WO2007072909A1

WO2007072909A1 - NOVEL OLIGONUCLEOTIDE AND NF-κB DECOY COMPRISING THE SAME

Info

Publication number: WO2007072909A1
Application number: PCT/JP2006/325502
Authority: WO
Inventors: Toshihiro Nakajima; Akiko Temma; Naho Suzuki
Original assignee: Anges Mg, Inc.
Priority date: 2005-12-22
Filing date: 2006-12-21
Publication date: 2007-06-28
Also published as: EP1978096A1; JPWO2007072909A1; US20100167390A1

Abstract

Disclosed is a novel oligonucleotide which has a higher NF-κB-binding ability than a known oligonucleotide decoy for NF-κB and is useful as an NF-κB decoy. Also disclosed is use of the oligonucleotide for medical purposes. The oligonucleotide has a nucleotide sequence which has a consensus sequence and in which a specific nucleotide sequence is added to each of the 5’-terminus and the 3’-terminus of the consensus sequence. An NF-κB decoy comprises a double strand composed of the oligonucleotides substantially complementary to each other.

Description

Specification

Novel oligonucleotide and NF-κB decoy comprising the same

Technical field

[0001] The present invention relates to a novel oligonucleotide and an NF-κB decoy comprising the same. The NF-κB decoy of the present invention is useful for prevention, improvement or treatment of ischemic disease, allergic disease, autoimmune disease, cancer transfer, infiltration and the like.

Background art

[0002] NF-κB (nuclear factor kappa B) is a collective term for a group of transcription factors that play a role in regulating the expression of genes related to immune responses, such as site force-in and adhesion factors. When it binds to the binding site on the gene, the gene related to immune response is overexpressed. For this reason, NF-κB is involved in allergic diseases such as atopic dermatitis and rheumatoid arthritis caused by immune reactions, autoimmune diseases, ischemic diseases such as myocardial infarction, and various diseases such as arteriosclerosis. Known to do.

[0003] On the other hand, it is known that administration of a decoy for a transcription factor reduces the activity of the transcription factor of interest and treats or prevents a disease caused by the transcription factor. Decoy means “decoy” in English, and a substance with a structure resembling that which a substance should originally bind to or act on is called a decoy. As a decoy of a transcription factor that binds to a binding region on a genomic gene, a double-stranded oligonucleotide having the same base sequence as the binding region is mainly used (Patent Documents 1 to 3). In the presence of such an oligonucleotide decoy, a part of the transcription factor molecule binds to the oligonucleotide decoy without binding to the binding region on the genomic gene to be originally bound. For this reason, the number of molecules of transcription factors that bind to the binding region on the genomic gene to be originally bound decreases, and as a result, the activity of the transcription factor decreases. In this case, the oligonucleotide is called a decoy because it functions as a fake (bait) of the binding region on the real genomic gene and binds a transcription factor. Various oligonucleotide decoys for NF-κB are also known, and their pharmacological effects are also known (Patent Documents 4 to 4). [0004] It is a well-known fact that the force with which decoy oligonucleotides delivered into cells can exist stably in cells for a long time can be an important key for the above mechanism to work efficiently. . Oligonucleotides are degraded by intracellular nucleases, making them difficult to exist stably in cells and in the nucleus. To overcome this difficulty, various modifications are made to oligonucleotides. Have been attempted (eg, Non-Patent Document 1, Patent Document 13). Among them, the most commonly used modification is modification with phosphorothioate (PS), and phosphorothioate oligonucleotides have high resistance to nucleases, and are therefore attracting attention as therapeutic oligonucleotides. (For example, Non-Patent Document 2). Phosphorothioation is the conversion of one of the two non-bridging oxygen atoms bound to the phosphorus atom that constitutes the phosphoester bond between adjacent nucleotides to a thio atom.

[0005] However, phosphorothioate oligonucleotides have significantly higher nuclease resistance than natural phosphodiester oligonucleotides, while being more targeted than phosphodiester oligonucleotides. In many cases, disadvantages such as decreased binding ability to the molecule and decreased specificity to the target molecule are observed (Non-Patent Document 1, Non-Patent Document 3). Furthermore, since phosphorothioate groups are toxic, phosphorothioate oligonucleotides are often more cytotoxic than phosphodiester oligonucleotides (4). , Phosphorothioate oligonucleotides are disadvantageous in their use as therapeutic agents.

[0006] Patent Document 1: Japanese Patent Publication No. 96/035430

Patent Document 2: Japanese Patent No. 3392143

Patent Document 3: W095 / 11687

Patent Document 4: JP-A-2005-160464

Patent Document 5: International Publication No. WO96 / 35430

Patent Document 6: International Publication No. WO02 / 066070

Patent Document 7: International Publication WO03 / 043663

Patent Document 8: International Publication WO03 / 082331

Patent Document 9: International Publication WO03 / 099339 Patent Document 10: International Publication WO04 / 026342

Patent Document 11: International Publication No. WO05 / 004913

Patent Document 12: International Publication No. WO05 / 004914

Patent Document 13: JP-T 08-501928

Non-patent literature l: Milligan et al., J. Med. Chem. 1993, 36, 1923

Non-Patent Document 2: Marwick, C., (1998) J. Am. Med. Assoc., 280, 871

Non-Patent Document 3: Stein & Cheng, Science 1993, 261, 1004

Non-Patent Document 4: Levin et al., Biochem. Biophys. Acta, 1999, 1489, 69

Non-Patent Document 5: Neish AS et al., J. Exp. Med. 1992, Vol. 176, 1583-1593.

(Non-Patent Document 6: Leung K et al., Nature. 1988 Jun 23; 333 (6175): 776-778.)

