WO2007058504A1 - Novel compounds as agonist for ppar gamma and ppar alpha, method for preparation of the same, and pharmaceutical composition containing the same - Google Patents

Novel compounds as agonist for ppar gamma and ppar alpha, method for preparation of the same, and pharmaceutical composition containing the same Download PDF

Info

Publication number
WO2007058504A1
WO2007058504A1 PCT/KR2006/004867 KR2006004867W WO2007058504A1 WO 2007058504 A1 WO2007058504 A1 WO 2007058504A1 KR 2006004867 W KR2006004867 W KR 2006004867W WO 2007058504 A1 WO2007058504 A1 WO 2007058504A1
Authority
WO
WIPO (PCT)
Prior art keywords
preparation
mmol
nmr
ethyl
phenyl
Prior art date
Application number
PCT/KR2006/004867
Other languages
French (fr)
Inventor
Geun Tae Kim
Hee Oon Han
Jong Sung Koh
Seung Hae Kim
Kyoung-Hee Kim
Hee-Kyung Chung
Ok Ku Park
Sang Kweon Jeon
Sung Ho Woo
Hyeon Joo Yim
Gwong-Cheung Hur
Sung Woon Hong
Ki Dong Koo
Chang-Seok Lee
Min Sun Chang
Sun-Young Koo
Hyun Woo Joo
Jeong Uk Song
Sang Pil Moon
Song-Mi-A
Original Assignee
Lg Life Sciences, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lg Life Sciences, Ltd. filed Critical Lg Life Sciences, Ltd.
Publication of WO2007058504A1 publication Critical patent/WO2007058504A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C251/00—Compounds containing nitrogen atoms doubly-bound to a carbon skeleton
    • C07C251/32—Oximes
    • C07C251/34—Oximes with oxygen atoms of oxyimino groups bound to hydrogen atoms or to carbon atoms of unsubstituted hydrocarbon radicals
    • C07C251/48—Oximes with oxygen atoms of oxyimino groups bound to hydrogen atoms or to carbon atoms of unsubstituted hydrocarbon radicals with the carbon atom of at least one of the oxyimino groups bound to a carbon atom of a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C309/00—Sulfonic acids; Halides, esters, or anhydrides thereof
    • C07C309/63—Esters of sulfonic acids
    • C07C309/64—Esters of sulfonic acids having sulfur atoms of esterified sulfo groups bound to acyclic carbon atoms
    • C07C309/65—Esters of sulfonic acids having sulfur atoms of esterified sulfo groups bound to acyclic carbon atoms of a saturated carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
    • C07D209/18—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D209/22—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with an aralkyl radical attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
    • C07D209/42—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/62—Oxygen or sulfur atoms
    • C07D213/63—One oxygen atom
    • C07D213/64—One oxygen atom attached in position 2 or 6
    • C07D213/643—2-Phenoxypyridines; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/32—One oxygen, sulfur or nitrogen atom
    • C07D239/34—One oxygen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
    • C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
    • C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
    • C07D261/08—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/08—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
    • C07D263/16—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D263/18—Oxygen atoms
    • C07D263/20—Oxygen atoms attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D265/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
    • C07D265/28—1,4-Oxazines; Hydrogenated 1,4-oxazines
    • C07D265/34—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings
    • C07D265/36—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings condensed with one six-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D271/00—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
    • C07D271/02—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
    • C07D271/10—1,3,4-Oxadiazoles; Hydrogenated 1,3,4-oxadiazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D277/28—Radicals substituted by nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00—Systems containing only non-condensed rings
    • C07C2601/06—Systems containing only non-condensed rings with a five-membered ring
    • C07C2601/08—Systems containing only non-condensed rings with a five-membered ring the ring being saturated

Definitions

  • the present invention relates to a novel compound as an agonist for peroxisome proliferator-activated receptor gamma (PPAR ⁇ ) and alpha (PPAR ⁇ ), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • PPAR ⁇ alpha
  • Diabetes mellitus has serious effects on people's health and accompanies various complications.
  • type I diabetes mellitus characterized by little or no insulin secretory capacity due to the destruction of pancreatic cells
  • type II diabetes mellitus characterized by insulin deficiency and insulin resistance due to other causes.
  • the prevalence of type II diabetes mellitus is 90% or more of total patients with diabetes mellitus.
  • Representative examples of complications accompanying diabetes include hyperlipidemia, obesity, hypertension, retinopathy and renal insufficiency (Paul Zimmer, et al, Nature, 2001, 414, 782).
  • Sulfonylureas (stimulating insulin secretion in pancreatic cells), biguanides (inhibiting glucose production in the liver), ⁇ -glucosidase inhibitors (inhibiting glucose absorption in the intestines), etc. have been used as agents to treat diabetes.
  • PPAR ⁇ peroxisome proliferator-activated receptor gamma
  • Thiazolidinediones increasing insulin sensitivity
  • these drugs have side effects such as hypoglycemia, weight gain and the like (David E. Moller, Nature, 2001, 414, 821).
  • these agents raise concerns of inducing hypoglycemia. Accordingly, there is a strong need to develop diabetes therapeutic agents which can treat hyperglycemia and reduce complications of diabetes mellitus with decreased side effects, without inducing hypoglycemia and weight gain.
  • accelerators for human PPAR ⁇ and PPAR ⁇ showed positive effects in various arteriosclerosis animal models, which also suggested the possibility of these compounds being used to treat arteriosclerosis (Li, A.C., et al, J. Clin. Invest. 2000, 106 523, Collins, A., Arterioscler., Thromb., Vase. Biol. 2002, 21, 365-367, Bernadette P. Neve, et al. Biochemical Pharmacology 2000, 60, 1245). Further, since it was reported that PPAR ⁇ accelerators inhibit factors inducing inflammation, the possibility of PPAR ⁇ accelerators being used as therapeutic agents for treatment of inflammation was also suggested.
  • tesaglitazar AZ-242
  • muraglitazar BMS-298585
  • the animal test result ob/ob mouse
  • tesaglitazar showed the excellent effects thereof on treatment of hyperglycemia, hyperinsulinism, and hypertriglyceridmia (B.Bjung et al., J. Lipid Res. 2002, 43, 1855-1863).
  • PPAR partial agonist has been introduced as a method of improving insulin resistance while decreasing side effects of PPAR agonist such as weight gain and edema (SM Rangwala and MA Lazar, Sci STKE, 2002(121), 121-122). They operate selectively according to PPAR promoter and tissue like SERM (Selective Estrogen Receptor Modulator) to improve insulin resistance and selectively inhibit the gene expression associated with a cell differentiation of adipocyte etc (JP Berger et al., MoI Endo., 2003, 17(4), 662-676).
  • SERM Selective Estrogen Receptor Modulator
  • the partial agonist of PPAR binds to PPAR in a completely different way from the full agonist.
  • the acidic moiety of PPAR full agonist forms hydrogen bond with amino acids such as His449, Tyr473, His323, Ser289 and Gln286 etc.
  • Tyr473 among them is located in AF-2 domain of carboxyl terminal, and the hydrogen bond with Tyr473 is important to achieve the co- activator recruitment and DNA binding structure (Tontonoz et al., Genes Dev., 1994, 8, 1224-1234), (Kubota N et al., MoI Cell, 1999, 4, 597-609) (Cronet P et al., Structure, 2001, 9, 699-706).
  • GW0072 as a partial agonist of PPAR shows a different binding form.
  • GW0072 is a compound of carboxylic acid series like other PPAR full agonistes, but it shows that it doest not bind to AF-2 domain and thus it does not form a hydrogen bond with Tyr473 (Yoshioka T., J Med Chem., 1989, 32, 421 -428). This difference in a binding way is a very important factor that can distinguish a PPAR full agonist from a partial agonist.
  • PPAR agonist has possibility to induce osteoporosis.
  • Osteoblasts and adipocytes which have ability to form bone, stem from mesenchymal cells of bone marrow during a process of differentiation.
  • osteoblast While the differentiation of osteoblast from mesenchymal cells is controlled by transcriptional factors such as Runx2/Cbfal or Dlx5, the differentiation of adipocyte from mesenchymal cells is controlled by PPAR ( Komori T et al., Cell, 1997, 89(5), 755-764), (Acampora T et al., Development, 1997, 126(17): 3795-809 Lecka- Czernik B, J Cell Biochem., 1999, 74, 357-371). Further, when an osteoblast is treated with a rosiglitazone as PPAR agonist, the osteoblast is differentiated to adipocyte along with the activation of PPAR, while inhibiting irreversibly the activation of osteoblast phenotype.
  • A is selected from the group consisting of the below substituents
  • R 1 is a below substituent
  • R 2 , R 3 and R 4 are each independently hydrogen, halogen, substituted or unsubstituted C 1 -C 6 alkyl, preferably C 1 -C 4 alkyl;
  • R5 is one or more substituents selected from the group consisting of the below substituents;
  • R 6 is hydrogen, halogen, substituted or unsubstituted C 1 -C 6 alkyl, or substituted or unsubstituted C 1 -C 6 alkoxy, preferably, Ci-C 4 alkyl, or substituted or unsubstituted C 1 -C 6 alkoxy;
  • R 7 and R 8 are each independently hydrogen, substituted or unsubstituted Ci-C 6 alkyl, substituted or unsubstituted C 1 -C 6 alkoxy, or substituted or unsubstituted aryl, preferably, Ci-C 4 alkyl, substituted or unsubstituted Ci-C 6 alkoxy, or substituted or unsubstituted aryl;
  • R 5 is two or more substituents, they are each independently selected from the above substituents;
  • R 9 is hydrogen, or substituted or unsubstituted Ci-C 6 alkyl, preferably C 1 -C 3 alkyl, and Y is -CH-, -O-, -S- or -N-;
  • D is selected from the group consisting of the below substituents
  • E 1 and E 2 are each independently selected from the group consisting of the below substituents
  • n 0 or 1
  • G is hydrogen, or substituted or unsubstituted Ci-C 6 alkyl
  • E 3 is selected from the group consisting of the below substituents
  • R 10 and R 11 are each independently hydrogen, or substituted or unsubstituted C 1 -C 6 alkyl, preferably C 1 -C 3 alkyl,
  • R 12 is hydrogen, substituted or unsubstituted C 1 -CO alkyl, or substituted or unsubstituted cycloalkyl;
  • E 4 is selected from the group consisting of hydrogen, substituted or unsubstituted Ci-C 6 alkyl, or substituted or unsubstituted C 1 -C 6 alkoxy;
  • X is Ci ⁇ C 6 alkyl substituted with halogen or unsubstituted, preferably Ci ⁇ Cs alkyl substituted with halogen or unsubstituted.
  • the alkyl as defined above is an unsubstituted alkyl
  • any one of E 1 and E 2 is preferably the
  • the compound of Formula 1 as an active agent for treatment of diseases is intended to include pharmaceutically acceptable salts, or isomers thereof.
  • pharmaceutically acceptable salts, or isomers thereof For the convenience of explanation, they are briefly illustrated as the compound of Formula lin the present disclosure.
  • the compound of Formula 1 according to the present invention has the structure quite different from well-known PPAR ⁇ and PP ARa accelerators and also an excellent activation effect as to human PPAR ⁇ and PP ARa associated with prevention and treatment of diabetes mellitus, and complications accompanying diabetes such as hyperlipidemia and arteriosclerosis, and inflammation, as can be seen in the below Experimental Examples,
  • substituent group(s) is (are) substituted by alkyl, cycloalkyl, alkoxy, oxo or halogen.
  • Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, hexyl, ethenyl, prophenyl, butenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like.
  • the term "pharmaceutically acceptable salt” means a formulation of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound.
  • the term “isomer” also has the same meaning as the above.
  • the pharmaceutical salts includes salts of acids that form non-toxic acid adduct containing pharmaceutically acceptable anion, for example, acid adducts of inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, iodic acid and the like; acid adducts of organic carbonic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid and the like; acid adducts of sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, bezenesulfonic acid or p-toluenesulfonic and the like.
  • inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, io
  • the examples of pharmaceutically acceptable salts of carboxylic acid include metal salts or alkaline earth metal salts of lithium, sodium, potassium, calcium magnesium and the like; and salts of amino acids such as lysine, arginine, guanidine and the like; organic salts of dicyclohexylamine, N-methyl-D-glucarmine, tris(hydroxymethyl)methylamine, diethanolamine, choline, tirethylamine and the like.
  • the compound of Formula 1 according to the present invention can be converted to its salts by known methods.
  • the term "isomer” means a compound of the present invention or a salt thereof, that has the same chemical formula or molecular formula but is optically or stereochemically different therefrom. Since a variety of compounds according to the present invention have an oxime structure, they can be present in the form of trans or cis geometric isomers. AU of these isomers and mixtures thereof are of course included in the range of the present invention.
  • alkyl means an aliphatic hydrocarbon group.
  • the alkyl moiety may be a "saturated alkyl” group, which means that it does not contain any alkene or alkyne moieties.
  • the alkyl moiety may also be an "unsaturated alkyl” moiety, which means that it contains at least one alkene or alkyne moiety.
  • An “alkene” moiety refers to a group consisting of at least two carbon atoms and at least one carbon-carbon double bond
  • an “alkyne” moiety refers to a group consisting of at least two carbon atoms and at least one carbon-carbon triple bond.
  • the alkyl moiety may be branched, straight chain, or cyclic.
  • the alkyl group may be a lower alkyl having 1 to 6 carbon atoms.
  • the alkyl group of the compounds of the invention may be designated as "C 1 -C 4 alkyl" or similar designations.
  • “Ci-C 4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, and t-butyl.
  • halogen is intended to be broadly construed to include -F, -Cl, -Br, and -I.
  • the compounds of Formula 1 are compounds as defined below: 1. 3- ⁇ [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2- (propoxyimino)ethyl]oxy ⁇ benzoate
  • the present invention also relates to processes for preparation of the compounds of Formula 1.
  • a person skilled in the art could easily manufacture the compound of Formula 1 on the basis of the chemical structure thereof by various processes. In other words, it will be possible to prepare the compound of Formula 1, within the scope of the present invention, by the process described in the present disclosure or by combining some of processes known in the prior art. So the scope of the present invention is not limited to the below processes.
  • the compound of Formula 1 can be prepared by reacting the compound of Formula 2 with the compound of Formula 3 in the presence of base, as shwon in Reaction Scheme 1 below.
  • A, D and X are the same as defined in Formula 1, and L means Cl, Br, I or methanesulfonyloxy group.
  • the reaction can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used.
  • organic solvent such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used.
  • the typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used.
  • the desired compound of Formula 1 can be prepared by hydrolyzing condensed compounds, as shwon in Reaction Scheme 2 below.
  • A, D, L and X are the same as defined in Formula 1, and L means Cl, Br, I or OMs(methanesulfonyloxy group).
  • the reaction 'a' in the reaction scheme can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used.
  • organic solvent such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used.
  • the typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used.
  • the oximation 'b' in the reaction scheme can be conducted with oxime in the presence of organic solvent, such as methanol, ethanol or propanol, or even water, and in some cases, two or more mixtures of them can be used.
  • organic solvent such as methanol, ethanol or propanol, or even water
  • the typical examples of the base include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate and the like, and in some cases, two or more kinds of them can be used.
  • the reaction compounds above can also be prepared by a person skilled in the art on the basis of the chemical structure by various methods. Some examples are illustrated in the below.
  • the compounds represented by Formulas 2 and 4 can be prepared by a well-known method (H. O. Han, et al KR2004-0097273).
  • the present invention provides a pharmaceutical composition for accelerating PPAR ⁇ and PPAR ⁇ comprising (a) a therapeutically effective amount of the compound of Formula 1, and (b) a physiologically acceptable carrier, diluent, or excipient, or a combination thereof.
  • pharmaceutical composition as used herein means a mixture of a compound of the invention with other chemical components, such as diluents or carriers.
  • the pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to oral, injection, aerosol, parenteral, and topical administrations.
  • compositions can also be obtained by reacting compounds with acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.
  • acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.
  • a therapeutically effective amount means an amount of active ingredients effective to alleviate, ameliorate or prevent symptoms of disease or decrease or delay the onset of clinical markers or symptoms of disease.
  • a therapeutically effective amount refers to that amount which has the effect of (1) reversing the rate of progress of a disease; (2) inhibiting to some extent progress of the disease; and/or, (3) alleviating to some extent (or, preferably, eliminating) one or more symptoms associated with the disease.
  • the therapeutically effective amount may be determined by experiments on the efficacy of compound as an active agent via in vivo and in vitro known model systems for diseases to be treated.
  • carrier means a chemical compound that facilitates the incorporation of a compound into cells or tissues.
  • DMSO dimethyl sulfoxide
  • carrier facilitates the uptake of many organic compounds into the cells or tissues of an organism.
  • diot defines chemical compounds diluted in water that will dissolve the compound of interest as well as stabilize the biologically active form of the compound. Salts dissolved in buffered solutions are utilized as diluents in the art.
  • One commonly used buffered solution is phosphate buffered saline because it mimics the ionic strength conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a compound.
  • the compounds described herein can be administered to a human patient per se, or in pharmaceutical compositions in which they are mixed with other active ingredients, as in combination therapy, or suitable carriers or excipient(s). Techniques for formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, 18th edition, 1990.
  • the pharmaceutical composition of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with the present invention thus may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well- known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences, above.
  • the compound of Formula 1 according to the present invention can be formulated into dasage forms suitable for injection or oral admimistration in accordance with intended use.
  • the agents of the present invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks 's solution,
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the compound of the present invention to be formulated as tablet, pill, powder, granule, dragee, capsule, liquid, gel, syrup, slurry, suspension and the like, for oral ingestion by a patient.
  • Preferable dosage forms are capsule and tablet. It is preferable that tablets and pills be coated.
  • Pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipient with one or more compounds of the present invention, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl cellulose, and/or polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
  • the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • the compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • Formula 1 as an active agent can be preferably contained in an amount of about 0.1 ⁇
  • the dosage amount of the compound of Formula 1 will be dependent on the subject's weight and age, the nature and severity of the affliction and the judgment of the prescribing physician.
  • the dosage amount required will be in the range of about 1 to 1000 mg a day depending on the frequency and strength of the dosage.
  • a total dosage amount of about 1 ⁇ 500 mg a day will be sufficient. In some patients, the dosage amount in a day will be higher than that.
  • the present invention provides the use of the compound of Formula 1 for manufacture of a medicament for the treatment or prevention of diseases involving human PPAR ⁇ and PPAR ⁇ .
  • Diseases involving human PPAR ⁇ and PPAR ⁇ mean the diseases which can be treated and prevented by activating human PPAR ⁇ and PPAR ⁇ , and include, for example, but are in no way limited to diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc. Representative examples of the complications associated with diabetes mellitus are hyperlipidemia, arteriorasclerosis, obesity, hypertension, retinopathy, kidney inefficiency, etc.
  • the term “treating” means ceasing or delaying progress of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting symptoms of diseases.
  • the term “preventing” means ceasing or delaying symptoms of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting no symptoms of diseases, but having high risk of developing symptoms of diseases.
  • FIG. 1 is a diagram showing the processing of vector pZeo-GAL in Example
  • FIG. 2 is a diagram showing the processing of vector pZeo-GAL-PPAR ⁇ LBD in Example 2(2).
  • FIG. 3 is a diagram showing the processing of vector pZeo-GAL-PPAR ⁇ LBD in Example 2(3).
  • FIG. 4 is a graph showing the maP2 gene expression in rat cell in Experimental Example 5.
  • FIG. 5 is a graph showing the Acrp30 gene expression in rat cell in Experimental Example 5.
  • FIG. 6 is a graph showing lipid accumulation in the mouse Adipocyte cell line
  • FIG. 7 is an optical microscope photograph showing degree of formation of Calcified Nodule from osteoblast cell in Experimental Example 7.
  • PREPARATION 1 Preparation of dZ)-2-bromo-l-r3-(4-fluorophenvnisoxazol-5- yl]ethanon 0-propyloxime
  • PREPARATION 3 Preparation of ethyl l-((2EV2-r3-(4-fluoro ⁇ henylMsoxazol-5-vn-2- (propoxyimino)ethyl 1-1 H-indol-2-carboxylate
  • reaction solution was diluted with ethyl acetate, washed with water, and dried over anhydrous sodiumsulfate, and solvent was removed, then the residue was purified by column chromatography to give 10 mg of the title compound in a yield of 44%.
  • reaction solution was slowly added to a mixture of 414 mg (2.0 mmol) of 4-chlorobenzohydrazide hydrochloride, 0.28 mL of (2.0 mmol) of triethylamine and 20 mL of dichloromethane at 0 ° C, while stirring. After 1 hour, 169 mg (2.0 mmol) of 2-chloro- 1,3-dimethyl imidazolinium chloride and 0.28 mL (2.0 mmol) of triethylamine were further added thereto. After 1 hour, the resulting solution was washed with saturated ammonium chloride and water and then dried over anhydrous sodiumsulfate, followed by filtering. After solvent was removed, the residue was purified by column chromatography to give 80 mg of the title compound in a yield of 11%.
  • PREPARATION 7 Preparation of ⁇ Z>2-bromo-l-r5-(4-fluoro ⁇ henvn-1.3.4-oxadiazol- 2-yllethanon O-propyloxime
  • EXAMPLE 13 Preparation of l- ⁇ (2EV2-r3-f4-fluorophenvnisoxazol-5-yll-2- (propoxyimino)ethyl 14-phenyl- 1 H-pyrrole-3 -carboxylic acid
  • reaction solution was stirred for 3 hours at room temperature, and 5 mL of saturated ammonium chloride was added thereto, then 10 mL of ethyl acetate was further added thereto. An organic layer was separated and dried over anhydrous magnesium sulfate, followed by filtering. Solvent was removed to give 10 mg of the title compound using column chromatography in a yield of 46%.
