WO2007077627A1

WO2007077627A1 - Substance separating device and method of substance separation

Info

Publication number: WO2007077627A1
Application number: PCT/JP2006/300066
Authority: WO
Inventors: Takanori Anazawa; Shinji Kato
Original assignee: Kawamura Institute Of Chemical Research
Priority date: 2006-01-06
Filing date: 2006-01-06
Publication date: 2007-07-12

Abstract

A substance separating device that is capable of continuously highly separating two or more substances contained in a fluid. There is provided a substance separating device comprising separation flow channel (3) through which a fluid as a sample passes, first outflow aperture (6) formed at a downstream end of the separation flow channel (3) and first holding member (1) capable of holding a first substance, disposed at a region of wall surface on the side of first outflow aperture (6) of the separation flow channel (3). In the substance separating device, such separation flow channels (3) in multi-stages are connected to each other.

Description

Specification

Substance separation device and substance separation method

Technical field

[0001] The present invention relates to a substance separation device capable of continuously separating substances contained in a fluid.

And a substance separation method capable of continuously separating substances contained in a fluid.

Background art

A microfluidic device performs a reaction in a reaction field such as a minute capillary channel. This microfluidic device has few by-products, greatly increases the reaction speed of heterogeneous reaction systems, can construct a continuous reaction device, can perform reactions with a small amount of reagent, and operates in parallel It is suitable for screening synthetic reactions because it is easy. In addition, when optimum conditions are found, there is a feature that production is possible immediately with a numbering-up system without considering scale-up, and it is expected to be a chemical reaction device in the future.

[0003] Many of the applications of the microfluidic device described above require separation of the synthesized product, but the high-efficiency separation means that can be incorporated into the microfluidic device is limited. Two or more substances contained in a fluid incorporated into a microfluidic device, for example, two or more fluids that are uniformly mixed, a solute and a solvent, two or more solutes in a solution, a dispersoid and a dispersion medium, Examples of methods for separating two or more kinds of dispersoids in a dispersion liquid, and fragments and solutes in a solution from each other for the purpose of concentration, purification, recovery, analysis, etc. include dialysis, chromatography, and electrophoresis. Are known. Among these, chromatography can be performed only by the force batch method that can increase the number of separation stages. Therefore, a control device capable of precise time control such as a sorting device and a flow path switching valve is required. . Furthermore, there is a problem when the processing amount is insufficient as a method for concentrating, refining, and collecting production equipment. Electrophoresis is capable of continuous separation. Force separation targets are limited to charged substances. Further, since bubbles are generated by electrolysis of water, there is a problem that it is difficult to incorporate the microfluidic device together with other mechanisms. Dialysis can be separated continuously, but the processing speed is slow. However, in order to separate molecules, there is a problem that the resolution is low and a large amount of dialysate is required.

[0004] In addition, a column-type adsorption separation method is known as a normal scale separation method. However, if this method is to be carried out with a microfluidic device, it is necessary to switch between the original solution and the washing solution on the introduction side, and the switching operation between the concentrated solution and the dilution solution on the outflow side, and a valve for that purpose. In addition to requiring an expensive microfluidic device with a structure, there are problems that it is difficult to perform a large number of parallel operations, which is a feature of microfluidic devices.

[0005] On the other hand, in Patent Document 1 filed by the present inventors, liquid-liquid mass transfer is performed by bringing a small amount of liquids that are not miscible with each other into contact with each other in a layered manner and stably flowing, and thereafter There is disclosed a micro chemical device capable of continuously separating and recovering a liquid once again in contact with the soot. This micro chemical device has a capillary channel inside, and the inner surface of the channel has a low contact angle part with a contact angle with water of 25 ° or less and a contact angle with water with a low contact angle part. It has a high contact angle portion that is 10 ° or more higher than the above, and the low contact angle portion and the high contact angle portion are continuously connected across the upstream end and downstream end of the flow path. However, this is a device for introducing two types of liquids that are not miscible with each other into the flow path, making them come into contact with each other in a layered manner, and allowing them to flow in a stable manner. There is no description of the separation, nor is there any disclosure of the configuration for performing the separation.

[0006] In addition, Patent Document 2 filed by the present inventors discloses a micro chemical device capable of continuously extracting and oil-water separation by contacting a minute amount of liquid that is immiscible with each other and then separating them. ing. This microchemical device has a capillary channel inside thereof, and at the downstream end of the channel, the inner surface has a low contact angle portion where the contact angle with water is 25 ° or less, and the contact angle with water. Has a liquid separation chamber that has a high contact angle portion that is 10 ° or more higher than that of the low contact angle portion, and a cross-sectional area that is 2 to: LOOO times that of a capillary channel. An outflow path is formed for each of the contact angle portion and the high contact angle portion. However, in this case as well, the two liquids that are immiscible with each other are introduced into the flow path, and the two liquids are separated and discharged in the separation chamber. It does not describe the separation of substances contained in the solution, but also discloses the configuration for performing the separation. It has not been.

Patent Document 1: Japanese Patent Laid-Open No. 2001-137613

Patent Document 2: JP 2000-262871 A

Disclosure of the invention

Problems to be solved by the invention

[0007] The problem to be solved by the present invention is that valve operation is required for two or more kinds of substances in the fluid, such as two or more kinds of fluids uniformly mixed, a solute and a solvent, and two or more kinds of solutes. The object is to provide a material separation device and a material separation method capable of continuous high-level separation.

Means for solving the problem

[0008] The inventor forms a first holding part capable of holding the separation target substance on one side of the inner surface of the separation channel through which the fluid as the sample flows, and in the vicinity of the first holding part Increase the concentration of uptake and release of the separation target material, and form a first outlet and a second outlet on the downstream end of the separation channel on the side closer to and farther from the first holding part, respectively. From the first outlet, the fluid in which the substance to be separated is concentrated, from the second outlet, the substance to be separated is diluted, and Z or a substance other than the substance to be separated is concentrated. It was found that fluids can be separated by taking out each one.

[0009] That is, the present invention is a micro device for separating a first substance and a second substance in a fluid from each other, the separation channel for circulating the fluid, and a downstream end of the separation channel. A first outlet and a second outlet formed, and a first holding portion provided on a part of a wall surface on the first outlet side of the separation channel, which can hold the first substance. A material separation device is provided.

[0010] Further, the present invention is a method for separating a first substance and a second substance in a fluid from each other, and (I) a first holding part capable of holding the first substance is provided in a part of a wall surface. A step of allowing the fluid to flow into the separation channel; (i) a step of incorporating the first substance into the first holding part; and (III) releasing the first substance from the first holding part. The concentrated solution of the first substance is taken out from the downstream end force of the first holding part, and the diluted solution of the first substance and Z or the concentrated solution of the second substance are taken downstream of the first holding part. Remove from the other end of the end And a method for separating the substance.

The invention's effect

[0011] The present invention concentrates two or more substances contained in a state dissolved in a fluid, for example, two or more uniformly mixed fluids, a solute and a solvent, and two or more solutes in a solution. Provided are a substance separation device and a substance separation method that can be separated from each other for the purpose of purification, recovery, removal, analysis, and the like. In addition, it is possible to provide a substance separation device and a substance separation method that can be separated continuously by a batch method that requires flow path switching and valve operation. Therefore, the operation of collecting a sample with a time control program such as chromatography does not need to switch the flow path switching valve as in the case of column-type adsorption separation. In addition, since the substance separation device of the present invention can obtain a high-concentration separation liquid simply by connecting it in multiple stages, it can be used for each stage as in the case of stacking conventional membrane separation devices. Since a pump is not required, it is easy to incorporate the pump into a microfluidic device and create a single micro 'total' analysis 'TAS'.

Brief Description of Drawings

[0012] [Fig. 1] A three-dimensional embodiment material separation device. (A) is a plan view, and (b) is a side sectional view taken along the line α-α in (a).

FIG. 2 is a material separation device of a semi-stereoscopic embodiment. (A) is a plan view, (b) is a side sectional view taken along line j8-j8 in (a), and (c) is a side sectional view taken along line γ-γ in (a).

[FIG. 3] A material separation device of a planar type embodiment. (A) is a plan view, (b) is a side view, and (c) is a side sectional view taken along line δ-δ in (a).

[FIG. 4] The substance separation device of Example 1. (A) is a top view, (b) is a side view.

FIG. 5 is a plan view of a material separation device produced in Example 2 by a three-dimensional stepwise arrangement.

6 is a side sectional view taken along the line ε—ε in FIG.

FIG. 7 is a plan view of the first outer layer.

FIG. 8 is a plan view of the inner layer.

FIG. 9 is a plan view of a second outer layer. FIG. 10 is an exploded perspective view of a separation channel and a communication channel.

FIG. 11 is a partial plan view of the substance separation device of Example 3.

FIG. 12 is a side sectional view of the substance separation device of Example 3.

FIG. 13 is a side cross-sectional view of the substance separation device of Example 4.

Explanation of symbols

[0013] 1 1st holding part 2 ··· 2nd holding part 3 · · Separation channel 5 · · Inlet 6 1st outflow 7

· · First outlet 8, 18, 38, 48 · · Communication channel 15 · · Inlet 16 · · Second outlet 17 · · Second outlet 33, 34 · · Porous layer, silica gel layer 36 · · Spacers 42, 43, 44 · · Extraction flow path

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings. In each drawing used in the following description, the scale of each member is appropriately changed to make each member a recognizable size. Structures having the same objective function are indicated by the same numbers.

[0015] The substance separation device and the substance separation method of the present invention separate at least two substances in a fluid containing two or more substances, that is, at least a first substance and a second substance from each other. Provide devices and methods. Here, the first substance and the second substance in the solution may be either a liquid substance or a solid substance in a single state. In addition, the fluid in which these substances are dissolved may be one in which either substance dissolves the other substance or both substances are dissolved in the third solvent. That is, examples of the first substance and the second substance include two fluids in a mixed fluid composed of two or more fluids, a solute and a solvent, and two kinds of solutes in a solution. Examples of the above mixed fluid include a mixture of a water-soluble organic liquid such as N, N-dimethylformamide, N, N-dimethylacetamide, N, N-dimethylsulfoxide, acetone, isopropyl alcohol, and ethanol, and trihalomethane. And dilute aqueous solutions of organic liquids that dissolve in trace amounts of water. Examples of solutes and solvents include aqueous solutions of biochemical substances such as poly (or oligo) nucleotides, sugar chains, poly (or oligo) peptides (herein aqueous solutions include buffer solutions), various chemical substances Examples include aqueous solutions and organic solvent solutions. Examples of two or more solutes include poly (or oligo) nucleotides having different base sequences, sugar chains having different sequences, poly (or oligos) having different sequences. ) Biochemical substances such as peptides, optical isomers, products and by-products of synthetic reactions, and various other chemical substances. Among these, the separation method of the present invention is effective particularly in a system with a low concentration. For example, an aqueous solution of the above biochemical substance, a water-soluble solvent dissolved in a small amount in water, and the like.

[0016] Hereinafter, in order to avoid complicated explanation, the case where the fluid is a liquid and the separation target substances are two types (first substance and second substance) will be described as an example. At this time, the first substance and the second substance may be any two substances in the liquid, for example, two kinds of solutes dissolved in a common solvent may be V, Two or more fluids that are uniformly mixed may be used, and may be a solvent and a solute. In particular, two types of solutes dissolved in the solvent will be described. The case of separating three or more substances will be explained in the specific mechanism and method section below.

[0017] [Basic configuration of substance separation device]

The basic structure of the substance separation device of the present invention is a microdevice for separating a first substance and a second substance in a fluid from each other, the separation channel for circulating the fluid, and the separation channel. A first outlet and a second outlet formed at the downstream end, and a first holder capable of holding the first substance provided on a part of the wall surface on the first outlet side of the separation channel. Part. Preferably, the separation channel further includes a second holding part provided on a part of the wall surface on the second outlet side of the separation channel and capable of holding the second substance. Hereinafter, the configuration will be described with specific examples.

[0018] [Three-dimensional type]

FIG. 1 is a diagram of a three-dimensional material separation device according to an embodiment of the present invention, in which FIG. 1 (a) is a plan view, and FIG. 1 (b) is a side sectional view taken along the line α-α. In the material separation device 100 of this embodiment, a first outer layer 22 and a second outer layer 24 are laminated on both surfaces of the inner layer 23, respectively, and a base material 21 is laminated on the outer side of the first outer layer 22, and the first outer layer 22 is laminated. 2 A cover layer 25 is laminated outside the outer layer 24. Further, the separation channel 3 is formed in the inner layer 23, and the first holding part 1 is formed on the inner surface of the separation channel 3 on the first outer layer 22 side. One end of the separation channel 3 in the length direction is an inlet 5, a hole that penetrates the base material 21 and the first outer layer 22 and communicates with the inlet 5 is formed as an inlet 15. . In the first outer layer 22, the flow of the separation channel 3 is A communication channel 8 that connects the outlet 6 and the first outlet 7 is formed, and a communication channel 18 that connects the outlet 16 of the separation channel 3 and the second outlet 17 is formed in the second outer layer 24. Is formed. The first outlet 7 is formed as a hole that penetrates the base material 21 and communicates with the communication channel 8 formed in the first outer layer 22, and the second outlet 17 is the base material 21, the first It is formed as a hole that penetrates the outer layer 22 and the inner layer 23 and communicates with the communication channel 18 formed in the second outer layer 24. That is, the fluid introduced from the inlet 15 enters the separation channel 3 from the inlet 5 and flows through the separation channel 3, and part of the fluid flows upward from the first outlet 6 in the figure, It flows out of the substance separation device from the first outlet 7 through the communication channel 8. In addition, the remaining part flows out from the second outlet 16 downward in the figure, then flows out of the substance separation device from the second outlet 17 through the communication channel 18.

[0019] The material constituting the inner layer 23, the first outer layer 22, the second outer layer 24, the base material 21, and the cover layer 25 is arbitrary, for example, a metal such as glass or stainless steel, or a semiconductor such as silicon. Crystals such as quartz, ceramics, carbon, and organic polymers can be used. Although the organic polymer may be classified strictly as an inorganic polymer, such as polydimethylsiloxane, it usually includes those treated as an organic polymer. Each of these materials has short and long, and a suitable material may be selected according to the target separation system. In particular, the organic polymer has a high degree of freedom for adjusting the retaining property of the inner wall of the flow path, which will be described later, and is likely to have a high retaining property. Therefore, particularly high heat resistance is preferable except for a system that requires organic solvent resistance. After the organic polymer, it is preferable to select a glass that can relatively easily adjust the retention of the inner wall of the channel.