Non-Patent Document 7: Marina A. et al., The Journal of Biological Chemistry, 1995, Vol.270, Number 6, pp. 2620-2627

Disclosure of the invention

Problems to be solved by the invention

[0007] As described above, oligonucleotide decoys for NF-κB are known. Needless to say, it is desirable to provide an oligonucleotide decoy having a higher binding ability to NF-κB than known oligonucleotide decoys. . Therefore, an object of the present invention is to provide a novel oligonucleotide useful as an NF-κB decoy having a higher binding ability to NF-κB than a known oligonucleotide decoy for NF-κB, and a pharmaceutical use thereof. Is to provide.

[0008] Further, an object of the present invention is to provide an oligonucleotide decoy for a transcription factor that has a resistance to nuclease having a high binding ability to a target transcription factor.

In the prior art, efforts have been made to improve the region where NF-κB binds. The inventors of the present application thought that the base sequence in the region adjacent to the region to which NF-κB binds may play an important role in the ability to bind to NF-κB. Then, as specifically described in the following examples, 100 types of oligonucleotides were prepared for the regions adjacent to the same binding region, and their binding ability to NF-κB was tested. NF-κB With high binding capacity The inventors have found gogonucleotide and completed the present invention.

[0010] Furthermore, the inventors of the present application show that by binding only the core sequence of the oligonucleotide decoy with nuclease resistance, the binding ability to a transcription factor is significantly increased as compared with the case where the entire sequence is completely nuclease-resistant modified. The headline, the second invention of the present application was completed.

[0011] That is, the present invention provides an oligonucleotide having a base sequence represented by the following general formula [I].

A-X-B [I]

(In the general formula [I], X is a consensus sequence represented by gggatttccc or gggactttcc, A is a 5 ′ additional sequence selected from the group consisting of cgc, ccc, gga, cgca, ccct and ggct, B is agc, acc A 3 ′ additional sequence selected from the group consisting of ggg, gcg, gcc and gcgg force). The present invention also provides an NF-κB decoy comprising the oligonucleotide of the present invention, which is a substantially double-stranded oligonucleotide complementary to each other. Further, the present invention provides a pharmaceutical comprising the oligonucleotide of the present invention as described above, which contains oligonucleotides having substantially double-stranded strength complementary to each other as an active ingredient. Furthermore, the present invention provides a method for inhibiting NF-κB, which comprises interacting with the NF-κB the oligonucleotide of the present invention, which is a complementary double-stranded oligonucleotide complementary to each other. I will provide a. Furthermore, the present invention provides the use of the above-described oligonucleotide of the present invention, which is complementary to each other and has a substantially double-stranded force, for producing an inhibitor that inhibits NF-κB. . Furthermore, the present invention cures or ameliorates by inhibiting NF-κB, which comprises administering an effective amount of the above-mentioned oligonucleotides of the present invention, which are complementary to each other and have substantially double-stranded strength. Provide methods for prevention, amelioration or treatment of disease. Furthermore, the present invention provides the above-mentioned oligonucleotide of the present invention, which is for producing a medicament for a disease that is cured or ameliorated by inhibition of NF-κB of oligonucleotides that are complementary to each other and have substantially double-stranded strength. Provide use.

[0012] Further, the present invention provides an oligonucleotide for a transcription factor comprising a core sequence and an oligonucleotide having a complementary double-stranded force and having an additional sequence bonded to one or both ends of the core sequence. In the decoy, only the bond between nucleotides constituting the core sequence is modified with nuclease resistance, and the bond between other nucleotides is modified. An oligonucleotide decoy is provided. Furthermore, the present invention relates to an oligonucleotide decoy for a transcription factor, comprising a core sequence and oligonucleotides having substantially double-stranded forces complementary to each other, with additional sequences attached to one or both ends of the core sequence. Only the bond between the nucleotides constituting the core sequence is modified with nuclease resistance, and the bond between the other nucleotides is modified, and the effective amount of the oligonucleotide is characterized by interacting with the transcription factor. A method for inhibiting the transcription factor is provided. Furthermore, the present invention relates to an oligonucleotide for a transcription factor comprising a core sequence and oligonucleotides having a substantially double-stranded force complementary to each other and having an additional sequence bonded to one or both ends of the core sequence. In the nucleotide decoy, only the bond between the nucleotides constituting the core sequence is modified with nuclease resistance, and the bond between the other nucleotides is modified. Inhibiting Uses for producing inhibitors are provided.

The invention's effect

[0013] According to the present invention, a novel oligonucleotide having a higher binding ability to NF-κB than a known decoy oligonucleotide is provided. Since the oligonucleotide of the present invention has a high binding ability to NF-κB, it exhibits superior performance as a decoy for NF-κB than known oligonucleotides, and greatly reduces the physiological activity of NF-κB. Can be made. Therefore, various medicaments containing the decoy of the present invention as an active ingredient exhibit excellent medicinal effects.

[0014] In addition, according to the second invention of the present application, in which only the bond between nucleotides constituting the core sequence is modified with nuclease resistance and is an oligonucleotide decoy, it is specifically described in the following examples. As shown in the figure, compared to a fully S-modified oligonucleotide having the same sequence, the binding ability to a transcription factor is greatly increased, while the core sequence occupying the central portion of the oligonucleotide is resistant to nuclease by S 匕. As it is conferred, resistance to nuclease is not significantly reduced compared to fully S-modified oligonucleotides. For this reason, partial S-oligonucleotide is considered to exhibit excellent performance as a decoy for transcription factors in vivo.