  • PREPARATION 14 Preparation of methyl 2-f3-([2-[3-f4-fluorophenvnisoxazol-5-yl1- 2-(propoxyimino)ethyl " [oxy)phenyDpropanoate
  • PREPARATION 15 Preparation of 2-bromo-l-[3-(4-chlorophenylMsoxazol-5- yljethanon O-propyloxime
  • PREPARATION 17 Preparation of 2-bromo-l-f4-phenoxyphenyltethanon O- propyloxime
  • PREPARATION 22 Preparation of methyl 3-fcvclopento ⁇ y>5-hvdroxybenzoate 0.10 g of the title compound was obtained in a yield of 21% in the same manner as in PREPARATION 21, except that 0.34 g (2.0 mmol) of methyl 3,5- dihydroxybenzoate and 0.15 g (1.0 mmol) of isobutylbromide were used.
  • PREPARATION 25 Preparation of methyl 3-([(2EV2-(propoxyiminoV2-(3-r4- (trifluoromethvDphenyl] isoxazol-5 -yl I ethyl "
  • PREPARATION 26 Preparation of methyl 3-(IT2EV2-f3-f4-fluorophenvnisoxazol-5- yll-2-(propoxyimino ' )ethyl]oxy>-l-naphthoate
  • PREPARATION 28 Preparation of methyl 3-(r(2EV2-r3-(4-fluorophenylMsoxazol-5- yll-2-(propoxyimino)ethyl]oxy>-5-( ' trifluoromethyl)benzoate
  • PREPARATION 29 Preparation of methyl 3-(rf2ZV2-(3-phenoxyphenylV2- ⁇ ropoxyiminotethylloxy
  • PREPARATION 30 Preparation of l-rZV2-bromo-l-r3- (cyclopentyloxy * )phenyl] ethanon O-propyloxime
  • PREPARATION 32 Preparation of methyl (3-(r(2ZV2-f3-(cycloDentyloxyfahenvn-2- (propoxyiminotethyl] oxy ) phenvPacetate
  • PREPARATION 33 Preparation of methyl (3-([r2ZV2-[4-(cvclopentyloxy ⁇ phenyll-2- (propoxyimino)ethyl]oxy ⁇ phenyQacetate
  • PREPARATION 38 Preparation of ⁇ ZV2-bromo-l-r3-Qiexyloxy)phenyl1ethanone O- propyloxime
  • PREPARATION 39 Preparation of 3-rdZV2-bromo-N-propoxyethaneimidoyllphenyl butane- 1 -sulfonate
  • PREPARATION 41 Preparation of ⁇ ZV2-chloro-l-(Z4-difluorophenyltethanone O- propyloxime
  • 0.70 g of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 23, except that 0.70 g (3.4 mmol) of 2-bromo-l-[3- (trifluoromethoxy)phenyl]ethanone was used.
  • PREPARATION 46 Preparation of ⁇ ZV2-bromo-l-(3-benzyloxy ⁇ henvnethanone O- ethyloxime
  • PREPARATION 48 Preparation of dZV2-bromo-l-(3- ⁇ henoxyphenvnethanone O-(2- fluoroethvDoxime
  • EXAMPLE 36 Preparation of 3-isopropoxy-5- ⁇
  • EXAMPLE 40 Preparation of (3- ⁇ r(2EV2-r3-(4-fluorophenvnisoxazol-5-vn-2- ( " propoxyimino)ethyll oxy ⁇ -5 -isopropoxyphenyDacetic acid
  • EXAMPLE 46 Preparation of r3-ethoxy-5-( ⁇ (2ZV2-fpropoxyimino>2-r3-(4- methoxyphenoxy ⁇ phenyll ethyl 1 oxy)phenyll acetic acid
  • EXAMPLE 48 Preparation of 2- ⁇ r(2EV2-r3-f4-fluorophenvnisoxazol-5-yl1-2- (propoxyimino ⁇ ethyli oxy 1 benzoic acid
  • PREPARATION 52 Preparation of methyl 3- ⁇ 2-r3-(hexyloxy)phenyll-2-oxoethoxyl-5- isopropoxybenzoate 40 mg of the title compound was obtained in a yield of 93% in the same manner as in PREPARATION 2, except that 30 mg (0.10 mmol) of 2-bromo-l-[3- (hexyloxy)phenyl]ethanone and 21 mg (0.10 mmol) of 3-hydroxy-5- isopropoxybenzoate were used.
  • PREPARATION 53 Preparation of methyl l-IY2ZV2-(3-nitrophenylV2- (propoxyimino)ethyl] - 1 H-indol-3 -carboxylate
  • PREPARATION 54 Preparation of methyl l- ⁇ (2ZV2-r3-famino)phenyl1-2- (propoxyimino)ethyl ⁇ - 1 H-indol-3 -carboxylate
  • EXAMPLE 68 Preparation of sodium 5-chloro-l- ⁇ (2ZV2-(propoxyiminoV2-r4- (trifluoromethvDphenvH ethyl ⁇ - 1 H-indol-3 -carboxylate
  • EXAMPLE 70 Preparation of l-r(2ZV2- ⁇ .4-difluorophenylV2-rpropoxyimino)enyl]- 5-trifluoromethoxy- 1 H-indol-3 -carboxylic acid
  • EXAMPLE 72 Preparation of sodium 5-fluoro-l-r(2ZVf2-methoxyimino)-2-(3- phenoxyphenyltethyli-lH-indol-S-carboxylate
  • EXAMPLE 80 Preparation of ⁇ 3-isopropoxy-5-[2-[(ZVmethoxyiminol-2-(3- phenoxyphenvD-ethoxyl-phenvU-acetic acid
  • PREPARATION 55 Preparation of 5-(2-r3-(4-fluorophenylVisoxazol-5-v ⁇ -2-r(E> propoxyiminoi-ethoxyl-isophthalic acid monomethyl ester
  • PREPARATION 56 Preparation of 3- ⁇ 2-[3-r4-fluorophenylVisoxazol-5-yll-2-r(EV propoxyiminol-ethoxy ⁇ -5-(3-methyl-[L2,4]oxadiazol-5-y ⁇ -benzoic acid methyl ester
  • EXAMPLE 82 Preparation of 3- ⁇ 2-[3-(4-fluorophenvn-isoxazol-5-yll-2-r(EV propoxyiminol-ethoxy ⁇ -5 -(3 -methyl- F 1 ,2,41oxadiazol-5-ylVbenzoic acid
  • PREPARATION 57 Preparation of 5- ⁇ 2-r3-(4-fluorophenviyisoxazol-5-yll-2-I ⁇ E> propoxyimino]-ethoxyl-N-(2-oxopropyl)-isophthalamic acid methyl ester
  • 0.07 g of the title compound was obtained in a yield of 54% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.097 g (0.28 mmol) of 2-bromo-l-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-ethanon O-propyl-oxime, 0.07 g (0.28 mmol) of 3-hydroxy-5-(pyrimidine-2-yloxy)benzoic acid methyl ester and 0.19 g (0.56 mmol) of cesium carbonate were used.
  • PREPARATION 59 Preparation of 4-hvdroxv-biphenvl-2-carbo ⁇ ylic acid methyl ester 0.07 g (0.28 mmol) of 4-methoxy-biphenyl-2-carboxylic acid methyl ester was dissolved in N-methylmorpholine. 0.18 mL (1.0 mmol) of octanethiol and 0.052 g (1.3 mmol) of sodiumhydroxide were added thereto while stirring. And then the reaction solution was refluxed at 120 " C for 10 hours. The pH of the resulting solution was adjusted to pH 2 with IN hydrochloric acid. Ethyl acetate was added thereto. An organic solvent was removed.
  • EXAMPLE 87 Preparation of 4- ⁇ [(2EV2-[3-(4-fluoro ⁇ henvnisoxazol-5-yll- 2(PrOPOXvJmJnOIeIJiVnOXvI -biphenyl-2-carbo ⁇ ylic acid
  • 0.005g of the title compound was obtained in a yield of 36% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.01 g (0.03 mmol) of 2-bromo-l-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-ethanon O-propyl oxime, 0.007 g (0.03 mmol) of 4-hydroxy-biphenyl-2-carboxylic acid methyl ester and 0.02 g (0.06 mmol) of cesium carbonate were used.
  • 0.024g of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.033 g (0.1 mmol) of 2-bromo-l-(3-phenoxy-phenyl)-ethanon 0-propyl-oxime, 0.024 g (0.1 mmol) of 3-hydroxy-5-(pyrimidine-2-yloxy)benzoic acid methyl ester and 0.062 g (0.2 mmol) of cesium carbonate were used.

Abstract

The present invention relates to novel compounds accelerating the activity of Peroxisome proliferator-activated receptor gamma (PPARϜ) and alpha (PPARα), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.

Description

NOVEL COMPOUNDS AS AGONIST FOR PPAR GAMMA AND PPAR ALPHA, METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME
FIELD OF THE INVENTION
The present invention relates to a novel compound as an agonist for peroxisome proliferator-activated receptor gamma (PPARγ) and alpha (PPARα), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.
BACKGROUND OF THE INVENTION
Diabetes mellitus has serious effects on people's health and accompanies various complications. There are two major types of diabetes mellitus: type I diabetes mellitus characterized by little or no insulin secretory capacity due to the destruction of pancreatic cells, and type II diabetes mellitus characterized by insulin deficiency and insulin resistance due to other causes. The prevalence of type II diabetes mellitus is 90% or more of total patients with diabetes mellitus. Representative examples of complications accompanying diabetes include hyperlipidemia, obesity, hypertension, retinopathy and renal insufficiency (Paul Zimmer, et al, Nature, 2001, 414, 782). Sulfonylureas (stimulating insulin secretion in pancreatic cells), biguanides (inhibiting glucose production in the liver), α-glucosidase inhibitors (inhibiting glucose absorption in the intestines), etc. have been used as agents to treat diabetes. Recently, peroxisome proliferator-activated receptor gamma (PPARγ) accelerators (Thiazolidinediones, increasing insulin sensitivity) have drawn attention as therapeutic agents for diabetes. However, these drugs have side effects such as hypoglycemia, weight gain and the like (David E. Moller, Nature, 2001, 414, 821). Furthermore, these agents raise concerns of inducing hypoglycemia. Accordingly, there is a strong need to develop diabetes therapeutic agents which can treat hyperglycemia and reduce complications of diabetes mellitus with decreased side effects, without inducing hypoglycemia and weight gain.
Recently, it has been found through in vivo testing that PPARγ accelerators (agonists) increase insulin sensitivity and also decrease serum levels of glucose and insulin, which suggest the possibility of such compounds being used as therapeutic agents for treatment of diabetes (Ricote M., Nature 1998, 391, 79-82). Accordingly, fibrates which activate PPARα were used as agents functioning to decrease blood triglyceride (TG) levels by 20 ~ 50%, decrease LDLc by 10 ~ 15% and increase HDLc by 10 ~ 15%, as observed through various experiments (Isseman, L, et al, Nature 1990, 347, 645-650; Linton, M. R, Curr. Atheroscler. Rep. 2000, 2, 29-35). This fact is
supported by reports that the activation of PPARα activates the transcription of enzymes which break down fatty acids to decrease the de novo synthesis of fatty acids in liver, thereby resulting in the decreased production and secretion of TG and VLDL.
Recently, accelerators for human PPARγ and PPARα showed positive effects in various arteriosclerosis animal models, which also suggested the possibility of these compounds being used to treat arteriosclerosis (Li, A.C., et al, J. Clin. Invest. 2000, 106 523, Collins, A., Arterioscler., Thromb., Vase. Biol. 2002, 21, 365-367, Bernadette P. Neve, et al. Biochemical Pharmacology 2000, 60, 1245). Further, since it was reported that PPARγ accelerators inhibit factors inducing inflammation, the possibility of PPARγ accelerators being used as therapeutic agents for treatment of inflammation was also suggested.
Therefore, the possibility was suggested that compounds activating both PP ARa and PPARγ can be used in treating diabetes mellitus and hyperlipidemia caused by diabetes mellitus (Auwerx, J., Insulin Resistance, Metabolic Disease Diabetic
Complications 1999, 167-172). Recently, many researchers have also confirmed in animal models that the compounds activating both PPARγ and PP ARa modulate the blood glucose and lipid levels (Koji Murakami, et al, Diabetes, 1998, 47, 1841, Dawn A. Brooks, et al., J. Med. Chem. 2001, 44, 2061).
Because of excellent pharmaceutical effects in various fields as described above, many pharmaceutical companies have been trying to find compounds activating both PPARγ and PPARα. Among these compounds, tesaglitazar (AZ-242) and muraglitazar (BMS-298585) are under clinical phase III trial as of year 2004 (Brad R. Henke, J. Med. Chem. 2004, 47, 4118-4127). In particular, the animal test result (ob/ob mouse) of tesaglitazar showed the excellent effects thereof on treatment of hyperglycemia, hyperinsulinism, and hypertriglyceridmia (B.Bjung et al., J. Lipid Res. 2002, 43, 1855-1863).
Meanwhile, side effects such as weight gain and edema may occur along with the excellent effects. These side effects are clearly found in the case of rosiglitazone and pioglitazone as accelators of PPARγ. More specifically, weight gain (3~5kg) has been ascertained in most of patients, and edema has been accompanied in some patients (S.
Mudaliar et al, Curr. Opin. Endocrinol. Diabetes 2002, 9, 285-302). The occurrence of edema may be a burden on the heart; therefore, it is important to develop the compounds which activate both PPARγ and PPARα, but not causing these side effects. The weight gain by the action of PPAR accelator is mainly caused by an increse of subcutaneous fat in which secretion of metabolic regulators occurs actively. While such weight gain is accompanied with a decrease of abdominal fat, weight loss is generally recommended for treatment of diabetes, whereby the development of compounds not causing the weight gain is required. In this connection, an accelerator activating both PPARγ and PPARα without weight gain has also been reported (R. K. Virkramadithyan et al, Obesity Res. 2003, 11, 292-303).
The concept of PPAR partial agonist has been introduced as a method of improving insulin resistance while decreasing side effects of PPAR agonist such as weight gain and edema (SM Rangwala and MA Lazar, Sci STKE, 2002(121), 121-122). They operate selectively according to PPAR promoter and tissue like SERM (Selective Estrogen Receptor Modulator) to improve insulin resistance and selectively inhibit the gene expression associated with a cell differentiation of adipocyte etc (JP Berger et al., MoI Endo., 2003, 17(4), 662-676). These results have also been proved through in vivo testing; specifically, the experimental result has been reported that an insulin resistance is improved and a weight gain is considerably inhibited (Misra P et al., J Pharmacol Exp Ther., 2003, 306(2), 763-771), (Rocchi S et al., MoI Cell, 2001, 8, 737-747), (Liu LS et al., 1998, Endocrinology, 139(11), 4531-4539). Therefore, it is expected that the PPAR partial agonist can become a better therapeutic agents than the PPAR full agonist which has many side effects such as weight gain and edema.
It is known that the partial agonist of PPAR binds to PPAR in a completely different way from the full agonist. According to X-ray crystal structure of TZD series and compounds of carboxylic acid series as PPAR full agonist, the acidic moiety of PPAR full agonist forms hydrogen bond with amino acids such as His449, Tyr473, His323, Ser289 and Gln286 etc. Tyr473 among them is located in AF-2 domain of carboxyl terminal, and the hydrogen bond with Tyr473 is important to achieve the co- activator recruitment and DNA binding structure (Tontonoz et al., Genes Dev., 1994, 8, 1224-1234), (Kubota N et al., MoI Cell, 1999, 4, 597-609) (Cronet P et al., Structure, 2001, 9, 699-706). On the other hand, GW0072 as a partial agonist of PPAR shows a different binding form. GW0072 is a compound of carboxylic acid series like other PPAR full agonistes, but it shows that it doest not bind to AF-2 domain and thus it does not form a hydrogen bond with Tyr473 (Yoshioka T., J Med Chem., 1989, 32, 421 -428). This difference in a binding way is a very important factor that can distinguish a PPAR full agonist from a partial agonist.
In addition to side effects such as weight gain and edema, PPAR agonist has possibility to induce osteoporosis. Osteoblasts and adipocytes, which have ability to form bone, stem from mesenchymal cells of bone marrow during a process of differentiation. While the differentiation of osteoblast from mesenchymal cells is controlled by transcriptional factors such as Runx2/Cbfal or Dlx5, the differentiation of adipocyte from mesenchymal cells is controlled by PPAR (Komori T et al., Cell, 1997, 89(5), 755-764), (Acampora T et al., Development, 1997, 126(17): 3795-809 Lecka- Czernik B, J Cell Biochem., 1999, 74, 357-371). Further, when an osteoblast is treated with a rosiglitazone as PPAR agonist, the osteoblast is differentiated to adipocyte along with the activation of PPAR, while inhibiting irreversibly the activation of osteoblast phenotype. This phenomenon occurs probably by the result that PPAR inhibits the activity of specific factors of osteoblast such as Runx2/Cbfal or osteopontin, alkaline phosphatase, and osteocalcin (Lecka-Czernik B, J Cell Biochem., 1999, 74, 357-371).
SUMMARY OF THE INVENTION
It is therefore an object of the present invention to provide a novel compound of Formula 1 activating both human PPARγ and PPARα with excellent efficacy.
It is a further object of the present invention to provide processes for preparation of such novel compounds.
It is another object of the present invention to provide pharmaceutical compositions for acceleratrating PPARγ and PPARα activity comprising a therapeutically effective amount of the novel compound as an active agent.
It is another object of the present invention to provide methods for treating or preventing PPARγ and PPARα-related diseases, such as diabetes mellitus, its complications, inflammation, osteoporosis and the like, by the use of the novel compound of the present invention as an active agent.
Other objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description.
According to the present invention, there is provided a compound of Formula 1
[Formula 1]
Figure imgf000008_0001
or a pharmaceutically acceptable salt and isomer thereof,
wherein,
A is selected from the group consisting of the below substituents;
Figure imgf000009_0001
(0
Figure imgf000009_0002
(iii)
wherein, R1 is a below substituent,
Figure imgf000009_0003
wherein, R2, R3 and R4 are each independently hydrogen, halogen, substituted or unsubstituted C1-C6 alkyl, preferably C1-C4 alkyl;
Figure imgf000009_0004
Figure imgf000010_0001
wherein, R5 is one or more substituents selected from the group consisting of the below substituents;
(a) hydrogen, halogen, hydroxy, substituted or unsubstituted C1-C6 alkyl, preferably C1-C4 alkyl, nitro, substituted or unsubstituted amine;
(b) substituted or unsubstituted C1-C6 alkoxy;
Figure imgf000010_0002
(g) °
(h) -NH-SO2-R8
wherein, R6 is hydrogen, halogen, substituted or unsubstituted C1-C6 alkyl, or substituted or unsubstituted C1-C6 alkoxy, preferably, Ci-C4 alkyl, or substituted or unsubstituted C1-C6 alkoxy;
R7 and R8 are each independently hydrogen, substituted or unsubstituted Ci-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, or substituted or unsubstituted aryl, preferably, Ci-C4 alkyl, substituted or unsubstituted Ci-C6 alkoxy, or substituted or unsubstituted aryl;
in case where R5 is two or more substituents, they are each independently selected from the above substituents;
Figure imgf000011_0001
wherein, R9 is hydrogen, or substituted or unsubstituted Ci-C6 alkyl, preferably C1-C3 alkyl, and Y is -CH-, -O-, -S- or -N-;
Figure imgf000011_0002
(vii)
D is selected from the group consisting of the below substituents;
Figure imgf000011_0003
Figure imgf000012_0001
wherein, E1 and E2 are each independently selected from the group consisting of the below substituents,
(a) hydrogen, halogen, substituted or unsubstituted Ci-C6 alkyl, or substituted or unsubstituted Cι~Cό alkoxy;
Figure imgf000012_0002
wherein, n is 0 or 1, G is hydrogen, or substituted or unsubstituted Ci-C6 alkyl;
Figure imgf000012_0003
wherein, E3 is selected from the group consisting of the below substituents,
(a) hydrogen, halogen, hydroxy, substituted or unsubstituted Ci-C6 alkyl, or substituted or unsubstituted C1-C6 alkoxy; (b) -OSO2R10, -NHRio, -NR10Rn, -CH2OR10;
wherein, R10 and R11 are each independently hydrogen, or substituted or unsubstituted C1-C6 alkyl, preferably C1-C3 alkyl,
Figure imgf000013_0001
(e) -CH2OH, -CH2NHCOMe or -CH2NHSO2Me
Figure imgf000013_0002
^- N O (i) ^^
(j) -CONHCH2CORI2 or -CONHRi2
wherein, R12 is hydrogen, substituted or unsubstituted C1-CO alkyl, or substituted or unsubstituted cycloalkyl;
Figure imgf000014_0001
wherein, E4 is selected from the group consisting of hydrogen, substituted or unsubstituted Ci-C6 alkyl, or substituted or unsubstituted C1-C6 alkoxy;
X is Ci~C6 alkyl substituted with halogen or unsubstituted, preferably Ci~Cs alkyl substituted with halogen or unsubstituted.
In a preferable embodiment, the alkyl as defined above is an unsubstituted alkyl
or halogen-substituted alkyl, A as defined above is
(Ri and R5 are the same as defined above), and the abo
Figure imgf000014_0002
ve R5 is (R6 is the same as defined above). D as defined above is preferably,
Figure imgf000015_0001
(E3 and E4 are the same as defined above), any one of E1 and E2 is preferably the
O O
Il Il substituents of the Formula -(CHa^CO-G or -{CH(CH3))-CO-G (n and G are the same as defined above). G as defined above is preferably hydrogen.
The compound of Formula 1 as an active agent for treatment of diseases, even when a separate explanation is not added thereto, is intended to include pharmaceutically acceptable salts, or isomers thereof. For the convenience of explanation, they are briefly illustrated as the compound of Formula lin the present disclosure.