[0020] The substance separation device 100 is configured by adhering a base material 21, a first outer layer 22, an inner layer 23, a second outer layer 24, and a cover layer 25 in a tightly stacked state. The fixing may be bonding with an adhesive, may be fixing without using an adhesive, or may be fixed with screws or clamps in a state where each layer is liquid-tight. . In addition, for example, each layer is integrally formed without forming each layer separately by a method such as a micro photo molding method, and each layer may not be recognized as a layer. For example, a method such as injection molding, cutting or etching Thus, a plurality of the above layers, for example, the base material 21 and the first outer layer 22, and the second outer layer 24 and the cover layer 25 are formed as integrally molded members, respectively. Is Each layer may not be recognized as a layer. The outer shape of the substance separation device 100 is arbitrary, and may be, for example, a plate shape (including a straight plate shape and a curved plate shape), a sheet shape (including a film, a belt, a ribbon, etc.), a rod shape, and a spherical shape. Among these, the plate shape or the sheet shape is easy to manufacture, can be easily integrated with other microfluidic devices, and can increase and decrease the heating / cooling speed in the case of usage methods that raise and lower the temperature. Favored ,.

[0021] (Separation flow path)

In the inner layer 23, a capillary separation channel 3 is formed as a missing portion of the layer. The cross-sectional shape of the separation channel 3 is arbitrary, and may be, for example, a rectangle such as a square or a rectangle, a trapezoid, a triangle, a pentagon, a hexagon, a circle, or a semicircle. Among these, a rectangular shape, a trapezoidal shape, or a semicircular shape is preferable for ease of production. In the case of a cross-sectional shape having corners, the corners may be rounded.

[0022] In the case where the substance separation device of the present invention is configured by laminating the outer layer on both sides of the inner layer as described above, the separation channel is configured by the through groove of the inner layer. It is preferable because it is easy to design. In the case of a multi-stage structure, which will be described later, a communication flow that connects an outlet in the upstream separation channel and an inlet in the downstream separation channel to the outer layer laminated on the inner layer. It is preferable that the road is formed in the outer layer.

[0023] (first holding part)

The inner wall of a part of the circumference of the cross section of the separation channel 3 can hold the first substance that is the separation target, and preferably has a higher holding ability than the second substance with respect to the first substance that is the separation target. The first holding part 1 is formed, which exhibits higher retention than the other part of the inner wall with respect to the first substance. “Retention” as used herein may be based on any interaction such as adsorption, absorption, swelling, hydration, hydrophobic bond, hydrogen bond, electrostatic force, dielectric interaction and the like. The first holding unit 1 may be an adsorbent fixing unit such as activated charcoal, zeolite, silica gel, surface-modified silica gel, and alumina when the holding property is based on adsorption. When the retention is based on absorption, it may be an absorbent fixing part such as a porous organic polymer or a porous gel. When the retention is based on swelling, it can be, for example, a fixed part of a temperature-responsive gel having a gel Z solid transition temperature. When the retention is based on hydration, for example, polysaccharides or ionic groups It can be a fixed part. When the retention is based on a hydrophobic bond, it may be a fixed part of a hydrophobic porous body such as activated carbon or hydrophobic silica gel. When the retention is based on hydrogen bonding, it can be a fixing part of a hydrophilic adsorbent such as silica gel. When the holding property is based on static electricity, it may be a fixing part of a porous body having a cation group anion machine on the surface. Of course, the holding property of the first holding unit 1 may be based on a plurality of types of these interactions.

When the first substance is a biochemical substance in particular, the first holding unit 1 can be a probe fixing site having a molecular recognition function that exhibits a selective affinity for the first substance. For example, when the first substance is DNA, the first holding unit 1 can be an immobilized surface of probe DNA having a base sequence complementary to the DNA. The probe can be a chemical substance, biochemical substance, biological tissue, or the like. The selective affinity can be, for example, an antigen and antibody, an enzyme and a substrate, or an allele of a polynucleotide. The first holding part is also preferably an adsorption site having stereoselectivity, for example, an optically active substance recognition adsorption site. The part into which the first substance is taken in may be the surface and Z or the inside of the first holding part.

[0024] Here, "can be held" means that it is taken in and released into the first holding unit, for example, adsorption and desorption when the interaction is adsorption, and absorption and desorption when the interaction is absorption. It is possible to say that even after a long period of operation, more first substance is taken up and released. Therefore, if the first substance is taken in but is not released by being fixed to the first holding part, it will not function as an uptake site after flowing a sufficiently large amount of sample solution, so it cannot be “held”. . It is preferable that the first holding unit 1 has a large amount of uptake and release because the separation efficiency is improved and a high-concentration stock solution can be separated.

[0025] The retention may occur as an equilibrium under a constant temperature condition, for example, as in a chromatographic carrier, and uptake and release may occur by changing the temperature. A suitable degree of uptake and release may be selected according to the separation method of the present invention. Interactions in which uptake and release can occur particularly efficiently by changing temperature include adsorption, absorption on temperature-responsive gels with gel Z solid transition, and hybridization of poly (or oligo) nucleotides. And denoising hybridization and hydrogen bonding. The amount that the first holding unit can hold the first substance is a suitable level depending on the separation conditions, for example, the concentration of the first substance in the raw fluid and the concentration of the first substance in the target separation / concentrate. The amount of the first substance in the raw fluid introduced into the separation channel is preferably 3 times or more of the preferred amount, more preferably 10 times or more of the preferred amount. By setting it within this range, separation can be carried out efficiently, and a concentrated solution having a high concentration can be obtained. The upper limit of the amount that the first holding part can hold the first substance is naturally limited, but it is not necessary to set an upper limit because it is high in itself. For example, it is also preferable that the amount of the first substance in the raw fluid introduced into the separation channel is 1000 times or 10,000 times.

[0026] The surface shape of the first holding part 1 is arbitrary, and a smooth surface, a concavo-convex structure, a surface on which powder is fixed, a surface on which porous body powder is fixed, a porous layer, and a layered gel are fixed. The structure may be a structure in which a porous gel is fixed, a structure in which a chain polymer dissolved in a solution to be separated is chemically bonded to a channel wall, or the like. Among these, a surface having a porous body that can take a large surface area in order to increase the amount of fixation of a probe or the like, that is, a porous powder fixing surface or a porous layer is particularly preferable. The thickness of the porous layer is preferably 1 μm or more, more preferably 3 μm or more, and most preferably 5 μm or more. Further, the thickness of the porous body preferable in relation to the height of the separation channel is 1Z100 or more, more preferably 1Z30 or more, and most preferably the surface force on which the porous body is formed is the distance to the opposing surface of the channel. Preferably it is 1Z10 or more. The upper limit of the thickness of the porous body is the distance to the position, as close as possible to the opposed surface of the flow path. Separation efficiency can be increased by using a porous body having the above thickness.

[0027] The porous body is optional as long as it is a so-called continuous porous body in which pores communicate at least in the depth direction. The pore shape is, for example, a sponge (sponge) composed of cellular cavities communicating with each other, a giroid structure in which the structure of the pore and the structure is equivalent, or a gap between the powder particles fixed in contact with each other. It may be a formed sintered body, a bundle of channels such as a plurality of capillaries or slits parallel to each other, a gap between fibers of a nonwoven fabric or a woven fabric, and the like.

[0028] Although the average pore diameter of the porous body is arbitrary, it is preferably smaller than the diameter of the separation channel 3, preferably 0.1-50 111, more preferably 0.5-20 111. preferably 1, ₀ will have the time to mix the materials by diffusion and Ru this range less than der, separation efficiency is lowered. Mako If the above range is exceeded, the number of adsorption sites decreases, so the separation efficiency also decreases. If the cross section of the separation channel 3 is completely occupied by the porous body that is the first holding part 1 and the porous body that is the second holding part 2, and there is no other space, these The pore diameter of the porous body is preferably 3 to 50 111, more preferably 5 to 20 / ζ πι. Below this range, the pressure loss becomes excessive.

[0029] The material of the porous body may be any material as long as it can form a porous body. For example, silicon oxide, alumina, zeolite, glass, ceramic, carbon, metal, organic polymer, etc. A suitable material may be selected. Among these, an organic polymer is preferable because a porous body can be easily formed and surface characteristics can be easily controlled. Among them, the active energy ray-curable resin is particularly preferable because it is easy to form a porous body in the minute separation channel 3. As the porous body made of active energy ray-curable resin and the production method thereof, for example, those described in JP-A-7-316336 filed by the present inventors can be used. In this method, first, an energy beam polymerizable compound and a phase separation agent that dissolves the compound but does not dissolve or swell the polymer are formed on the wall of the separation channel where the porous body is to be formed. Coat the mixture. Next, the coating portion is irradiated with active energy rays such as ultraviolet rays, and the energy ray polymerizable compound is polymerized and cured, and at the same time, phase separation is performed to form a porous body, and a phase separation agent in the porous is formed. It is to be removed by washing. As the energy beam polymerizable compound, for example, a monomer or an oligomer having an taliloyl group or a maleimide group can be preferably used. In addition, when the material of the porous body is a material other than the active energy ray-curable resin, for example, one component of the Zirgel method, the wet phase separation method, the dry phase separation method, and the co-continuous microphase separator Known methods according to each material such as elution removal method and powder sintering method can be used.

The first holding part 1 occupies a part of the inner wall of the circumference of the cross section of the separation channel 3 and is substantially continuous in the length direction of the separation channel 3. At this time, the first holding unit 1 is preferably substantially parallel to the flow direction of the fluid flowing through the separation channel 3, but is preferably completely parallel. Further, the first holding unit 1 may have a partly interrupted place, but it is preferable that the first holding part 1 not be interrupted. By doing in this way, resolution can be improved.

[0031] The range that the first holding unit 1 occupies on the circumference of the cross section of the separation channel 3 is arbitrary. 0 to 50% is preferable. When the cross-sectional shape of the separation channel 3 is rectangular, the first holding part 1 is preferably formed as one side of the longer side. At this time, the average distance from the formation surface of the first holding part 1 to the opposing surface is preferably 1 to 500 μm, more preferably 3 to 300 μm, and even more preferably 5 to 150 / ζ πι. 5-: LOO / zm is most preferable. Below this range, pressure loss increases, requiring a large pump and reducing the separation throughput. On the contrary, if it exceeds this range, it takes time for the separation operation and the separation efficiency decreases. There may be a portion other than this distance in the length direction of the separation channel. Further, the distance from the first holding part 1 to the facing surface means the distance to the surface facing the surface force of the thickness when the holding part has a thick structure such as a porous body. However, as described later, when the separation channel 3 has the second holding part, and the first holding part and the second holding part are both porous layers, these surfaces are in contact with each other. good. It is also preferable that the distance from the first holding portion 1 to the facing surface of the separation channel 3 is large near the outflow ports 6 and 16 that are small near the inflow port 5. At this time, it is also preferable that the distance is less than the average distance in the vicinity of the inlet 5, and it is also preferable that the average distance is exceeded in the vicinity of the outlet. By adopting such a structure, the resolution and separation efficiency can be increased.

[0032] The material separation device 100 is formed in a plate shape or a sheet shape, the stream lines of the separation channel 3 are arranged in parallel to the plate surface or the sheet surface, and the first holding unit 1 is the plate surface or the sheet. Forming parallel to the surface is most preferable for ease of manufacturing. Next, it is preferable that the first holding portion 1 is provided perpendicularly to the plate surface or the sheet surface because manufacturing is relatively easy. In addition, the formation surface of the first holding portion 1 may be different for each separation channel or each stage of the separation channel.

[0033] One length of each separation channel 3 is preferably an arbitrary force of 10 μm to 30 cm, more preferably 50 / ζ πι to 10 cm, and even more preferably 100 m to 3 cm. The preferred length of the separation channel 3 depends on the distance between the first holding part 1 and the second holding part 2, and is 2 to 2 times the average distance between the first holding part 1 and the second holding part 2. : L000 times preferred 3 to: L00 times more preferred 5 to 50 times Strength S More preferred. By setting this range, it is possible to construct a material separation device having sufficient separation ability and good space factor.

[0034] At least a part of the inner wall of the separation channel 3 other than the first holding portion has the second substance with respect to the second substance. It is also preferable to provide the second holding part 2 which shows higher holding ability than the one holding part and which shows higher holding ability than the other part of the inner wall with respect to the second substance. That is, the first holding part and the second holding part

, Different retention properties for the substances to be separated. For example, when the substance to be separated is two types of DNA having different base sequences, the first holding unit 1 is a surface of a probe DNA that has a complementary base sequence to one of the DNAs. The second holding part 2 can be the surface of the probe DNA fixed base having a base sequence complementary to the other DNA. Thus, when the substance to be separated is a biochemical substance in particular, the first holding part 1 and the second holding part 2 are probes having different selective affinities for these biochemical substances. It can be. The details of the retention and affinity that the second holding part shows for the second substance are the same as those shown by the first holding part 1 for the first substance. The affinity between the first substance and the first holding part and the affinity between the second substance and the second holding part may be different.

By providing the second holding part, it is possible to further increase the selectivity and efficiency of separation.

For example, when the first substance path and the second substance are two kinds of solutes in the solution, such as when the second substance is two kinds of solutes in the solution, the device having only the first holding part is provided. In the solution, the first substance in the solution is concentrated, but the second substance is not diluted, and the concentration of the second substance remains unchanged.Therefore, no matter how high the concentration of the first substance, the purity of the first substance There are limits to improvement. However, by providing the second holding portion, the concentration of the first substance and the dilution of the second substance can be performed simultaneously, so that the purity of the first substance and the second substance can be increased. Thus, the separation device provided with the second holding part is particularly suitable for separating two kinds of solutes in the solution.

When the second holding part 2 is formed, the first holding part 1 and the second holding part 2 occupy different ranges on the circumference of the cross section of the separation channel 3 and intersect each other. Each of them is substantially continuous in the length direction of the separation channel 3. The second holding unit 2 is also the same as the first holding unit 1 in terms of parallelism and continuous state with respect to the flow direction of the fluid flowing through the separation channel 3.