BEST MODE FOR CARRYING OUT THE INVENTION

[0015] As described above, the oligonucleotide of the present invention has the nucleotide sequence represented by the above general formula [I]. Have. In the present invention, “having a base sequence” means that the bases of the oligonucleotide are arranged in such an order. Thus, for example, an “oligonucleotide having a base sequence represented by r _C gcgggatttccca gc” means a 16-base size oligonucleotide having the base sequence of cgcgggatttcccagc. The oligonucleotide having the base sequence represented by the general formula [I] includes a single-stranded oligonucleotide having the indicated base sequence, an oligonucleotide that is a complementary strand thereof, an oligonucleotide having a double-stranded force complementary to each other, and It includes partial duplexes that are partially hybridized with complementary strands to form duplexes. In the present specification and claims, “an oligonucleotide having complementary double-stranded forces” means a complete double-stranded oligonucleotide whose entire regions are complementary to each other. To do. As described later, when used as a decoy for NF-κB (sometimes referred to as “NF-KB decoy” in the present specification and claims), oligos having double-stranded forces complementary to each other Preferably it is a nucleotide.

[0016] In the general formula [I], the consensus sequence represented by X is gggatttccc (SEQ ID NO: 1, Non-Patent Document 5) or gggactttcc (SEQ ID NO: 2, Non-Patent Document 6). An array is preferred. These consensus sequences have the base sequence of the binding region of the genomic gene to which the NF-κB family binds in common.

[0017] Since A in the general formula [I] is a sequence added to the 5 'end of the consensus sequence represented by X, it is referred to as "5' additional sequence" in the present invention, and cgc , Ccc, gga, cgca, ccct and ggct. Since B in the general formula [I] is a sequence added to the 3 ′ end of the consensus sequence represented by X, it is referred to as “3 ′ additional sequence” in the present invention. Selected from the group consisting of agc, acc, ggg, gcg, gcc and gcgg.

[0018] Preferred examples of the oligonucleotide represented by the general formula [I] include cgcgggatttcccagc (arrangement IJ number 3) ゝ cccgggatttcccacc (arrangement 4) ggagggatttcccggg cgcagggat ttcccgcg (eyes il 歹 U number b), ccctgggatttcccgcc (eyes il 歹 [J number 7 and ggctgggatttcccgcgg (酉 self IJ number 8).

[0019] The oligonucleotide of the present invention is preferably DNA in principle, but the bond between at least two adjacent nucleotides is modified with nuclease resistance so that it is against nuclease. It is preferred to increase resistance. Here, “nuclease-resistant modification” means a modification that makes nuclease degradation more natural than natural DNA, and such DNA modification itself is well known. Examples of the nuclease resistance modification include phosphorothioation (sometimes referred to as “S” in the present specification), phosphorodithioation, phosphoramidate formation, and the like. Of these, S is preferred. As described above, conversion to S means that one of two non-bridging oxygen atoms bonded to a phosphorus atom constituting a phosphate ester bond between adjacent nucleotides is converted to a thio atom. The technique of converting the bond between any adjacent nucleotides to S is well known, and can be performed, for example, by the method described in Non-Patent Document 7, and S-modified oligonucleotides are also synthesized commercially. . In the oligonucleotide of the present invention, an oligonucleotide in which all of the linkages between nucleotides are converted to S (hereinafter, sometimes referred to as “fully-modified oligonucleotide” in the present specification) is also preferable. Only the bonds between the nucleotides constituting the S are converted to S, and the other nucleotides, that is, the nucleotides constituting the 5 'addition sequence, the nucleotides constituting the 3' addition sequence, the 5 'end of the consensus sequence Between the nucleotide and the 3′-end nucleotide of the 5 ′ addition sequence and between the 3′-end nucleotide of the consensus sequence and the 5′-end nucleotide of the 3 ′ addition sequence, the oligonucleotide (hereinafter referred to as this oligonucleotide) is modified. Such oligonucleotides are sometimes referred to herein as “partially S-oligonucleotides”). As specifically shown in the Examples below, partially S-modified oligonucleotides have a binding capacity for NF-κB that is about 3-5 times higher compared to fully S-oligonucleotides having the same sequence. On the other hand, since the consensus sequence occupying the central part of the oligonucleotide is given resistance to nuclease by S 匕, the resistance to nuclease is not significantly reduced compared to a fully S-modified oligonucleotide. For this reason, it is considered that the partially S-oligonucleotide exhibits excellent performance as an NF-κB decoy in vivo. In the case of a double-stranded oligonucleotide, each of the above-mentioned nuclease resistance modification may be performed on only one of the strands, but it is preferable to modify both strands.

The oligonucleotide of the present invention can be synthesized using a commercially available nucleic acid synthesizer. It can also be prepared in large quantities by nucleic acid amplification methods such as PCR. [0021] The oligonucleotides of the present invention, which are substantially double-stranded oligonucleotides complementary to each other, have uses as NF-κB decoys. Accordingly, the present invention also provides an NF-κB decoy comprising the oligonucleotides of the present invention and substantially complementary to each other and having double-stranded strength. Here, “NF-κBJ” refers to a homo- or heterodimer of a protein of the NF-κBZRel family member. “NF-κB family” refers to an NF-K BZRel family member. Of protein. For example, P50, P52, P65 (Rel-A), c-Rel, Rd-B. “Homo or heterodimers” include all combinations of NF-κB family single member proteins. In addition, here, “substantially double-strand force” means a complete double-strand or at least one base having one or two bases in a single strand. To do. The NF-κB decoy is preferably a complete double strand that can be used if it is an oligonucleotide that also has a double strand strength. In addition, the single-stranded oligonucleotide has a use as a ligand when purifying the oligonucleotide of the present invention by affinity chromatography in the nucleic acid amplification method or by affinity chromatography. In addition, the partial double-stranded oligonucleotide has a use as a starting material for producing a single-stranded oligonucleotide by generating or denaturing a substantially double-stranded oligonucleotide.