The compound of Formula 1 according to the present invention has the structure quite different from well-known PPARγ and PP ARa accelerators and also an excellent activation effect as to human PPARγ and PP ARa associated with prevention and treatment of diabetes mellitus, and complications accompanying diabetes such as hyperlipidemia and arteriosclerosis, and inflammation, as can be seen in the below Experimental Examples,
Some terms used in the present disclosure are briefly explained below.
When the term "substituted" is used without any separate or additional descriptions in the present disclosure, it means that the substituent group(s) is (are) substituted by alkyl, cycloalkyl, alkoxy, oxo or halogen. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, hexyl, ethenyl, prophenyl, butenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like.
As used herein, the term "pharmaceutically acceptable salt" means a formulation of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. The term "isomer" also has the same meaning as the above. The pharmaceutical salts includes salts of acids that form non-toxic acid adduct containing pharmaceutically acceptable anion, for example, acid adducts of inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, iodic acid and the like; acid adducts of organic carbonic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid and the like; acid adducts of sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, bezenesulfonic acid or p-toluenesulfonic and the like. The examples of pharmaceutically acceptable salts of carboxylic acid include metal salts or alkaline earth metal salts of lithium, sodium, potassium, calcium magnesium and the like; and salts of amino acids such as lysine, arginine, guanidine and the like; organic salts of dicyclohexylamine, N-methyl-D-glucarmine, tris(hydroxymethyl)methylamine, diethanolamine, choline, tirethylamine and the like. The compound of Formula 1 according to the present invention can be converted to its salts by known methods.
As used herein, the term "isomer" means a compound of the present invention or a salt thereof, that has the same chemical formula or molecular formula but is optically or stereochemically different therefrom. Since a variety of compounds according to the present invention have an oxime structure, they can be present in the form of trans or cis geometric isomers. AU of these isomers and mixtures thereof are of course included in the range of the present invention.
The term "alkyl" means an aliphatic hydrocarbon group. The alkyl moiety may be a "saturated alkyl" group, which means that it does not contain any alkene or alkyne moieties. The alkyl moiety may also be an "unsaturated alkyl" moiety, which means that it contains at least one alkene or alkyne moiety. An "alkene" moiety refers to a group consisting of at least two carbon atoms and at least one carbon-carbon double bond, and an "alkyne" moiety refers to a group consisting of at least two carbon atoms and at least one carbon-carbon triple bond. The alkyl moiety, whether saturated or unsaturated, may be branched, straight chain, or cyclic. For example, the alkyl group may be a lower alkyl having 1 to 6 carbon atoms. The alkyl group of the compounds of the invention may be designated as "C1-C4 alkyl" or similar designations. By way of example only, "Ci-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, and t-butyl.
The term "halogen" is intended to be broadly construed to include -F, -Cl, -Br, and -I.
Other terms used herein can be interpreted as having their usual meanings in the art to which the present invention pertains.
In a particularly preferred embodiment, the compounds of Formula 1 are compounds as defined below: 1. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2- (propoxyimino)ethyl]oxy}benzoate
2. l-{(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl}-lH-indol- 2-carboxylic acid
3. 3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4,-oxadiazol-2-yl]-2- (propoxyimino)ethyl] oxy } benzoic acid
4. (lE)-l-[3 -(4-fluorophenyl)isoxazol-5 -yl] -2-phenoxyethanone O-propyloxime
5. {l-(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2-(propoxyimino)ethyl}-lH-indol- 3-yl} acetic acid
6. 1 -(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2-(ρropoxyimino)ethyl]- 1 H-indol-3- carboxylic acid
7. {l-(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2-(propoxyimino)ethyl}-lH-indol- 3-yl} acetic acid
8. 3-{[(2E)-2-(butoxyimino)-2-(3-phenylisooxazol-5-yl)ethyl]oxy}benzoic acid
9. 3-{[(2E)-2-[5-(4-fluoroρhenyl)-l,3,4,-oxadiazol-2-yl]-2- (propoxyimino)ethyl]oxy}benzoic acid
10. 3- { [(2E)-2-[2-(4-fluorophenyl)-l ,3,-thiazol-4-yl]-2- (propoxyimino)ethyl]oxy}benzoic acid
11. 3-{[(2Z)-2-(2-naphthyl)-2-(propoxyimino)ethyl]oxy}benzoic acid
12. (3-{[(2Z)-2-(2-naphthyl)-2-(proρoxyimino)ethyl]oxy}ρhenyl)acetic acid 13. l-{(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl}4-phenyl- lH-pyrrole-3-carboxylic acid
14. 6-{[(2E)-[3-(4-fluorophenyl)isoxazol-5-yl]2-(propoxyimino)ethyl]oxy}-l- naphthoic acid
15. 1 -[2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]- 1 H-indol-4- carboxylic acid
16. 3 - { [2- [3 -(4-fluorophenyl)isoxazol-5 -yl] -2-(propoxyimino)ethyl] oxy } -2- naphthoic acid
17. 3-{[2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
18. 2-(3-{ [2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)propanoic acid
19. 3 - { [2- [3 -(4-chlorophenyl)isoxazol-5 -yl] -2-(propoxyimino)ethyl]oxy } benzoic acid
20. 3-{[2-(4-phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}benzoic acid
21. 3-{[(2E)-2-(propoxyimino)-2-{3-[4-trifluoromethyl]phenyl}isoxazol-5-
yl]ethyl}oxy}benzoic acid
22. (3-{[(2E)-2-(ρropoxyimino)-2-{3-[4-(trifluoromethyl)phenyl]isoxazol-5- yl}ethyl]oxy}phenyl)acetic acid
23. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy-5- isopropoxybenzoic acid
24. 3 -isopropoxy-5- { [(2Z)-2-(2-naphthyl)-2(propoxyimino)ethyl]oxy } benzoic acid
25. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy-5- isobutoxybenzoic acid
26. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy-5- cyclophenoxybenzoic acid
27. 3-{[(2Z)-2-(3-phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}benzoic acid
28. (3-{ [(2Z)-2-(3-phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}phenyl)acetic acid
29. 3-{[(2E)-2-(propoxyimino)-2-{3-[4-(trifluoromethyl)phenyl] isoxazol-5- yl}ethyl]oxy}-l-naphthoic acid
30. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-l- naphthoic acid
31. l-[3-(4-fluorophenyl)isoxazol-5-yl]-2-[3-(trifluoromethyl)phenoxy]ethanone O- propyloxime
32. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-5- (trifluoromethyl)benzoic acid
33. 3-{[(2Z)-2-(3-phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}-5- (trifluoromethyl)benzoic acid
34. (3-{ [(2Z)-2-[3-(cyclopentyloxy)phenyl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid 35. (3-{ [(2Z)-2-[4-(cyclopentyloxy)phenyl]-2- (propoxyimino)ethyl] oxy } phenyl)acetic acid
36. 3-isopropoxy-5-{[(2Z)-2-(3-oxo-3,4-dihydro-2H-l,4-benzoxazine-6-yl)-2- (propoxyimino)ethyl]oxy}benzoic acid
37. 3-isopropoxy-5-{[(2Z)-2-(4-methyl-3-oxo-3,4-dihydro-2H-l,4-benzoxazine-6- yl)-2-(propoxyimino)ethyl]oxy}benzoic acid
38. (3-{ [(2Z)-2-(3-oxo-3,4-dihydro-2H-l ,4-benzoxazine-6-yl)-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
39. (3-ethoxy-5-{ [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
40. (3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-5- isopropoxyphenyl)acetic acid
41. sodium (3-{[(2Z)-2-(ethoxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl)acetate
42. (3-{[(2Z)-[3-(benzyloxy)phenyl]-2-(ethoxyimino)ethyl]oxy}phenyl)acetic acid
43. [3-({(2Z)-2-(propoxyimino)-2-[3-(4- methoxyphenoxy)phenyl]ethyl}oxy)phenyl]acetic acid
44. (3-{[(2Z)-2-[3-(4-methoxyρhenoxy)phenyl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
45. 6-({(2Z)-2-(propoxyimino)-2-[3-(4-methoxyphenoxy)phenyl]ethyl}oxy)-l- naphthoic acid
46. [3-ethoxy-5-({(2Z)-2-(propoxyimino)-2-[3-(4- methoxyphenoxy)phenyl] ethyl } oxy)phenyl] acetic acid
47. [3-({(2Z)-2-(propoxyimino)-2-[3-(4-methoxyphenoxy)ρhenyl]ethyl}oxy)-5- isopropoxyphenyljacetic acid
48. 2-{ [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}benzoic acid
49. 3-{[(2Z)-2-[3-(hexyloxy)phenyl]-2-(propoxyimino)ethyl]oxy}benzoic acid
50. (3-{[(2Z)-2-[3-(hexyloxy)phenyl]-2-(propoxyimino)ethyl]oxy}acetic acid
51. 1 - {(2Z)-2-[3-(hexyloxy)phenyl]-2-(ρropoxyimino)ethyl} - 1 H-indol-3- carboxylic acid
52. (2-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl] oxy } phenyl)acetic acid
53. (2-{[(2Z)-2-[3-(4-methoxyphenoxy)ρhenyl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
54. 1 -[(2Z)-2-(3-nitrophenyl)-2-(propoxyimino)ethyl]- 1 H-indol-3-carboxylic acid
55. 3-{[(2Z)-2-[3-(hexyloxy)ρhenyl]-2-(propoxylimino)ethyl]oxy}-5- isopropoxybenzoic acid
56. 3-({(2Z)-2-[3-(hexyloxy)ρhenyl]-2-[(2-hydroxyethoxy)imino]ethyl}oxy)-5- isopropoxybenzoic acid 57. l-[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-lH-indol-3-carboxylic acid
58. sodium 3-{[(2Z)-2-{3-[(butylsulfonyl)oxy]phenyl}-2- (propoxyimino)ethyl]oxy}-5-isopropoxybenzoate
59. l-{(2Z)-2-(3-phenoxyphenyl)-2-(propoxyimino)-lH-indol-3-carboxylic acid
60. l-{(2Z)-2-{3-[(methylsulfonyl)amino]phenyl}-2-(ρropoxyimino)ethyl}-lH- indol-3-carboxylic acid
61. l-[(2Z)-2-(3-{[(4-chloroρhenyl)sulfonyl]ammo}phenyl)-2- (propoxyimino)ethyl] - 1 H-indol-3 -carboxylic acid
62. l-{(2Z)-2-(propoxyimino)-2-[3-(trifluoromethoxy)phenyl]ethyl}-lH-indol-3- carboxylic acid
63. l-[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-5-methoxy-lH-indol-3- carboxylic acid
64. [3-({(2Z)-2-(propoxyimino)-2-[4- (trifluoromethyl)phenyl]ethyl}oxy)phenyl]acetic acid
65. (3-{[(2Z)-2-{3-{(butylsulfonyl)oxy}phenyl}-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
66. sodium 5-chloro-l-[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-lH- indol-3-carboxylate
67. sodium 5-fluoro-l-{(2Z)-2-(propoxyimino)-2-[4- (trifluoromethyl)phenyl] ethyl } - 1 H-indol-3 -carboxylate
68. sodium 5-chloro-l-{(2Z)-2-(propoxyimino)-2-[4-(
)phenyl]ethyl } - 1 H-indol-3 -carboxylate
69. 1 -[(2Z)-2-(2,4-difluorophenyl)-2-(propoxyimino)enyl]- 1 H-indol-3 -carboxylic acid
70. l-[(2Z)-2-(2,4-difluorophenyl)-2-(propoxyimino)enyl]-5-trifluoromethoxy-lH- indol-3 -carboxylic acid
71. sodium 5-fluoro-l-[(2Z)-2-[(2- fluoroethoxy)imino]-2-(3- phenoxyphenyl)ethyl] - 1 H-indol-3 -carboxylate
72. sodium 5-fluoro-l-[(2Z)-(2-methoxyimino)-2-(3-ρhenoxyphenyl)ethyl]-lH- indol-3 -carboxylate
73. sodium { l-[(2Z)-(3-phenoxyphenyl)-2-(propoxyimino)ethyl]-l H-indol-3 - yl}acetate
74. [3-({(2Z)-2-(propoxyimino)-2-[3- (trifluoromethyl)pheny 1] ethyl } oxy)phenyl] acetic acid
75. 5-fluoro-l -{(2Z)-2-[(2-fluoroethoxy)imino]-2-[3- (trifluoromethoxy)phenyl]ethyl}-lH-indol-3-carboxylic acid
76. sodium (l-{(2Z)-2-(propoxyimino)-2-[3-(trifluoromethoxy)phenyl]ethyl}-lH- indol-3-yl)acetate
77. (3-ethoxy-5-{[(2Z)-2-(3-phenoxyphenyl)-2- (propoxyimino)ethyl] oxy } phenyl)acetic acid
78. sodium 5-fluoro-l-{(2Z)-(2-methoxyimino)-2-[3- (trifluoromethoxy)phenyl]ethyl}-lH-indol-3-carboxylate
79. 4-isopropoxy-2- {2-(3-phenoxyphenyl)-2-[(Z)-propoxyimino]-ethoxy} -benzoic acid
80. {3-isopropoxy-5-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]- phenyl} -acetic acid
81. {3-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-phenyl}-acetic acid
82. 3-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)-propoxyimmo]-ethoxy}-5-(3- methyl-[ 1 ,2,4]oxadiazol-5-yl)-benzoic acid
83. 5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)-propoxyimino]-ethoxy}-N-(2- oxopropyl)-isophthalamic acid
84. N-cyclopropyl-5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)-propoxyimino]- ethoxy}-isophthalamic acid
85. 2-bromo-5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)-propoxyimino]- ethoxy} -benzoic acid
86. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy}-
5(pyrimidine-2-yloxy)benzoic acid
87. 4-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy}- biphenyl-2-carboxylic acid 88. 5- { [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy} -2- morpholine-4-ylbenzoic acid
89. 3-{[(2Z)-2-[3-(4-chlorophenoxy)ρhenyl]-2(propoxyimino)ethyl]oxy}-5- (pyrimidine-2-yloxy)benzoic acid
90. 3-{[(2Z)-2-(3-phenoxyphenyl)-2(propoxyimino)ethyl]oxy}-5-(pyrimidine-2- yloxy)benzoic acid
91. 3-{ [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy}-5- (hydroxymethyl)benzoic acid
92. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy}- 5(pyrrolidine- 1 -ylmethyl)benzoic acid
93. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(ρroρoxyimino)ethyl]oxy}- 5(isopropoxymethyl)benzoic acid
94. 3-[(acetylamino)methyl]-5-(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]- 2(propoxyimino)ethyl]oxy } benzoic acid
95. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2(propoxyimino)ethyl]oxy}- 5 { [(methylsulfonyl)amino]methyl}benzoic acid
96. l-[(2E)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-5-fluoro-l H-indol-2- carboxylic acid
97. 1 -[(2E)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-5-methoxy- 1 H-indol-3- carboxylic acid 99. l-[(2Z)-2-(4-chlorophenyl)-2-(ρroρoxyimino)ethyl]-5-fluoro-l H-indol-3- carboxylic acid
100. sodium 5-fluoro-l-[(2Z)-2-(3-hydroxyphenyl)-2-(propoxyimino)ethyl]-l H- indol-3-carboxylate
101. 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-5- [(methylsulfonyl)oxy]benzoic acid
102. 5-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-2- [(methylsulfonyl)oxy]benzoic acid
103. 2-ethoxy-5- { [(2E)-2-[3-(4-fluoroρhenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}benzoic acid
104. 2-(ethylamino)-5- { [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}benzoic acid
105. 2-(dimethylamino)-5-{ [(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl] oxy } benzoic acid
106. 1 -[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2-(proρoxyimino)ethyl]-6- methoxy-lH-indol-3-carboxylic acid
107. sodium 1 -[(2Z)-2-(3-phenoxyphenyl)-2-(propoxyimino)ethyl]-l H-indol-3- carboxylate
108. sodium 1 -[(2Z)-2-(ethoxyimino)-2-(3-phenoxyρhenyl)ethyl]- 1 H-indol-3-
carboxylate 109. sodium l-[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-6-methoxy-lH- indol-3 -carboxylate
110. l-[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]-4-methoxy-lH-indol-3- carboxylic acid
111. (4-{[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]oxy}phenyl)acetic acid
112. (2-{[(2Z)-2-(ethoxyimino)-2-(3-phenoxyphenyl)ethyl]oxy}phenyl)acetic acid
113. 3 -(2- { [(2Z)-2-(ethoxyimino)-2-(3 -phenoxyphenyl)ethyl]oxy }phenyl)propanoic acid
114. l-[(2Z)-2-(ethoxyimino)-2-{3-[(propylsulfonyl)oxy]phenyl}ethyl]-lH-indol-3- carboxylic acid
115. sodium-l-{(2Z)-2-(ethoxyimino)-2-[3-(trifluoromethoxy)phenyl]ethyl}-5- fluoro- 1 H-indol-3 -carboxylate
116. sodium { l-[(2Z)-2-(propoxyimino)-2-{3-[(propylsulfonyl)oxy]phenyl}ethyl]-
1 H-indol-3 -yl } acetate
117. sodium {l-[(2Z)-2-(ethoxyimino)-2-(3-{[(4- methylphenyl)sulfonyl]oxy}phenyl)ethyl]-lH-indol-3-yl}acetate
118. (3-ethoxy-5-{[(2Z)-2-(methoxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl)acetic acid
119. sodium (3-ethoxy-5-{[(2E)-2-[3-(4-fluoroρhenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)acetate 120. sodium l-{(2Z)-2-(ethoxyimino)-2-[3-(pyridme-2-yloxy)phenyl]ethyl}-5- fluoro- 1 H-indol-3 -carboxylate
121. [3-({(2Z)-2-(propoxyimino)-2-[3-(pyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid
122. sodium l-{(2Z)-2-(propoxyimino)-2-[3-(pyridine-2-yloxy)phenyl]ethyl}-lH- indol-3 -carboxylate
123. sodium 1 - { (2Z)-2-(ethoxyimino)-2- [3 -(ρyridine-2-yloxy)phenyl]ethyl } - 1 H- indol-3-carboxylate
124. sodium (3 -isopropyloxy-5 - { [(2Z)-2-(ethoxyimino)-2-(3 - phenoxyphenyl)ethyl]oxy}phenyl)acetate
125. sodium (3 -isopropyloxy-5 -{[(2Z)-2-(propyloxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl)acetate
126. (Z)-3-{2-[3-(2-oxo-l,3-oxazolidine-3-yl)phenyl]-2- (propoxyimino)ethyl}oxy)phenyl acetic acid
127. methyl (3-ethoxy-5-{[(2Z)-2-[3-(2-oxo-l,3-oxazolidine-3-yl)ρhenyl]-2-
(propoxyimino)ethyl]oxy}phenyl)acetate
128. {3-[2-[(Z)-ethoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-phenyl}-acetic acid
129. [3-({(2Z)-2-(ethoxyimino)-2-[3-(pyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid
130. [3-({(2Z)-2-(methoxyimino)-2-[3-(ρyridine-2- yloxy)phenyl] ethyl } oxy)phenyl] acetic acid
131. (3-{[(2Z)-2-(methoxyimino)-2-(2-naphthyl)ethyl]oxy}phenyl)acetic acid
132. (3-{[(2Z)-2-(ethoxyimino)-2-(2-naphthyl)ethyl]oxy}phenyl)acetic acid
133. [3-(cyclopentyloxy)-5-{[(2Z)-2-(ethoxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl]acetic acid
134. {3-cyclopentyloxy-5-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]- phenyl} -acetic acid
135. {3-methoxy-5-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-phenyl}- acetic acid
136. {3-[2-[(Z)-ethoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-5-methoxyphenyl}- acetic acid
137. {3-ethoxy-5-[2-[(Z)-ethoxyimino]-2-(3-phenoxyρhenyl)-ethoxy]-phenyl}- acetic acid
138. {3-isopropoxy-5-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-
phenyl} -acetic acid
139. {3-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-phenyl}-acetic acid
140. [3-methoxy-5-({(2Z)-2-(methoxyimino)-2-[3-(ρyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid
141. [3-isopropoxy-5-({(2Z)-2-(methoxyimino)-2-[3-(pyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid. The present invention also relates to processes for preparation of the compounds of Formula 1. A person skilled in the art could easily manufacture the compound of Formula 1 on the basis of the chemical structure thereof by various processes. In other words, it will be possible to prepare the compound of Formula 1, within the scope of the present invention, by the process described in the present disclosure or by combining some of processes known in the prior art. So the scope of the present invention is not limited to the below processes.
As an illustrative process for such preparation, the compound of Formula 1 can be prepared by reacting the compound of Formula 2 with the compound of Formula 3 in the presence of base, as shwon in Reaction Scheme 1 below.
[Reaction Scheme 1]
Figure imgf000031_0001
(2) (3) (1)
wherein A, D and X are the same as defined in Formula 1, and L means Cl, Br, I or methanesulfonyloxy group.
The reaction can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used. The typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used.
In some cases, the desired compound of Formula 1 can be prepared by hydrolyzing condensed compounds, as shwon in Reaction Scheme 2 below.
[Reaction Scheme 2]
Figure imgf000032_0001
(4) (3) (5) (1)
wherein A, D, L and X are the same as defined in Formula 1, and L means Cl, Br, I or OMs(methanesulfonyloxy group).
The reaction 'a' in the reaction scheme can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used. The typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used.
The oximation 'b' in the reaction scheme can be conducted with oxime in the presence of organic solvent, such as methanol, ethanol or propanol, or even water, and in some cases, two or more mixtures of them can be used. The typical examples of the base include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate and the like, and in some cases, two or more kinds of them can be used. The reaction compounds above can also be prepared by a person skilled in the art on the basis of the chemical structure by various methods. Some examples are illustrated in the below.
Firstly, the compounds represented by Formulas 2 and 4 can be prepared by a well-known method (H. O. Han, et al KR2004-0097273).