[0037] In the case where the second holding part 2 is formed, the range occupied by each on the circumference of the cross section of the separation channel 3 is larger as much as possible, and the amount of the substance to be separated increases. Therefore, it is preferable. The first holding part 1 and the second holding part 2 are in contact with each other on the circumference of the channel cross section. However, a boundary region (non-holding portion or third holding portion) having different holding properties is provided at the boundary portion between the first holding portion 1 and the second holding portion 2. In order to prevent re-mixing of the first substance and the second substance, both holding force is released. Therefore, it is preferable that the wall surface of the separation channel includes a pair of parallel surfaces, and the first holding unit and the second holding unit are provided on the pair of parallel surfaces. For example, when the cross-sectional shape of the separation channel 3 is rectangular, the first holding part 1 and the second holding part 2 are formed on opposite long sides, and the two short sides are used as boundary regions. Is preferred. When the material separation device has a layered structure, the first holding part and the Z or second holding part are manufactured when the structure is provided on the surface on the inner layer side in the outer layer. It is easy and preferable. At this time, the average distance between the first holding unit 1 and the second holding unit 2 is the same as the distance from the first holding unit to the facing surface when the second holding unit is not provided.

[0038] However, when the separation channel 3 has the second holding part and both the first holding part and the second holding part are porous layers, these surfaces may be in contact with each other. When in contact with each other, the fluid flows only inside the porous layer. The second holding part is formed, and the cross section of the separation channel 3 is completely occupied by the porous body that is the first holding part 1 and the porous body that is the second holding part 2. When there is no space, the influence of the cross-sectional shape of the separation channel 3 on the separation performance and separation efficiency is relatively small. In this case, it is preferable to adopt a shape that is easy to manufacture as the cross-sectional shape of the separation channel 3, and in particular, a rectangle, trapezoid, circle, or ellipse is preferable.

[0039] When the second holding part is provided, the surface state of the second holding part is the same as that of the first holding part. The thicknesses of the porous bodies of the first holding unit 1 and the second holding unit 2 do not have to be the same, but are preferably the same in terms of increasing the separation ability. Further, when the first holding part and the second holding part are formed of a porous body, the distance between these surfaces is preferably 100 m or less. In addition, when the pressure loss of the fluid flowing through the porous body whose pore diameter is large, for example, 3 to 50 m is not so high, the porous bodies of the first holding unit 1 and the second holding unit 2 The thickness of the first holding part 1 and the second holding part 2 is preferred, where the sum of the body thicknesses is equal to the height of the separation channel and the porous body is completely in contact. More preferably, the distance to the opposing wall of the flow path is ½. With this form By doing so, the resolution can be increased.

[0040] (Inlet)

In the present embodiment of FIG. 1, the inlet 5 is provided on the first holding part 1 side at the upstream end of the separation channel 3, but at any position in the cross section of the separation channel. May be provided. For example, the first holding part 1 may be provided on the opposite surface side or the side surface side, or may be provided in the same cross-sectional shape as the separation channel cross section. The inlet 5 may form the separation device as a part of the microfluidic device, and may be connected to other mechanisms in the microfluidic device, such as a pump mechanism or a valve mechanism. When this separation device is connected in multiple stages, it may be connected to the outlets of all stages.

[0041] (First outlet and second outlet)

The separation flow path 3 is formed with a first outlet 6 through which a fluid enriched in the first substance to be separated flows out and a second outlet 16 through which the fluid diluted with the first substance flows out. Yes. The first outlet 6 is disposed in the cross section of the separation channel in the vicinity of the first holding part 1, and the second outlet 16 is connected to the first holding part 1 from the first outlet. Located far away. Preferably, in the same cross section, the first outlet 6 is disposed at a position in contact with the first holding portion 1, and the second outlet 16 is disposed at a position in contact with the opposing surface. More preferably, the first outlet 6 is disposed inside the first holding part 1, and the second outlet 16 is disposed at a position in contact with the facing surface.

[0042] When the second holding part 2 is formed, the first outlet 6 preferably contacts the first holding part 1 and does not contact the second holding part 2 in the same cross section. The second outlet 16 is disposed at a position where it contacts the second holding part 2 and does not contact the first holding part 1. More preferably, the first outlet 6 is arranged inside the first holding part 1 and the second outlet 16 is arranged inside the second holding part 2.

[0043] Of course, it is preferable that each outlet is provided at the downstream end of the separation channel 3 because the loss of the dead volume is prevented and the reduction of the separation performance is prevented. Therefore, in the present embodiment, the first outlet 6 is formed at the downstream end of the first holding unit 1, and the second outlet 16 is formed at the downstream end of the opposing surface of the first holding unit 1. In this way, both outlets are provided on the opposing surface of the inner wall of the separation channel 3 so that the fluid flows out from the first outlet 6 and the second outlet 16 in opposite directions. Force remixing near the outlet Is preferable, and the separation performance is increased. In addition, the above flow In order to prevent remixing due to diffusion of the first substance and the second substance in the vicinity of the outlet and thereby reducing the separation ability, the length of the outlet in the longitudinal direction of the separation channel is preferably short. It is also preferable to increase the flow velocity at this portion by making the cross-sectional area of each outlet smaller than the cross-sectional area of the separation channel, preferably less than 1Z2.

[0044] Regarding the arrangement of the first holding portion and its opposing surface, the first outlet and the second outlet, and the communication channel, there may be, for example, the following two forms other than the above three-dimensional type.

[0045] [Semi-solid]

Fig. 2 is an explanatory view of the semi-solid embodiment, Fig. 2 (a) is a plan view, Fig. 2 (b) is a side sectional view taken along line j8-j8 in Fig. 2 (a), and Fig. 2 ( c) is a cross-sectional side view taken along line γ-γ in Fig. 2 (a). In the semi-three-dimensional type, the inner layer 23 is composed of two layers of a base material side inner layer 23a and a cover layer side inner layer 23b, and the first outer layer 22 and the second outer layer 24 are omitted. The deficient portions that form the separation channel 3 formed in the base material side inner layer 23a and the cover layer side inner layer 23b are combined to form a substantially rectangular separation channel 3, and the base of the separation channel 3 is formed. The first holding part 1 is formed on the surface on the material 21 side.

[0046] The thickness of the substrate-side inner layer 23a on the first holding unit 1 side in the cross section at the downstream end of the separation channel 3 is the first outlet 6 and is opposed to the first holding unit. The thickness of the cover layer side inner layer 23b on the surface side is the second outlet 16. On the other hand, the base-side inner layer 23a is provided with a communication channel 8 that communicates from the first outlet 6 to the first outlet 7, and the cover-side inner layer 23b has a second outlet 16 from the second outlet 16. A communication channel 18 that communicates with the outlet 17 is provided. That is, up to the separation channel 3 and the outlets 6 and 16, which are the downstream ends of the separation channel 3, the defect portions of the base-side inner layer 23a and the cover-side inner layer 23b are completely overlapped, and the cross section is rectangular [Fig. (b)], as it progresses downstream from outlets 6 and 16, it slightly shifts laterally in the plane [Fig. 2 (c)], and finally becomes mutually independent communication channels 8 and 18. .

[0047] In the semi-solid type, when the cross-sectional shape of the outlets 6 and 16 is large with respect to the height, the concentrated liquid containing the substance desorbed from the first holding unit 1 is discharged from the first outlet 6. Before it flows out, it tends to reduce the resolution by remixing with the diluent flowing out from the second outlet 16. Further, when the second holding part is provided, before the substances detached from the first holding part 1 and the second holding part 2 respectively flow out from the first outlet 6 and the second outlet 16, respectively. Remix and resolution Tends to be reduced. In order to prevent this, the cross-sectional shape of the outlets 6 and 16 is preferably such that the ratio of height Z width is 0.5 or more, more preferably 0.7 or more, and most preferably 1 or more. The upper limit of the ratio of height to Z width is preferably as high as possible, but there is no need to set any particular restrictions. However, from the viewpoint of ease of production, 10 or less is preferred, and 5 or less is more preferred. 3 The following is most preferred. In addition, in order to prevent a decrease in resolution due to remixing, it is preferable that the first outlet 6 and the second outlet 16 are bent in opposite directions with a curvature as shown in FIG. .

[0048] When the ratio of the height Z width of the separation channel 3 is smaller than the ratio of the height Z width of the outlet, the width is gradually increased so as to become the ratio as approaching the outlet. It is preferable to narrow. Even in the semi-three-dimensional shape, the second holding part 2 may be formed on the opposing surface of the first holding part 1 of the separation channel 3 as necessary.

As another mode of the outlet in the semi-three-dimensional type, the first outlet 6 and the second outlet 16 may be provided on the side surface of the downstream end of the separation channel 3. In this embodiment, the communication channel 8 and the communication channel 18 are connected at right angles to the opposing side surfaces of the downstream end of the separation channel 3. Also in this case, the ratio of the height Z width of the outlet is preferably as described above. In addition, it is preferable that the width of the separation chamber is gradually narrowed as it approaches the outlet.

[0049] [Plane type]

FIG. 3 is an explanatory view of a flat type, FIG. 3 (a) is a plan view, and FIG. 3 (b) is a side view. In the planar type, the separation channel 3 having a rectangular cross section is formed in the inner layer 23, and the first holding part 1 is formed on one side surface of the separation channel 3 perpendicular to the inner layer 23. A first outlet 6 that opens in a plane perpendicular to the inner layer 23 is provided at the downstream end of the first holding part 1, and a second outlet 16 is provided on the side surface of the opposite face of the first outlet 6. . The connecting flow path 8 and the connecting flow path 18 that connect the first outlet 6 and the second outlet 16 to the first outlet 7 and the second outlet 17 are the same inner layer as the separation channel 3. Form in 23. The first outer layer 22 and the second outer layer 24 laminated on the surface of the inner layer 23 are omitted. If necessary, the second holding part 2 may be provided on the inner wall of the separation channel having a rectangular cross section on the side facing the first holding part.

[0050] The first outer layer 22 and the second outer layer 24 are formed as a compromise between a three-dimensional type and a planar type, One or both of the communication channel 8 connected to the first outlet 6 and the communication channel 18 connected to the second outlet 16 are partially formed in the first outer layer 22 and the second outer layer 24. May be. Such a compromise type is suitably used for a separation device having a staged arrangement.

[0051] [Stepwise arrangement of separation channels]

When the first outlet 6 of the separation channel 3 is connected to the inlet 5 of the other separation channel 3, the first substance is concentrated twice and the concentration rate is improved. This is because, within one separation channel, the concentration difference does not exceed a certain level due to the homogenization effect due to diffusion, but when multiple separation channels are connected in series from the upstream side to the downstream side, the concentration Because the difference can be accumulated, it can be highly concentrated.

[Two-stage arrangement]

When the number of stages is two (in this case, the two stages are referred to as the upstream stage and the downstream stage), when seeking to concentrate the first substance or remove the second substance, the first outlet of the upstream stage The inlet 5 of the downstream separation channel 3 may be connected to 6. When concentration of the second substance or removal of the first substance is required, the inlet 5 of the separation channel 3 in the downstream stage may be connected to the second outlet 16 in the upstream stage. When concentrating both the first and second substances. What is necessary is just to connect the inlet 5 of the separation flow path 3 in a separate downstream stage to the first outlet 6 and the second outlet 16, respectively.

[0052] As described above, the preferred embodiments of each separation channel of the substance separation device of the present invention include three typical embodiments: a three-dimensional shape, a semi-three-dimensional shape, and a planar shape. In the stepwise arrangement of the separation channels, the separation channels in these embodiments may be arranged in any combination. However, it is easy to manufacture by using the same separation channel for each separation channel. Yes, preferred. Hereinafter, the aspect of the stepwise arrangement will be described by taking as an example a three-dimensional shape that can maximize the separation efficiency in a single stage. The same applies to the arrangement of semi-solid type and flat type.

[0053] [Stepwise arrangement in three-dimensional shape]

5 and 6 are a plan view of a three-dimensional stepwise arrangement and a side cross-sectional view along the ε-ε line.

FIG. 7 is a plan view of the first outer layer 22. The first outer layer 22 has a separation channel 3 for each stage. A communication channel 38 is formed from the first outlet 6 to the inlet 5 of the downstream downstream separation channel 3.

FIG. 8 is a plan view of the inner layer 23. In the inner layer 23, the separation channels 3 are arranged in a plurality of stages along the length direction, and a plurality of separation channels 3 are arranged in parallel in each stage.

FIG. 9 is a plan view of the second outer layer 24. In the second outer layer 24, a communication channel 48 is formed from the second outlet 16 of the separation channel 3 at each stage to the inlet 5 of the separation channel 3 at the downstream downstream stage. .

[Basic configuration of stepwise arrangement of three or more steps]

The basic structure of the stepwise arrangement when the first and second substances dissolved in a common medium are concentrated from the medium is described below.

The range from the first stage force to the Kth stage in Figs. 5 to 10 shows the basic configuration of the staged arrangement. In the embodiment shown in FIG. 5 and FIG. 6, among the methods of connecting the separation channels in multiple stages, they are connected by the following preferable connection method. That is, the separation channel 3 is arranged in a plurality of stages from upstream to downstream, the separation channel 3a in the first stage, the separation channels 3b and 3c in the second stage, the separation channel 3d in the third stage, 3e and 3f are arranged, and the first outlet 6a of the separation channel 3a in the first stage is connected to the inlet 5b of the separation channel 3b in the second stage through the communication channel 38a. The second outlet 16a of the separation channel 3a is connected to the inlet 5c of the separation channel 3c in the second stage through a communication channel 48a.

[0055] Further, the first outlet 6b of the separation channel 3b in the second stage is connected to the inlet 5d of the separation channel 3d in the third stage through a communication channel 38b, and the separation channel The second outlet 16b of 3b is connected to the inlet 5e of the separation channel 3e in the third stage through a communication channel 48b. In addition, the first outlet 6c of the separation channel 3c in the second stage is connected to the inlet 5e of the separation channel 3e through the communication channel 38c, and the second outlet of the separation channel 3c. 16c is connected to the inlet 5f of the separation channel 3f in the third stage through the communication channel 48c.

[0056] The second outlet 16b of the separation channel 3b in the second stage and the first outlet 6c of the separation channel 3c are connected to the inlets of different separation channels in the third stage. It is not the same It is connected to the inlet 5e of one separation channel 3e. Now, assume that the concentrations of the first and second substances in the initial sample are 50% each. When the sample flows into the separation channel 3a, the sample flowing out from the first outlet 6a increases the concentration of the first substance to 60%, for example, and at the same time the sample flowing out from the second outlet 16a For example, it drops to 40%. When the sample flowing out from the first outlet 6a of the separation channel 3a flows into the separation channel 3b, the concentration of the first substance introduced at 60% is, for example, the same as the first outlet 6b, as described above. The sample flowing out from the outlet rises to 70%, and the sample flowing out from the second outlet 16b falls to 50%. On the other hand, the sample flowing out from the first outlet 6c of the separation channel 3c into which the sample having the concentration of the first substance of 40% is introduced, for example, increases the concentration of the first substance to 50% and the second stream. The sample flowing out of outlet 16c will drop to 40%.