[0022] As described above, various NF-κB decoys are already known, and various pharmaceutical uses thereof are also known. Therefore, the NF-κB decoy of the present invention has a use as a medicine, similar to the known NF-κB decoy. More specifically, the NF-κB decoy of the present invention is an agent for preventing, improving or treating ischemic disease, allergic disease, inflammatory disease, autoimmune disease, cancer metastasis * invasion, or cachexia; Restenosis, acute coronary syndrome, cerebral ischemia, myocardial infarction, reperfusion injury of ischemic disease, atopic dermatitis, psoriasis vulgaris, contact dermatitis, keloid, wound, ulcerative colitis, Crohn's disease, Prevention, improvement or prevention of nephropathy, glomerulosclerosis, albuminuria, nephritis, renal failure, rheumatoid arthritis, osteoarthritis, intervertebral disc degeneration, asthma, chronic obstructive pulmonary disease or cystic fibrosis Therapeutic agent; and has medicinal use as a preventive, ameliorating or therapeutic agent for vascular restenosis that occurs after percutaneous coronary angioplasty, percutaneous angioplasty, neurosurgery, organ transplantation or organ surgery. Here, the vascular restenosis includes restenosis caused by the use of artificial blood vessels, catheters, stents, or vein transplantation. Stenosis; and restenosis resulting from surgical treatment for obstructive arteriosclerosis, aneurysm, aortic divergence, acute coronary syndrome, cerebral ischemia, Marfan syndrome, and pullover crab.

[0023] When used for these medicinal purposes, the route of administration of the oligonucleotide is not particularly limited, but is not limited to intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, direct administration to the target organ or tissue, and the like. Oral administration is preferred. The dose is appropriately set according to the target disease, patient symptoms, administration route, etc. Usually, 0.1 10000 ol, preferably 1 1000 nmol, more preferably 10 100 nmol per day for an adult can be administered. The preparation can be performed by a conventional method. For example, in the case of an injection, it can be in the form of a solution in which the oligonucleotide of the present invention is dissolved in physiological saline. In the preparation, additives commonly used in the pharmaceutical field such as preservatives, buffers, solubilizing aids, emulsifiers, diluents, tonicity agents and the like may be appropriately mixed. Moreover, the other medicinal component may be included.

[0024] As described above, and as specifically described in the Examples below, the partial S-oligonucleotide decoy described above binds to a transcription factor more than the complete S-oligonucleotide decoy. The consensus sequence that occupies the middle part of the oligonucleotide is more resistant to nuclease by S 匕, so its resistance to nuclease is much less than that of a fully S-modified oligonucleotide. do not do. For this reason, the partial S-oligonucleotide is considered to exhibit excellent performance as a decoy for transcription factors in vivo. Therefore, the present invention also provides an oligo for a transcription factor comprising a core sequence and oligonucleotides having substantially double-stranded strength complementary to each other and having additional sequences bound to one or both ends of the core sequence. In the nucleotide decoy, an oligonucleotide decoy is characterized in that only a bond between nucleotides constituting the core sequence is modified with nuclease resistance and a bond between other nucleotides is not modified. Here, the “core sequence” is a region to which a transcription factor binds, and in the case of NF-κB, the above-described consensus sequence. Further, the meaning of “substantially double-strand force” is the same as described above, and complete double-strand is preferred. Each nuclease resistance modification described above may be performed on only one of the strands, but it is preferable to modify both strands. In addition to the NF-κB family, transcription factors include STAT— 1 STAT— 3 STAT— 6 Ets AP— 1 E Examples include 2F, but are not limited thereto.

Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Example

[0026] 1. Preparation of oligonucleotide

100 types of oligodeoxyribonucleotides (hereinafter sometimes referred to as “ODN”) in which an adjunct sequence is bound to both ends of the sequence of SEQ ID NO: 1, which is a known consensus sequence of NF-κB Synthesized. Two strands complementary to each other were chemically synthesized and hybridized to form a complete double-stranded ODN. Each ODN was obtained by converting the bond between all nucleotides to S in both strands (hereinafter sometimes referred to as “SODN”). The SODN number, base sequence, SEQ ID NO., Length, and melting temperature (Tm) are shown in Tables 11 to 13. Of the 100 kinds of oligonucleotides shown in Table 11 and Table 1-3, the oligonucleotide of the present invention represented by the general formula [I] is SODN7 (SEQ ID NO: 3), SODN8 (SEQ ID NO: 4). SODN9 (SEQ ID NO: 5), SODN16 (SEQ ID NO: 6), SODN17 (SEQ ID NO: 7) and SODN30 (SEQ ID NO: 8).

[0027] [Table 1-1]

SODN No. SEQ ID NO: Number of bases Tm (.C) Sequence (5 '→ 3')

1 9 16 50 ctt ggatttcccgtc

2 10 16 50 gtagggatttcccgtg

3 11 16 50 c t ggatttcccttc

4 12 16 50 ct cgggatttc ccatc

5 13 16 50 cttgggatttc cctcc

6 14 16 54 cgagggatttc ccggc

7 3 16 54 cgcgggatttc ccagc

8 4 16 54 cccgggatttcccacc

9 5 16 54 ggagggatttcccggg

10 15 16 54 cct ggatttcccgcc

11 16 17 54 gt tcgggattt ccctgc

12 17 17 54 cctcgggattt cccat c

13 18 17 54 cacagggattt cccgtc

14 19 17 54 ccgtgggattt ccctt c

15 20 17 54 caccgggattt cccaac

16 6 17 58 cgcagggattt cccgcg

17 7 17 58 ccctgggattt cccgcc

18 21 17 58 cggcgggatttccctgg

19 22 17 58 cggagggatttcccggg

20 23 17 58 ggccgggattt ccctcg

21 24 18 54 ct gagggattt cccat tc

22 25 18 54 ct ttgggattt ccctgtc

23 26 18 54 catagggattt cccat cc

24 27 18 54 gctagggattt cccatag

25 28 18 54 gt ctgggattt ccctt tg

26 29 18 62 gggtgggatttcccgggg

27 30 18 62 cgcagggattt cccgcgc

28 31 18 62 cggtgggatttcccgggc

29 32 18 62 cgccgggattt cccacgc

30 8 18 62 ggctgggatttcccgcgg

31 33 19 58 cgcgggatttc ccaat ate

32 34 19 58 ctagggatttcccaccttc

33 35 19 58 cgcgggatttc cctat tag

34 36 19 58 gtagggatttc ccgt aac

35 37 19 58 cttgggatttc ccgct tag SODN No. Sequence number Number of bases Tm (.C) Sequence (5 '→ 3')