Secondly, the compound D-(i) of Formula 3 in which E2 is H, and G is Me,
Figure imgf000033_0001
, can be prepared by a well-known method (Kevin J. Duffy, et al J.MedChem., 2001, 44, 3730-3745).
Thirdly, the compound D-(iii) of Formula 3 in which E2 is H, and G is Me,
Figure imgf000033_0002
, can be prepared by a well known method (G. T. Kim, et al WO 2005- 040127).
A person skilled in the art to which the present invention pertains can easily understand the detailed reaction conditions for preparation of the compound of the present invention, based upon many PREPARATIONS and EXAMPLES to be illustrated later, thus explanations thereof are omitted herein in the interest of brevity.
Also, the present invention provides a pharmaceutical composition for accelerating PPARγ and PPARα comprising (a) a therapeutically effective amount of the compound of Formula 1, and (b) a physiologically acceptable carrier, diluent, or excipient, or a combination thereof. The term "pharmaceutical composition" as used herein means a mixture of a compound of the invention with other chemical components, such as diluents or carriers. The pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to oral, injection, aerosol, parenteral, and topical administrations. Pharmaceutical compositions can also be obtained by reacting compounds with acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.
The term "therapeutically effective amount" means an amount of active ingredients effective to alleviate, ameliorate or prevent symptoms of disease or decrease or delay the onset of clinical markers or symptoms of disease. Thus, a therapeutically effective amount refers to that amount which has the effect of (1) reversing the rate of progress of a disease; (2) inhibiting to some extent progress of the disease; and/or, (3) alleviating to some extent (or, preferably, eliminating) one or more symptoms associated with the disease. The therapeutically effective amount may be determined by experiments on the efficacy of compound as an active agent via in vivo and in vitro known model systems for diseases to be treated.
The term "carrier" means a chemical compound that facilitates the incorporation of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a commonly utilized carrier as it facilitates the uptake of many organic compounds into the cells or tissues of an organism.
The term "diluent" defines chemical compounds diluted in water that will dissolve the compound of interest as well as stabilize the biologically active form of the compound. Salts dissolved in buffered solutions are utilized as diluents in the art. One commonly used buffered solution is phosphate buffered saline because it mimics the ionic strength conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a compound.
The compounds described herein can be administered to a human patient per se, or in pharmaceutical compositions in which they are mixed with other active ingredients, as in combination therapy, or suitable carriers or excipient(s). Techniques for formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, 18th edition, 1990.
The pharmaceutical composition of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well- known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences, above. The compound of Formula 1 according to the present invention can be formulated into dasage forms suitable for injection or oral admimistration in accordance with intended use. For injection, the agents of the present invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks 's solution,
Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compound of the present invention to be formulated as tablet, pill, powder, granule, dragee, capsule, liquid, gel, syrup, slurry, suspension and the like, for oral ingestion by a patient. Preferable dosage forms are capsule and tablet. It is preferable that tablets and pills be coated. Pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipient with one or more compounds of the present invention, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl cellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
When the formulation is presented in unit dosage form, the compound of
Formula 1 as an active agent can be preferably contained in an amount of about 0.1 ~
1,000 mg unit dosage. The dosage amount of the compound of Formula 1 will be dependent on the subject's weight and age, the nature and severity of the affliction and the judgment of the prescribing physician. For adult administration, the dosage amount required will be in the range of about 1 to 1000 mg a day depending on the frequency and strength of the dosage. For intramuscular or intravenous administration to adults, a total dosage amount of about 1 ~ 500 mg a day will be sufficient. In some patients, the dosage amount in a day will be higher than that.
The present invention provides the use of the compound of Formula 1 for manufacture of a medicament for the treatment or prevention of diseases involving human PPARγ and PPARα. "Diseases involving human PPARγ and PPARα" mean the diseases which can be treated and prevented by activating human PPARγ and PPARα, and include, for example, but are in no way limited to diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc. Representative examples of the complications associated with diabetes mellitus are hyperlipidemia, arteriorasclerosis, obesity, hypertension, retinopathy, kidney inefficiency, etc. The term "treating" means ceasing or delaying progress of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting symptoms of diseases. The term "preventing" means ceasing or delaying symptoms of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting no symptoms of diseases, but having high risk of developing symptoms of diseases. BRIEF DESCRIPTION OF THE DRAWINGS
The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
FIG. 1 is a diagram showing the processing of vector pZeo-GAL in Example
2(1).
FIG. 2 is a diagram showing the processing of vector pZeo-GAL-PPARγLBD in Example 2(2).
FIG. 3 is a diagram showing the processing of vector pZeo-GAL-PPARαLBD in Example 2(3).
FIG. 4 is a graph showing the maP2 gene expression in rat cell in Experimental Example 5.
FIG. 5 is a graph showing the Acrp30 gene expression in rat cell in Experimental Example 5.
FIG. 6 is a graph showing lipid accumulation in the mouse Adipocyte cell line
(3T3-1) in Experimental Example 6.
FIG. 7 is an optical microscope photograph showing degree of formation of Calcified Nodule from osteoblast cell in Experimental Example 7.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention will now be illustrated in more detail by the following PREPARATIONS and EXAMPLES; however, the scope of the present invention is not limited thereto. In below, processes for synthesis of intermediates for preparing final compounds are illustrated in PREPARATIONS, whereas processes for synthesis of the final compounds using the compound of PREPARATIONS are illustrated in EXAMPLES.
PREPARATION 1: Preparation of dZ)-2-bromo-l-r3-(4-fluorophenvnisoxazol-5- yl]ethanon 0-propyloxime
(1) Preparation of 2-bromo-l-[3-(4-fluorophenvDisoxazol-5-yllethanon
1 g of the title compound was obtained in the same manner as in Heterocycles,
1993, 35 (2), 591-598 and J. Med. Chem., 1991, 34 (2), 600-605, except that 5 g (40 mmol) of 4-fluorobenzaldehyde was used.
NMR: 1H-NMR(CDCl3) δ 7.86~7.77(2H, m), 7.32(1H, s), 7.24-7.18(2H, m), 4.48(2H,
s)
Mass(EI) 284, 286(M++1)
(2) Preparation of (lZV2-bromo-l-r3-(4-fluorophenyl)isoxazol-5-yllethanon O- propyloxime
100 mg (0.35 mmol) of 2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon was dissolved in methanol, and then 39 mg (0.35 mmol) of propyloxyamine hydrochloride was added thereto, followed by stirring for 10 hours at room temperature to give 90 mg of the title compound using column chromatography in a yield of 75%.
NMR: 1H-NMR(CDCl3) δ 7.86~7.81(2H, m), 7.28~7.14(2H, m), 7.89(1H, s), 4.37(2H, s), 4.31(2H, t, J=8Hz), 1.85~1.76(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 341, 343(M++l)
PREPARATION 2: Preparation of methyl 3-([(2E)-2-[3-(4-fluorophenvnisoxazol-5- vH2-(propoxyimino')ethyl'|oxy)benzoate
18 mg (0.053 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5- yljethanon 0-propyloxime, 8.0 mg (0.053 mmol) of methyl 3-hydroxy benzoate and 26 mg (0.079 mmol) of cesium carbonate were stirred in acetonitrile solvent under reflux for 30 minutes, and then solvent was removed to give 15 mg of the title compound using column chromatography in a yield of 69%.
NMR: 1H-NMR(CDCl3) δ 7.85~7.82(2H, m), 7.71~7.67(2H, m), 7.37(1H, s), 7.37~7.33(1H, m), 7.21~7.15(3H, m), 5.14(2H, s), 4.33(2H, t, J=8Hz), 3.91(3H, s), 1.88~1.78(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 413(M+-Hl)
EXAMPLE 1: Preparation of 3-(r(2E)-2-[3-(4-fluorophenvnisoxazol-5-yll2- (propoxyimino)ethvπoxyl benzoic acid
Figure imgf000042_0001
15 tng (0.063 mmol) of methyl 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]2- (propoxyimino)ethyl]oxy}benzoate was dissolved in tetrahydrofuran: methanol: IN NaOH(1 :1:1), then stirred for 5 hours, and the resulting solution was acidificated with 1 N HCl to pH 2 and extracted with ethyl acetate. The reaction solution was dried over anhydrous sodiumsulfate and filtered off to give 10 mg of the title compound in a yield of 69%.
NMR: 1H-NMR(CDCl3) δ 7.85~7.82(2H, m), 7.79~7.71(2H, m), 7.41~7.36(1H, m), 7.37(1H, s), 7.23-7.13(3H, m), 5.12(2H5 s), 4.34(2H, t, J=8Hz), 1.86~1.80(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 399(M++1)
PREPARATION 3: Preparation of ethyl l-((2EV2-r3-(4-fluoroρhenylMsoxazol-5-vn-2- (propoxyimino)ethyl 1-1 H-indol-2-carboxylate
9.5 mg (0.05 mmol) of ethyl lH-indol-2-carboxylate was dissolved in dimethylformaldehyde, then 2.4 mg (0.06 mmol) of sodium hydride was added thereto, and then the resulting solution was stirred for 30 minutes at room temperature, and 17 mg (0.05 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime was added thereto. After 30 minutes, the reaction solution was diluted with ethyl acetate, washed with water, and dried over anhydrous sodiumsulfate, and solvent was removed, then the residue was purified by column chromatography to give 10 mg of the title compound in a yield of 44%.
NMR: 1H-NMR(CDCl3) δ 7.69~7.67(1H, m), 7.58~7.54(2H, m), 7.37~7.32(2H, m), 7.36(1H, s), 7.18~7.14(1H, m), 7.08~7.03(2H, m), 6.06(1H, s), 6.01(2H, s), 4.39(2H, q, J=8Hz), 4.32(2H, t, J=8Hz), 1.85~1.76(2H, m), 1.41(3H, t, J=8Hz), 1.01(3H, t, J=8Hz)
Mass(EI) 450(M++l)
EXAMPLE 2: Preparation of l-{(2Ey2-r3-f4-fluorophenvnisoxazol-5-vn-2- (propoxyiminotethyl 1-1 H-indol-2-carboxylic acid
Figure imgf000043_0001
10 mg (0.022 mmol) of ethyll-{(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl}-lH-indol-2-carboxylate was dissolved in tetrahydrofuran: methanol: IN NaOH(1 : 1 : 1 ), and stirred under reflux for 1 hour. After acidification with 1 N HCl to pH 2, the resulting solution was extracted with ethyl acetate. An organic layer was dried over anhydrous magnesium sulfate and filtered off to obtain 7 mg of the title compound in a yield of 78%.
NMR: 1H-NMR(CDCl3) δ 7.7O~7.67(1H, m), 7.60~7.56(2H, m), 7.45(1H, s), 7.37~7.32(2H, m), 7.19~7.15(1H, m), 7.06~7.02(2H, m), 6.14(1H, s), 5.98(2H, s), 4.30(2H, t, J=8Hz), 1.81-1.75(2H, m), 0.99(3H, t, J=8Hz)
Mass(EI) 422(M++1)
PREPARATION 4: Preparation of (lZV2-bromo-l-[5-('4-chlorophenylV1.3.4- oxadiazol-2-yl]ethanon O-propyloxime
( 1 ) Preparation of (2Z)- 3 -bromo-2-(propoxyimino)propionic acid
1.7 g (10.0 mmol) of 3-bromo-2-oxopropionic acid was dissolved in 50 mL of methanol, then 1.6 g (20.0 mmol) of anhydride sodium acetate and 1.1 g (10 mmol) of propyloxyamine hydrochloride were added thereto, followed by stirring for 5 hours at room temperature. The solvent was removed, and ethyl acetate was added thereto, followed by washing with 1 N HCl. An organic layer was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed and the residue was recrystallized with hexane/ethyl acetate (10/1) to obtain 76 g of the title compound in a yield of 34%.
NMR: 1H-NMR(CDCl3) δ 4.14(4H, m), 4.19(2H, s), 1.69~1.64(2H, m), 0.93(3H, 8Hz)
Mass(EI) 224, 226(M++1)
(2) Preparation of ( 1 Z)-2-bromo- 1 - ["5-(4-chlorophenyD- 1.3.4-oxadiazol-2- yliethanon 0-propyloxime 448 mg (2.0 mmol) of (2Z)-3-bromo-2-(propoxyimino)propionic acid was dissolved in 20 mL of dichloromethane, then 0.28 mL of (2.0 mmol) of triethylamine and 169 mg (2.0 mmol) of 2-chloro- 1,3 -dimethyl imidazolinium chloride were slowly added thereto at 0°C while stirring. After 10 minutes, the reaction solution was slowly added to a mixture of 414 mg (2.0 mmol) of 4-chlorobenzohydrazide hydrochloride, 0.28 mL of (2.0 mmol) of triethylamine and 20 mL of dichloromethane at 0°C, while stirring. After 1 hour, 169 mg (2.0 mmol) of 2-chloro- 1,3-dimethyl imidazolinium chloride and 0.28 mL (2.0 mmol) of triethylamine were further added thereto. After 1 hour, the resulting solution was washed with saturated ammonium chloride and water and then dried over anhydrous sodiumsulfate, followed by filtering. After solvent was removed, the residue was purified by column chromatography to give 80 mg of the title compound in a yield of 11%.
NMR: 1H-NMR(CDCl3) δ 8.10~8.08(2H, m), 7.52~7.50(2H, m), 4.68(2H, s), 4.39(2H, t, J=8Hz), 1.88~1.80(2H, m), 1.03(3H, t, J=8Hz)
EXAMPLE 3: Preparation of 3-{r(2EV2-[5-(4-chlorophenvn-1.3 A-oxadiazol-2-yll-2- (propoxyimino)ethyl1oxy}benzoic acid
Figure imgf000045_0001
7 mg of the title compound was obtained in a yield of 65% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 9.4 mg (0.026 mmol) of (lZ)-2-bromo-l-[5-(4-chlorophenyl)-l,3,4-oxadiazol-2-yl]ethanon O- propyloxime and 4.0 mg (0.026 mmol) of methyl 3-hydroxy benzoate were used.
NMR: 1H-NMR(CDCl3) δ 8.09~8.08(2H, m), 7.74-7.71(2H, m), 7.52~7.49(2H, m), 7.4O~7.36(1H, m), 7.26~7.23(1H, m), 6.31(2H, s), 4.38(2H, t, J=8Hz), 1.87~1.76(2H, m), 0.99(3H, t, J=8Hz)
Mass(EI) 416(M++l)
EXAMPLE 4: Preparation of (!EVl-r3-(4-fluoropheαylMsoxazol-5-yll-2- phenoxyethanon O-propyloxime
Figure imgf000046_0001
10 mg of the title compound was obtained in a yield of 97% in the same manner as in PREPARATION 2, except that 10 mg (0.029 mmol) of (lZ)-2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 2.8 mg (0.029 mmol) of phenol were used.
NMR: 1H-NMR(CDCl3) δ 7.85~7.78(2H, m), 7.36(1H, s), 7.32~7.27(2H, m), 7.19~7.14(2H, m), 7.03~7.93(3H, m), 5.09(2H, s), 4.32(H, t, J=8Hz), 1.86-1.77(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 355(M++l) PREPARATION 5: Preparation of αZVl-biphenyl-4-yl-2-bromoethanon O- propyloxime
60 mg of the title compound was obtained in a yield of 90% in the same manner as in PREPARATION l-(2), except that 55 mg (0.20 mmol) of 2-bromo-4'- phenylacetophenone was used.
Mass(EI) 332, 334(M++1)
EXAMPLE 5: Preparation of 3-(r(2ZV2-biphenyl-4-yl-2
(propoxyiminotethylloxylbenzoic acid
Figure imgf000047_0001
9 mg of the title compound was obtained in a yield of 77% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 10 mg (0.03 mmol) of (lZ)-l-biphenyl-4-yl-2-bromoethanon 0-propyloxime and 4.6 mg (0.03 mmol) of methyl 3-hydroxy benzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.78-7.75(2H5 m), 7.71~7.70(2H, m), 7.61~7.57(4H, m), 7.45~7.42(2H, m), 7.37~7.34(2H, m), 7.2O~7.17(1H, m), 5.31(2H, s), 4.26(2H, t, J=8Hz), 1.86~1.77(2H, m), 1.00(3H, t, J=8Hz) Mass(EI) 390(M++l)
EXAMPLE 6: Preparation of l-(2EV2-r3-(4-fluorophenvnisoxazol-5-yll2- (propoxyiminokthyli-lH-indol-S-carboxylic acid
Figure imgf000048_0001
7 mg of the title compound was obtained in a yield of 41% in the same manner as in PREPARATION 3and EXAMPLE 2 in sequence, except that (lZ)-2-bromo-l-[3- (4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 7.2 mg (0.041 mmol) of methyl lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.21~8.19(1H, m), 8.17(1H, s), 7.79~7.73(2H, m), 7.68~7.66(1H, m), 7.33~7.29(2H, m), 7.33(1H, s), 7.16-7.11(2H, m), 5.40(2H, s), 4.34(2H, t, J=8Hz), 1.85-1.79(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 422(M++1)
EXAMPLE 7: Preparation of π-f2E>2-[3-f4-fluorophenvnisoxazol-5-vn2- (propoxyiminotethyl 1-1 H-indol-3 - yl 1 acetic acid
Figure imgf000049_0001
9 mg of the title compound was obtained in a yield of 71% in the same manner as in PREPARATION 3 and EXAMPLE 2 in sequence, except that (lZ)-2-bromo-l-[3-
(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 10 mg (0.029 mmol) of methyl lH-indol-3-carboxylate and 5.5 mg (0.029 mmol) of methyl lH-indol-3- ylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.69~7.66(2H, m), 7.57~7.55(1H, m), 7.45~7.43(1H, m), 7.34(1H, s), 7.25~7.22(1H, m), 7.15~7.06(3H, m), 6.45(1H, s), 5.35(2H, s), 4.34(2H, t, J=8Hz), 3.77(2H, s), 1.87-1.78(2H, m), 1.02(3H, t, J=8Hz)
Mass(EI) 436(M++1)
PREPARATION 6: Preparation of (lZV2-bromo-l-(3-phenyl-isoxazol-5-yl)eibanon O- butyloxime
90 mg of the title compound was obtained in a yield of 53% in the same manner as in PREPARATION l-(2), except that 133 mg (0.50 mmol) of 2-bromo-l-(3-phenyl- isoxazol-5-yl)ethane-l-one and 63 mg (0.50 mmol) of butyloxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 7.84~7.83(2H, m), 7.47~7.46(3H, m), 6.93(1H, s), 4.36(2H5 s), 4.35(2H, t, J=8Hz), 1.78-1.73(2H, m), 1.48-1.43(2H, m), 0.97(3H, t, J=8Hz) Mass(EI) 337, 339(M++!)
EXAMPLE 8: Preparation of 3-(r(2EV2-(butoxyiminoV2-r3-phenyl-isoxazol-5- yDethylloxyl benzoic acid
Figure imgf000050_0001
100 mg of the title compound was obtained in a yield of 90% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 90 mg (0.027 mmol) of (lZ)-2-bromo-l-(3-phenyl-isoxazol-5-yl)ethanon O-butyloxime was
used.
NMR: 1H-NMR(CD3OD) δ 7.77~7.73(2H, m), 7.51~7.47(2H, m), 7.41~7.36(3H, m), 7.2O~7.16(1H, m), 7.1O(1H, s), 6.95~6.92(1H, m), 5.13(2H, s), 4.25(2H, t, J=8Hz), 1.67(2H, q, J=8Hz), 1.41-1.32(2H, m), 0.88(3H, t, J=8Hz)
Mass(EI) 395(M++1)
PREPARATION 7: Preparation of αZ>2-bromo-l-r5-(4-fluoroρhenvn-1.3.4-oxadiazol- 2-yllethanon O-propyloxime
400 mg of the title compound was obtained in a yield of 27% in the same manner as in PREPARATION 4, except that 650 mg (3.4 mmol) of 4- chlorobenzohydrazide hydrochloride and 760 mg (3.4 mmol) of (2Z)-3-bromo-2- (propoxyimino)propionic acid were used.
NMR: 1H-NMR(CDCl3) δ 8.18~8.14(2H, m), 7.24~7.20(2H, m), 4.68(2H, s), 4.38(2H, t, J=8Hz), 1.86-1.80(2H, m), 1.03(3H, 8Hz)
Mass(EI) 342, 344(M++1)
EXAMPLE 9: Preparation of 3-([f2EV2-[5-f4-fluorophenviyUA-oxadiazol-2-yll-2- (propoxyimino'jethylloxylbenzoic acid
Figure imgf000051_0001
20 mg of the title compound was obtained in a yield of 43% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 20 mg (0.058 mmol) of (lZ)-2-bromo-l-[5-(4-fluorophenyl)-l,3,4-oxadiazol-2-yl]ethanon O-propyloxime was used.
NMR: 1H-NMR(CDCl3) δ 8.16~8.14(2H, m), 7.74~7.72(2H, m), 7.38~7.36(1H, m), 7.25~7.19(3H, m), 5.31(2H, s), 4.36(2H, t, J=8Hz), 1.86~1.80(2H, m), 1.00(3H, t, 8Hz)
Mass(EI) 400(M++l) PREPARATION 8: Preparation of QZ>2-bromo-l-r2-(4-fluoroρhenylM.3-thiazol-4- yl]ethanon O-propyloxime
( 1 ) Preparation of 2-bromo- 1 - [2-(4-fluorophenyl )- 1.3 -thiazol-4-yll ethanon
0.76 g (4.9 mmol) of 4-fluorothiobenzamide and 1.2 g (4.9 mmol) of 1,4- dibromo-2,3-butanedione were dissolved in dioxane, then stirred under reflux for 5 hours. Solvent was removed and the residue was purified by column chromatography to obtain 300 mg of the title compound in a yield of 20%.
