAC

(SEQ ID NO: 149) (SEQ ID NO: 150) 540 AA-GGCCCTTGTGTTGGACTGT GGCCCTTGTGTTGGACTGTCATTAT

(SEQ ID NO: 151) (SEQ ID NO: 152)

Start N25 mi primer N25 rni complementary primer

Position

264 TUrGrArArArUrUrArArGrGrArGrGrArArArGrA rArArUrUrUrUrUrCrUrUrUrCrCrUrCrCrUrUrArArUrUrUr rArArArATT CrArUrU

(SEQ ID NO: 153) (SEQ ID NO: 154)

266 TArArArUrUrArArGrGrArGrGrArArArGrArArAr TUrGrArArUrUrUrUrUrCrUrUrUrCrCrUrCrCrUrUrArArUr

ArArUrUCA UrUrUrU

(SEQ ID NO: 155) (SEQ ID NO: 156)

299 TArArArCrCrCrUrCrCrCrUrArArGrArUrGrUrC TCrCrUrCrCrArGrArCrArUrCrUrUrArGrGrGrArGrGrGrUr rUrGrGrAGG UrUrUrU

(SEQ ID NO: 157) (SEQ ID NO: 158)

300 TArArCrCrCrUrCrCrCrUrArArGrArUrGrUrCrU TArCrCrUrCrCrArGrArCrArUrCrUrUrArGrGrGrArGrGrGr rGrGrArGGT UrUrUrU

(SEQ ID NO: 159) (SEQ ID NO: 160)

303 TCrCrUrCrCrCrUrArArGrArUrGrUrCrUrGrGrA TCrCrArArCrCrUrCrCrArGrArCrArUrCrUrUrArGrGrGrAr rGrGrUrUGG GrGrUrU

(SEQ ID NO: 161) (SEQ ID NO: 162)

305 TUrCrCrCrUrArArGrArUrGrUrCrUrGrGrArGr TUrCrCrCrArArCrCrUrCrCrArGrArCrArUrCrUrUrArGrGr

GrUrUrGrGGA GrArUrU

(SEQ ID NO: 163) (SEQ ID NO: 164)

309 TUrArArGrArUrGrUrCrUrGrGrArGrGrUrUrGr TCrArGrCrUrCrCrCrArArCrCrUrCrCrArGrArCrArUrCrUr

GrGrArGrCTG UrArUrU

(SEQ ID NO: 165) (SEQ ID NO: 166)

311 TArGrArUrGrUrCrUrGrGrArGrGrUrUrGrGrGr TUrCrCrArGrCrUrCrCrCrArArCrCrUrCrCrArGrArCrArUr

ArGrCrUrGGA CrUrUrU

(SEQ ID NO: 167) (SEQ ID NO: 168)

317 TCrUrGrGrArGrGrUrUrGrGrGrArGrCrUrGrGr TUrUrCrArGrUrUrCrCrArGrCrUrCrCrCrArArCrCrUrCrCr ArArCrUrGAA ArGrUrU

(SEQ ID NO: 169) (SEQ ID NO: 170)

322 TGrGrUrUrGrGrGrArGrCrUrGrGrArArCrUrGr rUrCrCrCrArUrUrCrArGrUrUrCrCrArGrCrUrCrCrCrArAr

ArArUrGrGGA CrCrUrU

(SEQ ID NO: 171) (SEQ ID NO: 172)

327 TGrGrArGrCrUrGrGrArArCrUrGrArArUrGrGr rUrUrCrUrGrUrCrCrCrArUrUrCrArGrUrUrCrCrArGrCrUr

GrArCrArGAA CrCrUrU

(SEQ ID NO: 173) (SEQ ID NO: 174)

328 TGrArGrCrUrGrGrArArCrUrGrArArUrGrGrGr rCrUrUrCrUrGrUrCrCrCrArUrUrCrArGrUrUrCrCrArGrCr

ArCrArGrAAG UrCrUrU

(SEQ ID NQ: 175)_ _ (SEQ ID NO: 176)

337 rCrUrGrArArUrGrGrGrArCrArGfArArGrCrGrA ^" rCrUrArA^"rUrUrOrCrGrCrUrUrCrUrGrUrCrCrCrArUrUrCr rArArUrUAG ArGrUrU