36 38 19 62 ct cggga tttcccagct eg

37 39 19 62 ct aggga tttcccgctggc

38 40 19 62 gaagggatttc ccggt ccc

39 41 19 62 cc cggga tttccctaaccc

40 42 19 62 ca cggga tttc ccagc gac

41 43 19 58 gataccgggat ttcccatg

42 44 19 58 catcgt ggat ttcccttc

43 45 19 58 gaatgagggat ttcccgtg

44 46 19 58 ggaacagggat ttcccaag

45 47 19 58 gtcttagggat ttcccacc

46 48 19 62 ggtcacgggat ttccctgc

47 49 19 62 ct gtgcgggat ttccctgc

48 50 19 62 cacctcgggat tt ccc tec

49 51 19 62 ccacgagggat ttcccagc

50 52 19 62 gcaaccgggat ttcccacc

51 53 20 58 gc aggga tttcccattaaac

52 54 20 58 cat ggatttc cctct taac

53 55 20 58 gt aggga tttc ccagt tttc

54 56 20 58 gt aggga tttc ccagt atac

55 57 20 58 ctt ggatttccctttcttc

56 58 20 62 ct cgggatttc ccatt cctc

57 59 20 62 gt cgggatttc cctggtttg

58 60 20 62 c t ggatttcccggatatc

59 61 20 62 ctt gga tttc ccggt tagc

60 62 20 62 gtt ggatttc cctct gagg

61 63 20 58 catagggattt cccatcttg

62 64 20 58 ctttgggattt ccctgtttg

63 65 20 58 ct ctgggattt ccctt tatc

64 66 20 58 ct tagggattt cccat gate

65 67 20 58 gtttgggattt cccttgttc

66 68 20 62 catcgggattt cccaccttc

67 69 20 62 ct tcgggattt cccaccttg

68 70 20 62 gt gagggattt cccgatgtc

69 71 20 62 gtaagggattt cccggctag

70 72 20 62 gctagggattt cccagtagc SODN No. Sequence number Number of bases Tm (.C) Sequence (5 '→ 3')

71 73 20 58 gatatgggatt tcccactag

72 74 20 58 ct ttcgggatt tcccatttg

73 75 20 58 gttttg gatttcccttctc

74 76 20 58 gatacgggatt tcccaatac

75 77 20 58 gattcgggatt tccct tttg

76 78 20 62 ggtacgggatt tcccactac

77 79 20 62 gggtcgggatt tccca tatg

78 80 20 62 gt tacgggatt tccct ctcc

79 81 20 62 ccctcgggatt tccca aatc

80 82 20 62 gtgatgggatt tcccgttgg

81 83 20 58 gt tcttgggat ttccctttc

82 84 20 58 gtatatgggat ttccctagg

83 85 20 58 caagtagggat ttcccatac

84 86 20 58 gatattgggat ttcccttcc

85 87 20 58 gt ttttgggat ttccctgtc

86 88 20 62 cgaattgggat ttccctccg

87 89 20 62 gt ttatgggat ttcccgcgg

88 90 20 62 caatcagggat ttcccgtcc

89 91 20 62 cgtttcgggat ttccctctg

90 92 20 62 ggttgtgggat ttcccgatg

91 93 20 58 gtaaaatgggatttcccgag

92 94 20 58 ctgaatagggatttcccatc

93 95 20 58 gaattctgggatttccctac

94 96 20 58 ctttttagggatt tec cage

95 97 20 58 gtaattaggga tttcccagg

96 98 20 62 gct tttgggatttcccgtc

97 99 20 62 gcaatacggga tttcccagg

98 100 20 62 caagtat ggga tttcccggc

99 101 20 62 gagtcgaggga tttcccatc

100 102 20 62 ctt tcagggatttcccacg

2. Measurement of binding ability to NF-κΒ (primary screening)

The ability of each SODN to bind to NF-κB is determined by reacting each SODN with NF-κΒ (ρ65), and then converting the remaining free NF-κΒ to a commercially available NF-κΒ measurement kit ( Using TransAM Kit (NF-κΒ, ρ65, AC TIVE MOTIF), Jurkat, TPA and CI-Stimulated, Nuclear Extract (phorbol ester (TPA) and calcium ionophore (CI)) included in the kit Stimulated Jurk at cell nuclear extract) was measured using the NF-κB molecule, and the measurement was performed according to the kit instructions, which contained NF-κB (p65 protein). Combined consensus arrangement An NF-κB solution is added to the wells in which the column is immobilized, and after washing, NF-κB bound to the solid phase is quantified by E LISA. According to this measurement method, the higher the binding ability of the oligonucleotide to NF-κB, the smaller the amount of NF-κΒ quantified by ELISA.