Here, the sample (B) flowing out from the second outlet 16b of the second-stage separation channel 3b is the first substance in the second stage after the concentration of the first substance is concentrated in the first stage. The concentration of is diluted. Similarly, in the sample (C) flowing out from the first outlet 6c of the separation channel 3c, the concentration of the first substance is diluted in the first stage, and then the concentration of the first substance is concentrated in the second stage. It is a thing. And these two concentrations will be approximately equal. Therefore, there is no benefit of separating the above two samples having the same first substance concentration in different separation channels. Therefore, the two samples may be introduced into the same separation channel 3e rather than into the different separation channels.

The fourth and subsequent stages are similarly connected. That is, the separation channel is arranged in a plurality of stages from upstream to downstream, and any continuous three stages of the plurality of stages (in this case, the three stages are referred to as an upstream stage, a midstream stage, and a downstream stage). ), The first outlet of the first separation channel in the upstream stage is connected to the inlet of the second separation channel in the middle stage, and the first outlet of the first separation channel The second outlet is connected to the inlet of the third separation channel in the middle stage, and the first outlet of the second separation channel in the middle stage is the fourth separation channel in the downstream stage. And the second outlet of the second separation channel is connected to the inlet of the fifth separation channel in the middle stage, and the third separation outlet in the middle stage. The second outlet of the channel is connected to the inlet of the sixth separation channel in the downstream stage, and the front The first outlet of the third separation channel is of the fifth Connected to the inlet of the separation channel! RU

As described above, the stepwise arrangement of the separation channels in the present embodiment is an arrangement in which the separation channel 3 is increased by one for each stage. By adopting such a connection structure, one separation flow path 3 is connected to each of the next two separation flow paths, that is, the number of flow paths is doubled for each stage. Compared to the structure, the number of channels can be reduced and the space factor is improved.

[0059] When the substance separation device is configured only with the basic configuration of this staged arrangement, the outlets of the plurality of separation channels in the most downstream stage (stage K in FIG. 5) Of these, the fluid outlet having the highest number of passages through the first outlet of the separation channel in each stage is connected to the first outlet 7 for taking out the fluid, and the most downstream stage (Kth stage). Among the plurality of separation channel outlets in FIG. 2, the second fluid outlet 17 from which the fluid outlet having the largest number of passages through the second outlet of the separation channel in each stage takes out the fluid. By connecting to each other, the first substance concentrated fluid and the second substance concentrated fluid are respectively taken out from the respective outlets.

[0060] The above-described method is generally described as follows.

In other words, the separation channels arranged in parallel in each stage are represented as “columns”, and the column in which the first substance is most concentrated is referred to as the first column. 3a is referred to as “separation channel [1, 1]”, and in general, the separation channel 3 in the n-th i-th row (n and i are positive integers, the same shall apply hereinafter) is referred to as “separation channel [n , i] ”. Similarly, for the inflow port 5, the first outflow port 6, and the second outflow port 16, the n-th row and the i-th row are indicated by [n, i].

[0061] Then, the first outlet 6a (that is, the first outlet [1, 1] of the separation channel 3a (that is, the separation channel [1, 1]) in the first row and the first row shown in FIG. ]) Is led to the separation channel 3b (that is, the separation channel [2, 1]) in the second stage and the first row. On the other hand, the first-stage first-row separation channel [1, 1 second outlet 16a (that is, second-outlet [1, 1]) is the second-stage second row separation channel. Connected to the inlet 5 (ie, inlet 5 [2, 2]) of 3c (ie, the separation channel [2, 2])!

Regarding the connection between the second and third stages, the first outlet [2, 1] is connected to the inlet [3, 1] and the second outlet [2, 1] with respect to the separation channel [2, 1]. Is connected to inlet 5 [3, 2]. For the separation channel [2, 2], the first outlet [2, 2] is connected to the inlet [3, 2] and the second outlet [2, 2]. 2] is connected to the inlet [3, 3].

In general, the first outlet [n, i] of the nth stage and the second stage is connected to the inlet [n + 1, i] of the separation path [n + 1, i] of the (n + 1) stage. The second outlet [n, i] of the separation channel of the nth stage and the second column is the separation channel [n + 1, i + 1] of the (n + 1) th stage (i + 1) row Connected to the inlet [n + 1, i + 1].

From the first outlet [K, 1] of the final stage (Kth stage) of this basic component, the solution most concentrated in the first substance is the second outlet from the second outlet [Κ, K]. The solution with the highest concentration of the substance flows out.

[0062] In the basic configuration of this stepwise arrangement, the number of stages of the separation channel 3 is preferably 3 or more, more preferably 4 or more, and most preferably 5 or more. The larger the number of stages, the better the separation target with a low separation performance in a single stage can be separated. Of course, the number of stages can be reduced in a system in which the separation ability in one separation channel 3 is excellent. The upper limit of the number of stages is not particularly limited, but from the viewpoint of ease of production, 1000 stages or less is preferable, and 100 stages or less is more preferable. In the present invention, unlike the membrane separation apparatus, since the stepwise arrangement type separation device does not require a pump for each stage, the structure becomes extremely simple and can be easily incorporated in the microfluidic device. be able to. When the microfluidic devices have the same volume, the separation performance as a whole is improved by forming smaller separation channels in multiple stages.

When the substance separation device is configured with only the basic configuration of this staged arrangement, as described above, the first substance flowing out from the first outlet [K, 1] in the final stage (Kth stage) The most concentrated solution is connected to the first outlet 7 and the solution most concentrated in the second substance flowing out from the second outlet [Κ, K] is connected to the second outlet 17. If the yield is calculated even if the rate drops somewhat, for example, the first outlet [K, 2] and the first outlet [K, 3] in the final stage (Kth stage) are also used for the first outlet. 7 may be connected. The same applies to the second outlet 17.

[0063] In the above-described stepwise arrangement, the above-described configuration is preferable in the case of three-component separation that separates the first substance and the second substance in the common solvent. In the case of a two-component separation in which the substance is a solvent, only the concentration (or removal) of the first substance needs to be considered.Therefore, the second outlet 17 is not provided and the second outlet 17 is connected. The flow path to be joined to 27 Good. Conversely, the first outlet 7 may not be provided, and the flow path connected to the first outlet 7 may be arranged to join 27. Alternatively, after the third stage, the number of separation channels in each stage is half that of the first substance concentration side, and according to the general expression, the second outlet of the second stage “n, n / 2j” (However, if nZ2 is not an integer, it is the closest integer.) Connecting the downstream downstream inlet [n + 1, (n + l) Z2] Of course, this should be done for the first outlet when concentrating the second substance.

[0064] When the substance separation device is formed with the downstream range stage described below after the basic components of the staged arrangement, the outlets are connected as follows.

[Securement of concentrated solution amount]

When the above-mentioned basic arrangement of the stepwise arrangement is adopted, assuming that the outflow amount from each outlet is equal, the amount of the fluid with the maximum concentration of the first substance, that is, the extraction amount of the K-stage up to that point, is assumed. The outlet from which the fluid that has passed through the first outlet the most times flows out, or the first outlet [K, 1] where the first substance is concentrated to the maximum in the generalized display. The amount of liquid decreases as the number of stages increases. Similarly, at the second outlet [流, K] where the second substance is concentrated to the maximum, the yield decreases as the number of plates increases. As a means for avoiding this inconvenience, the following two methods are preferred and used. The following two methods may be used in combination.

[0066] (First method: Method in which the number of separation channels in the downstream range stage is substantially constant in each stage)

As shown in Fig. 5 and Fig. 6, in this method, the basic configuration described above is used in the upstream range stage from the first stage to the Κ stage that is the boundary stage (that is, the stage where η = Κ). As described above, the number of separation channels included in each stage is the same as the number of separation channels. In addition, in an arbitrary stage (hereinafter referred to as “downstream range stage”) downstream of the first stage of the boundary stage, a substantially constant number of separation channels are formed in each stage. For example, in the first and subsequent stages, two separation channels and one K-1 separation channel are formed alternately. By adopting such a configuration, it is possible to increase the yield of the concentrated fluid while maintaining a high space factor.

[0067] Of the plurality of separation channel outlets in the most downstream stage (first stage), the number of passages of the first outlet of the separation channel in each stage is the highest. Outlet is the first thing A flow that is connected to the first outlet 7 for taking out the concentrated fluid and has the highest number of passages through the second outlet of the separation channel in each stage among the outlets of the plurality of separation channels in the most downstream stage. Since the outlet is connected to the second outlet 17 for taking out the second substance concentrated fluid, the first substance and the second substance concentrated in each outflow loca are taken out.

[0068] In this method, the number of separation channels in the nth stage after the Kth stage is alternately set to K and K-1. In this case, outflow force of the fluid that maximizes the number of times of passage through the first outlet 6 among the outlets of each separation channel 3 in the stage where the number of separation channels 3 is K. Connected to the first outlet 7 via the flow path 42 and connected to the second outlet 17 via the outlet flow path 44. Has been. The other outlet is connected to the third outlet 27 by a take-out channel 43.

By doing so, a large amount of the solution separated (concentrated) with a minimum number of flow paths to a predetermined value or more can be collected. Since the amount of fluid flowing into the separation channel on the downstream downstream side is reduced by the amount of solution taken out every other stage after the Kth stage, if a sufficiently large number of downstream range stages are provided, Finally, most of the introduced solution is separated from the first outlet 7 or the second outlet 17 and taken out. That is, the separation yield is improved.

[0069] The general expression of the downstream range from the K-th stage as the boundary stage is as follows. In other words, i separation channels are arranged in the nth stage, and at least one of n or i is 2 or more, and the number of times of passage through the first outlet of the separation channel is the largest in the nth stage. The fluid outlet is connected to the first outlet 7 for taking out the fluid, and the fluid outlet having the maximum number of passages through the second outlet is connected to the second outlet 17 for taking out the fluid. Thus, the fluid passes through the first outlet in the upstream of the separation channel outlet of the stage where the number of separation channels in the nth and subsequent stages is arranged. 1 is the number of times that the fluid passes through the second outlet, and m is the largest outlet, where 1-m is the largest outlet connected to the first outlet 7 Outlet force It is configured to be connected to the second outlet 17. Specifically, when the number of stages and the number of columns are the same, the n-th first outlet [n, 1] including n separation channels is connected to the first outlet 7, and Two outlets [n, n] are connected to the second outlet 17. [0070] By connecting as in the first method, it is not necessary to increase the number of separation channels as the stage advances in the downstream range stage, so that the number of separation channels in the downstream range stage increases. It is suppressed. That is, the number of separation channels in the stage increases with the number of stages until the boundary stage is reached, but after the boundary stage, the number of separation channels does not increase even if the number of stages n increases! In this case, if the number of separation channels in the n-th stage is the K-th boundary stage, it is generally constant at K in the range where the number of stages n is K or more (downstream range stage). If the outlets are connected to the outlets every other stage, the number of channels in the range where n is K or more (downstream range stage) becomes K and (K 1) each time n increases.

As in the case of the basic configuration of the stepwise arrangement described above, also in this embodiment, the first outlet 6 of the separation channel 3 in each stage out of the plurality of separation channel outlets in the most downstream stage. A plurality of outlets with a relatively large number of passages are connected together to the first outlet 7, and a plurality of passages with a relatively large number of passages through the second outlet 7 of the separation channel 3 in each stage are provided. The outlets may be connected together to the second outlet 17. In this case, several adjacent outlets are collectively connected to the first outlet 7 or the second outlet 17, and a large amount of solution separated (concentrated) above a predetermined value can be collected. .

[0071] In the case of separation of two components in which the second substance is a solvent, only the concentration (or removal) of the first substance needs to be considered. 2Make the flow path connected to the outlet 17 merge with 27. Conversely, the first outlet 7 may not be provided, and the flow path connected to the first outlet 7 may be arranged to join 27. Alternatively, the number of separation channels in each stage after the Kth stage is halved only on the first substance concentration side, and according to the general expression, the second outlet “K, K / 2J or "(Κ- 1), (Κ- 1) / 2 \ (where ΚΖ2 or (Κ- 1) Ζ2 is the nearest integer if Ζ2 is not an integer) Κ 1), (Κ 1) It is preferable to connect to Κ2] or [Κ, 好ましい 2] because the yield of the first substance concentrated fluid increases.Of course, when the second substance is concentrated, This should be done for one outlet.

[0072] (Second method: Method in which the sum of the cross-sectional areas of the separation flow paths in each stage is substantially the same)

In the second method, the sum of the cross-sectional areas of the separation channel (s) at any particular stage is approximately the sum of the cross-sectional areas of the separation channel (s) at any stage downstream from it. Same It is a method to become. This can be done for any two stages, but it is preferable that the sum of the cross-sectional areas of the separation flow paths be substantially the same for all stages. As a result, even if the number of separation channels in the upstream stage is small, the amount of concentrated solution taken out can be increased. Specific examples can include the following (2-1), (2-2), and (2-3). Each of these methods may be used in combination, or may be used in combination with the first method.

[0073] (2-1) Method for adjusting the cross-sectional area of the separation channel

In this method, as shown in FIGS. 12 and 13, the cross-sectional area of the separation channel in each stage is adjusted without changing the number of separation channels in each stage. For example, the cross-sectional area of the first-stage separation channel is Z times the cross-sectional area of each separation-channel in the final stage (the Z-th stage). As a result, the amount of the undiluted solution supplied to the inlet 5 of the first-stage separation channel is multiplied by Z, so that the first outlet [Z, 1] and the second outlet [Z, Z From the above, it is possible to collect the concentrated solution at a flow rate Z times that when the cross-sectional areas of all the separation channels are the same. At this time, when enlarging the cross-sectional area of the separation channel, increasing the distance between the first holding portion and the facing surface increases the distance to be separated by diffusion, and the separation speed decreases. Because it is in the direction of Therefore, it is preferable to increase only the width of the separation channel without changing the distance between the first holding portion and the facing surface. When expanding the width, it is possible to prevent a decrease in the accuracy of the distance between the first holding part and its facing surface by providing a column or wall in the flow path. Suitable for mold embodiment. In this case, the distance between the first holding part and the opposing surface in the separation channel (or between the first holding part 1 and the second holding part 2 when the second holding part 2 is provided). The distance) is fixed by the thickness of the inner layer 23, but the expansion of the channel width is a force that can be easily implemented.