(SEQ ID NO: 177) (SEQ I D NO: 178) ^"338 TUrGrArArUrGrGrGrArCrArGrArArGrCrGrArA ^" rArCrUrArArUrUrUrCrGrCrUrUrCrUrGrUrCrCrCrArUrUr rArUrUrAGT CrArUrU

(SEQ ID NO: 179) (SEQ ID NO: 180)

339 TGrArArUrGrGrGrArCrArGrArArGrCrGrArArA rCrArCrUrArArUrUrUrCrGrCrUrUrCrUrGrUrCrCrCrArUr rUrUrArGTG UrCrUrU

(SEQ ID NO: 181) (SEQ ID NO: 182)

342 TUrGrGrGrArCrArGrArArGrCrGrArArArUr rCrCrGrCrArCrUrArArUrUrUrCrGrCrUrUrCrUrGrUrC

UrArGrUrGrCGG rCrCrArUrU

(SEQ ID NO: 29) (SEQ ID NO: 30)

343 TGrGrGrArCrArGrArArGrCrGrArArArUrUrArG rUrCrCrGrCrArCrUrArArUrUrUrCrGrCrUrUrCrUrGrUrCr rUrGrCrGGA CrCrUrU

(SEQ ID NO: 183) (SEQ ID NO: 184)

344 TGrGrArCrArGrArArGrCrGrArArArUrUrArGrU TUrUrCrCrGrCrArCrUrArArUrUrUrCrGrCrUrUrCrUrGrUr rGrCrGrGAA CrCrUrU

(SEQ ID NO: 185) (SEQ ID NO: 186)

349 TGrArArGrCrGrArArArUrUrArGrUrGrCrGrGrA TCrArArCrUrUrUrCrCrGrCrArCrUrArArUrUrUrCrGrCrUr rArArGrUTG UrCrUrU

(SEQ ID NO: 187) (SEQ ID NO: 188)

350 TArArGrCrGrArArArUrUrArGrUrGrCrGrGrArA TGrCrArArCrUrUrUrCrCrGrCrArCrUrArArUrUrUrCrGrCr rArGrUrUGC UrUrUrU

(SEQ ID NO: 189) (SEQ ID NO: 190)

351 TArGrCrGrArArArUrUrArGrUrGrCrGrGrArArA TGrGrCrArArCrUrUrUrCrCrGrCrArCrUrArArUrUrUrCrGr rGrUrUrGCC CrUrUrU

(SEQ ID NO: 191) (SEQ ID NO: 192)

353 TCrGrArArArUrUrArGrUrGrCrGrGrArArArGrU TCrCrGrGrCrArArCrUrUrUrCrCrGrCrArCrUrArArUrUrUr rUrGrCrCGG CrGrUrU

(SEQ ID NO: 193) (SEQ ID NO: 194)

357 TArUrUrArGrUrGrCrGrGrArArArGrUrUrGrCrC rUrUrCrCrCrCrGrGrCrArArCrUrUrUrCrCrGrCrArCrUrAr

TGrGrGrGAA ArUrUrU

(SEQ ID NO: 195) (SEQ ID NO: 196)

383 TArArArUrCrArCrGrGrUrCrArCrUrUrUrCrArAr TUrUrArArUrGrUrUrGrArArArGrUrGrArCrCrGrUrGrArUr

CrArUrUAA UrUrUrU

(SEQ ID NO: 197) (SEQ ID NO: 198)

387 TCrArCrGrGrUrCrArCrUrUrUrCrArArCrArUrU TGrUrUrGrUrUrArArUrGrUrUrGrArArArGrUrGrArCrCrGr rArArCrAAC UrGrUrU

(SEQ ID NO: 199) (SEQ ID NO: 200)

407 TArCrArArCrArGrCrArUrCrCrCrArCrCrArArCr TUrCrArArArUrGrUrUrGrGrUrGrGrGrArUrGrCrUrGrUrU

ArUrUrUGA rGrUrUrU

(SEQ ID NO: 201) (SEQ ID NO: 202)