[0031] Specifically, the above measurement was performed as follows. Each SODN solution was serially diluted using the Complete Binding Buffer included in the kit, and used as a measurement sample (ratio 3, 4 steps, n = 3). Samples of 30 μL were added to the wells, and the control and blank wells were filled with Compl ete Binding Buffer. Add 20 μL of Jurkat, TPA and CI-Stimulated, Nuclear Extract, each of which is diluted to 125 μg / mL with Complete Lysis Buffer included in the kit, to each well. I got the Complete Lysis Buffer. After incubation with shaking for 1 hour, the wells were washed with IX Wash Buffer included in the kit, and anti-NF-κB (p65 protein) antibody was added and incubated for 1 hour. The wells were washed with IX Wash Buffer, and anti-rabbit HRP-conjugated IgG was added and incubated for 1 hour. Wash with IX Wash Buffer, cover the developer (Developing Solution) included in the kit, develop color for 10 minutes, stop the reaction by adding Stop Solution, and measure the absorbance at 450 nm and 630 nm. .

[0032] The absorbance at 450 nm is subtracted from the absorbance at 630 nm, and the average value of the blank is further subtracted to calculate the ratio (%) of the average value of each concentration with respect to the control when the average value of the control is 100%. The concentration at which the value was 50% (inhibition of binding by 50%) was calculated from the regression line between two points across% (using analysis software (Graph Pad PRISM 4, GraphPad SOFTWARE)). As the nucleotide sequence of the oligonucleotide used for control, a fully S-modified ccttgaagggatttccctcc (SEQ ID NO: 103), which is a known NF-κB decoygonucleotide, was used. Of the 100 SODN measured, 10 SODN with higher activity (SODN6,7,8,9, 16, 17,2 7,30,36,91) and 2 SODN with lower activity (SODN82 , 83)! The results are shown in Table 2. In Table 2, the IC values of the control decoys vary in 100 types.

50

This is because SODN was divided into 18 groups and the control values were measured in each run.

[0033] [Table 2] Contrast decoy contrast contrast

SODN No. SEQ ID NO: base number IC ₅₀ (nM) against the ratio (IC ₅₀ (nM)

6 14 16 1. 31 55. 0 2. 39

7 3 16 1. 61 33. 2 4. 86

8 4 16 2. 01 41. 3 4. 86

9 5 16 2. 01 41. 3 4. 86

16 6 17 1. 37 39. 2 3. 50

17 7 17 1. 31 37. 4 3. 50

27 30 18 2. 23 48. 2 4. 64

30 8 18 1. 33 28. 7 4. 64

36 38 19 2. 10 53. 8 3. 91

82 84 20> 5 2. 70

83 85 20> 5 2. 70

91 93 20 3.06 43. 4 7. 06

[0034] 3. Measurement of binding ability to NF-κΒ (secondary screening)

10 kinds of SODN (SODN6,7,8,9, 16, 17,27,30,36,91) and 2 kinds of SODN (SODN82,83) with low activity that were highly active in the primary screening The inhibitory activity of binding to NF-κB (p65 protein) was compared in the same test method as the primary screening at a ratio of 3, 6 and n = 3. As a comparative control, a fully S-modified cct tgaagggatttccctcc (SEQ ID NO: 103), which is a known NF-κB decoy oligonucleotide, was used. The results are shown in Table 3-1 and Table 3-2.

[0035] [Table 3-1]

IC 50 (nM) Sealing Decoy

0DN

1 2 3 Mean SD vs. contrast decoy 5. 30 5. 11 5. 36 5. 26 0. 1 1 100. 0

[0036] [Table 3-2] IC 50 (nM) contrast decoy

ODN

1 2 3 Mean S D against ¾ Cons: De 4. 48 4. 89 4. 95 4. 77 0. 21 100. 0 S0DN27 2. 94 2. 88 2. 79 2. 87 0. 06 60. 1

1. 71 1. 95 1. 95 1. 87 0. 11

S0DN36 2. 34 2. 80 2. 69 2. 61 0. 20 54. 7

SOD 觀 8. 88 8. 06 7. 84 8. 26 0. 44 173.1

S0DN83 7. 47 7. 36 7. 17 7. 33 0. 12 153.7

S0DN91 2. 72 2. 39 2. 62 2. 58 0. 14 54. 0

[0037] As shown in Table 3-1 and Table 3-2, SODN7,8,9,16,17,30 (oligonucleotide of the present invention) is 2.5 to 3 times as much as control decoy oligonucleotide. Inhibitory activity was observed. There was a 5.2-fold difference between SODN82, which had the lowest activity, and SODN7, which had the highest activity.

[0038] 4. Binding ability of partially S-oligonucleotide

SODN7,8,9,16,17 and 30 partial S-oligonucleotides of the oligonucleotide of the present invention (both strands are S-converted only between nucleotides constituting the consensus sequence, hereinafter referred to as "PSODN") The ability to bind to NF-κB (p65 protein) (which may be called) was examined in the same manner as described above. The results are shown in Tables 4 and 5. Table 5 is a table comparing SODN binding ability and PSODN binding ability side by side. In these tables, the control decoy is a completely S-modified oligonucleotide having the base sequence represented by SEQ ID NO: 103. For example, oligonucleotides having the same number, such as SODN7 and PSODN7, have the same base sequence, and the base sequence is as described above.

[0039] [Table 4]

IC50 (nM)

0DN

1 2 3 ％% of san SD Control Decoy 4. 42 5. 39 4. 97 4. 93 0. 40 100. 0

PS0DN7 0. 46 0. 53 0. 63 0. 54 0. 07 1 1. 0

PS0DN8 0. 53 0. 64 0. 72 0. 63 0. 08 12. 8

PS0DN9 0. 35 0. 66 0. 61 0. 54 0. 14 10. 9

PS0DN16 0. 38 0. 49 0. 37 0. 41 0. 05 8. 4

PS0DN17 0. 44 0. 47 0. 53 0. 48 0. 03 9. 8

PS0DN30 0. 41 0. 50 0. 53 0. 48 0. 05 9. 7

[0040] [Table 5] IC50 (n) ¾ against control decoy

OD 赠

SOD N PS ODN S ODN P SODN

7 1.75 0.54 33.3) 0.3

8 2. 1 2 0.S 3 40.3 I 2.0

9 1.88 0.54 35.7 (0.2

1 6 1.98 0.4 1 37.6 7.9

1 7 1.81 0.48 9.1

30 1.87 0.48 39.) 9.1

[0041] As shown in Tables 4 and 5 above, PSODN was 3.2 to 4.8 times more potent in binding ability to NF-κB (p65 protein) than SODN having the same base sequence.