NMR: 1H-NMR(CDCl3) δ 8.25(1 H, s), 8.00~7.97(2H, m), 7.19~7.16(2H, m), 4.73(2H,
s)
Mass(EI) 300, 302(M++l)
(2) Preparation of (lZy2-bromo-l-r2-(4-fluoroϋhenvD-l.3 -thiazol-4-yll ethanon O- propyloxime
200 mg of the title compound was obtained in a yield of 56% in the same manner as in PREPARATION l-(2), except that 300 mg (1.0 mmol) of 2-bromo-l-[2- (4-fluorophenyl)-l,3-thiazol-4-yl]ethanon and 111 mg (1.0 mmol) of propyloxyamine hydrochloride were used.
Mass(EI) 357, 359(M++1)
EXAMPLE 10: Preparation of 3- (r(2EV2-r2-(4-fluorophenylVl.3. -thiazol-4-yll -2- (propoxyiminotethyll oxy } benzoic acid
Figure imgf000053_0001
25 mg of the title compound was obtained in a yield of 30% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 71 mg (0.20 mmol) of (lZ)-2-bromo-l-[2-(4-fluorophenyl)-l,3-thiazol-4-yl]ethanon O-propyloxime was used.
NMR: 1H-NMR(CDCl3) δ 8.41(1H, s), 7.85~7.82(2H, m), 7.77~7.71(2H, m), 7.39~7.35(1H, m), 7.22~7.2O(1H, m), 7.13~7.06(2H, m), 5.32(2H, s), 4.27(2H, t, J=8Hz), 1.84-1.78(2H, m), LOO(IH, t, 8Hz)
Mass(EI) 415(M++l)
EXAMPLE 11: Preparation of 3-{r(2ZV2-(2-naphthvn-2-
(propoxyimino)ethvnoxy I benzoic acid
Figure imgf000053_0002
50 mg of the title compound was obtained in a yield of 69% in the same manner as in PREPARATION 2, PREPARATION l-(2) and EXAMPLE 1 in sequence, except that 50 mg (0.20 mmol) of 2-bromo-2'-acetonaphthone and 30mg (0.20 mmol) of methyl 3 -hydroxy benzoate were used.
NMR: 1H-NMR(CDCl3) δ 8.13(1H, s), 7.88~7.79(4H, m), 7.72~7.69(2H, m), 7.50~7.46(2H, m), 7.35~7.31(1H, m), 7.17~7.15(1H, m), 5.39(2H, s), 4.29(2H, t, J=8Hz), 1.88-1.79(2H, m), 1.03(1H, t, 8Hz)
Mass(EI) 364(M++l)
EXAMPLE 12: Preparation of (3-(r(2Z)-2-(2-naphthylV2-
(propoxyimino^ethyll oxy ) phenvDacetic acid
Figure imgf000054_0001
70 mg of the title compound was obtained in a yield of 46% in the same manner as in PREPARATION 2, PREPARATION l-(2) and EXAMPLE 1 in sequence, except that 100 mg (0.40 mmol) of 2-bromo-2'-acetonaphthone and 67 mg (0.40 mmol) of methyl 3 -hydroxy phenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 8.1O(1H, s), 7.88~7.79(4H, m), 7.48~7.45(2H, m), 7.25~7.2O(1H, m), 6.90~6.87(3H, m), 5.30(2H, s), 4.25(2H, t, J=8Hz), 3.59(2H, s), 1.85~1.78(2H, m), LOl(IH, t, 8Hz)
Mass(EI) 378(M++1) PREPARATION 9: Preparation of ethyl 4-ρhenyl-lH-pyrrole-3-carboxylate
5.5 mL of (47 mmol) of benzaldehyde and 13 g (57 mmol) of triethyl phosphonoacetate were dissolved in tetrahydrofuran, then 7.9 g (70 mmol) of potassium t-butoxide was slowly added thereto. After 2 hours, 11 g (57 mmol) of tosylmethyl isocyanate and 7.9 g (70 mmol) of potassium t-butoxide were added thereto. After 3 hours, solvent was removed and the residue was purified by column chromatography to obtain 5.6 g of the title compound in a yield of 55%.
Mass(EI) 216(M++1)
EXAMPLE 13: Preparation of l-{(2EV2-r3-f4-fluorophenvnisoxazol-5-yll-2- (propoxyimino)ethyl 14-phenyl- 1 H-pyrrole-3 -carboxylic acid
Figure imgf000055_0001
6 mg of the title compound was obtained in a yield of 27% in the same manner as in PREPARATION 3 and EXAMPLE 2, except that 17 mg (0.050 mmol) of (lZ)-2- bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 10 mg (0.050 mmol) of ethyl 4-phenyl- 1 H-pyrrole-3 -carboxy late were used.
NMR: 1H-NMR(CDCl3) δ 7.81~7.78(2H, m), 7.62~7.6O(1H, m), 7.46~7.43(2H, m), 7.35~7.30(3H, m), 7.18~7.15(2H, m), 6.84~6.78(2H, m), 5.11(2H, s), 4.32(2H, t, J=8Hz), 1.87-1.78(2H, m), 1.00(1H, t, 8Hz)
Mass(EI) 448(M++!)
EXAMPLE 14: Preparation of 6-(f(2EVr3-(4-flυorophenvnisoxazol-5-vn2- (propoxyimino)ethyli oxy 1-1 -naphthoic acid
Figure imgf000056_0001
14 mg of the title compound was obtained in a yield of 62% PREPARATION 2 and EXAMPLE 1 in sequence, except that 17 mg (0.050 mmol) of (lZ)-2-bromo-l-[3- (4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 10 mg (0.050 mmol) of 6- hydroxy- 1 -naphthoic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 9.01~8.99(lH, m), 8.27~8.25(1H, m), 7.97~7.95(1H, m), 7.82~7.78(2H, m), 7.54~7.38(1H, m), 7.38~7.31(2H, m), 7.15~7.12(2H, m), 6.95 (IH, s), 5.32(2H, s), 4.37(2H, t, J=8Hz), 1.90~1.81(2H, m), 1.05(1H, t, 8Hz)
Mass(EI) 449(M++l)
PREPARATION 10: Preparation of methyl l-[2-[3-(4-fluorophenvnisoxazol-5-yll-2-
(propoxyiminotethyli - 1 H-indol-4-carboxylate 8.7 mg (0.05 mmol) of methyl lH-indol-4-carboxylate was dissolved in 1 mL of dimethylformamide, then 2.4 mg (0.06 mmol) of sodium hydride was added thereto. After 10 minutes, 17 mg (0.05 mmol) of 2-bromo-l-[3-(4-fluorophenyl)isoxazol-5- yl]ethanon O-propyloxime was added thereto. The reaction solution was stirred for 3 hours at room temperature, and 5 mL of saturated ammonium chloride was added thereto, then 10 mL of ethyl acetate was further added thereto. An organic layer was separated and dried over anhydrous magnesium sulfate, followed by filtering. Solvent was removed to give 10 mg of the title compound using column chromatography in a yield of 46%.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.99~7.93(2H, m), 7.77~7.62(2H, m), 7.51~7.49(0.6H, m), 7.39-7.38(0.4H5 m), 7.29~7.23(2H, m), 7.21~7.08(2.6H, m), 6.58(0.4H, d, J=4Hz), 5.43(0.8H, s), 5.39(1.2H5 s), 4.36~4.32(2H, m), 3.96(3H5 s), 1.87-1.77(2H5 m), 1.03-0.86(3H5 m)
Mass(EI) 436(M++1)
EXAMPLE 15: Preparation of l-r2-r3-(4-fluorophenvnisoxazol-5-vn-2- (propoxyimino)ethyll-lH-indol-4-carboxylic acid
Figure imgf000057_0001
10 mg (0.023 mmol) of methyl l-[2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]-lH-indol-4-carboxylate was added to a mixture solution of 2.0 mL of tetrahydrofuran, 2.0 mL of methanol, and 1 mL of IN sodium hydroxide, and the resulting solution was reacted for 2 hours at room temperature. After the reaction, 5 mL of saturated ammonium chloride was added thereto, then 20 mL of ethyl acetate was added thereto. An organic layer was separated and dried over anhydrous magnesium sulfate, followed by filtering. Solvent was removed to give 7 mg of the title compound using column chromatography in a yield of 72%.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.98~7.54(4H, m), 7.43~7.26(2H, m), 7.20~7.09(3.5H, m), 6.61(0.5H, d, J=4Hz), 5.45(0.5H, s), 5.40(0.5H, s), 4.37~4.33(2H, m), 1.86~1.80(2H, m), 1.03~0.98(3H, m)
Mass(EI) 422(M+H-I)
PREPARATION 11: Preparation of methyl 3-(r2-r3-(4-fluorophenvOisoxazol-5-vπ-2- (propoxyimino)ethyl] oxy ) -2-naphthoate
68 mg (0.2 mmol) of 2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime and 40 mg (0.2 mmol) of methyl 3-hydroxy-2-naphthalene carboxylate were dissolved in 4 mL of acetonitrile, then 97 mg (0.3 mmol) of cesium carbonate was added thereto. The reaction solution was stirred under reflux for 3 hours, and filtered off, and then solvent was removed to give 20 mg of the title compound using column chromatography in a yield of 21 %.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.31(1H, d, J=I 1.6Hz), 8.17~7.81(3H, m), 7.73~7.53(3H, m), 7.43~7.00(4H, m), 5.39(1.5H, s), 5.27(0.5H, s), 4.42-4.31(2H, m), 3.96(1.5H, s), 3.82(1.5H, s), 1.92~1.81(2H, m), 1.09~0.98(3H, m)
Mass(EI) 463(M++1)
EXAMPLE 16: Preparation of 3-(r2-r3-(4-fluorophenvnisoxazol-5-yll-2- (propoχyimino)ethylioxy} -2-naphthoic acid
Figure imgf000059_0001
16 mg of the title compound was obtained in a yield of 83% in the same manner as in EXAMPLE 1, except that 20 mg (0.043 mmol) of methyl 3-{[2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-2-naphthoate was used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.83~8.74(1H, m), 8.08~7.75(3H, m), 7.62~7.43(5H, m), 7.21~7.02(2H, m), 5.52(0.5H, s), 5.50(1.5H, s), 4.44~4.36(2H, m), 1.89~1.81(2H, m), 1.05~1.00(3H, m)
Mass(EI) 449(M++1)
PREPARATION 12: Preparation of methyl 3-([2-f3-r4-fluorophenvnisoxazol-5-yll-2- (propoxyiminotethvnoxylphenvDacetate
120 mg of the title compound was obtained in a yield of 97% in the same manner as in PREPARATION 2, except that 100 mg (0.29 mmol) of 2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 49 mg (0.29 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.05~7.67(4H, m), 7.37~7.33(2H, m), 7.20~7.15(3H, m), 5.32(0.5H, s), 5.14(1.5H, s), 4.37~4.31(2H, m), 3.91(3.0H, s), 2.04-1.78(2H, m), 1.03~0.99(3H, m)
Mass(EI) 427(M++1)
EXAMPLE 17: Preparation of 3-([2-r3-f4-fluorophenvnisoxazol-5-yl1-2- (propoxyimino)ethyl1oxy>phenyl)acetic acid
Figure imgf000060_0001
62 mg of the title compound was obtained in a yield of 53% in the same manner as in EXAMPLE 1, except that 120 mg (0.28 mmol) of methyl 3-{[2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}phenyl) acetate was used.
NMR: 1H-NMR(CDCl3) δ 7.60~7.57(2H, m), 6.96~6.91(2H, m), 6.74(1H, s), 6.70~6.68(2H, m), 6.58~6.56(1H, m), 4.85(2H, s), 4.12(2H, t, J=8Hz), 3.28(2H, s), 1.67-1.60(2H, m), 0.85(3H, t, J=8Hz)
Mass(EI) 413(M++1) PREPARATION 13: Preparation of methyl 2-("3-hvdroχyphenvDpropanoate
( 1 ) Preparation of methyl 2-(3 -benzyloxyphenvDpropanoate
170 mg (0.66 mmol) of methyl 3-benzyloxyphenylethanoate was dissolved in tetrahydrofuran, then LHMDS(LO M tetrahydrofuran solution, 0.73 mmol) was added dropwise thereto at -78 °C, and stirred for 30 minutes, then 0.046 mL (0.73 mmol) of methyl iodide was further added thereto. The temperature was slowly raised to room temperature over 1 hour, and then saturated ammonium chloride was added to the reaction solution. After extracting with ethyl acetate, an organic layer was separated and dried over anhydrous magnesium sulfate, followed by filtering. Then, solvent was removed to give 50 mg of the title compound using column chromatography in a yield of 28%.
NMR: 1H-NMR(CDCl3) δ 7.44~7.23(6H, m), 6.93(1H, s), 6.91~6.85(2H, m), 5.06(2H, s), 3.7O~3.66(1H, m), 3.65(3H, s), 1.48(3H, d, J=7.5Hz)
Mass(EI) 271(M++1)
(2) Preparation of methyl 2-(3 -hydroxyphenvDpropanoate
50 mg (0.18 mmol) of methyl 2-(3-benzyloxyphenyl)propanoate was dissolved in 10 mL of methanol solution, then 10 mg of 10% palladium/C was added thereto, and then the resulting solution was reacted for 3 hours under hydrogen atmosphere. After the reaction, palladium was removed by filtering, and then solvent was removed to obtain 20 mg of the title compound using column chromatography in a yield of 61%.
NMR: 1H-NMR(CDCl3) δ 7.25~7.15(1H, m), 6.85~6.70(3H, m), 5.15(1H, s), 3.70(3H, s), 1.50(3H, d)
Mass(EI) 181(M++1)
PREPARATION 14: Preparation of methyl 2-f3-([2-[3-f4-fluorophenvnisoxazol-5-yl1- 2-(propoxyimino)ethyl"[oxy)phenyDpropanoate
30 mg of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 2, except that 38 mg (0.11 mmol) of 2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 20 mg (0.11 mmol) of methyl 2-(3-hydroxyphenyl)propanoate were used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.32~7.79(2H, m), 7.25-7.13(3H, m), 6.94~6.85(4H, m), 5.16(1.5H, s), 5.08(0.5H, s), 4.36~4.30(2H, m), 3.72~3.66(1H, m), 3.65(3H, s), 2.04-1.77(2H, m), 1.48(3H, d, J=8Hz), 1.04-0.99(3H, m)
Mass(EI) 441(M++1)
EXAMPLE 18: Preparation of 2-(3-(r2-r3-f4-fluorophenyl)isoxazol-5-yl1-2- (propoxyimino^ethylloxylphenvπpropanoic acid
Figure imgf000063_0001
15 mg of the title compound was obtained in a yield of 51% in the same manner as in EXAMPLE 1, except that 30 mg (0.069 mmol) of methyl 2-(3-{[2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}phenyl)propanoate was used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.03~7.71(2H, m), 7.24-7.11(3H, m), 6.94~6.84(4H, m), 5.13(1.5H, s), 5.06(0.5H, s), 4.34~4.28(2H, m), 3.7O~3.6O(1H, m), 1.84-1.75(2H, m), 1.46(3H, d, J=4Hz), 1.02~0.97(3H, m)
Mass(EI) 427(M++1)
PREPARATION 15: Preparation of 2-bromo-l-[3-(4-chlorophenylMsoxazol-5- yljethanon O-propyloxime
150 mg of the title compound was obtained in a yield of 42% in the same manner as in PREPARATION 1-2, except that 300 mg (0.998 mmol) of 2-bromo-l-[3- (4-chlorophenyl)isoxazol-5-yl]ethanon and 111 mg (0.995 mmol) of n-propoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.78~7.76(2H, m), 7.45~7.43(2H, m), 6.9O(1H, m), 4.36(2H, s), 4.32~4.30(2H, m), 1.81~1.78(2H, m), 1.01~0.99(3H, m)
Mass(EI) 358(M++1) PREPARATION 16: Preparation of methyl 3-(r2-r3-(4-chlorophenvnisoxazol-5-yll-2- (propoxyimino'jethylioxylbenzoate
120 mg of the title compound was obtained in a yield of 66% in the same manner as in PREPARATION 2, except that 150 mg (0.42 mmol) of 2-bromo-l-[3-(4- chlorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 64 mg (0.42 mmol) of methyl 3-hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.77~7.60(4H, m), 7.50~7.30(3.4H, m), 7.2O~7.1O(1H, m), 6.92(0.6H, m), 5.21(1.4H, s), 5.13(0.6H, s), 4.33~4.31(2H, m), 3.90(3H, s), 1.83~1.8O(1H, m), 1.01~0.95(3H, m)
Mass(EI) 429(M++1)
EXAMPLE 19: Preparation of 3-(r2-|"3-(4-chlorophenvDisoxazol-5-vπ-2- (propoxyiminotethylioxylbenzoic acid
Figure imgf000064_0001
92 mg of the title compound was obtained in a yield of 88% in the same manner as in EXAMPLE 1, except that 110 mg (0.25 mmol) of methyl 3-{[2-[3-(4- chlorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}benzoate was used. NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.77~7.60(4H, m), 7.50-7.30(3.4H, m), 7.25~7.15(1H, m), 6.93(0.6H, m), 5.23(1.4H5 s), 5.15(0.6H, s), 4.34~4.33(2H, m), 1.84~1.80(2H, m), 1.02~0.99(3H, m)
Mass(EI) 415(M++!)
PREPARATION 17: Preparation of 2-bromo-l-f4-phenoxyphenyltethanon O- propyloxime
280 mg of the title compound was obtained in a yield of 46% in the same manner as in PREPARATION 1-2, except that 510 mg (1.75 mmol) of 2-bromo-l-(4- phenoxyphenyl)ethanon and 276 mg (2.47 mmol) of n-propoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 7.69~7.61(2H, m), 7.37~7.34(2H, m), 7.16~7.12(1H, m), 7.05~6.97(4H, m), 4.54(1H, s), 4.35(1H, s), 4.25~4.14(2H, m), 1.82~1.69(2H, m), 1.02~0.90(3H, m)
Mass(EI) 349(M++1)
PREPARATION 18: Preparation of methyl 3-{[2-(4-phenoxyρhenylV2- (propoxyimino)ethyl] oxy } benzoate
50 mg of the title compound was obtained in a yield of 92% in the same manner as in PREPARATION 2, except that 45 mg (0.129 mmol) of 2-bromo-l-(4- phenoxyphenyl)ethanon O-propyloxime and 25 mg (0.144mmol) of methyl 3- hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.65~7.60(4H, m), 7.34-7.31(3H, m), 7.15~7.09(2H, m), 7.02~6.95(2H, m), 5.25(2H, s), 4.22(3H, t, J=6.5Hz), 3.90(3H, s), 1.81~1.77(2H, m), 1.00 (3H, t, J=6.5Hz)
Mass(EI) 420(M++!)
EXAMPLE 2Oi Preparation of 3-(|"2-(4-phenoxyphenvn-2-
(propoxyiminokthylloxylbenzoic acid
Figure imgf000066_0001
36 mg of the title compound was obtained in a yield of 74% in the same manner as in EXAMPLE 1, except that 50 mg (0.119 mmol) of methyl 3-{[2-(4- phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}benzoate was used.
NMR: 1H-NMR(CDCl3) δ 7.70~7.64(4H, m), 7.40~7.32(3H, m), 7.20~7.09(2H, m), 7.02~6.95(2H, m), 5.27(2H, s), 4.22(3H, t, J=6.5Hz), 1.82-1.77(2H, m), 1.00 (3H, t, J=6.5Hz)
Mass(EI) 406(M+H-I) PREPARATION 19: Preparation of dZV2-bromo-l-(3-[4-
(trifluoromethvπphenyl] isoxazol-5 - yl } ethanon O-propyloxime
1.3 g of the title compound was obtained in a yield of 10% in the same manner as in PREPARATION 1, except that 8.7 g (50 mmol) of 4-trifluoromethylbenzaldehyde was used.
NMR: 1H-NMR(CDCl3) δ 7.98~7.96(2H, m), 7.75~7.73(2H, m), 6.96(1H, s), 4.39(2H, s), 4.24(2H, t, J=8Hz), 1.85~1.76(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 392 (M++l)
EXAMPLE 21: Preparation of 3-(f(2EV2-(propoxyiminoV2-(3-r4- trifluoromethyliphenyUisoxazol-5-yliethvUoxylbenzoic acid
Figure imgf000067_0001
15 mg of the title compound was obtained in a yield of 65% in the same manner as in PREPARATION2 and EXAMPLE 1, except that 20 mg (0.051 mmol) of (lZ)-2- bromo-l-{3-[4-(trifluoromethyl)phenyl]isoxazol-5-yl}ethanon O-propyloxime and 7.8 mg (0.051 mmol) of methyl 3-hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.98~7.94(2H, m), 7.77~7.74(4H, m), 7.44~7.35(1H, m), 7.23~7.2O(1H, m), 7.00(1H, s), 5.25(2H, s), 4.35(2H, t, J=8Hz), 1.88~1.79(2H, m),
1.02(3H, U=8Hz) Mass(EI) 449(M++!)
EXAMPLE 22: Preparation of f3-(IT2E)2-(propoxyimino>2-(3-r4- (trifluoromethvπphenyllisoxazol-S-vUethylioxylphenvDacetic acid
Figure imgf000068_0001
5 mg of the title compound was obtained in a yield of 42% in the same manner as in PREPARATION 2 and EXAMPLE 1, except that 10 mg (0.026 mmol) of QZ)-2- bromo-l-{3-[4-(trifluoromethyl)phenyl]isoxazol-5-yl}ethanon O-propyloxime and 4.2 mg (0.026 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.98~7.93(2H, m), 7.75~7.71(2H, m), 7.28~7.24(1H, m), 6.99(1H, s), 7.96~7.88(3H, m), 5.17(2H, s), 4.32(2H, t, J=8Hz), 3.62(2H, s), 1.85-1.76(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 463(M++!)