[0074] (2-2) Method of adjusting the number of separation channels in each stage

This is a method in which the number of separation channels in each stage is adjusted so that the sum of fluids flowing in each stage is substantially the same. When there are n separation channels included in the nth stage (n = l to Z), each separation channel is used for separation in the final Zth stage in the nth stage. This is a system consisting of the same number of separation channels connected in parallel, approximately ZZn times the number of channels. In other words, instead of the separation channel, which is the basic structure of separation, a plurality of separation channels are completely formed. This is a method of replacing with a separation unit connected in parallel. Here, the term “completely connected in parallel” means that the inlet 5, the first outlet 6, and the second outlet 7 are all connected in parallel. However, since the number of channels is a natural number, if the value of ZZn is not an integer, it should be an integer close to it. For example, the number of separation channels in the first stage is Z, the second stage is composed of two separation units with each number of separation channels ZZ2, and the third stage is the number of separation channels. Consists of three separation units, each of which is ZZ3. If these fractions are not integers, the nearest integer may be used. As a result, the amount of the undiluted solution supplied to the inlet 5 of the first-stage separation channel is increased N times, and the first outlet [Z, 1] and the second outlet [Z, Z] of the final stage are Concentrated solution can be collected at a flow rate Z times that when the cross-sectional areas of all separation channels are the same.

Similar to the above (2-2), this method is suitable for all cases where the separation channel is a three-dimensional type, a semi-three-dimensional type, and a planar type.

(2-3) Adjusting the length of the separation channel

In this system, the length of the separation channel in any specific stage is set longer than the length of the separation channel in the downstream next stage. As a result, even when the flow rate of the fluid flowing through the separation channel in the specific stage is increased, the residence time is maintained and the amount of concentrated solution taken out can be increased. Specifically, when the number of separation channels included in the nth stage is n, the length of the nth stage separation channel is set to the separation stage's Zth separation channel. The flow path length is approximately nZZ times. The amount of the stock solution supplied to the inlet 5 of the first-stage separation channel is multiplied by Z, so that the first outlet [Z, 1] and the second outlet [Z, Z] in the final stage From this method, the concentrated solution can be collected at a flow rate Z times that when the length of all the separation channels is the same. This method uses all three-dimensional, semi-solid, and flat-type separation channels. It is suitable for this case.

In the second method for securing the concentrated solution amount as described above, as in the case of the basic configuration of the stepwise arrangement, the concentration (or removal) of the first substance is performed in the case of separation of _two components. Therefore, the flow path connected to the second outlet 17 may be joined to the third outlet 27 without providing the second outlet 17. Alternatively, the number of separation channels in each stage is concentrated in the first substance. The second outlet of the second stage “n, n / 2j (where nZ2 is not an integer is the closest integer) It is preferable to connect to the inlet [n + 1, (n + l) Z2] in the side stage because the yield of the first substance concentrated fluid increases.Of course, when concentrating the second substance, This should be done for the first outlet.

[Inlet, outlet, communication channel]

In the substance separation device of the present invention, the inlet 15 for introducing the separation raw fluid into the separation channel 3 and the formation of the first outlet 7, the second outlet 17, and the third outlet 27 described above are formed. The position and shape are arbitrary, and may be an opening to the outside of the separation device, or the connection pipe is connected! It may be connected to some mechanism such as a reaction channel. Further, it may be any surface of the material separation device, for example, a substrate side surface, a cover layer side surface, or an end surface or a side surface of the material separation device. When a large number of the substance separation devices are installed in parallel to increase the throughput, it is preferably the end face or side surface of the substance separation device.

Also, each communication channel can be adjusted suitably without having to have the same cross-sectional area. For example, in the first method for securing the amount of concentrated solution, the amount of fluid flowing out from a certain separation channel flows to the downstream separation channel and the communication channel 42 or the communication channel 44. It is preferable to suitably adjust the cross-sectional areas of the communication flow paths 38, 48, 42, and 44 so that the flowing force is substantially equal.

[0077] [Other mechanisms]

The following configuration may be added to the configuration of the present embodiment described above.

In order to adjust the flow rate ratio of each flow path, it is possible to change the cross-sectional area of each separation flow path, the flow length of each connection flow path, and provide a flow control valve in any part of the flow path It is also possible. For example, on the way from the first outlet [K, 1] and the second outlet [Κ, K] of the downstream range stage (n> K where n> K) to the connecting channel 42 and the connecting channel 44 Also, it is preferable to install a valve to adjust each outflow amount.

[0078] In addition, out of the plurality of outlets in the separation channel of the final stage, an outlet not connected to the outlet is connected to the inlet 5 in the separation channel of the upstream stage via a pump. Also Good. For example, out of the plurality of outlets in the separation channel in the final stage, the outlets other than the first outlet [Z, 1] and the second outlet [Z, Z] are connected to the third outlet 27, The third outlet 27 is connected to the inlet 5a of the first-stage separation channel 3a through a pump in the substance separation device or outside through a transfer pipe. It is also possible to connect to separation channels other than the first stage, and it is also possible to connect to a plurality of separation channels depending on the concentration. As a result, it is possible to return the fluid that has flowed out from the outflow loci not connected to the first outlet 7 and the second outlet 17 to the upstream separation channel, and to efficiently use the sample. be able to. In the stepwise arrangement, the second outlet 17 is not provided as described above, and when the flow path connected to the second outlet 17 is merged with the third outlet 27, the merged flow is You may connect so that a path may be recirculated. In addition, when the number of separation channels in the third and subsequent stages is halved only on the first substance concentration side as described above, the other outlets not connected to the first outlet 7 are refluxed. You can connect. The mechanism for refluxing using such a stepwise arrangement of the separation flow path allows the first substance highly separated and concentrated to be recirculated from the second flow outlet of the single separation flow path. It is preferable because it can be obtained. As a pump used in the above reflux mechanism, a pump incorporated in a microfluidic device can be preferably used.

It is also possible to form a third holding part on the wall surface other than the first holding part and the second holding part of the separation channel, and to provide a third outlet on the side of the third holding part. The solute and solvent can be separated. Similarly, a fourth holding part and a fourth outlet can be provided to separate the four types of solutes contained in the fluid from each other. In this case, for example, four holding portions and four outflow ports can be preferably formed on each side surface of the separation channel having a rectangular cross section. However, a substance separation device having two types of holding parts, a first holding part and a second holding part, is preferable because it can achieve the highest separation performance.

[0079] [Substance separation method]

The material separation method of the present invention will be described below, but details not described below are the same as those described in the section of the material separation device of the present invention.

[0080] [Basic configuration]

The substance separation method of the present invention is a method for separating one side of an inner wall of a separation channel through which a sample fluid flows. Forming a first holding part capable of holding the first substance, and taking in and releasing the first substance in the first holding part, and the first holding side at the downstream end of the separation channel. The first spillage rocker provided on the other side and the other side also contain the fluid in which the first substance is concentrated, and the second spillage rocker also contains the solution in which the first substance is diluted and the solution in which the second substance is concentrated. obtain. In addition, if necessary, a separation device in which a second holding portion that exhibits higher holding ability with respect to the second substance can be used on the wall surface on the second outlet side of the separation channel.

[0081] That is, a method of separating a first substance and a second substance in a fluid from each other, wherein (I) a separation flow having a first holding part capable of holding the first substance on a part of a wall surface A step of flowing the fluid into the channel (hereinafter sometimes referred to as an “introduction step”), and (i) a step of incorporating the first substance into the first holding part (hereinafter referred to as an “intake step”). (III) The first substance is released from the first holding part, the concentrated solution of the first substance is taken out from the downstream end of the first holding part, and the first substance Removing the diluted solution and Z or the concentrated solution of the second substance from the other end of the downstream end of the first holding part (hereinafter also referred to as “release process”). It is a method of separating.

In the substance separation method of the present invention, at least in the release step (III), the flow rate flowing in the separation channel is made laminar with a Reynolds number of less than 2300. As a result, the first substance from which the first holding portion force has also been released flows along the streamline, and the first outflow rocker on the first holding portion side can flow out more. When the separation device of the present invention is used, the fluid can flow in a laminar flow by setting the cross-sectional area of the separation channel to a predetermined value.

[0082] When the fluid to be introduced is a two-component system such as a mixed fluid of two types of fluid, a solute and a solvent, and a dispersoid and a dispersion medium, the fluid is introduced from the first outlet on the first holding part side. Take out the fluid in which one substance is concentrated, and take out the fluid in which the first substance is diluted and the second substance is relatively concentrated from the second outlet. When the second holding portion is provided, the separation efficiency is further increased.

[0083] In the case where the fluid to be introduced is a three-component system composed of, for example, a first substance and a second substance, which are solutes, and a common solvent, the fluid in which the first substance is concentrated from the first outlet The second spiller removes the fluid in which the first substance is diluted. At this time, the second substance Is affected by the retention of the first holding part for the second substance in the previous period and the retention of the inner wall surface other than the first holding part for the second substance. For example, if the first holding part shows a weaker holding property against the second substance than the first substance, the concentrated second substance is less than the first substance from the first outlet. Out of the second outlet, the second substance diluted to a lesser extent than the first substance flows out. In the case where the first holding part does not hold the second substance, the first outlet and the second outflower will flow out the fluid in which the second substance is not concentrated or diluted. When the separation channel is provided with a second holding part that retains the second substance, a fluid in which the second substance is diluted flows out from the first outlet, The fluid enriched in the second substance flows out from the two outlets. That is, in this case, the three components of the first substance, the second substance, and the solvent are separated.

[0084] When three or more kinds of solutes contained in a fluid are separated from each other, first, the two kinds of solutes are separated using a separation device that can separate the two kinds of solutes. Separation can be achieved by connecting a separation device that can separate the remaining substance to one or both of the outlets 17. Alternatively, by using a separation device that has a third holding part on the wall surface other than the first holding part and the second holding part of the separation channel, and a third outlet is provided on the third holding part side. It can also be separated. The same is true when the four substances contained in the fluid are separated from each other. However, it is preferable to use a substance separation device having two types of holding parts, a first holding part and a second holding part, because separation can be performed most efficiently.

[0085] Hereinafter, a case where two types of solutes (first substance and second substance) contained in a solvent are separated will be described as an example.

[Constant temperature method]

The substance separation method of the present invention can be performed under a constant temperature condition. In this case, the (I) introduction step, (II) uptake step, and (III) release step can be performed at the same temperature and flow rate, and there is no distinction as operation. The first substance taken into the first holding part flows in the same manner as the movement of the sample spot in the liquid chromatograph while repeating uptake and release on the first holding part side of the separation channel. To move in the separation channel at a speed slower than the flow velocity of the fluid and reach the downstream end of the separation channel. The first substance released there flows out mainly from the first outlet together with the fluid flowing through the part other than the first holding part of the separation channel. The That is, in this method, the uptake process and the release process are performed simultaneously. Considering the material tolerance, the first substance in the fluid flowing in from the inlet reaches the first holding part by diffusion, and a part of it is held in the first holding part. Accordingly, the concentration of the first substance in the part other than the first holding part of the separation channel decreases. Then, at the downstream end of the separation channel, the first substance released from the first holding part is added to the fluid flowing through the part other than the first holding part of the separation channel and added to the first substance. Since it flows out from the outlet, the concentration of the first substance flowing out of the first outlet loca rises. On the other hand, in the second outflow rocker, the solution in which the concentration of the first substance is reduced by the amount held in the first holding part flows out. The amount of the first substance released from the lower end of the first holding part is equal to the amount of the first substance held in the first holding part until reaching the lower end of the separation channel. Thus, the steady state is maintained.

This method is easy to operate and energy saving because there is no need for temperature changes. However, the resolution in one stage is lower than the temperature change method described later. In order to reduce this, it is preferable to increase the amount of the first substance that can be taken up by the first holding part.

In this method, the fluid to be separated is continuously injected and separated. Therefore, the predetermined separation may not always be performed until the sample solution injection start force reaches a steady state. However, during this time, it is possible to collect a solution that also flows out the outlet force with a time division program, such as chromatography. The continuous injection mentioned here means that it is not a batch method, and may be intermittent injection or an injection whose flow rate changes.

[Temperature change method]

When the retention of the first holding part with respect to the first substance has temperature dependence, for example, adsorption or

In the case of absorption into a gel having a gel Z solid transition point, etc., it is possible to separate it with high efficiency in one or a few steps by utilizing this characteristic. In the case of adsorption, for example, in the case of adsorption, the amount of adsorption decreases at a high temperature and a high temperature. Absorption and other uptake mechanisms show similar characteristics. However, in the case of absorption by a temperature-responsive gel, for example, the amount of absorption increases when it is in a gel state at a low temperature, and becomes solid at high temperature, such as poly-N-isopropylacrylamide gel. There is also. In the present invention, the operating conditions can be changed in accordance with these characteristics. [0087] (I) In the introducing step, the fluid to be separated is introduced from the inflow port, and flows into the separation channel. At this time, it is not necessary for the fluid to flow through the separation channel in a laminar flow, but in the case where the steps (i) to (ii) are repeated, and (III) the laminar flow is used also as the discharge step. . The temperature and flow rate of the introduction process are arbitrary.

(II) In the taking-in process, the first substance in the fluid is taken into the first holding unit by diffusion in a state of fluid flow or in a state where the transfer is temporarily stopped. For example, when the uptake is adsorption, the separation channel is kept at the adsorption temperature. At this time, by taking the time of the taking-in process by taking sufficient time for the first substance that is farthest from the first holding part and near the opposing surface of the first holding part to move to the first holding part by diffusion, It should be taken into the first holding part.

[0088] According to Fick's second law, the root mean square of the diffusion distance (hereinafter referred to as the average diffusion distance) is proportional to the square root of time. Indicated. When the average diffusion distance is 100 m, the time required for diffusion in water is, for example, about 6 seconds for ethanol (molecular weight 46), about 60 seconds for single-stranded oligonucleotide (25 bases, molecular weight about 8 500), In the case of myosin (molecular weight about 540,000), it is calculated as about 600 seconds. When the average diffusion distance is 10 m, the time required for diffusion is 1Z100.

[0089] Therefore, the residence time of the fluid in the separation channel is approximately equal to the diffusion when the average diffusion distance is 100 m when the distance from the first holding portion to the opposing wall surface is 100 m. It is preferable that the time is longer than required. For example, when the molecular weight of the substance to be separated is about 8500, it is preferable to set it to about 60 seconds or longer. By setting this time or longer, the first substance is sufficiently taken into the first holding part, and high separation efficiency is realized. However, since it takes time to express selectivity for incorporation, such as polynucleotide hybridization, in this case, it is preferable that the time is longer than the time required for the diffusion. . The upper limit of the residence time is not particularly limited, but is preferably 10 minutes or less, more preferably 3 minutes or less, and most preferably 1 minute or less. By setting the residence time to be less than or equal to the above upper limit, the separation throughput can be increased. In other words, the higher the molecular weight of the substance to be separated, the smaller the first holding part force of the separation channel and its distance to the opposite surface. U, because it can increase.