[0042] 5. Binding inhibition test for other NF-κB family proteins

Check whether the core-only S-decoy nucleic acid (PSODN7,8,9,16,17 and 30) is also inhibited in other NF-κΒ family proteins (p50, p52, Rel-B). I debated. The examination method is basically the same as the primary screening experiment method. We compared the binding inhibitory activity of various NF-κΒ family proteins to the NF-κΒ consensus binding site at a common ratio of 3, 6 and n = 2. As a comparative control, a fully S-modified ccttgaagggatttccctcc (SEQ ID NO: 103), which is a known NF-κΒ decoy oligonucleotide, was used. For binding inhibition tests on various NF-κΒ family proteins, NF-κB Family TransAM Kit (ACT IVE MOTIF) was used, and for p50, Jurkat, TPA and CI-Stimulated, Nuclear Extract (ACTIVE MOTIF) Re B and p52 were evaluated using various NF-κΒ family protein molecules of Raji nuclear extract (manufactured by ACTIVE MOTIF). As the primary antibody, anti-NF-κΒρ50 antibody, anti-NF-κΒρ52 antibody or anti-Rel-B antibody was used, respectively, and HRP-labeled anti-rabbit IgG was used for all secondary antibodies.

[0043] Specifically, the above measurement was performed as follows. Each oligonucleic acid solution was serially diluted with Complete Binding Buffer and used as a measurement sample. Samples to be measured were added to each 30 L well, and Complete Binding Buffer was added to the control and blank wells. 20 μL of nuclear extract diluted with Complete Lysis Buffer was carved into each well, and Complete Lysis Buffer was placed in the blank well. After incubating with shaking for 1 hour, the wells were washed with IX Wash Buffer, and the primary antibody was covered and incubated for 1 hour. Wash well with IX Wash Buffer, add secondary antibody and incubate for 1 hour. I started. After washing with IX Wash Buffer and developing solution for 10 minutes, the reaction was stopped by adding Stop Solution and the absorbance at 450 nm and 630 nm was measured.

[0044] The analysis method involves subtracting the absorbance at 630 nm from the absorbance at 450 nm, subtracting the average value of the blank, and then the ratio of the average value of each concentration to the control when the average value of the control is 100% ( %) And 50% inhibitory concentration (IC50) was calculated using analysis software (Graph Pad PRISM 4, GraphPad S OFTWARE). The results are shown in Table 6. Note that p65 is based on the value in the secondary screening (Table 4 above).

[0045] [Table 6]

IC50 (n M)

R el-B p52 50 p65 ^fr Conventional B decoy 9.45 8.42 8.45 4.93

PSODN 7 1 .S 1 3.01 1 .02 0.54

PSODN 3 1 .82 3.22 1 .08 0.63

PSODN 9 1 .95 1 .55 0.91 0.54

PSODN 16 2.26 2.37 0.80 0.41

PSODN 17 1 .87 4.29 0.91 0.48

PSODN 30 0.92 2.11 0.69 0.4S

[0046] When comparing IC50 values with a conventional NF-KB decoy (completely S-modified SEQ ID NO: 103, the same shall apply hereinafter), 4.2 to 10.3 times for Rd-B, 5.4 to 2.0 times for p52, 50 times It showed 12.2-7.8 times stronger binding inhibitory activity. Therefore, it was shown that the novel sequence decoy nucleate with only the core has strong binding inhibitory activity against other NF-κB family proteins other than p65 protein alone.

[0047] 5. Binding inhibition test of decoy nucleic acid with changed S-position to NF-κB p65 protein Decoy nucleic acid in which only the additional sequence was changed due to the influence of S-position on the oligonucleotide sequence ( FSODN), S-decoy nucleic acid (ODN) was synthesized for the same sequence, and its binding inhibition activity to the NF-κB consensus binding site was compared at a common ratio of 3, 6 and n = 2. The binding inhibition test for NF-κB p6 5 protein was performed using NF-κB, p65 TransAM Kit (ACTIVE MOTIF) and Jurkat, TPA and CI—Stimulated, Nuclear Extract (ACTIVE MOTIF) NF-κ. B protein molecules were used for evaluation. The test method was the same as in Example 5 above. Note that “additional sequence only is S” means that the inside of the attachment and between the addition and the core are S, for example, if the sequence is 7, CsGsCsGGGATTTCCCsAsGsC. Table 7 shows the comparison results. In addition, PSODN uses values from the secondary screening (Table 4 above).

[Table 7]

IC50 M)

0DN number

PS0DN * FS0DN 0DN

7 0.54> 100> 100

8 0.63> 100> 100

9 0.54> 100> 100

16 0.41 1.11> 100

17 0.48> 100> 100

30 0.48> 100> 100

Compared to conventional NF-κΒ decoy 4.93 4.30 3.24 Core sequence only Si decoy nucleic acid (PSODN), the inhibitory activity by FSODN and ODN was low at IC50 value of ΙΟΟηΜ or more. However, Traditional of NF- _K B about 3.9-fold stronger binding inhibitory activity than the decoy was observed for FSODN16. Therefore, it was suggested that even with the same sequence, the binding inhibitory activity varies greatly depending on the position of S 匕.

Claims

The scope of the claims

[I] An oligonucleotide having a base sequence represented by the following general formula [I].