PREPARATION 20: Preparation of methyl 3-hvdroxy-5-isopropoxybenzoate
0.63 g (3.8 mmol) of methyl 3,5-dihydroxybenzoate was dissolved in 10 mL of tetrahydrofuran, then 0.15 g (60%, 3.8 mmol) of sodium hydride was slowly added thereto while stirring at room temperature. After 30 minutes, 0.35 mL (3.8 mmol) of isopropylbromide was added dropwise to the solution, then stirred for 5 hours at 60 °C . 20 mL of saturated aqueous ammonium chloride was poured thereto, and the resulting solution was extracted with ethyl acetate, dried over anhydrous magnesium sulfate, and filtered off, and then solvent was removed to obtain 0.30 g of the title compound using column chromatography in a yield of 38%
NMR: 1H-NMR(CDCl3) δ 7.15~7.14(1H, m), 7.08(1H, brs), 6.59~6.58(1H, m), 5.24(1H, brs), 4.6O~4.54(1H, m), 3.89(3H, s), 1.35(6H, d, J=7Hz)
MaSS(EI) ZIl(M++!)
PREPARATION 21; Preparation of methyl 3-hvdroxy-5-isobutoxybenzoate
0.34 g (2.0 mmol) of methyl 3,5-dihydroxybenzoate, 0.42 g (3.0 mmol) of potassiumcarbonate and 0.14 g (1.0 mmol) of isobutylbromide were dissolved in 3 mL of dimethylformamide, and then stirred for 12 hours at 50 °C . The reaction solution was diluted with ethyl acetate, washed with water, dried over magnesium sulfate and filtered off. Solvent was removed to obtain 0.080 g of the title compound using column chromatography in a yield of 18%
NMR: 1H-NMR(CDCl3) δ 7.15~7.14(1H, m), 7.07(1H, brs), 6.59~6.58(1H, m), 5.14(1H, m), 3.89(3H, s), 3.74(2H, d, J=7Hz), 2.09~2.04(lH, m), 1.01(6H, d, J=7Hz)
Mass(EI) 225(M++1)
PREPARATION 22: Preparation of methyl 3-fcvclopentoχy>5-hvdroxybenzoate 0.10 g of the title compound was obtained in a yield of 21% in the same manner as in PREPARATION 21, except that 0.34 g (2.0 mmol) of methyl 3,5- dihydroxybenzoate and 0.15 g (1.0 mmol) of isobutylbromide were used.
NMR: 1H-NMR(CDCl3) δ 7.12 (IH, brs), 7.05(1H, brs), 6.56~6.55(1H, m), 5.17(1H, m), 4.81~4.75(1H, m), 3.88(3H, s), 1.95~1.87(2H, m), 1.87~1.77(4H, m), 1.65~1.57(2H, m)
Mass(EI) 237(M++l)
EXAMPLE 23: Preparation of 3-{r(2E)-2-[3-(4-fluorophenvnisoxazol-5-vn-2- (propoxyimino)ethylloxy-5-isopropoxybenzoic acid
Figure imgf000070_0001
3.0 mg of the title compound was obtained in a yield of 27% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 8.1 mg
(0.024 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime and 5.0 mg (0.024 mmol) of methyl 3-hydroxy-5-isopropoxybenzoate were used. .
NMR: 1H-NMR(CD3OD) (sodium salt) δ 7.90-7.87(2H5 m), 7.22-7.18(2H, m), 7.17(1H, s), 7.16(1H, brs), 7.14(1H, brs), 5.55~5.54(1H, m), 5.18(2H, s), 4.59~4.56(1H, m), 4.29(2H, t, J=7Hz), 1.82-1.78(2H, m), 1.28(6H, d, J=7Hz), 1.00(3H, t, J=7Hz) Mass(EI) 457(M++1)
EXAMPLE 24: Preparation of 3-isopropoxy-5-(rf2ZV2-(2-naphthvn- 2(propoxyimino)ethvnoxyl benzoic acid
Figure imgf000071_0001
22 mg of the title compound was obtained in a yield of 46% in the same manner as in PREPARATION 2, PREPARATION l-(2) and EXAMPLE 1 in sequence, except that 25 mg (0.10 mmol) of 2-bromo-2'-acetonaphthone and 5.0 mg (0.10 mmol) of methyl 3-hydroxy-5-isopropoxybenzoate were used.
NMR: 1H-NMR(CDCl3) (sodium salt) δ 8.11(1H, s), 7.88~7.79(4H, m), 7.48~7.46(2H, m), 7.29(1H, s), 7.21(1H, s), 6.69(1H, m), 5.34(2H, s), 4.54~4.51(1H, m), 4.27(2H, t, J=7Hz), 1.85~1.81(2H, m), 1.29(6H, d, 7Hz), 1.03(1H, t, 7Hz)
Mass(EI) 422(M++1)
EXAMPLE 25: Preparation of 3-{[(2EV2-r3-(4-fluorophenvnisoxazol-5-vn-2- (propoxyirninotethylioxy-5-isobutoxybenzoic acid
Figure imgf000072_0001
8.0 mg of the title compound was obtained in a yield of 47% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 12 mg
(0.036 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime and 8.0 mg (0.036 mmol) of methyl 3-hydroxy-5-isobutoxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.82~7.80(2H, m), 7.3O(1H, s), 7.26(1H, s), 7.14(2H, t, J=9Hz), 6.91(1H, s), 6.76~6.75(1H, m), 5.20(2H, s), 4.33(2H, t, J=7Hz), 3.73(2H, d, J=7Hz), 2.1O~2.O5(1H, m), 1.85~1.80(2H, m), 1.02(6H, d, J=7Hz), 1.02(3H, t, J=7Hz)
Mass(EI) 471(M++1)
EXAMPLE 26: Preparation of 3-([f2EV2-r3-(4-fluorophenvnisoxazol-5-vn-2- (propoxyimino)ethyl1oxy-5-cyclopentoxybenzoic acid
Figure imgf000072_0002
9.0 mg of the title compound was obtained in a yield of 50% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 12 mg (0.036 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime and 8.4 mg (0.036 mmol) of methyl methyl 3-(cyclopentoxy)-5- hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.81~7.79(2H, m), 7.27(1H, s), 7.24(1H, s), 7.14(2H, t, J=9Hz), 6.91(1H, s), 6.71~6.7O(1H, m), 5.18(2H, s), 4.8O~6.75(1H, m), 4.32(2H, t, J=7Hz), 1.95-1.89(2H5 m), 1.87-1.75(6H, m), 1.65~1.60(2H, m), 1.00(3H, t, J=7Hz)
Mass(EI) 483(M++l)
PREPARATION 23: Preparation of (lZ)-2-bromo-l-(3-phenoxyρhenvnethanone O- propyloxime
(1) Preparation of 2-bromo-3'-phenoxyacetophenone
0.5 g (2.4 mmol) of l-(3-phenoxyphenyl)ethanone and 1.2 g (2.4 mmol) of tetrabutylammoniumtribromide were dissolved in 10 mL of chloroform/3 mL of methanol and stirred for 12 hours at room temperature. 20 mL of 5% sodiumthiosulfate was added thereto, and then the resulting solution was extracted with ethyl acetate, and dried over magnesium sulfate and filtered off. Solvent was removed to obtain 0.29 g of the title compound using column chromatography in a yield of 42%.
NMR: 1H-NMR(CDCl3) δ 7.72~7.66(1H, m), 7.61~7.57(1H, m), 7.45~7.43(1H, m), 7.39~7.35(2H, m), 7.26~7.25(1H, m), 7.17~7.15(1H, m), 7. 04~7.01(2H, m), 4.40(2H, m) Mass(EI) 291, 293(M++l)
(2) Preparation of ( 1 Z)- 2-bromo- 1 -(3 -phenoxyphenyDethanone O-propyloxime
17 mg of the title compound was obtained in a yield of 49% in the same manner as in PREPARATION l-(2), except that 290 mg (1.0 mmol) of 2-bromo-3'- phenoxyacetophenone was used.
NMR: 1H-NMR(CDCl3) δ 7.46~7.44(1H, m), 7.42~7.4O(1H, m), 7.36~7.32(3H, m), 7.1O(1H, t, J=9Hz), 7.03~7.00(3H, m), 4.51(2H, m), 4.21(2H, t, J=7Hz), 1.80~1.72(2H, m), 0.98(3H, t, J=7Hz)
Mass(EI) 348, 350(M++l)
EXAMPLE 27: Preparation of 3-{|"f2ZV2-f3-phenoxyphcnvπ2- (propoxyiminotethylioxylbenzoic acid
Figure imgf000074_0001
18 mg of the title compound was obtained in a yield of 79% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 20 mg (0.057 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-propyloxime and 8.7 mg (0.057 mmol) of methyl 3-hydroxybenzoate were used. NMR: 1H-NMR(CDCl3) δ 7.71~7.69(1H, m), 7.64~7.62(1H, m), 7.42~7.4O(1H, m), 7.36~7.28(5H, m), 7.15~7.06(2H, m), 6.99~6.96(3H, m), 5.23(2H, s), 4.22(2H, t, J=7Hz), 1.81-1.75(2H, m), 0.99(3H, t, J=7Hz)
Mass(EI) 406(M++!)
EXAMPLE 28: Preparation of f 3-1 r(2ZV2-(3-phenoxyDhenvn2-
(propoxyiminokthyll oxy } phenvDacetic acid
Figure imgf000075_0001
9.0 mg of the title compound was obtained in a yield of 50% in the same manner as in PREPARATION 2 and EXAMPLE 1, except that 15 mg (0.043 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone 0-propyloxime and 7.2 mg (0.043 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.41~7.39(1H, m), 7.37~7.35(1H, m), 7.32~7.27(3H, m),
7.22-7.19(1H, m), 7.1O~7.O6(1H, m), 6.98~6.95(3H, m), 6.88~6.86(1H, m), 6.81~6.79(2H, m), 5.16(2H, s), 4.18(2H, t, J=7Hz), 3.58(2H, s), 1.78~1.73(2H, m), 0.97(3H, t, J=7Hz)
Mass(EI) 420(M++l) PREPARATION 24: Preparation of methyl 3-hvdroxy-l -naphthoate
320 mg (1.7 mmol) of 3-hydroxy-l -naphthoic acid synthesized in the same manner as described in J. Med. Chem 2001, 44, 3730-3745(Kevin J. Duffy et al) was stirred together with a mixture solution of 10 mL of methanol and 10 niL of 4 M hydrochloric acid dioxane for 9 hours at room temperature. Solvent was removed under reduced pressure and the residue was purified by column chromatography to obtain 115 mg of the title compound in a yield of 33%.
NMR: 1H-NMR(CDCl3) δ 8.79~8.72(1H, m), 7.82(2H, d, J=2.4Hz), 7.66~7.64(1H, m), 7.45~7.25(3H, m), 6.48(1H, brs), 3.98(3H, s)
Mass(EI) 203(M++l)
PREPARATION 25: Preparation of methyl 3-([(2EV2-(propoxyiminoV2-(3-r4- (trifluoromethvDphenyl] isoxazol-5 -yl I ethyl"|oxy| - 1 -naphthoate
13 mg of the title compound was obtained in a yield of 52% in the same manner as in PREPARATION 2, except that 19 mg (0.048 mmol) of 2-bromo-l-[3-(4- trifluoromethylphenyl)isoxazol-5-yl]ethanon O-propyloxime and 10 mg (0.049 mmol) of methyl 3-hydroxy-l -naphthoate were used.
NMR: 1H-NMR(CDCl3) δ 8.79~8.76(1H, m), 7.95~7.90(2H, m), 7.87(1H, s), 7.80~7.70(3H, m), 7.55~7.45(3H, m), 7.00(1H, s), 5.32(2H, s), 4.36(2H, t, J=6.5Hz), 3.97(3H, s), 1.86~1.83(2H, m), 1.03(3H, t, J=6.5Hz)
Mass(EI) 513(M++1) EXAMPLE 29: Preparation of 3-(r(2EV2-(proρoxyiminoV2-(3-r4- (trifluoromethyl)phenyll isoxazol-5 -yl } ethylioxy I - 1 -naphthoic acid
Figure imgf000077_0001
9 mg of the title compound was obtained in a yield of 72% in the same manner as in EXAMPLE 1, except that 13 mg (0.025 mmol) of methyl 3-{[(2E)-2- (propoxyimino)-2-{3-[4-(trifluoromethyl)phenyl]isoxazol-5-yl}ethyl]oxy}-l-naphthoate
was used.
NMR: 1H-NMR(CDCl3) δ 8.99~8.9O(1H, m), 8.07(1H, s), 8.05~7.90(2H, m), 7.85~7.65(3H, m), 7.60~7.45(3H, m), 7.02(1H, s), 5.34(2H, s), 4.37(2H, t, J=7Hz), 1.87-1.84(2H, m), 1.04(3H, t, J=7Hz)
Mass(EI) 499(M++1)
PREPARATION 26: Preparation of methyl 3-(IT2EV2-f3-f4-fluorophenvnisoxazol-5- yll-2-(propoxyimino')ethyl]oxy>-l-naphthoate
11 mg of the title compound was obtained in a yield of 95% in the same manner as in PREPARATION 2, except that 10 mg (0.025 mmol) of 2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon 0-propyloxime and 10 mg (0.029 mmol) of methyl 3-hydroxy-l-naphthoate were used.
NMR: 1H-NMR(CDCl3) δ 8.81~8.77(1H, m), 7.92~7.74(4H, m), 7.52~7.37(3H, m), 7.18~7.12(2H, m), 6.99(1H, s), 5.31(2H, s), 4.35(2H, t, J=6.8Hz), 3.98(3H, s), 1.89-1.80(2H, m), 1.03(3H, t, J=7.6Hz)
Mass(EI) 463(M++1)
EXAMPLE 30: Preparation of 3-{IT2EV2-r3-(4-fluorophenynisoxazol-5-yll-2- (propoxyimino')ethyl'loxy)-l-naphthoic acid
Figure imgf000078_0001
5 mg of the title compound was obtained in a yield of 48% in the same manner as in EXAMPLE 1, except that 11 mg (0.023 mmol) of methyl 3-{[(2E)-2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-l-naphthoate was used.
NMR: 1H-NMR(CDCl3) δ (Mixture of E and Z) 8.69~8.66(1H, m), 7.84~7.71(4H, m), 7.47~7.35(3H, m), 7.16~7.09(3H, m), 5.33(1H, s), 5.17(1H, s), 4.29~4.24(2H, m), 1.76-1.73(2H, m), 0.96~0.80(3H, m)
Mass(EI) 449(M++1) EXAMPLE 31: Preparation of l-r3-(4-fluoroρhenvnisoxazol-5-yll-2-r3- (trifluoromethyl)phenoxyiethanon θ-propyloxime
Figure imgf000079_0001
2.6 mg of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 2, except that 5 mg (0.012 mmol) of 2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 2 mg (0.012 mmol) of 3-
trifluoromethyl phenol were used.
E-isomer: NMR: 1H-NMR(CDCl3) δ 7.86~7.79(2H, m), 7.42-7.37(1 H, m), 7.25~7.13(5H, m), 6.91(1H, s), 5.21(2H, s), 4.32(2H, t, J=8Hz), 1.86~1.77(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 423(M++1)
Z-isomer: NMR: 1H-NMR(CDCl3) δ 7.85~7.82(2H, m), 7.42~7.37(2H, m), 7.28~7.23(2H, m), 7.19~7.15(3H, m), 5.14(2H, s), 4.39(2H, t, J=6.8Hz), 1.85~1.79(2H,
m), 1.01(3H, t, J=7.6Hz)
Mass(EI) 423(M++1) PREPARATION 27: Preparation of methyl 3-hvdroxy-5-(trifluoromethvDbenzoate
(1) Preparation of 3 -("benzyloxy)-5 -(trifluoromethvObenzoic acid
1 g (4.8 mmol) of 3-trifluoromethyl-5-fluorobenzoic acid was dissolved in 10 mL of dimethylformamide, then 623 mg (5.76 mmol) of benzyl alcohol was added thereto dropwise. 423 mg (60%, 10.5 mmol) of sodium hydride was slowly added to the reaction solution at 0°C, and stirred for 10 minutes, then the solution was heated at 50 °C for 4 hours. The reaction solution was diluted with ethyl acetate and washed with water, and then dried over anhydrous magnesium sulfate. Solvent was removed and the residue was purified by column chromatography to obtain 825 mg of the title compound in a yield of 58%.
NMR: 1H-NMR(CDCl3) δ 7.95(1H, s), 7.85(1H, s), 7.50~7.30(6H, m), 5.13(2H, s)
Mass(EI) 297 (M++l)
(2) Preparation of 3 -hydroxy-5-(trifluoromethyl')benzoic acid
720 mg (2.43 mmol) of 3-(benzyloxy)-5-(trifluoromethyl)benzoic acid was dissolved in methanol, then 100 mg of 10% palladium carbon was added thereto and stirred under hydrogen balloon for 9 hours. After completion of the reaction, the reaction solution was filtered by Cellite and distilled off under reduced pressure, then the residue was purified by column chromatography to give 321 mg of the title compound in a yield of 64%.
Mass(EI) 207 (M++l) (3) Preparation of methyl 3-hydroxy-5-(trifluoromethvDbenzoate
321 mg (1.5 mmol) of 3-hydroxy-5-(trifluoromethyl)benzoic acid was stirred together with a mixture solution of 10 mL of methanol and 10 mL of 4 M hydrochloric acid dioxane for 9 hours at room temperature. After solvent was removed under reduced pressure, the residue was purified by column chromatography to give 150 mg of the title compound in a yield of 43%.
NMR: 1H-NMR(CDCl3) δ 7.85(1H, s), 7.71(1H, s), 7.29(1H, s), 3.94(3H, s)
Mass(EI) 221 (M++l)
PREPARATION 28: Preparation of methyl 3-(r(2EV2-r3-(4-fluorophenylMsoxazol-5- yll-2-(propoxyimino)ethyl]oxy>-5-('trifluoromethyl)benzoate
99 mg of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 2, except that 130 mg (0.33 mmol) of 2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 80 mg (0.36 mmol) of methyl 3-hydroxy-5-(trifluoromethyl)benzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.93(1H, m), 7.87~7.80(3H, m), 7.41(1H, s), 7.19~7.13(2H, m), 6.91(1H, s), 5.26(2H, s), 4.32(2H, t, J=8Hz), 3.94(3H, s), 2.04~1.75(2H, m), 1.01(3H, t, J=8Hz)
Mass(EI) 481 (M++l) EXAMPLE 32: Preparation of 3-(rr2EV2-r3-f4-fluorophenylMsoxazol-5-vn-2- (propoxyimino)ethvnoxy) -5-(trifluoromethyl*)benzoic acid
Figure imgf000082_0001
34 mg of the title compound was obtained in a yield of 36% in the same manner as in EXAMPLE 1, except that 99 mg (0.20 mmol) of methyl 3-{[(2E)-2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-5-(trifluoromethyl)benzoate was used.
NMR: 1H-NMR(CDCl3) δ 7.53~7.47(3H, m), 7.39(1H, s), 6.84~6.81(2H, m), 6.76(1H, s), 6.6O(1H, s), 4.76(2H, s), 4.09(2H, t, J=6.5Hz), 1.65-1.62(2H, m), 0.84QH, t, J=7.5Hz)
Mass(EI) 467 (M++l)
PREPARATION 29: Preparation of methyl 3-(rf2ZV2-(3-phenoxyphenylV2- φropoxyiminotethylloxy|-5-(trifluoromethyπbenzoate
8 mg of the title compound was obtained in a yield of 78% in the same manner as in PREPARATION 2, except that 7.5 mg (0.021 mmol) of l-(Z)-2-bromo-l-[3- phenoxyphenyl]ethanon O-propyloxime and 5 mg (0.022 mmol) of methyl 3-hydroxy- 5-(trifluoromethyl)benzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.88(1H, s), 7.73(1H, s), 7.41~7.29(6H, m), 7.11~6.96(4H, m), 5.26(2H, s), 4.23(2H, t, J=6.8Hz), 3.93(3H, s), 1.83-1.64(2H, m), 0.98(3H, t, J=7.6Hz)
Mass(EI) 488 (M++l)
EXAMPLE 33: Preparation of 3-{ r(2ZV2-(3-phenoχyphenylV2-
(propoxyimino)ethvH oxy 1-5 -(trifluoromethvDbenzoic acid
Figure imgf000083_0001
3.5 mg of the title compound was obtained in a yield of 36% in the same manner as in EXAMPLE 1, except that 8 mg (0.016 mmol) of methyl 3-{[(2Z)-2-(3- phenoxyphenyl)-2-(propoxyimino)ethyl]oxy}-5-(trifluoromethyl)benzoate was used.
NMR: 1H-NMR(CDCl3) δ 7.94(1H, s), 7.8O(1H, s), 7.43~7.29(6H, m), 7.11~6.90(4H, m), 5.28(2H, s), 4.24(2H, t, J=6.8Hz), 1.84-1.75(2H, m), 0.99(3H, t, J=7.6Hz)
Mass(EI) 474 (M++l)
PREPARATION 30: Preparation of l-rZV2-bromo-l-r3- (cyclopentyloxy*)phenyl] ethanon O-propyloxime
( 1 ) Preparation of 1 -(3 -cyclopentyloxyphenyD ethanon
1 g (7.34 mmol) of l-(3-oxyphenyl)ethanon was dissolved in 20 mL of acetonitrile and 20 mL of dimethylformamide together with 1.3 g (8.7 mmol) of cyclopentyl bromide and 3.6 g (11 mmol) of cesium carbonate, and then the resulting solution was stirred and heated for 3 hours at 80 °C. Ethyl acetate was added thereto, washed with 1 N hydrochloric acid and then dried over anhydrous magnesium sulfate.
This solution was filtered off, then the filtered solution was removed and then the residue was purified by column chromatography to give 1.2 g of the title compound in a yield of 80%.