[0090] (III) In the release step, for example, when the uptake is adsorption, the separation channel is changed to the desorption temperature. When fluid flows through the separation channel, the fluid flows out into the first outlet and the second outlet at the downstream end of the separation channel. By flowing in a laminar flow with a Reynolds number of less than 2300, the first substance released from the first holding part flows along the streamline and flows out more from the first outlet on the first holding part side. Become. When the separation device of the present invention is used, since the cross-sectional area of the separation channel is sufficiently small V, it is possible to flow a fluid that is difficult to be turbulent in a laminar flow.

[0091] In this substance separation method, in order to increase the separation efficiency, in the release step, the first substance released from the first holding part flows in the vicinity of the opposing surface of the first holding part. It is important that the first spillage loca spill out without remixing. In order to prevent remixing, the structure of the outlet of the separation device should be designed so that it is difficult to remix as described above, and the force of the first holding part before the first substance released by diffusion is remixed by diffusion. It is important to select a flow rate that will flow out of the first holder.

[0092] For example, in the case of a system in which the amount of uptake increases at low temperatures, such as adsorption, the first substance is taken into the first holding part at a low temperature in the uptake process, and the first holding part is used in the release process. The temperature is changed to a high temperature to release the first substance and the first spillage loca is spilled. At this time, it is preferable to raise the temperature of the release process as rapidly as possible so as to reduce remixing due to diffusion and to flow out at a high flow rate. The time required for the discharge process is preferably shorter than the time required for diffusion of the average diffusion distance when the distance from the first holding part to the opposite wall surface is defined as the average diffusion distance. Its preferred value is 1Z3 or less.

For example, if the distance between the first holding part force and the opposite wall is 100 m and the molecular weight of the substance to be separated is about 8500, approximately 60 seconds or less is preferable, and 30 seconds or less is more preferable. 20 seconds or less is most preferable. The lower limit of the time required for the release process is short as long as the temperature can be raised sufficiently. For example, lms may be used, but 0.01 seconds or more is preferable. The above is preferable. This makes it possible to raise the temperature sufficiently and to suppress the pressure loss increase tl. [0093] The method of raising and lowering the temperature is arbitrary. Program control of the temperature control block, transfer between temperature control blocks adjusted to different temperatures, immersion in liquid such as hot water, blowing of temperature-controlled gas, Examples include infrared heating, laser heating, and microwave heating. In the discharging process, if the time used for raising or lowering the temperature to a predetermined temperature is long, remixing may occur during that time. Heating is preferable because laser heating and microwave heating power can increase the rate of temperature rise. In addition, in the case of other heating and cooling methods, if the material separation device of the present invention is used, the heat capacity of the device is small, so that the temperature can be increased and decreased quickly, for example, in the order of seconds. The lower limit of the time required for the release process can be set to such a short time.

[0094] After the release step (III), the steps after the uptake step (I) can be repeated. The cooling rate after the discharge process is arbitrary. Performing both the release process and the next uptake process at the temperature of the release process, and then lowering or stopping the flow rate and lowering the temperature to a predetermined uptake process temperature also increases the selectivity of selective adsorption. This is preferable because it can be performed. In the case of using a multi-stage type material separation device, this method is preferable because it is not necessary to provide a temporary storage volume in the communication channel of the material separation device, and the device structure is simplified.

[0095] [Method for separating substances by stepwise arrangement]

In the substance separation method by stepwise arrangement, the solutions separated from the first outlet 7, the second outlet 17, and the third outlet 27 of the stepwise arrangement type material separation device according to the present invention, respectively. Take out. The stepwise arrangement differs from the separation method using a single-stage material separation device in that a third outlet is formed and the force can also remove fluid.

[0096] In this case, if the fluid to be introduced is a fluid in which the first substance and the second substance are uniformly dissolved, or a two-component system such as a solute and a solvent, the first holding unit side first From the outlet, the fluid enriched in the first substance is taken out, and the second outflow locuser can take out the fluid in which the first substance is diluted and the second substance is relatively concentrated. The third spill loca removes intermediate concentrations of the first and second substances. When the separation holding channel 3 is provided with the second holding portion, the separation efficiency is further increased.

[0097] Further, the fluid to be introduced includes a first substance that is a solute, a second substance that is a solute, and a combination of them. In the case of a three-component system having a common solvent power, the first outflow rocker takes out the fluid in which the first substance is concentrated, and the second outflow rocker takes out the fluid in which the first substance is diluted, and the third outflow Loca can remove fluids of intermediate concentration of the first substance. At this time, the second substance is affected by the retention of the first holding part in the first holding part with respect to the second substance and the holding ability of the wall part other than the first holding part with respect to the second substance. For example, if the first holding part shows a weaker holding ability for the second substance than the first substance, the concentrated second substance is less than the first substance but is concentrated from the first outlet. From the second outlet, the second substance diluted to a lesser extent than the first substance flows out from the second outlet, and the second substance with an intermediate concentration flows out from the third stream loca. If the first holding part does not hold the second substance, the first outlet, the second outlet, and the third outflower will flow out the fluid in which the second substance is not concentrated or diluted. . In the case where the separation channel 3 is provided with a second holding part that retains the second substance, the fluid diluted with the second substance flows out from the first outlet, From the two outlets, the fluid in which the second substance is concentrated flows out, and in the third outlet loca, the fluid in which both the first substance and the second substance are diluted, that is, the concentrated solvent flows out. In other words, it is possible to separate the three components with a single material separation device. Therefore, it is particularly preferable to use a substance separation device provided with a second holding part in the substance separation method by stepwise arrangement.

[0098] In the case of the method of changing the temperature using the stepwise arrangement, in the discharge process, the fluid flows into the separation channel 3 in the downstream downstream stage at the temperature of the discharge process. Therefore, after the inflow, the transfer is substantially stopped, the temperature is changed to the temperature of the intake process, and the next intake process is performed. Or, the communication flow path between any two continuous stages (upstream and downstream stages) should be connected so that the fluid flowing out of the upstream stage will not rise in temperature during the discharge process. The temperature may be lowered in the flow path and flowed into the downstream inlet. Such a temperature distribution can be effectively implemented when a fluid by laser or microwave is selectively heated.

[0099] The usage methods of the first means and the second means in securing the amount of the concentrated solution are the same as those described in the section of these substance separation devices. However, when the second means is not used, when paying attention to any three consecutive stages, when the solution is sent from the upstream stage to the middle stage, the middle stage and the downstream stage can be sent with a single delivery. In some cases, the separation channel 3 is not filled. But, Even in this case, only the upstream volume can be separated because it is separated and transferred from the midstream stage to the downstream stage. However, it is preferable to use the second means because the processing efficiency deteriorates.

[0100] [Temperature change method 2]

The above "temperature change method 1" can also be a method in which the temperature change method is reversed.

In this method, the (Γ) introduction step is integrated with the next capture step.

(π ′) In the intake step, the fluid to be separated is introduced from the inflow port, and flows in a laminar flow into the separation channel. At this time, if the uptake is adsorption, the separation channel is kept at the adsorption temperature, and the first substance located farther from the middle between the first holding part and its opposite surface is diffused to the first holding part. The flow rate is such that the residence time is insufficient for movement. As a result, the concentration of the first substance in the solution near the first holding part becomes lower due to the polarization, and the concentration of the first substance in the solution is not different from that after the inflow near the opposite surface. By controlling the flow in this manner, a solution having a reduced first substance concentration flows out from the first outflow locuser, and a solution having almost the same composition as the solution flowing into the inflow port flows out from the second outflow port.

In the (ιπ ′) release step, the liquid feeding is stopped or very slow, and if the uptake is adsorption, the separation channel is changed to the desorption temperature. Then, the desorbed first substance diffuses to the opposing surface of the first holding part, and the concentration of the first substance is made substantially uniform throughout the separation channel. Thereafter, when the liquid is sent, a solution having substantially the same first substance concentration flows out from the first outlet and the second outlet.

Therefore, the solution flowing out of the first outflow loca flows out in the (π ′) uptake step, and is almost the same as the solution diluted in the first substance and the original solution outflowing in the (ιπ ′) release step. The solution of the concentration is mixed, and the total solution becomes a solution in which the first substance is diluted. On the other hand, the solution from which the second outflow loca also flows out is a solution in which the first substance is concentrated in total. That is, the concentration side and the dilution side of the first substance are opposite to the above “temperature change method 1”.

Of course, even in this temperature change method 2, after the above (ΠΓ) release step, the above (ΙΓ) uptake step and the following steps can be repeated, and material separation can be performed by stepwise arrangement. The

[0101] [Serial arrangement of different separation devices] For example, when three or more kinds of solutes contained in a solution are separated from each other, first, use a separation device that can separate two of them, and then separate the first outlet 7 and the second outlet of the separation device. 17 and Z or the third outlet 27 can be separated by connecting a separation device that can separate the remaining material.

[Reflux and multi-stage connection]

As described in the section “Other mechanisms” in “Stepwise arrangement of separation channels” above, the outlets other than the outlet connected to the first outlet 7 are connected to the upstream stage via a pump. It is also preferable to reflux to the inlet 5 or the inlet 15. Further, the first substance concentrated liquid flowing out from the first outlet 7 of the substance separation device in which the separation channel is arranged in stages may be connected to the second substance separation device. At this time, it is preferable that the second outlet 17 and Z or the third outlet 27 are refluxed to the inlet 15 of the substance separation device or the inlet 15 of the upstream substance separation device via a pump. By arranging the substance separation devices arranged in stages in this way in series, the yield of the first substance concentrate is increased compared to simply connecting the substance separation device in one stage in series, and the reflux concentration is reduced. The pump for this is also small.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to the scope of the following examples.

Example 1

[0102] “Production of substance separation device and substance separation method”

FIG. 4 is a plan view and a side view of the three-dimensional single-stage material separation device produced in Example 1. FIG. In the material separation device of Example 1, the first outer layer 22 and the second outer layer 24 are fixed to both surfaces of the inner layer 23, and the base material 21 is fixed to the outer side of the first outer layer 22, respectively. 24, the separation layer 3 is formed in the inner layer 23, and the first holding portion is formed in the first outer layer 22 facing the separation channel 3. Formed, the communication channel 8 is formed in the first outer layer 22, the communication channel 18 is formed in the second outer layer 24, and the first outlet is formed at the boundary surface between the inner layer 23 and the first outer layer 22. 6 and a second outlet 16 is provided at the interface between the inner layer 23 and the second outer layer 24.

[0103] [Preparation of separation device]

First, the method of ultraviolet irradiation and fluorescence characteristic measurement in this example will be described. The

(Irradiation with UV lamp # 1)

Using a UE031-3 53CHC type UV irradiation device manufactured by Eye Graphics Co., Ltd., which uses a 3kW metal nitride lamp as the light source, UV light with a wavelength of 365nm and an intensity of 40mWZcm2 was irradiated in a nitrogen atmosphere at room temperature unless otherwise specified. .

(Irradiation with UV lamp # 2)

Irradiates UV light with a wavelength of 365 nm and an intensity of 50 mWZcm2 in a nitrogen atmosphere at room temperature unless otherwise specified using a multi-light 250 W series exposure light source unit manufactured by Usio Electric Co., Ltd., which uses a 250 W high-pressure mercury lamp as the light source. did.

(Fluorescence intensity measurement method)

The fluorescence intensity was measured using a confocal laser microscope TCS-NT manufactured by Leica Corporation.

[0104] Next, a method for adjusting a film forming solution and a composition in this example will be described. In Example 1, the porous layer is produced by “reaction-induced phase separation”.

(Preparation of composition XI)

As an energy ray polymerizable compound, 70 parts of trifunctional urethane acrylate oligomer “Dudic V-4263” (Dainippon Ink Chemical Co., Ltd.) with an average molecular weight of 2000, hexanediol diatalate “New Frontier HDDA” 30 parts (manufactured by Daiichi Kogyo Seiyaku Co., Ltd.), 3 parts 1-hydroxycyclohexyl phenol ketone “Ilga Cure 1 184” (Ciba-Gaigi Co., Ltd.) as a photopolymerization initiator, and 2, 4 diphenyl as a polymerization retarder A composition XI was prepared by mixing 0.5 parts of -l-4-methyl 1-pentene (manufactured by Kanto Yigaku Co., Ltd.).

[0105] (Preparation of composition X2)

As an energy ray polymerizable compound, 80 parts of “Dudic V-4263”, 20 parts of “Neufrontier HDD A”, and 2 parts of “Irgacure 1 184” as a photopolymerization initiator were mixed. A composition X2 was prepared.

[0106] (Preparation of film-forming solution Y1)

As an energy ray polymerizable compound, 72 parts by mass of the above-mentioned “Dudic V-4263” 18 parts by mass of cyclopenta-rudiatalylate “R-684” (manufactured by Nippon Gyaku Co., Ltd.), 10 parts by mass of glycidyl methacrylate (manufactured by Wako Pure Chemical Industries, Ltd.), methyl decanoate ( 180 parts by weight of Wako Pure Chemical Industries, Ltd., 10 parts by weight of acetone as a volatile good solvent, and 3 parts by weight of “Irgacure-1 184” as an ultraviolet polymerization initiator were mixed uniformly. Membrane liquid Y1 was prepared.

[Formation of base material side member]

Using an acrylic plate having a thickness of 1 mm as the base material 21, the composition XI is applied on the base material 21 by a spin coater, and the connecting channel 8 of the coating film is to be formed (see FIG. 4). The first outer layer 22 was formed by semi-curing the film-forming solution XI by irradiating ultraviolet light through a photomask with an ultraviolet lamp # 2 for 40 seconds to the other part of the film. Thereafter, the uncured composition XI remaining in the non-irradiated part of the ultraviolet rays was washed and removed with a 50% aqueous ethanol solution to form a groove serving as the communication channel 8.

[0108] The composition Y1 is applied onto the first outer layer 22 with a spin coater, and the portion (see Fig. 4) where the separation channel 3 for separation of the coating film is to be formed (see Fig. 4) by an ultraviolet lamp # 2. Irradiate UV light for 40 seconds through a photomask to cure the irradiated film-forming solution Y1 in a porous state, and wash and remove the uncured composition Y1 remaining in the UV-irradiated part with 50% aqueous ethanol. Next, the pore-forming agent remaining inside the pores of the porous layer 33 was washed away with n-xane to form the porous layer 33.