A-X-B [I]

(In the general formula [I], X is a consensus sequence represented by gggatttccc or gggactttcc, A is a 5 ′ additional sequence selected from the group consisting of cgc, ccc, gga, cgca, ccct and ggct, B is agc, acc A 3 ′ additional sequence selected from the group consisting of ggg, gcg, gcc and gcgg force).

[2] The oligonucleotide according to claim 1, wherein the consensus sequence is gggatttccc.

[3] The oligonucleotide according to claim 2, which has a base sequence represented by cgcgggatttcccagc, cccgggatttcccacc, ggagggatttcccggg, cgcagggatttcccgcg, ccctgg gatttcccgcc or ggctgggatttcccgcgg.

[4] The oligonucleotide according to claim 1, comprising double-stranded forces complementary to each other.

[5] The oligonucleotide according to claim 1, wherein the oligonucleotide is modified with a nuclease-resistant binding force between at least two adjacent nucleotides.

[6] The oligonucleotide according to [5], wherein the oligonucleotide also has double-stranded forces complementary to each other, both of which are modified with nucleotide resistance.

7. The oligonucleotide according to claim 5, wherein at least all nucleotides constituting the consensus sequence are nuclease-resistant modified.

[8] The oligonucleotide according to claim 7, wherein the oligonucleotide has a nuclease-resistant modification.

[9] The oligonucleotide according to claim 7, wherein only a bond between nucleotides constituting the consensus sequence is modified with nuclease resistance, and a bond between other nucleotides is modified.

[10] The oligonucleotide according to [5], wherein the nuclease-resistant modifying ability is phosphorothioate.

[I I] The oligonucleotide according to claim 1, wherein the NF-κB decoy also has a substantially double-stranded oligonucleotide force complementary to each other.

12. The NF-κB decoy according to claim 11, wherein the oligonucleotide is a complete double strand.

[13] A small amount of the NF-κB decoy selected from the group consisting of p65, p50, p52 and Re 卜 B protein. 12. The NF-κB decoy according to claim 11, which binds to at least one molecular species.

[14] The pharmaceutical agent according to any one of [1] to [10] above, which comprises, as an active ingredient, an oligonucleotide having a substantially double-stranded force complementary to each other.

15. The medicament according to claim 14, wherein the oligonucleotide is a complete double strand.

[16] The medicament according to claim 14, which is an agent for preventing, improving or treating ischemic disease, allergic disease, inflammatory disease, autoimmune disease, cancer metastasis' invasion, or cachexia.

[17] Vascular restenosis, acute coronary syndrome, cerebral ischemia, myocardial infarction, reperfusion injury of ischemic disease, atopic dermatitis, psoriasis vulgaris, contact dermatitis, keloid, sores, ulcerative colitis , Crohn's disease, nephropathy, glomerulosclerosis, albuminuria, nephritis, renal failure, rheumatoid arthritis, osteoarthritis, intervertebral disc degeneration, asthma, chronic obstructive pulmonary disease or cystic fibrosis

15. The medicament according to claim 14, which is an ameliorating or therapeutic agent.

[18] The medicine according to claim 14, which is an agent for preventing, improving or treating vascular restenosis that occurs after percutaneous coronary angioplasty, percutaneous angioplasty, bypass surgery, organ transplantation or organ surgery.

19. The medicament according to claim 18, wherein the vascular restenosis is restenosis caused by use of an artificial blood vessel, a catheter, a stent, or vein transplantation.

[20] The medicament according to claim 18, wherein the vascular restenosis is caused by surgical treatment for obstructive arteriosclerosis, aneurysm, aortic detachment, acute coronary syndrome, cerebral ischemia, Marfan syndrome, or puller crab chest. .

[21] An oligonucleotide decoy for a transcription factor comprising a core sequence and oligonucleotides complementary to each other and having substantially double-stranded force, each having an additional sequence bonded to one or both ends of the core sequence. An oligonucleotide decoy characterized in that only a bond between nucleotides constituting a core sequence is modified with nuclease resistance and a bond between other nucleotides is modified.

[22] The oligodeoxytide decoy according to claim 21, which is a phosphorothioate-resistant potency.

[23] The oligonucleotide according to claim 1, wherein the oligonucleotide has a double-strand force that is complementary to each other and interacts with NF-κB. Including A method for inhibiting NF-κB.

[24] The inhibitor according to claim 1, which is an oligonucleotide according to claim 1, wherein the oligonucleotide is substantially double-stranded and complementary to each other, and inhibits NF-κB. Use for manufacturing.

[25] The oligonucleotide according to any one of claims 1 to 10, which comprises administering an effective amount of an oligonucleotide having substantially double-stranded strength complementary to each other, NF-κB For the prevention, amelioration, or treatment of diseases that are cured or ameliorated by inhibition of.

[26] The oligonucleotide according to any one of claims 1 to 10, wherein the oligonucleotide is substantially double-stranded and complementary to each other, and is cured or ameliorated by inhibiting NF-κB. For the manufacture of a medicament for the disease to be treated.

[27] An oligonucleotide decoy for a transcription factor comprising a core sequence and an oligonucleotide having complementary double strands and having an additional sequence bonded to one end or both ends of the core sequence. Only the bond between nucleotides constituting the core sequence is modified with nuclease resistance, and the bond between other nucleotides should be modified. The effective amount of the oligonucleotide is allowed to interact with the transcription factor. A method for inhibiting the transcription factor.

[28] An oligonucleotide decoy for a transcription factor comprising a core sequence and an oligonucleotide having complementary double strands and having an additional sequence bonded to one end or both ends of the core sequence. Producing an inhibitor of an oligonucleotide that inhibits the transcription factor activity, characterized in that only the bond between nucleotides constituting the core sequence is modified with nuclease resistance and the bond between other nucleotides is modified. Use to do.