NMR: 1H-NMR(CDCl3) δ 7.55~7.49(2H, m), 7.4O~7.36(1H, m), 7.12~7.1O(1H, m), 4.88~4.84(1H, m), 2.63(3H, s), 1.99-1.82(6H, m), 1.69-1.60(2H, m)
Mass(EI) 205 (M++l)
(2) Preparation of 2-bromo-l- [3 -(cvclopentyloχy')phenyl1 ethanon
500 mg (2.44 mmol) of l-(3-cyclopentyloxyphenyl) ethanon was dissolved in 13 mL of chloroform: methanol (10:3) solution, then 1.18 g (2.44 mmol) of tetrabutyl ammonium tribromide was added thereto dropwise. After stirring for 9 hours at room temperature, 50 mL of chloroform was added thereto, and then washed with water. An organic layer was dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to give 500 mg of the title compound in a yield of 72%. NMR: 1H-NMR(CDCl3) δ 7.52~7.48(2H, m), 7.39~7.35(1H, m), 7.13~7.1O(1H, m), 4.86~4.82(1H, m), 4.44(2H, s), 1.95~1.65(8H, m), Mass(EI) 284(M++1)
(3) Preparation of l-(Z)-2-bromo-l-[3-(cvclopentyloxy^phenyllethanon O- propyloxime
500 mg (1.76 mmol) of 2-bromo-l-[3-(cyclopentyloxy)phenyl]ethanon was dissolved in 7 mL of methanol, then 289 mg (3.52 mmol) of anhydride sodium acetate and 197 mg (1.76 mmol) of propyloxyamine hydrochloride were added thereto, followed by stirring for 5 hours at room temperature. After solvent was removed, ethyl acetate was added thereto and the resulting solution was washed with 1 N HCl. An organic layer was dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to give 315 mg of the title compound in a yield of 52%.
NMR: 1H-NMR(CDCl3) δ 7.30~7.17(3H, m), 6.91~6.89(1H, m), 4.81~4.78(1H, m), 4.34(2H, s), 4.24(2H, t, J=8Hz), 1.93~1.61(10H, m), 0.98(3H, t, J=8Hz)
Mass(EI) 341(M++1)
PREPARATION 3Jj Preparation of l-(Z>2-bromo-H4-
(cyclopentyloxy)phenyl] ethanon O-propyloxime
(I) Preparation of 1 -(4-cvclopentyloxyphenyO ethanon
1 g (7.34 mmol) of l-(4-oxyphenyl)ethanon together with 1.3 g (8.7 mmol) of cyclopentyl bromide and 3.6 g (11 mmol) of cesium carbonate were dissolved in 20 mL of acetonitrile, and then the resulting solution was stirred and heated for 3 hours at 80 °C . Ethyl acetate was added thereto, and the resulting solution was washed with 1 N hydrochloric acid and then dried over anhydrous magnesium sulfate. This solution was filtered off, then the filtered solution was removed and the residue was purified by column chromatography to obtain 1.6 g of the title compound in a quantitative yield.
NMR: 1H-NMR(CDCl3) δ 7.91(2H, d, J=8Hz), 6.89(2H, d, J=8Hz), 4.83~4.82(1H, m), 2.55(3H, s), 2.05-1.64(8H, m)
Mass(EI) 205 (M++l)
(2) Preparation of 2-bromo- 1 -(4-cyclopentyloxyphenyl) ethanon
500 mg (2.44 mmol) of l-(4-cyclopentyloxyphenyl) ethanon was dissolved in 13 mL of chloroform: methanol (10:3) solution, then 1.18 g (2.44 mmol) of tetrabutyl ammonium tribromide was added thereto dropwise. After stirring for 9 hours at room temperature, 50 mL of chloroform was added thereto, and the reaction solution was washed with water. An organic layer was dried over anhydrous magnesium sulfate and the residue was purified by column chromatography to give 500 mg of the title compound in a yield of 72%.
NMR: 1H-NMR(CDCl3) δ 7.96~7.91(2H, m), 6.93~6.90(2H, m), 4.86~4.82(1H, m), 4.39(2H, s), 1.96-1.77(6H, m), 1.67-1.63(2H, m)
Mass(EI) 284(M++1) (3*) Preparation of l-(ZV2-bromo-l-[4-(cvclopentyloxy)phenyllethanon O- propyloxime
500 mg (1.76 mmol) of 2-bromo-l-[4-(cyclopentyloxy)phenyl]ethanon was dissolved in 7 mL of methanol , then 289 mg (3.52 mmol) of anhydride sodium acetate and 197 mg (1.76 mmol) of propyloxyamine hydrochloride were added thereto, followed by stirring 5 hours at room temperature. After solvent was removed, ethyl acetate was added thereto, and washed with 1 N HCl. An organic layer was dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to give 352 mg of the title compound in a yield of 58%.
NMR: 1H-NMR(CDCl3) δ 7.62~7.60(2H, m), 6.87~6.86(2H, m), 4.81~4.76(1H, m), 4.33(2H, s), 4.20(2H, t, J=I 2Hz), 1.90-1.55(1 OH, m), 0.98(3H, t, J=IlHz)
Mass(EI) 341(M++1)
PREPARATION 32: Preparation of methyl (3-(r(2ZV2-f3-(cycloDentyloxyfahenvn-2- (propoxyiminotethyl] oxy ) phenvPacetate
47 mg of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 2, except that 61 mg (0.179 mmol) of l-(Z)-2-bromo-l-[3- (cyclopentyloxy)phenyl]ethanon O-propyloxime and 30 mg (0.18 mmol) of methyl 2- (3-hydroxyphenyl)ethanoate were used.
NMR: 1H-NMR(CDCl3) δ 7.24~7.15(4H, m), 6.87~6.65(4H, m), 5.16(2H, s), 4.85~4.72(1H, m), 4.20(2H, t, J=6.8Hz), 3.67(3H, s), 3.56(2H, s), 1.90-1.72(8H, m), 1.62-1.56(2H, m), 0.98(3H, t, J=7.6Hz)
Mass(EI) 426 (M++l)
EXAMPLE 34: Preparation of (3-{[r2ZV2-r3-(cvclopentyloxy)phenyl1-2- (propoxyiminolethylioxylphenyDacetic acid
Figure imgf000088_0001
10 mg of the title compound was obtained in a yield of 22% in the same manner as in EXAMPLE I5 except that 47 mg (0.11 mmol) of methyl (3-{[(2Z)-2-[3- (cyclopentyloxy)phenyl]-2-(propoxyimino)ethyl]oxy}phenyl)acetate was used.
NMR: 1H-NMR(CDCl3) δ 7.25~7.19(4H, m), 6.87~6.68(4H, m), 5.16(2H, s), 4.8O~4.72(1H, m), 4.19(2H, t, J=6.5Hz), 3.58(2H, s), 1.85-1.50(10H, m), 0.98(3H, t, J=7Hz)
Mass(EI) 412 (M++l)
PREPARATION 33: Preparation of methyl (3-([r2ZV2-[4-(cvclopentyloxy^phenyll-2- (propoxyimino)ethyl]oxy}phenyQacetate
52 mg of the title compound was obtained in a yield of 68% in the same manner as in PREPARATION 2, except that 61 mg (0.179 mmol) of l-(Z)-2-bromo-l-[4- (cyclopentyloxy)phenyl]ethanon O-propyloxime and 30 mg (0.18 mmol) of methyl 2- (3-hydroxyphenyl)ethanoate were used.
NMR: 1H-NMR(CDCl3) δ 7.59(2H, d, J=8Hz), 7.22~7.18(1H, m), 6.87~6.81(5H, m), 5.17(2H, s), 4.77~4.74(1H, m), 4.18(2H, t, J=8Hz), 3.68(3H, s), 3.57(2H, s), 1.94-1.72(8H, m), 1.62-1.58(2H, m), 0.98(3H, t, J=8Hz)
Mass(EI) 426 (M++l)
EXAMPLE 35: Preparation of (3-{[T2Z)-2-r4-(cyclopentyloxy)phenyll-2- (propoxyimino)ethvπ oxy 1 phenvDacetic acid
Figure imgf000089_0001
40 mg of the title compound was obtained in a yield of 80% in the same manner as in EXAMPLE 1, except that 52 mg (0.12 mmol) of methyl (3-{[(2Z)-2-[4- (cyclopentyloxy)phenyl]-2-(propoxyimino)ethyl]oxy}phenyl)acetate was used.
NMR: 1H-NMR(CDCl3) δ 7.59(2H, d, J=8.5Hz), 7.22~7.18(1H, m), 6.87~6.81(5H, m), 5.16(2H, s), 4.77~4.74(1H, m), 4.17(2H, t, J=6.5Hz), 3.58(2H, s), 1.90~1.74(8H, m), 1.65-1.55(2H, m), 0.97(3H, t, J=6.5Hz)
Mass(EI) 412 (M++l) PREPARATION 34: Preparation of 6-r(lZV2-chloro-N-propoxyethaneimidoyll-2H-1.4- benzoxazine-3 (4H)- one
200 mg of the title compound was obtained in a yield of 70% in the same manner as in PREPARATION 23-(2), except that 226 mg (1.0 mmol) of 6- (chloroacetyl)-2H-l,4-benzoxazine-3(4H)-one was used.
NMR: 1H-NMR(CDCl3) δ 7.63(1H, s), 7.3O~7.28(1H, m), 7.19~7.18(1H, m), 7.01~6.99(lH, m), 4.64(2H, s), 4.51(2H, s), 4.21(2H, t, J=7Hz), 1.79~1.72(2H, m), 0.98(3H, t, J=7Hz)
Mass (EI) 283 (M++l)
PREPARATION 35: Preparation of αzy2-bromo-l-r3-(4-
Figure imgf000090_0001
(1) Preparation of 1 - [3 -(4-chlorophenoxy)phenyl1 ethanol
2.3 g (10 mmol) of 3-(4-chlorophenoxy)benzaldehyde was dissolved in tetrahydrofuran, then 6.9 mL (11 mmol) of 1.6M methyl lithium was slowly added thereto dropwise while stirring at room temperature. After 30 minutes, 30 mL of a saturated aqueous ammonium chloride was slowly added thereto dropwise at 0°C, and the resulting solution was extracted with ethyl acetate, and an organic layer was washed with aqueous saturated sodium chloride solution and then dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to give 2.4 g of the title compound in a yield of 96%.
Mass (EI) 249 (M+H-I)
(2) Preparation of 1 -|"3-(4-chlorophenoxy)phenyllethanone
2.4 g (9.6 mmol) of l-[3-(4-chlorophenoxy)phenyl]ethanol and 4.1 niL (29 mmol) of triethylamine were dissolved in 20 mL of dichloromethane/dimethylsulfoxide(l/3), and then 2.4 g (15 mmol) of sulfur trioxide pyridine was slowly added thereto dropwise at 0°C while stirring. After 5 hours, 30 mL of a saturated aqueous ammonium chloride was slowly added thereto dropwise at 0°C, and the resulting solution was extracted with ethyl acetate, and the extraction solution was washed with aqueous saturated sodium chloride solution, an organic layer was dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to give 1.9 g of the title compound in a yield of 80%.
Mass (EI) 247 (M++l)
(3) Preparation of ( lZV2-bromo-l- [3 -(4-ChIQrOPhBnQXv)PhBnVl] ethanone O- propyloxime
0.12 g of the title compound was obtained in a yield of 41% in the same manner as in PREPARATION 23, except that 0.19 g (0.77 mmol) of l-[3-(4- chlorophenoxy)phenyl] ethanone was used.
Mass (EI) 383 (M++l) PREPARATION 36: Preparation of (lZV2-bromo-l-[3-(4- methoxγphenoxy)phenyll ethanone O-propyloxime
0.25 g of the title compound was obtained in a yield of 60% in the same manner as in PREPARATION 35, except that 0.28 g (1.1 mmol) of 3-(4- methoxyphenoxy)benzaldehyde was used.
Mass (EI) 379 (M++l)
PREPARATION 37: Preparation of 2-bromo-l-r3-(hexyloxy)phenyl1ethanone
400 mg of the title compound was obtained in a yield of 67% in the same manner as in PREPARATION 30-(l), (2), except that 0.27 g (2.0 mmol) of 3-
hydroxyacetophenone was used.
Mass (EI) 300 (M++l)
PREPARATION 38: Preparation of αZV2-bromo-l-r3-Qiexyloxy)phenyl1ethanone O- propyloxime
60 mg of the title compound was obtained in a yield of 25% in the same manner as in PREPARATION 30-(3), except that 0.20 g (0.67 mmol) of 2-bromo-l-[3- (hexyloxy)ρhenyl]ethanone obtained in PREPARATION 37 was used.
NMR: 1H-NMR(CDCl3) δ 7.31~7.25(3H, m), 6.93-6.91 (IH, m), 4.34(2H, s), 4.24(2H, t, J=7Hz), 3.97(2H, t, J=7Hz), 1.81~1.75(4H, m), 1.49~1.44(2H, m), 1.37~1.33(4H, m), 1.00(3H, t, J=IHz), 0.90(3H, t, J=7Hz),
Mass (EI) 357 (M++l)
PREPARATION 39: Preparation of 3-rdZV2-bromo-N-propoxyethaneimidoyllphenyl butane- 1 -sulfonate
( 1 ) Preparation of 3 -acetylphenyl butane- 1 -sulfonate
272 mg (2.0 mmol) of 3-hydroxyacetophenone and 0.42 mL (3.0 mmol) of triethylamine were dissolved in 10 mL of dichloromethane, then 0.26 mL (2.0 mmol) of butylsulfonyl chloride was slowly added thereto dropwise while stirring at 0°C . After 12 hours, solvent was removed, and the reaction solution was diluted with 30 mL of ethyl acetate and an organic layer, which was washed with 10 mL of IN sodiumhydroxide and aqueous saturated sodium chloride solution, was dried over anhydrous magnesium sulfate, and the residue was purified by column chromatography to give 280 mg of the title compound in a yield of 55%.
Mass (EI) 257 (M++!)
(2) Preparation of 3-[(lZ)-2-bromo-N-propoxyethaneimidoyl1phenyl butane-1- sulfonate
100 mg of the title compound was obtained in a yield of 23% in the same manner as in PREPARATION 23, except that 0.28 g (0.11 mmol) of 3-acetylphenyl butane- 1 -sulfonate was used.
NMR: 1H-NMR(CDCl3) δ 7.67~7.65(1H, m), 7.62~7.61(1H, m), 7.45~7.42(1H, m), 7.32~7.3O(1H, m), 4.53(2H, s), 4.25(2H, q, J=7Hz), 3.25(2H5 1, J=7Hz), 2.01-1.95(2H, m), 1.79-1.75(2H, m), 1.55-1.49(2H, m), 0.99(3H, t, J=7Hz)
Mass (EI) 393 (M++l)
PREPARATION 40: Preparation of (lZV2-bromo-l-(3-nitrophenvnethanone O- propyloxime
180 mg of the title compound was obtained in a yield of 60% in the same manner as in PREPARATION 23-(2), except that 244 mg (1.0 mmol) of 2-bromo-(3- nitrophenyl)ethanone was used.
NMR: 1H-NMR(CDCl3) δ 8.57~8.56(1H, m), 8.24~8.22(1H, m), 8.04~8.02(lH, m), 7.6O~7.57(1H, m), 4.59(2H, s), 4.28(2H, t, J=7Hz), 1.81-1.76(2H, m), 1.00(3H, t, J=7Hz)
Mass (EI) 302 (M++l)
PREPARATION 41: Preparation of αZV2-chloro-l-(Z4-difluorophenyltethanone O- propyloxime
350 mg of the title compound was obtained in a yield of 71% in the same manner as in PREPARATION 23-(2), except that 380 mg (2.0 mmol) of 2-chloro-l- (2,4-difluorophenyl)ethanone was used.
Mass (EI) 248 (M++l)
PREPARATION 42: Preparation of (lZV2-chloro-l-(4-fluorophenvnethanone O- propyloxime
320 mg of the title compound was obtained in a yield of 52% in the same manner as in PREPARATION 23-(2), except that 345 mg (2.0 mmol) of 2-chloro-l-(4- fluorophenyl)ethanone was used.
Mass (EI) 230 (M++l)
PREPARATION 43: Preparation of (lZV2-bromo-l-r3-
(trifluoromethoxy)phenyllethanone θ-methyloxime
250 mg of the title compound was obtained in a yield of 24% in the same manner as in PREPARATION 23, except that 0.70 g (3.4 mmol) of 2-bromo-l-[3- (trifluoromethoxy)phenyl]ethanone was used.
Mass (EI) 313 (M++l)
PREPARATION 44: Preparation of. riZV2-bromo-l-r3-
(trifluoromethoxy)phenyll ethanone O-propyloxime
0.70 g of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 23, except that 0.70 g (3.4 mmol) of 2-bromo-l-[3- (trifluoromethoxy)phenyl]ethanone was used.
NMR: 1H-NMR(CDCl3) δ 7.92~7.89(1H, m), 7.65~7.63(1H, m), 7.57~7.55(1H, m), 7.44~7.41(1H, m), 4.53(2H, s), 4.26(2H, t, J=7Hz), 1.81~1.77(2H, m), 0.99(3H, t, J=7Hz)
Mass (EI) 341 (M++!)
PREPARATION 45: Preparation of (lZV2-bromo-l-r4-
(trifluoromethvQphenyllethanone O-propyloxime
1.7 g of the title compound i was obtained n a yield of 37% in the same manner as in PREPARATION 23, except that 2.7 g (14 mmol) of 4-trifluoromethyl acetophenone was used.
Mass(EI) 325 (M++!)
PREPARATION 46: Preparation of αZV2-bromo-l-(3-benzyloxyρhenvnethanone O- ethyloxime
590 mg of the title compound was obtained in a yield of 85% in the same manner as in PREPARATION 23, except that 450 mg (2.0 mmol) of 3-benzyloxy acetophenone was used.
Mass(EI) 349 (M++l) PREPARATION 47: Preparation of αZV2-bromo-l-(3-phenoxyphenvnethanone O- ethyloxime
600 mg of the title compound was obtained in a yield of 75% in the same manner as in PREPARATION l-(2), except that 700 mg (2.4 mmol) of 2-bromo-3'- phenoxyacetophenone was used.
Mass(EI) 335 (M++l)
PREPARATION 48: Preparation of dZV2-bromo-l-(3-ρhenoxyphenvnethanone O-(2- fluoroethvDoxime
420 mg of the title compound was obtained in a yield of 69% in the same manner as in PREPARATION 1 -(2), except that 500 mg (1.7 mmol) of 2-bromo-3'- phenoxyacetophenone was used.
NMR: 1H-NMR(CDCl3) δ 7.44-7.42(1, m), 7.4O~7.38(1H, m), 7.37~7.30(3H, m), 7.13~7.1O(1H, m), 7.05~7.00(3H, m), 4.76~4.73(1H, m), 4.66~4.63(1H, m), 4.54(2H, s), 4.53~4.5O(1H, m), 4.48~4.43(1H, m), 1.43(3H, t, J=7Hz)
Mass(EI) 353 (M+H-I)
PREPARATION 49: Preparation of ethyl 5-fluoro-lH-indol-3-carboxylate
1.2 g of the title compound was obtained in a yield of 17% in the same manner as in Org. Lett 2002, 4(5), 699-701, except that 3.3 g (33 mmol) of 4-fluoroaniline was used.
NMR: 1H-NMR(CDCl3) δ 8.55(1H, s), 7.96~7.95(1H, m), 7.85~7.82(1H, m), 7.35~7.32(1H, m), 7.05~6.99(lH, m), 4.40(2H, q, J=7Hz), 1.43(3H, t, J=7Hz)
Mass(EI) 208 (M++!)
PREPARATION 50: Preparation of ethyl S-chloro-lH-indol-S-carboxylate
250 mg of the title compound was obtained in a yield of 23% in the same manner as in Org. Lett 2002, 4(5), 699-701, except that 0.62 g (4.9 mmol) of 4- chloroaniline was used.
NMR: 1H-NMR(CDCl3) δ 8.6O(1H, s), 8.17~8.16(1H, m), 7.94~7.93(1H, m), 7.34~7.32(1H, m), 7.24~7.22(1H, m), 4.40(2H, q, J=7Hz), 1.43(3H, t, J=7Hz)
Mass(EI) 224 (M++!)
PREPARATION 51: Preparation of ethyl 5-(trifluoromethoxyVlH-indol-3-carboxylate
1.0 g of the title compound was obtained in a yield of 18% in the same manner as in Org. Lett 2002, 4(5), 699-701, except that 3.54 g (20 mmol) of 4-trifluoroaniline was used.
NMR: 1H-NMR(CDCl3) δ 8.47(1H, s), 7.89~7.88(1H, m), 7.8O~7.78(1H, m), 7.47~7.45(1H, m), 7.17~7.15(1H, m), 4.33(2H, q, J=7Hz), 1.40(3H, t, J=7Hz) Mass(EI) 274 (M++!)
EXAMPLE 36: Preparation of 3-isopropoxy-5-{|T2Z)-2-(3-oxo-3.4-dihvdro-2H-1.4- benzoxazine-6-vl)-2-(propoxvimmo)ethvl1oxy}benzoic acid
Figure imgf000099_0001
8.0 mg of the title compound was obtained in a yield of 18% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 28 mg (0.10 mmol) of 7- [( 1 Z)-2-bromo-N-propoxyethaneimidoyl] -2H- 1 ,4-benzoxazine-3 (4H)-one and 21 mg (0.10 mmol) of methyl 3-hydroxy-5-isopropoxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 8.4O(1H, s), 7.34~7.32(1H, m), 7.25~7.23(1H, m), 7.21~7.19(2H, m), 6.95~6.93(1H, m), 6.66~6.65(1H, m), 5.22(2H, s), 4.62(2H, s), 4.58~4.55(1H, m), 4.25(2H, t, J=7Hz), 1.81~1.77(2H, m), 1.31(6H, d, J=7Hz), 0.99(3H, t, J=7Hz)
Mass(EI) 443 (M++!)