409 TArArCrArGrCrArUrCrCrCrArCrCrArArCrArUr TCrArUrCrArArArUrGrUrUrGrGrUrGrGrGrArUrGrCrUrGr

UrUrGrATG UrUrUrU

(SEQ ID NO: 203) (SEQ ID NO: 204)

410 TArCrArGrCrArUrCrCrCrArCrCrArArCrArUrUr TCrCrArUrCrArArArUrGrUrUrGrGrUrGrGrGrArUrGrCrUr

UrGrArUGG GrUrUrU

(SEQ ID NO: 205) (SEQ ID NO: 206)

412 TArGrCrArUrCrCrCrArCrCrArArCrArUrUrUrG TCrArCrCrArUrCrArArArUrGrUrUrGrGrUrGrGrGrArUrGr rArUrGrGTG CrUrUrU

(SEQ ID NO: 207) (SEQ ID NO: 208)

413 TGrCrArUrCrCrCrArCrCrArArCrArUrUrUrGrA TUrCrArCrCrArUrCrArArArUrGrUrUrGrGrUrGrGrGrArUr rUrGrGrUGA GrCrUrU

(SEQ ID NO: 209) (SEQ ID NO: 210) 418 TCrCrArCrCrArArCrArUrUrUrGrArUrGrGrUrG TCrCrUrCrCrUrCrArCrCrArUrCrArArArUrGrUrUrGrGrUr rArGrGrAGG GrGrUrU

(SEQ ID NO: 211) (SEQ ID NO: 212)

426 TArUrUrUrGrArUrGrGrUrGrArGrGrArGrGrAr TCrGrArGrGrGrUrUrCrCrUrCrCrUrCrArCrCrArUrCrArAr

ArCrCrCrUCG ArUrUrU

(SEQ ID NO: 213) (SEQ ID NO: 214)

430 TGrArUrGrGrUrGrArGrGrArGrGrArArCrCrCr TCrUrUrGrCrGrArGrGrGrUrUrCrCrUrCrCrUrCrArCrCrAr

UrCrGrCrAAG UrCrUrU

(SEQ ID NO: 215) (SEQ ID NO: 216)

439 TGrArGrGrArArCrCrCrUrCrGrCrArArGrGrGr TCrCrUrUrCrUrGrCrCrCrUrUrGrCrGrArGrGrGrUrUrCrC

CrArGrArAGG rUrCrUrU

(SEQ ID NO: 217) (SEQ ID NO: 218)

440 TArGrGrArArCrCrCrUrCrGrCrArArGrGrGrCrA TArCrCrUrUrCrUrGrCrCrCrUrUrGrCrGrArGrGrGrUrUrC rGrArArGGT rCrUrUrU

(SEQ ID NO: 219) (SEQ ID NO: 220)

442 TGrArArCrCrCrUrCrGrCrArArGrGrGrCrArGrA TCrArArCrCrUrUrCrUrGrCrCrCrUrUrGrCrGrArGrGrGrUr rArGrGrUTG UrCrUrU

(SEQ ID NO: 221) (SEQ ID NO: 222)

443 TArArCrCrCrUrCrGrCrArArGrGrGrCrArGrArA TUrCrArArCrCrUrUrCrUrGrCrCrCrUrUrGrCrGrArGrGrGr rGrGrUrUGA UrUrUrU

(SEQ ID NO: 223) (SEQ ID NO: 224)

449 TCrGrCrArArGrGrGrCrArGrArArGrGrUrUrGr rUrGrUrUrCrUrUrCrArArCrCrUrUrCrUrGrCrCrCrUrUrGr

ArArGrArACA CrGrUrU

(SEQ ID NO: 225) (SEQ ID NO: 226)

450 TGrCrArArGrGrGrCrArGrArArGrGrUrUrGrArA rCrUrGrUrUrCrUrUrCrArArCrCrUrUrCrUrGrCrCrCrUrUr rGrArArCAG GrCrUrU

(SEQ ID NO: 227) (SEQ ID NO: 228)

452 TArArGrGrGrCrArGrArArGrGrUrUrGrArArGrA rUrCrCrUrGrUrUrCrUrUrCrArArCrCrUrUrCrUrGrCrCrCr rArCrArGGA UrUrUrU

(SEQ ID NO: 229) (SEQ ID NO: 230)