[0109] Using a polyethylene terephthalate (PET) sheet having a thickness of 80 m as a temporary support (not shown), the composition XI is coated on this with a bar coater to form the separation channel 3. The uncured coating film other than the part to be cured was irradiated with UV light through a photomask for 40 seconds by UV lamp # 2 to be semi-cured to form an inner layer 23 on a temporary support (not shown). Next, the uncured composition XI left in the non-irradiated part of the ultraviolet ray was washed and removed with a 50% aqueous ethanol solution to form a defective part of the inner layer 23 to be the separation channel 3. Thereafter, the defect portion of the inner layer 23 that becomes the separation channel 3 is laminated in alignment with the porous layer 33 of the first outer layer 22 formed on the base material 21, and in this state, UV light was irradiated for 60 seconds with UV lamp # 2 to cure and fix. Thereafter, the temporary support (not shown) was peeled off from the inner layer 23 to obtain a member in which the inner layer 23 was fixed on the first outer layer 22. This On the surface of this member, a groove serving as a separation channel 3 having a porous layer 33 formed on the bottom surface was formed.

[0110] (Immobilization of probe DNA)

A 5% by weight polyallylamine (molecular weight: 15000, manufactured by Nittobo Co., Ltd.) aqueous solution is placed in the groove produced above, and allowed to stand at 60 ° C for 1 hour, so that some amino groups in polyallylamine are porous. Reacted with the epoxy group in the layer 33. Thereafter, it was washed with running water for 15 minutes to introduce amino groups into the porous layer 33.

[0111] The base material containing the porous layer 33 having the amino group introduced therein was placed in a 5 mass% aqueous solution of dartalaldehyde (manufactured by Wako Pure Chemical Industries, Ltd.) and allowed to stand at 50 ° C for 2 hours. Almost all amino groups in polyallylamine were reacted with one aldehyde group in dartalaldehyde. Thereafter, the aldehyde group was introduced into the porous layer 33 by washing with running water for 10 minutes.

[0112] 20-base DN A amino-modified at the 5 'end of the porous body 33 introduced with the aldehyde group (probe N0, sequence 5'-amine-ACGTCATCGTCTCGATCTCG-3', manufactured by Espec Oligo Service Co., Ltd.) 2 μL of a 50 μM aqueous solution of the solution was dropped, and allowed to stand at 100% humidity and 50 ° C. for 15 hours to react the terminal amino group of DNA with the aldehyde group of the porous layer 33. Further, it was placed in a 0.2 mass% sodium tetrahydroborate aqueous solution and subjected to a reduction reaction for 5 minutes. In the next ^{ヽ, 0. 2XSSC / 0. 1 0} /0 SDS solution was washed净(0. 2XSSCi or 0. 03MNaCl, a 3mM Kuen aqueous solution of sodium, 0.1% SDS is 0.1% by weight dodecyl sulfate It was rinsed with 0.2 X SSC, further washed with distilled water, and naturally dried to immobilize DNA (probe NO) on the porous layer 33. As described above, the first holding unit 1 in which DNA (probe NO) was immobilized on the pore surface of the porous body 33 was configured.

[0113] (Formation of cover layer side member)

Using an 80 m thick polyethylene terephthalate (PET) sheet as a temporary support (not shown), composition X2 was coated on the uncured film with a bar coater. The cover layer 25 was formed by irradiating with UV rays for 1 second and semi-curing. The composition XI is applied on the cover layer 25 with a bar coater, and through a photomask, the communication path 18 of the uncured coating film 18 is to be formed (see FIG. 4). The second outer layer 24 is formed by semi-curing the film-forming solution XI by irradiating it with ultraviolet lamp # 2 for 120 seconds. It was. Thereafter, the uncured composition XI remaining in the non-irradiated portion of the ultraviolet rays was removed by washing with a 50% aqueous ethanol solution to form a groove serving as the communication channel 8 to obtain a cover layer side member.

[0114] (Fixing two members)

The second outer layer 24 of the cover layer side member is laminated in alignment with the first outer layer 22 of the base member side member, and in this state, the ultraviolet ray lamp # 1 is irradiated with ultraviolet rays for 60 seconds to be cured. Proceeded and stuck. Thereafter, the temporary support (not shown) was peeled from the cover layer 25 to obtain a separation device precursor.

[0115] (Formation of other structures)

Next, a hole having a diameter of 0.5 mm was formed in the base material 21 and the first outer layer 22 by using a drill at the end portion of the separation channel 3 that becomes the inlet 5 to form the inlet 5. Similarly, at the end of the communication channel 8, a hole having a diameter of 0.3 mm is formed in the base material 21 to form the outlet 7, and a pipe having an inner diameter of 8 mm and a height of 10 mm is bonded to the outlet 7 and stored. The liquid tank was 37. Similarly, at the end of the communication channel 18, a hole having a diameter of 0.3 mm is formed in the base material 21, the first outer layer 22, and the inner layer 23 to form the outlet 17, and the inner diameter is 8 mm. A pipe with a height of 10 mm was bonded to the outlet 17 to form a liquid storage tank 37.

[0116] As described above, the separation device 100 including the first holding unit 1 on which DNA (probe NO) was fixed was produced. The outline of the separation device 100 is 100 mm X 25 mm XI .4 mm. As for the dimensions of each part, the thickness of the base material 21 is lmm, and the thicknesses of the first outer layer 22, the inner layer 23, the second outer layer 24, and the cover layer 25 are all about 100 m, and the thickness of the porous layer Is about 5 m, and the pore size of the porous layer is about 1 μm. The dimensions of the separation channel 3 are about 500 m in width, 95 m in height, and about 40 mm in length, so that the separation channel 3 has a width of about 100 m near the outlet. It is gradually narrowed. The communication channel 8 and the communication channel 18 have a width force S of about 100 / ζ πι, a height force S of about 100 / ζ πι, a length of about 30 mm, and the first outlet 6 and the second outlet 16 have dimensions. The width was 100 m, and the length of the separation channel 3 in the length direction was 100 m. From the above dimensions, the volume of the separation channel 3 is about 1.9 / ζ 1 (πιπι ³ ).

[0117] [Method of substance separation]

[Temperature change method]

(Preparation) As a stock solution for separation experiments, a 20-base single-stranded DNA (FO, sequence 3'- TGCAGTAGCAGAGCTAGAGC) that has a base sequence complementary to probe NO and is labeled with the fluorescent dye Cy3 (Amersham Biosciences) A 1 μ ， buffer solution of Cy3-5,) was degassed by placing it in an ultrasonic cleaner for 1 minute while reducing the pressure with an aspirator.

[0118] A lmm thick acrylic plate (not shown) is placed on the upper surface of the separation channel 3 of the separation device 100 as a heat insulating material, and the separation device 100 is adjusted to a temperature control plate (not shown) at 54 ° C. I put it on the top. In this state, the temperature of the separation channel 3 was 50 ° C.

[0119] When the original solution was introduced into the inlet 15 from a microsyringe pump (not shown) for 30 minutes at 5 µ1Z, the fluorescence intensity of the solution flowing out from the first outlet 7 and the second outlet 17 was Although it was almost zero at first, it gradually increased and converged to a certain intensity.

[0120] (Uptake process)

The separation device 100 was placed on the above-described temperature control plate (not shown) adjusted to 54 ° C., and the pump was turned off and allowed to stand for 1 minute. Only in the first intake step, the liquid accumulated in the storage tank 37 of the first outlet 7 and the second outlet 17 was extracted during the two minutes, and the storage tank was emptied.

[0121] (Release process)

Next, the separation device 100 is placed on a temperature control plate (not shown) adjusted to 105 ° C, and after 10 seconds, the force is also applied for 6 seconds, and the pump is operated at a flow rate of 190 1Z to obtain a new one. The original solution was introduced into the separation channel 3 and at the same time, the solution in the separation channel 3 was extruded with the solution. Separately, when the temperature rise state of the separation channel 3 was measured, it was about 80 ° C 10 seconds after the transfer and about 90 ° C after 16 seconds.

[0122] The above uptake and release steps were repeated 30 times alternately, and the solution collected in the storage tank 37 of the first outlet 7 and the second outlet 17 was collected, and the fluorescence intensity was measured using a fluorescence spectrophotometric system. Was measured. As a result, with reference to the fluorescence intensity of the original solution, the first outlet force fluorescence intensity ratio of the solution taken out (ie, the concentration ratio of DNA (FO)) is 1.24, and the solution taken out from the second outlet 17 The fluorescence intensity ratio was 0.76.

[0123] [Constant temperature method]

Separation device 100 was placed on the above temperature control plate (not shown) adjusted to 54 ° C. The microsyringe pump (not shown) is continuously operated at a constant speed of 1. O / z lZ for 60 minutes, and the solution accumulated in the storage tanks of the first outlet 7 and the second outlet 17 is collected. did. As a result, with reference to the fluorescence intensity of the original solution, the first extraction force is the fluorescence intensity ratio of the extracted solution [ie, the concentration ratio of DNA (FO)] is 1.05, and the solution extracted from the second extraction port 17 The fluorescence intensity of was 0.95.

Example 2

In this example, a three-dimensional stepwise arrangement type material separation device, which is an example of the first means of the above embodiment, will be described.

5 and 6 are a plan view and a side cross-sectional view of the substance separation device manufactured in Example 2. FIG. In the same manner as in Example 1, a stepwise arrangement type three-dimensional separation device having the shape shown in FIGS. 5 and 6 was produced. However, the porous layer is formed on the surface of the first outer layer 22 other than the inner wall of the separation channel 3, and the portion other than the inner wall of the separation channel 3 is coated with the composition XI. Applying and irradiating the part other than the part opposite to the flow path 3 with ultraviolet rays, it is sealed with the cured resin to make it non-porous, and is applied to the inner wall of the separation flow path 3 on the first outer layer 22 side. Only the porous layer 33 is left and the first holding part 1 is formed. In addition, a porous layer 34 having the same structure is formed on the inner wall of the separation channel 3 on the second outer layer 24 side to serve as the second holding portion 2. FIGS. 5 and 6 show a multi-stage connection method, and the detailed shape of each separation chamber is omitted. The details of each separation chamber are the same as those shown in FIG.

[0125] In the substance separation device of Example 2, the separation channel 3 is connected in series over 21 stages. In addition, the number of separation flow paths 3 in each stage increases sequentially from 1 for the first stage and 2 for the second stage, and 11 and 10 alternately after the 11th stage. Then, among the outlets of each separation channel 3 in the stage where the number of separation channels 3 is 11 (odd stage), the passage through the first outlet 6 of the separation channel 3 in the upstream stage Flow out of the fluid with the highest number of times It is connected to the first outlet 7 via the loca outlet channel 42. Further, the fluid is connected to the second outlet 17 via the outlet outlet force outlet 44 of the fluid having the largest number of passages through the second outlet 16 of the separation channel 3 in the upstream stage. In addition, the other outlet is connected to the third outlet 27 via the outlet 43.

[0126] The substance separation device of Example 2 includes the first outer layer 22 and the second outer layer on both sides of the inner layer 23. The separation channel 3 is formed on the inner layer 23, the base material 21 is provided outside the first outer layer, and the cover layer 25 is provided outside the second outer layer 24. 3D type. The first holding part 1 and the first outlet 6 are provided on the surface of the first outer layer 22 on the inner layer 23 side, and the second holding part 2 and the first outlet 6 are provided on the surface of the second outer layer 24 on the inner layer 23 side. Two outlets 16 are provided.

[0127] The dimensions of each part of the substance separation device of Example 2 are 50 mm X 50 mm X 2.365 mm, and the dimensions of the separation channel 3 are about 300 / ζ πι in width, about lmm in length, The height is about 60 m (including the thickness of the porous layer 1 is about 5 m and the thickness of the porous layer 2 is about 5 m), the communication channel 38, the communication channel 48, and the extraction channels 42 and 44 are width forces About 100 m, height force ^ about 60 / ζ πι, diameter of inlet 5 and outlet 6, 6 is about 300 m.

Example 3

[0128] In the substance separation device of Example 3, for any two consecutive stages, the sum of the cross-sectional areas of the separation channel in the upstream stage is the sum of the cross-sectional areas of the plurality of separation channels in the downstream stage. It was formed so as to be substantially the same.

FIGS. 11 and 12 are a partial plan view and a side view of the first stage and the second stage part of the substance separation device of Example 3. FIG. In Example 3, the separation flow path 3 is formed in a gap between a pair of opposed flat surfaces. The first holding part 1 and the second holding part 2 are formed inside the pair of planes, respectively, and the distance between them (that is, the thickness of the separation channel) is constant by the spacer 36 (about 55 m). The width of each separation channel 3 is enlarged from the inlet 5 for a while. A plurality of first outlets 6 and second outlets 16 are arranged at predetermined intervals (approximately every 600 μm) at the downstream ends of the first holding part 1 and the second holding part 2, respectively. , Ru The plurality of communication channels 38 connected to the plurality of first outlets 6 in the upstream separation channel 3a are joined together and connected to the inlet 5 of the separation channel 3b in the downstream stage. ing. Similarly, the plurality of communication channels 48 connected to the plurality of second outlets 16 in the upstream separation channel 3a are joined together into the inlets 5 of the separation channel 3c in the downstream stage. It is connected to the.

[0130] [Table 1] Stage Number of separation channels (pieces) Separation channel width (// m)

1 1 6000

2 2 3000

3 3 2000

4 4 1500

5 5 1200

6 6 1000

7 7 860

8 8 750

9 9 670

10 10 600

1 1 1 1 550

12 12 500

13 13 460

14 14 430

15 15 400

16 16 375

17 17 352

18 18 333

19 19 315

20 20 300

21 21 300

[0131] Table 1 shows the number and width of the separation channels in each stage. Since the thickness of the separation channel 3 in each stage is substantially constant, the width of the separation channel is proportional to the channel cross-sectional area. As shown in Table 1), in Example 2, the same number of separation channels 3 as the number of stages are formed in each stage. On the other hand, the width of the separation channel increases from the downstream stage to the upstream stage. The product of the width of the separation channel and the number thereof is substantially the same in each stage. That is, the sum of the cross-sectional areas of the plurality of separation channels in the upstream stage is substantially the same as the sum of the cross-sectional areas of the plurality of separation channels in the downstream stage.

[0132] According to the substance separation device of Example 3, a large amount of sample can be circulated even if the number of separation channels in the upstream stage is small, so that the amount of concentrated solution taken out can be secured. It becomes possible.

Example 4

[0133] In the substance separation device of Example 4, in the three-dimensional substance separation device, The holding part 1 and the second holding part 2 are formed, and the first holding part 1 and the second holding part 2 are formed of a porous layer! The total thickness is high in the separation channel. In addition, a material separation device was formed.