453 TArGrGrGrCrArGrArArGrGrUrUrGrArArGrArA rCrUrCrCrUrGrUrUrCrUrUrCrArArCrCrUrUrCrUrGrCrCr rCrArGrGAG CrUrUrU

(SEQ ID NO: 231) (SEQ ID NO: 232)

455 TGrGrCrArGrArArGrGrUrUrGrArArGrArArCrA TGrGrCrUrCrCrUrGrUrUrCrUrUrCrArArCrCrUrUrCrUrGr rGrGrArGCC CrCrUrU

_ (SEQ ID NO:_233) (SEQ ID NO: 234)

^' 457 ^" VterβrUrUrGrArArGrArArCrArδrGrArGrCFCtU^" ^CrArGrUrUrCrArGrGrCrUrCrCrUrGrUrUrCrUrUrCrArAr^{1 )}

Sunayama ' KSrArArCTG ^" -^{1 *"} ; . CrCrUrU βt al.* ' (SEQ IO NO: 27) . . . _^ (SEQ ID NO: 28) ^"

470 TArArCrArGrGrArGrCrCrUrGrArArCrUrGrArC TGrUrUrGrArUrGrUrCrArGrUrUrCrArGrGrCrUrCrCrUrG

TArUrCrAAC rUrUrUrU

(SEQ ID NO: 235) (SEQ ID NO: 236)

471 TArCrArGrGrArGrCrCrUrGrArArCrUrGrArCrA TArGrUrUrGrArUrGrUrCrArGrUrUrCrArGrGrCrUrCrCrUr rUrCrArACT GrUrUrU

(SEQ ID NO: 237) (SEQ ID NO: 238)

475 TGrArGrCrCrUrGrArArCrUrGrArCrArUrCrArA TUrGrGrGrArGrUrUrGrArUrGrUrCrArGrUrUrCrArGrGrC rCrUrCrCCA rUrCrUrU

(SEQ ID NO: 239) (SEQ ID NO: 240)

480 TUrGrArArCrUrGrArCrArUrCrArArCrUrCrCrC TGrArArArUrUrGrGrGrArGrUrUrGrArUrGrUrCrArGrUrUr rArArUrUTC CrArUrU

(SEQ ID NO: 241) (SEQ ID NO: 242)

487 TArCrArUrCrArArCrUrCrCrCrArArUrUrUrCrGr TCrArArCrCrArCrGrArArArUrUrGrGrGrArGrUrUrGrArUr

UrGrGrUTG GrUrUrU

(SEQ ID NO: 243) (SEQ ID NO: 244)

489 TArUrCrArArCrUrCrCrCrArArUrUrUrCrGrUrG TUrUrCrArArCrCrArCrGrArArArUrUrGrGrGrArGrUrUrGr rGrUrUrGAA ArUrUrU

(SEQ ID NO: 245) (SEQ ID NO: 246)

494 TCrUrCrCrCrArArUrUrUrCrGrUrGrGrUrUrGrA TArUrArArCrUrUrCrArArCrCrArCrGrArArArUrUrGrGrGr rArGrUrUAT ArGrUrU

(SEQ ID NO: 247) (SEQ ID NO: 248)

495 TUrCrCrCrArArUrUrUrCrGrUrGrGrUrUrGrArA TUrArUrArArCrUrUrCrArArCrCrArCrGrArArArUrUrGrGr rGrUrUrATA GrArUrU

(SEQ ID NO: 249) (SEQ ID NO: 250)

497 TCrCrArArUrUrUrCrGrUrGrGrUrUrGrArArGrU TUrUrUrArUrArArCrUrUrCrArArCrCrArCrGrArArArUrUr rUrArUrAAA GrGrUrU (SEQ ID NO: 251) (SEQ ID NO: 252)

499 TArArUrUrUrCrGrUrGrGrUrUrGrArArGrUrUrA TUrCrUrUrUrArUrArArCrUrUrCrArArCrCrArCrGrArArAr rUrArArAGA UrUrUrU (SEQ ID NO: 253) (SEQ ID NO: 254)

501 TUrUrUrCrGrUrGrGrUrUrGrArArGrUrUrArUrA TArUrUrCrUrUrUrArUrArArCrUrUrCrArArCrCrArCrGrAr rArArGrAAT ArArUrU (SEQ ID NO: 255) (SEQ ID NO: 256)

502 TUrUrCrGrUrGrGrUrUrGrArArGrUrUrArUrArA TCrArUrUrCrUrUrUrArUrArArCrUrUrCrArArCrCrArCrGr rArGrArATG ArArUrU (SEQ ID NO: 257) (SEQ ID NO: 258)

503 TUrCrGrUrGrGrUrUrGrArArGrUrUrArUrArArA TUrCrArUrUrCrUrUrUrArUrArArCrUrUrCrArArCrCrArCr rGrArArUGA GrArUrU (SEQ ID NO: 259) (SEQ ID NO: 260)

505 TGrUrGrGrUrUrGrArArGrUrUrArUrArArArGrA TCrArUrCrArUrUrCrUrUrUrArUrArArCrUrUrCrArArCrCr rArUrGrATG ArCrUrU (SEQ ID NO: 261) (SEQ ID NO: 262)

506 TUrGrGrUrUrGrArArGrUrUrArUrArArArGrArA TUrCrArUrCrArUrUrCrUrUrUrArUrArArCrUrUrCrArArCr rUrGrArUGA CrArUrU (SEQ ID NO: 263) (SEQ ID NO: 264)

507 TGrGrUrUrGrArArGrUrUrArUrArArArGrArArU TArUrCrArUrCrArUrUrCrUrUrUrArUrArArCrUrUrCrArAr rGrArUrGAT CrCrUrU (SEQ ID NO: 265) (SEQ ID NO: 266) 531 TUrGrGrCrArArGrArArGrGrCrCrCrUrUrGrUr TGrUrCrCrArArCrArCrArArGrGrGrCrCrUrUrCrUrUrGrCr

GrUrUrGrGAC CrArUrU (SEQ ID NO: 267) (SEQ ID NO: 268) 540 TGrGrCrCrCrUrUrGrUrGrUrUrGrGrArCrUrGr TArUrArArUrGrArCrArGrUrCrCrArArCrArCrArArGrGrGr

UrCrArUrUAT CrCrUrU (SEQ ID NO: 269) (SEQ ID NO: 270)

"Sunayama et al. Cell Death and Differentiation 2004 (11): 771-781

Table 3: Exemplary sequences for PEM-3-LIKE siRNA

INCORPORATION BY REFERENCE

[0268] All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present disclosure, including any definitions herein, will control.

EQUIVALENTS

[0269] While specific embodiments of the subject disclosures have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosures will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the disclosures should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

CLAIMS:

1. An isolated, purified, or recombinant polypeptide complex comprising a PEM-3-LIKE polypeptide and a polypeptide selected from the group consisting of p32 polypeptide, FNBP3 polypeptide, and PCBPl polypeptide.

2. The polypeptide complex of claim 1 wherein the p32 polypeptide is selected from the group consisting of SEQ ID NO: 16 and a polypeptide encoded by any of SEQ. ID. NOS: 9, 10, 11, and 15.

3. The polypeptide complex of claim 1 wherein the FNBP3 polypeptide is selected from the group consisting of SEQ ID NO: 18 and a polypeptide encoded by any of SEQ. ID. NOS: 12 and 17.

4. The polypeptide complex of claim 1 wherein the PCBPl polypeptide is selected from the group consisting of SEQ ID NO: 20 and a polypeptide encoded by any of SEQ. ID. NOS: 13, 14 and 19.

5. The complex of any of claims 1-4 wherein the PEM-3-LIKE polypeptide is selected from the group consisting of SEQ. ID. NOS. 2, 4, 5, 6, 7, 8, 21, and 23, and a polypeptide encoded by any of SEQ ID NOS: 1, 3, or 24.