FIG. 5 is a plan view of the material separation device produced in Example 4, and FIG. 13 is a side sectional view taken along the line ε-ε. In Example 4, instead of the film-forming solution Y1 in which the amount of methyl decanoate (manufactured by Wako Pure Chemical Industries, Ltd.) was 180 parts by mass, the amount of the film-forming solution Y1 was changed to 350 parts by mass. A film-forming solution 2 having the same composition as in Example 1 was used. This film-forming solution 2 was applied to the inner surface of the resin layer 1 and cured by irradiating it with ultraviolet rays using an ultraviolet lamp # 1 to form a porous layer 33. In Example 2, the thickness force of the porous layer 33 which was about 5 m was formed to about 30 m. Further, the average pore diameter force of the porous layer 33 that was about m in Example 2 was increased to about 8 m by increasing the amount of added force of methyl decanoate.

Next, on the porous layer 33, the thread and the product XI were applied with a spin coater, and the porous layer 33 was impregnated. By irradiating UV light with UV lamp # 2 to the parts other than the part where the separation flow path 3 and the extraction flow path 43 are to be formed through a photomask, the porous material in the irradiated part is awaited (non- The DNA (NO) was fixed to the porous layer 33 that had been made porous and was not targeted. Then, holes were drilled using drills at both ends of the groove to be the separation channel 3 to form the inlet 5 and the first outlet 6.

[0136] In the same manner as the first inner layer 23a described above, a second inner layer 23b having a porous layer 34 to which DNA (Nl) was immobilized was produced. Then, the surface of the porous layer 33 of the first inner layer 23a and the surface of the porous body 34 of the second inner layer 23b are brought into close contact with each other, and ultraviolet rays are irradiated by the ultraviolet lamp A, so that both plates are completely attached. Stuck. As a result, the gap between the porous layer 33 of the first holding unit 1 and the porous body 34 of the second holding unit 2 became 0, and the separation channel 3 having a thickness of about 60 m was formed by both.

[0137] It should be noted that the average pore diameter of the porous bodies 33 and 34 is formed as large as about 8 µm, and therefore does not hinder the flow of fluid.

Example 5

[0138] "Creating a substance separation device"

A porous layer 34 is also formed on the surface of the second outer layer 24 of the cover layer side member, and the separation A second holding part 2 similar to that shown in FIG. 1 is formed on the surface of the first flow path 3 facing the first holding part 1, and the second holding part includes a first holding part The same substance separation device as in Example 1 except that DNA (probe Nl, sequence 5'-amine-ACGTCATTGTC TCGATCTCG-3 ') that differs in sequence by one base from the DNA immobilized on (probe NO) was immobilized. Produced.

[0139] "Method of substance separation"

As a stock solution for separation experiments, the fluorescent dye Cy5 (manufactured by Amersham Biosciences) has a single-stranded DNA (FO) labeled with the fluorescent dye Cy3 and a base sequence complementary to the probe N1. Temperature change method in the same manner as in Example 1 except that each 1 M mixed buffer solution of 20-base single-stranded DNA (F1, sequence 3 '-TGCAGTAACA GAGCTAGAGC-Cy5-5) labeled with A separation experiment was conducted.

[0140] As a result, based on the fluorescence intensity of Cy3 and Cy5 in the original solution, the fluorescence intensity ratio of Cy3 in the solution taken out from the first outlet (ie, the concentration ratio of DNA (FO)) is 1. 08, Cy5 The fluorescence intensity ratio [ie, the concentration ratio of DNA (Fl)] is 0.93, the Cy 3 fluorescence intensity ratio of the solution taken out from the second outlet 17 is 0.93, and the Cy5 fluorescence intensity ratio is 1. 08.

Example 6

[0141] "Production of substance separation device"

A material separation device similar to that of Example 3 was produced, except that the number of stages was 3 and the dimensions of the separation channel 3 were as follows. The size of the separation channel is 10 m high, 1500 μm wide, 3 cm long, 2nd stage, 100 μm high, 750 μm wide, 3 cm long, and 3rd high. The height was 100 μm, the width was 500 μm, and the length was 3 cm.

[0142] "Material separation method"

As a stock solution for the separation experiment, the same DNA mixed solution as in Example 5 was used, and the temperature change method was the same as in Example 1 except that the time for one liquid delivery from the pump was 15 seconds. A separation experiment was performed.

[0143] As a result, based on the fluorescence intensity of Cy3 and Cy5 in the original solution, the fluorescence intensity ratio of Cy3 in the solution taken out from the first outlet (ie, the concentration ratio of DNA (FO)) is 1.25, Cy5 The fluorescence intensity ratio of [the concentration ratio of DNA (Fl)] is 0.75, and the solution of Cy taken out from the second outlet 17 is Cy. The fluorescence intensity ratio of 3 was 0.75, and the fluorescence intensity ratio of Cy5 was 1.25.

Example 7

[0144] "Production of substance separation device"

In Example 1, (1) Prior to the step of forming the first outer layer 22, the composition XI was applied to the surface of the substrate 21, and the entire surface was irradiated with ultraviolet rays for 10 seconds to be semi-cured, and an adhesive layer (not shown) (2) After forming the first outer layer 22, instead of forming the porous layer 33, hydrophobized silica gel powder having an average particle size of about 10 μm (phenylpropylsilane-treated silica gel: (Made by Kokuyo Pure Chemical Co., Ltd.), leaving the adhesive layer attached to the adhesive layer, leaving it removed, and irradiating the separation channel part with ultraviolet rays to cure the adhesive layer, so that the silica gel is removed from the separation channel. The silica gel layer 33 was used instead of the porous layer 33 in the same manner as in Example 1 except that the silica gel that was fixed to the bottom surface and the non-fixed silica gel other than the separation channel was washed away with ethanol. A material separation device was created.

[0145] "Method of substance separation"

As in Example 1, except that a 1 M aqueous solution of 2,3-dihydroxynaphthalene (DHN: Wako Pure Chemical Industries) was used as the stock solution for the separation experiment, and the adsorption temperature was 25 ° C. Then, a separation experiment was conducted by the temperature change method. However, the concentration of DHN in the effluent was measured by UV absorbance at 342 nm.

[0146] As a result, the ratio of the concentration of the solution taken out from the first outlet and the concentration of the solution taken out from the second outlet force was 1.80.

Example 8

[0147] "Production of substance separation device"

Instead of the porous layer 33, a material separation device having the same dimensions as in Example 6 was produced, except that the same silica gel layer 33 as produced in Example 7 was formed.

[0148] "Method of substance separation"

Example 6 except that the same solution of 2,3-dihydroxynaphthalene (DHN: manufactured by Wako Pure Chemical Industries, Ltd.): LM aqueous solution was used as the stock solution for the separation experiment, and the adsorption temperature was 25 ° C. The separation experiment was conducted by the temperature change method in the same manner as described above.

[0149] As a result, the concentration of the solution taken out from the first outlet and the solution taken out from the second outlet are shown. The ratio to the liquid concentration was 4.83.

The present invention concentrates, purifies, and purifies two or more substances contained in a fluid dissolved state, for example, two or more uniformly mixed fluids, solutes and solvents, and two or more solutes in a solution. Provided are a substance separation device and a substance separation method that can be separated from each other for the purpose of recovery, removal, analysis, and the like. In addition, it is possible to provide a substance separation device and a substance separation method that can be separated continuously by a batch method that requires flow path switching and valve operation. Therefore, the operation of collecting a sample with a time control program such as chromatography does not need to switch the flow path switching valve as in the case of column-type adsorption separation. In addition, since the substance separation device of the present invention can obtain a high-concentration separation liquid simply by connecting it in multiple stages, it can be used for each stage as in the case of stacking conventional membrane separation devices. Since a pump is not required, it is easy to incorporate the pump into a microfluidic device and create a single micro 'total' analysis 'TAS'.

Claims

The scope of the claims

[1] A microdevice that separates a first substance and a second substance in a fluid from each other, and a separation channel for circulating the fluid;

A first outlet and a second outlet formed at a downstream end of the separation channel; and the first substance provided on a part of a wall surface on the first outlet side of the separation channel. A first holding part capable of holding;

A material separation device comprising:

[2] In the first aspect, the separation channel further includes a second holding portion that is provided on a part of the wall surface on the second outlet side of the separation channel and can hold the second substance. The substance separation device described.

[3] Upstream force The separation channel is arranged in a plurality of stages downstream, and in any two consecutive stages of the plurality of stages,

The first outlet of the first separation channel in the upstream stage is connected to the inlet of the second separation channel in the downstream stage,

3. The substance separation device according to claim 1, wherein the second outlet of the first separation channel is connected to the inlet of the third separation channel in the downstream stage.

[4] Upstream force The separation channel is arranged in a plurality of stages downstream, and in any three consecutive stages of the plurality of stages,

The first outlet of the first separation channel in the upstream stage is connected to the inlet of the second separation channel in the middle stage, and the second outlet of the first separation channel is Connected to the inlet of the third separation channel in the middle stage,

The first outlet of the second separation channel in the middle stage is connected to the inlet of the fourth separation channel in the downstream stage, and the second outlet of the second separation channel. The outlet is connected to the inlet of the fifth separation channel in the middle stage,

The second outlet of the third separation channel in the middle flow stage is connected to the inlet of the sixth separation channel in the downstream stage, and the first flow of the third separation channel. 3. The substance separation device according to claim 1, wherein the outlet is connected to the inlet of the fifth separation channel.

[5] Out of the plurality of separation channel outlets in the most downstream stage, the fluid outlet having the largest number of passages of the first outlet in the separation channel in each stage, Connected to the first outlet from which the fluid is removed,

Of the plurality of separation channel outlets in the most downstream stage, the fluid outlet having the largest number of passages through the second outlet of the separation channel in each stage is the fluid. The substance separation device according to claim 3, wherein the substance separation device is connected to a second outlet from which the gas is taken out.

6. The sum of the cross-sectional areas of the plurality of separation channels in the upstream stage is formed substantially the same as the sum of the cross-sectional areas of the plurality of separation channels in the downstream stage. The substance separation device according to any one of the items.

[7] Outflow force other than the outflow port to which the first take-out port is connected and the outflow port to which the second take-out port is connected among the plurality of separation channel outflow ports in the most downstream stage upstream stage 6. The substance separation device according to claim 5, wherein the substance separation device is connected to an inlet of the separation flow path.

[8] The substance separation device according to claim 3 or 4,

In the n-th stage, i separation channels are arranged, at least one of n or i is 2 or more,

In the nth stage, the outlet of the fluid having the largest number of passages of the first outlet of the separation channel is connected to the first outlet for taking out the fluid, and the second outlet The fluid outlet where the number of passages of the fluid is the largest is connected to the second outlet from which the fluid is extracted,

The number of times the fluid passes through the first outlet in the upstream stage of the separation channel outflow outlet of the stage where i separation flow paths in the nth stage and subsequent stages are arranged. 1, where m is the number of times the fluid passes through the second outlet, 1 m is the largest outlet force, and the outlet having the largest m-1 connected to the first outlet is the second outlet. Connected to the outlet! Talking substance separation device.

[9] The wall surface of the separation channel includes a pair of parallel surfaces,

The first holding part and the second holding part are provided on the pair of parallel surfaces. The substance separation device according to any one of Claims 2 to 8.

[10] The substance separation device is configured by laminating an outer layer on both sides of an inner layer,

The separation channel is constituted by a through groove in the inner layer,

The communication channel connecting the outlet in the separation channel in the upstream stage and the inlet in the separation channel in the downstream stage is formed in the outer layer! The substance separation device described.

11. The substance separation device according to claim 10, wherein the first holding part and Z or the second holding part are provided on a surface of the outer layer on the inner layer side.

[12] The separation channel is formed in an inner layer of the substance separation device,

10. The first holding part, the second holding part, the first outlet, and the second outlet are provided on an inner wall of the separation channel in the inner layer.

V, a substance separation device according to any one of the above.

[13] The substance separation device according to any one of [1] to [12], wherein the first holding unit and the Z or the second holding unit are made of a porous body.

14. The substance separation device according to any one of claims 2 to 12, wherein a gap force between the surface of the first holding part and the surface of the second holding part is 1 μm or more and 500 μm or less.

[15] The first holding part and the second holding part are made of a porous body,

The substance separation device according to any one of claims 2 to 12, wherein a gap force between the surface of the first holding unit and the surface of the second holding unit is 100 m or less.

[16] A method of separating a first substance and a second substance in a fluid from each other,

(I) a step of causing the fluid to flow into a separation channel provided with a first holding part capable of holding the first substance on a part of the wall surface;

(II) incorporating the first substance into the first holding unit;

(III) The first substance is released from the first holding part, the concentrated solution of the first substance is taken out from the downstream end of the first holding part, the diluted solution of the first substance and Z or the above Removing the concentrated solution of the second substance from the other end of the downstream end of the first holding unit;

A material separation method characterized by comprising:

17. The substance separation method according to claim 16, wherein the temperature of the holding part in the step (II) is different from the temperature of the holding part in the step (III).

[18] In the step (II), the inflow and the outflow of the fluid are substantially performed by holding the holding unit for a certain period of time at a temperature different from the temperature of the holding unit in the step (III). The substance separation method according to claim 17, which is a step of stopping the process.

[19] A method for separating a first substance and a second substance contained in a fluid from each other, the inlet, the first outlet and the second outlet, and a part of the wall on the first outlet side The separation channel provided with the first holding part capable of holding the first substance is arranged in a plurality of stages with the upstream force also downstream,

(i) flowing the fluid into the first separation channel in the upstream stage;

(ii) incorporating the first substance into the first holding part of the first separation channel;

(iii) The first substance is released from the first holding part of the first separation channel, and the fluid flowing out from the first outlet of the first separation channel is discharged into the second stage in the downstream stage. Injecting the fluid flowing out from the second outlet of the first separation channel into the third separation channel in the downstream stage;

(iv) Among the plurality of separation channel outlets in the most downstream stage, from the fluid outlet having the largest number of passages of the first outlet of the separation channel in each stage, The fluid containing the first substance is taken out, and among the plurality of separation channel outlets in the most downstream stage, the number of times of passage of the second outlet of the separation channel in each stage is the largest. Removing the fluid containing the second substance from the fluid outlet;

A material separation method having

[20] The temperature according to (19), wherein the temperature in the step (ii) and the temperature in the step (iii) are different in each stage of the separation channel arranged over the plurality of stages. Material separation method.

[21] The second substance can be held on a part of the wall on the other end side of the separation channel.

The substance separation method according to any one of claims 16 to 20, wherein 2 holding parts are provided.