6. The complex of any of claims 1-4 wherein the PEM-3-LIKE polypeptide is a purified polypeptide.

7. The complex of any of claims 1-4 wherein the complex is purified from cells.

8. A method for identifying an agent that modulates PEM-3-LIKE polypeptide interactions comprising:

(a) forming a mixture comprising a test agent, a PEM-3-LIKE polypeptide and a polypeptide selected from the group consisting of p32 polypeptide, FNBP3 polypeptide, and PCBPl polypeptide; and (b) detecting the effect of the test agent on the interaction between PEM-3- LIKE polypeptide and a polypeptide selected from the group consisting of p32 polypeptide, FNBP3 polypeptide, and PCBPl polypeptide.

9. The method of claim 8 wherein the test agent is an agent with known or suspected antiviral activity.

10. The method of claim 8 wherein the test agent is an agent that modulates PEM-3-LIKE activity.

11. The method of claim 8 wherein the p32 polypeptide is selected from the group consisting of SEQ ID NO: 16 and a polypeptide encoded by any of SEQ. ID. NOS: 9, 10, 11, and 15.

12. The method of claim 8 wherein the FNBP3 polypeptide is selected from the group consisting of SEQ ID NO: 18 and a polypeptide encoded by any of SEQ. ID. NOS: 12 and 17.

13. The method of claim 8 wherein the PCBPl polypeptide is selected from the group consisting of SEQ ID NO: 20 and a polypeptide encoded by any of SEQ. ID. NOS: 13, 14 and 19.

14. The method of any of claims 8-13 wherein the PEM-3-LIKE polypeptide is selected from the group consisting of SEQ. ID. NOS. 2, 4, 5, 6, 7, 8, 21, and 23, and a polypeptide encoded by any of SEQ ID NOS: 1, 3, or 24.

15. A method of inhibiting a viral infection in a subject in need of such treatment comprising administering to the subject an agent that decreases the expression or activity of a p32 polypeptide.

16. The method of claim 15, wherein the viral infection is a human immunodeficiency virus type 1 (HIV-I) infection.

17. The method of claim 16, wherein said decrease in the function or expression of a p32 polypeptide results in decreased expression of HIV-I protein Gag.

18. The method of claims 15, 16, or 17, wherein the agent is selected from the group consisting of a polypeptide, antibody or antigen-binding fragment, small molecule, nucleic acid molecule, aptamer, ribozyme, chemical, prodrug, peptidomimetic compound, and organometallic compound.

19. The method of claim 18, wherein the agent is an antibody or antigen-binding fragment that specifically binds the p32 polypeptide.

20. The method of claim 18, wherein the agent is a small molecule that inhibits the function of the p32 polypeptide.

21. The method of claim 18, wherein the agent decreases the expression of the p32 polypeptide.

22. The method of claim 21, wherein the agent comprises a nucleic acid molecule.

23. The method of claim 22, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding the p32 polypeptide.

24. The method of claim 23, wherein the nucleic acid molecule comprises ribonucleic acids and mediates RNA interference.

25. The method of claim 24, wherein the nucleic acid molecule is selected from among SEQ ID NOS: 27 and 28, and SEQ ID NOS: 29 and 30.

26. A method for identifying an antiviral agent comprising:

(a) transfecting mammalian cells with a proviral genome; and

(b) decreasing expression or function of a p32 polypeptide by the addition of a test agent, and

(c) determining viral transcript or protein levels or viral infectivity, wherein a decrease in the level of viral transcript or protein or a decrease in viral infectivity indicates that the test agent is an antiviral agent, and wherein step (b) may optionally be performed before step (a).

27. The method of claim 27, wherein the test agent is a nucleic acid molecule that mediates RNA interference of p32.

28. The method of claims 26 or 27, wherein the proviral genome is the genome of a human immunodeficiency virus (HIV).

29. The method of claim 28, wherein the viral protein level determined in step (c) is the level of HIV-I protein Gag.

30. An antiviral agent comprising a nucleic acid molecule that decreases expression or function of a p32 polypeptide.

31. The antiviral agent of claim 30, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding the p32 polypeptide.

32. The antiviral agent of claim 31, wherein the nucleic acid molecule mediates RNA interference of p32.

33. The antiviral agent of claim 32, wherein the nucleic acid molecule is selected from among SEQ ID NOS: 27 and 28, and SEQ ID NOS: 29 and 30.

34. An antiviral agent that specifically binds to and decreases the function of a p32 polypeptide.

35. The antiviral agent of claim 34, wherein the antiviral agent is a small molecule.

36. The antiviral agent of claim 34, wherein the antiviral agent is a polypeptide.

37. The antiviral agent of claim 34, wherein the antiviral agent is an antibody or antigen-binding fragment.

38. A pharmaceutical composition comprising an agent that decreases the expression or function of a p32 polypeptide and a pharmaceutically acceptable carrier.

39. The pharmaceutical composition of claim 38, wherein the agent is selected from the group consisting of a polypeptide, antibody or antigen-binding fragment, small molecule, nucleic acid molecule, aptamer, ribozyme, chemical, prodrug, peptidomimetic compound, and organometallic compound.

40. The pharmaceutical composition of claim 39, wherein the agent is an antibody or antigen-binding fragment that specifically binds the p32 polypeptide.

41. The pharmaceutical composition of claim 39, wherein the agent is a small molecule that inhibits the function of the p32 polypeptide.

42. The pharmaceutical composition of claim 39, wherein the agent decreases expression of the p32 polypeptide.

43. The pharmaceutical composition of claim 42, wherein the agent comprises a nucleic acid molecule.

44. The pharmaceutical composition of claim 43, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding the p32 polypeptide.

45. The pharmaceutical composition of claim 44, wherein the nucleic acid molecule is an siRNA construct and mediates RNA interference.

46. The pharmaceutical composition of claim 45, wherein the nucleic acid molecule is selected from among SEQ ID NOS: 27 and 28, and SEQ ID NOS: 29 and 30.

47. A method of inhibiting a viral infection in a subject in need of such treatment comprising administering to the subject an agent that decreases the expression or activity of a PEM-3-LIKE polypeptide, wherein said decrease in the expression or activity of a PEM-3-LIKE polypeptide results in decreased expression of a viral protein Gag.

48. The method of claim 47, wherein the viral infection is a human immunodeficiency virus type 1 (HIV-I) infection.

49. The method of claims 47 or 48, wherein the agent is selected from the group consisting of a polypeptide, antibody or antigen-binding fragment, small molecule, nucleic acid molecule, aptamer, ribozyme, chemical, prodrug, peptidomimetic compound, and organometallic compound.

50. The method of claim 49, wherein the agent is an antibody or antigen-binding fragment that specifically binds the PEM-3-LIKE polypeptide.

51. The method of claim 49, wherein the agent is a small molecule that inhibits the activity of the PEM-3-LIKE polypeptide.

52. The method of claim 49, wherein the agent decreases the expression of the PEM-3-LIKE polypeptide.

53. The method of claim 52, wherein the agent comprises a nucleic acid molecule.

54. The method of claim 53, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding the PEM3-LIKE polypeptide.

55. The method of claim 54, wherein the nucleic acid molecule comprises an siRNA construct and mediates RNA interference.

56. A p32 antagonist for use in the treatment of viral disorders.

57. The antagonist of claim 56, wherein the antagonist comprises a nucleic acid molecule.

58. The antagonist of claim 57, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding a p32 polypeptide.

59. The antagonist of claim 58, wherein the nucleic acid molecule is an siRNA construct.

60. The antagonist of claims 56, 57, 58, or 59, wherein the viral disorder is human immunodeficiency virus (HIV).

61. A PEM-3-LIKE antagonist for use in the treatment of viral disorders.

62. The antagonist of claim 61 , wherein the antagonist comprises a nucleic acid molecule.

63. The antagonist of claim 62, wherein the nucleic acid molecule specifically hybridizes to a transcript encoding a PEM-3-LIKE polypeptide.

64. The antagonist of claim 62, wherein the nucleic acid moleucle is an siRNA construct.

65. The antagonist of claims 61, 62, 63, or 64, wherein the viral disorder is human immunodeficiency virus (HIV).

66. Use of a p32 antagonist for the preparation of a medicatment for use in the treatment of viral disorders.

67. Use of a PEM-3-LIKE antagonist for the preparation of a medicament for use in the treatment of viral disorders.

68. The use of claims 66 or 61, wherein the viral disorder is human immunodeficiency virus (HIV).