EXAMPLE 37: Preparation of 3-isoproρoxy-5-{f(2ZV2-(4-methyl-3-oxo-3.4-dihvdro- 2H-M-benzoxazine-6-yl)-2-φropoxyimmotethylloχy|benzoic acid
Figure imgf000100_0001
20 mg (0.044 mmol) of methyl 3-isopropoxy-5-{[(2Z)-2-(3-oxo-3,4-dihydro-
2H-l,4-benzoxazine-6-yl)-2-(propoxyimino)ethyl]oxy}benzoate, which was obtained in the same manner as in PREPARATION 2, except that 56 mg (0.20 mmol) of 7-[(lZ)-2- chloro-N-propoxyethaneimidoyl]-2H-l,4-benzoxazine-3(4H)-one and 42 mg (0.20 mmol) of methyl 3-hydroxy-5-isopropoxybenzoate were used, was dissolved in 1 mL of acetonitrile, and a mixture of 18 mg (0.13 mmol) of potassiumcarbonate, 9.3 mg (0.066 mmol) of methyliodide and 10 mg (0.0044 mmol) of benzyltriethylammonium chloride was slowly added dropwise, followed by stirring under reflux. After 1 hour, solvent was removed, and then 12 mg (0.026 mmol, 58%) of methyl 3-isopropoxy-5-{[(2Z)-2-(4- methyl-3-oxo-3 ,4-dihydro-2H- 1 ,4-benzoxazine-6-yl)-2-
(propoxyimino)ethyl]oxy}benzoate was obtained using TLC (Thin Layer Chromatography). As a result, 8.0 mg of the title compound was obtained in a yield of 69% in the same manner as in EXAMPLE 1.
NMR: 1H-NMR(CDCl3). δ 7.34~7.33(1H, m), 7.32~7.3O(1H, m), 7.25~7.23(2H, m), 6.96~6.64(1H, m), 6.68~6.67(1H, m), 5.23(2H, s), 4.62(2H, s), 4.59~4.56(1H, m), 4.23(2H, t, J=7Hz), 3.36(3H, s), 1.82-1.78(2H, m), 1.32(6H, d, J=7Hz), 1.00(3H, t, J=7Hz)
Mass(EI) 457 (M++l) EXAMPLE 38: Preparation of G-(r("2ZV2-f3-oxo-3.4-dihvdro-2H-1.4-benzoxazine-6- yl )-2-(propoxyimino)ethyll oxy } phenvDacetic acid
Figure imgf000101_0001
5.0 mg of the title compound was obtained in a yield of 25% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 14 mg
(0.050 mmol) of 7-[(lZ)-2-chloro-N-propoxyethaneimidoyl]-2H-l,4-benzoxazine-
3(4H)-one and 8.3 mg (0.050 mmol) of methyl 2-(3-hydroxyphenyl)ethanoate were used.
NMR: 1H-NMR(CDCl3) δ 8.57(1H, s), 7.3O~7.28(1H, m), 7.21~7.19(1H, m), 7.03~6.98(lH, m), 6.93~6.91(1H, m), 6.87~6.84(3H, m), 5.18(2H, s), ), 4.59(2H, s), 4.19(2H, t, J=7Hz), 3.62(2H, s), 1.79-1.70(2H, m), 1.00(3H, t, J=7Hz)
MaSs(EI) 399 (M+-I-I)
EXAMPLE 39: Preparation of (3-ethoxy-5-(r("2EV2-r3-(4-fluorophenylMsoxazol-5-yll- 2-(propoxyimino>)ethylloxy}phenv0acetic acid
Figure imgf000101_0002
10 mg of the title compound was obtained in a yield of 44% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 17 mg (0.050 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 10 mg (0.050 mmol) of methyl (3-ethoxy-5-hydroxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.81~7.79(2H, m), 7.15~7.11(2H, m), 6.9O(1H, s), 6.48~6.44(3H, m), 5.12(2H, s), 4.30(2H, t, J=7Hz), 3.99(2H, q, J=7Hz), 3.57(2H, s), 1.82-1.78(2H, m), 1.38(3H, t, J=7Hz), 0.99(3H, t, J=7Hz)
Mass(EI) 457 (M++l)
EXAMPLE 40: Preparation of (3-{r(2EV2-r3-(4-fluorophenvnisoxazol-5-vn-2- ("propoxyimino)ethyll oxy } -5 -isopropoxyphenyDacetic acid
Figure imgf000102_0001
9.0 mg of the title compound was obtained in a yield of 38% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 17 mg (0.050 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O- propyloxime obtained in PREPARATION l-(2) and 11 mg (0.050 mmol) of methyl (3- hydroxy-5-isoρropyloxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.81~7.79(2H, m), 7.16~7.12(2H, m), 6.9O(1H, s), 6.46~6.42(3H, m), 5.12(2H, s), 4.52~4.47(1H, m), 4.30(2H, t, J=7Hz), 3.56(2H, s), 1.82-1.78(2H, m), 1.31(6H, d, J=7Hz), 0.99(3H, t, J=7Hz)
Mass(EI) 471 (M++l)
EXAMPLE 41: Preparation of sodium (3-{[(2ZV2-(ethoxyiminoV2-(3- phenoxyphenyl)ethyl]oxy}phenyDacetate
50 mg (0.15 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O- ethyloxime obtained in PREPARATION 47 and 25 mg (0.15 mmol) of methyl 3- hydroxyphenylacetate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 1 , and then the product was subjected to prep-HPLC and then lyophilized to obtain 20 mg of the title compound in a yield of 33%.
Figure imgf000103_0001
NMR: 1H-NMR(CDCl3) (Free acid) δ 7.41~7.39(1H, m), 7.37~7.36(1H, m), 7.32~7.27(3H, m), 7.22~7.19(1H, m), 7.09~7.06(lH, m), 6.98~6.96(3H, m), 6.88~6.86(1H, m), 6.82~6.80(2H, m), 5.15(2H, s), 4.28(2H, q, J=7Hz), 3.59(2H, s), 1.33(3H, t, J=7Hz)
Mass(EI) 406 (M++l)
EXAMPLE 42: Preparation of (3-(r(2ZU3-fbenzyloxytohenvH-2- (ethoxyimino)ethyl"loxy 1 phenvDacetic acid
Figure imgf000104_0001
15 mg of the title compound was obtained in a yield of 36% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 35 mg (0.10 mmol) of (lZ)-2-bromo-l-(3-benzyloxyphenyl)ethanone O-ethyloxime obtained in
PREPARATION 46 and 17 mg (0.10 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.39~7.37(2H, m), 7.3~7.32(2H, m), 7.31~7.28(2H, m), 7.21~7.18(2H, m), 7.13~7.1O(1H, m), 6.93~6.91(1H, m), 6.79~6.75(3H, m), 5.09(2H, s), 5.00(2H, s), 4.15(2H, q, J=IUz), 3.47(2H, s), 1.31(3H, t, J=7Hz)
Mass(EI) 420 (M++l)
EXAMPLE 43: Preparation of r3-({(2ZV2-(propoxyimino>2-[3-(4- methoxyphenoxy^phenyliethvUoxytøhenyllacetic acid
Figure imgf000104_0002
70 mg of the title compound was obtained in a yield of 39% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 150 mg (0.40 mmol) of (lZ)-2-bromo-l-[3-(4-methoxyphenoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 36 and 66 mg (0.040 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.36~7.33(1H, m), 7.31~7.29(1H, m), 7.27~7.25(1H, m), 7.25~7.23(1H, m), 7.21~7.19(1H, m), 6.97~6.93(2H, m), 6.92~6.89(1H, m), 6.88~6.84(2H, m), 6.82~6.80(2H, m), 5.14(2H, s), 4.18(2H, t, J=7Hz), 3.79(3H, s), 3.59(2H, s), 1.79-1.70(2H, m), 0.97(3H, t, J=7Hz)
Mass(EI) 450 (M++l)
EXAMPLE 44: Preparation of (3-([(2Z)-2-f3-r4-methoxyphenoxy)phenyl1-2- (propoxyimino)ethylioxylphenvnacetic acid
Figure imgf000105_0001
40 mg of the title compound was obtained in a yield of 28% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 120 mg (0.31 mmol) of (lZ)-2-bromo-l-[3-(4-chlorophenoxy)phenyl]ethanone O-propyloxime and 52 mg (0.31 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.43~7.41(1H, m), 7.34~7.3O(1H, m), 7.32~7.28(1H, m), 7.26~7.25(1H, m), 7.25~7.23(1H, m), 7.23~7.19(1H, m), 6.98~6.95(1H, m), 6.92~6.86(3H, m), 6.81~6.79(2H, m), 5.16(2H, s), 4.19(2H, t, J=7Hz), 3.59(2H5 s), 1.80~1.71(2H, m), 0.98(3H, t, J=7Hz)
Mass(EI) 454 (M++l)
EXAMPLE 45: Preparation of 6-(((2ZV2-fpropoxyiminoV2-r3-f4- methoxyphenoxy)phenyllethvUoxyH -naphthoic acid
Figure imgf000106_0001
45 mg of the title compound was obtained in a yield of 71% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 50 mg (0.13 mmol) of (lZ)-2-bromo-l-[3-(4-methoxyphenoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 36 and 27 mg (0.13 mmol) of 6-hydroxynaphthoic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 8.92(1H, d, J=IOHz), 8.22(1H, d, J=8Hz), 7.94(1H, d, J=8Hz), 7.49(1H, t, J=8Hz), 7.37(1H, d, J=8Hz), 7.29~7.22(3H, m), 7.21-7.18(1H, m), 6.961~6.90(3H, m), 6.82~6.80(2H, m), 5.31(2H, s), 4.25(2H, t, J=8Hz), 3.76(3H, s), 1.84-1.77(2H, m), 1.02(3H, t, J=8Hz)
Mass(EI) 486 (M++l)
EXAMPLE 46: Preparation of r3-ethoxy-5-({(2ZV2-fpropoxyimino>2-r3-(4- methoxyphenoxy^phenyll ethyl 1 oxy)phenyll acetic acid
Figure imgf000107_0001
20 mg of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 30 mg (0.079 mmol) of (lZ)-2-bromo-l-[3-(4-methoxyphenoxy)phenyl]ethanone O-propyloxime obtained in
PREPARATION 36 and 17 mg (0.079 mmol) of methyl (3-ethoxy-5- hydroxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.35-7.33 (IH, m), 7.3O~7.29(1H, m), 7.27~7.23(1H, m), 6.96~6.93(2H, m), 6.92-6.89(1H5 m), 6.87~6.84(2H, m), 6.43-6.42(1 H, m), 6.41~6.4O(1H, m), 6.38-6.37(1H, m), 5.11(2H, s), 4.18(2H, t, J=8Hz), 3.96(2H, q, J=8Hz), 3.79(3H, s), 3.54(2H, s), 1.79-1.71(2H, m), 1.35(3H, t, J=8Hz), 0.97(3H, t, J=8Hz)
Mass(EI) 494 (M++l)
EXAMPLE 47: Preparation of r3-(((2Z>2-(t)ropoxyiminoV2-r3-(4- methoxyphenoxy)phenyll ethyl 1 oxy V 5 -isopropoxyphenyll acetic acid
Figure imgf000108_0001
18 mg of the title compound was obtained in a yield of 45% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 30 mg (0.079 mmol) of (lZ)-2-bromo-l-[3-(4-methoxyphenoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 36 and 18 mg (0.079 mmol) of methyl (3-hydroxy-5- isopropyloxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.35-7.33 (IH, m), 7.3O~7.29(1H, m), 7.25~7.22(1H, m), 6.95~6.91(2H, m), 6.9O~6.87(1H, m), 6.89~6.83(2H, m), 6.43~6.42(1H, m), 6.39~6.37(2H, m), 5.11(2H, s), 4.5O~4.44(1H, m), 4.18(2H, t, J=8Hz), 3.79(3H, s), 3.53(2H, s), 1.79-1.71(2H, m), 1.29(6H, d, J=8Hz), 0.97(3H, t, J=8Hz)
Mass(EI) 508 (M++l)
EXAMPLE 48: Preparation of 2-{r(2EV2-r3-f4-fluorophenvnisoxazol-5-yl1-2- (propoxyimino^ethyli oxy 1 benzoic acid
Figure imgf000108_0002
20 mg of the title compound was obtained in a yield of 69% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 25 mg (0.073 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime obtained in PREPARATION l-(2) and 11 mg (0.073 mmol) of methyl 2-hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 8.18~8.16(1H, m), 7.86~7.79(2H, m), 7.61~7.54(1H, m), 7.22~7.00(4H, m), 6.98(1H, s), 5.39(2H, s), 4.34(2H, t, J=8Hz), 1.86~1.77(2H, m), 0.99(3H, t, J=8Hz)
Mass (EI) 399 (M++l)
EXAMPLE 49: Preparation of 3-{[(2ZV2-r3-(hexyloxy)phenvn-2- (propoxyimino^ethylioxylbenzoic acid
Figure imgf000109_0001
10 mg of the title compound was obtained in a yield of 43% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 20 mg (0.056 mmol) of (lZ)-2-bromo-l-[3-(hexyloxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 38 and 8.5 mg (0.056 mmol) of methyl 3-hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.71~7.69(1H, m), 7.68~7.66(1H, m), 7.35~7.32(1H, m), 7.24~7.21(3H, m), 7.15~7.13(1H, m), 6.89~6.75(1H, m), 5.25(2H, s), 4.23(2H, t, J=8Hz), 3.94(2H, t, J=8Hz), 1.83~1.73(4H, m), 1.45~1.41(2H, m), 1.33~1.30(4H, m), 0.99(3H, t, J=8Hz), 0.89(3H, t, J=8Hz)
Mass (EI) 414 (M++l)
EXAMPLE 50: Preparation of r3-(r(2Z)-2-r3-(hexyloxy>)phenyll-2- (propoxyiminotethylioxy I acetic acid
Figure imgf000110_0001
12 mg of the title compound was obtained in a yield of 50% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 20 mg (0.056 mmol) of (lZ)-2-bromo-l-[3-(hexyloxy)phenyl]ethanone O-propyloxime obtained in
PREPARATION 38 and 9.3 mg (0.056 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.24-7.18(4H, m), 6.89~6.84(4H, m), 5.16(2H, s), 4.20(2H, t, J=8Hz), 3.94(2H, t, J=8Hz), 3.59(2H, s), 1.79~1.73(2H, m), 1.74-1.65(2H, m), 1.45-1.40(2H, m), 1.34~1.29(4H, m), 0.98(3H, t, J=8Hz), 0.89(3H, t, J=8Hz)
Mass (EI) 428 (M++l)
EXAMPLE 51: Preparation of l-((2Z)-2-r3-(hexyloxy>phenyll-2- (propoxyimino*)ethyl }-l H-indol-3 -carboxylic acid
Figure imgf000111_0001
10 mg of the title compound in a yield of 41% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 20 mg (0.056 tnmol) of (lZ)-2- bromo-l-[3-(hexyloxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 38 and 9.8 mg (0.056 mmol) of 1 H-indol-3 -carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.19~8.17(1H, m), 7.86(1H, s), 7.43~7.41(1H, m), 7.28~7.25(2H, m), 7.21~7.18(1H, m), 7.05~7.03(lH, m), 7.01~6.99(lH, m), 6.86~6.84(1H, m), 5.36(2H, s), 4.26(2H, t, J=8Hz), 3.81(2H, t, J=8Hz), 1.81-1.75(2H, m), 1.74~1.65(2H, m), 1.42-1.35(2H, m), 1.34~1.25(4H, m), 0.97(3H9 t, J=8Hz), 0.88(3H, t, J=8Hz)
Mass (EI) 437 (M+H-I)
EXAMPLE 52: Preparation of (2-([αEV2-r3-(4-fluorophenvnisoxazol-5-yl1-2- (propoxyimino)ethvn oxy > phenvDacetic acid
Figure imgf000111_0002
28 mg of the title compound was obtained in a yield of 68% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 34 mg (0.10 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime obtained in PREPARATION l-(2) and 17 mg (0.10 mmol) of methyl 2-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.80~7.76(2H, m), 7.29~7.25(1H, m), 7.18(1H, d, J=6Hz), 7.05(2H5 t, J=6Hz), 6.98~6.96(2H, m), 6.9O(1H, s), 5.18(2H, s), 4.28(2H, t, J=7Hz, 3.61(2H, s), 1.84~1.76(2H, m), 0.97(3H, t, J=7Hz)
Mass (EI) 413 (M++l)
EXAMPLE 53: Preparation of (2-{r(2ZV2-r3-(4-methoxyphenoxy)phenyll-2- (propoxyiminotethyπoxylphenvDacetic acid
Figure imgf000112_0001
10 mg of the title compound was obtained in a yield of 46% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 18 mg (0.048 mmol) of (lZ)-2-bromo-l-[3-(4-methoxyphenoxy)phenyl]ethanone O-propyloxime obtained in
PREPARATION 36 and 7.9 mg (0.048 mmol) of methyl 2-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.29~7.18(4H, m), 7.12(1H, d, J=6Hz), 6.96~6.90(4H, m), 6.87~6.82(3H, m), 5.19(2H, s), 4.16(2H, t, J=7Hz), 3.78(3H, s), 3.47(2H, s), 1.78-1.71(2H, m), 0.96(3H, t, J=7Hz)
Mass (EI) 450 (M++l)
EXAMPLE 54: Preparation of l-rf2ZV2-(3-nitrophenvn-2-(propoxyiminotethyll-lH- indol-3-carboxylic acid
Figure imgf000113_0001
79 mg of the title compound was obtained in a yield of 75% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 90 mg (0.30 mmol) of (lZ)-2- bromo-l-(3-nitrophenyl)ethanone O-propyloxime obtained in PREPARATION 40 and 52 mg (0.30 mmol) of lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.44(1H, s), 8.17~8.15(2H, m), 7.84(1H, s), 7.74~7.7O(1H, m), 7.45~7.38(2H, m), 7.32~7.28(2H, m), 5.44(2H, s), 4.32(2H, t, J=IUz), 1.84-1.79(2H, m), 0.99(3H, t, J=IUz)
MaSs (EI) SSl (M++!)
PREPARATION 52: Preparation of methyl 3-{2-r3-(hexyloxy)phenyll-2-oxoethoxyl-5- isopropoxybenzoate 40 mg of the title compound was obtained in a yield of 93% in the same manner as in PREPARATION 2, except that 30 mg (0.10 mmol) of 2-bromo-l-[3- (hexyloxy)phenyl]ethanone and 21 mg (0.10 mmol) of 3-hydroxy-5- isopropoxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.53(1H, d, J=8Hz), 7.49(1H, s), 7.38(1H, t, J=8Hz), 7.21(1H, s), 7.16~7.14(2H, m), 6.71(1H, t, J=3Hz), 5.29(2H, s), 4.6O~4.54(1H, m), 3.99(2H, t, J=6Hz), 3.88(3H, s), 1.83~1.78(2H, m), 1.49~1.44(2H, m), 1.34-1.30(1 OH, m), 0.89(3H, t, J=7Hz)
Mass (EI) 429 (M++!)
EXAMPLE 55: Preparation of 3-(f(2ZV2-f3-(hexyloxy)phenyll-2- (propoxylimino'jethynoxy} -5-isopropoxybenzoic acid
Figure imgf000114_0001
10 mg of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 23-(2) and EXAMPLE 1, except that 15 mg (0.035 mmol) of methyl 3-{2-[3-(hexyloxy)phenyl]-2-oxoethoxy}-5-isopropoxybenzoate obtained in PREPARATION 52 was used.
NMR: 1H-NMR(CDCl3) δ 7.30~7.12(5H, m), 6.91~6.88(1H, m), 6.68(1H, t, J=3Hz), 5.21(2H, s), 4.57~4.52(1H, m), 4.21(2H, t, J=7Hz), 3.93(2H, t, J=7Hz), 1.84~1.71(4H, m), 1.46-1.42(2H, m), 1.34-1.31(1 OH, m), 0.98(3H, t, J=7Hz), 0.88(3H, t, J=7Hz)
Mass (EI) 472 (M++l)
EXAMPLE 56: Preparation of 3-({(2ZV2-r3-(hexyloxy)phenvn-2-IT2- hvdroxyethoxy)imino1 ethyl 1 oxy)-5 -isopropoxybenzoic acid
Figure imgf000115_0001
5.0 mg of the title compound was obtained in a yield of 30% in the same manner as in PREPARATION 23-(2) and EXAMPLE 1, except that 15 mg (0.035 mmol) of methyl 3-{2-[3-(hexyloxy)phenyl]-2-oxoethoxy}-5-isopropoxybenzoate obtained in PREPARATION 52 and 4.4 mg (0.039 mmol) of (2-hydroxyethyl)amine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 7.31~7.20(5H, m), 6.92~6.89(1H, m), 6.7O~6.67(1H, m), 5.27(2H, s), 4.57~4.53(1H, m), 4.43~4.41(2H, m), 4.02~4.00(2H, m), 3.96~3.91(2H, m), 1.80-1.73(2H, m), 1.46-1.43(2H, m), 1.36-1.31(10H5 m), 0.88(3H, t, J=7Hz)
Mass (EI) 474 (M++l)
EXAMPLE 57: Preparation of l-r(2ZV2-fethoxyiminoV2-(3-phenoxyphenyltethyll-lH- indol-3-carboxylic acid
Figure imgf000116_0001
32 mg of the title compound was obtained in a yield of 39% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 67 mg (0.20 mmol) of (lZ)-2- bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in PREPARATION 47 and 35 mg (0.20 mmol) of lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.18~8.16(1H, m), 7.82(1H, s), 7.35~7.23(5H, m), 7.19~7.08(3H, m), 6.95~6.82(4H, m), 5.34(2H, s), 4.33(2H, q, J=7Hz), 1.35(3H, t, J=7Hz)
Mass (EI) 415 (M++l)
EXAMPLE 58: Preparation of sodium 3-(r(2ZV2-(3-r(butylsulfonvnoxy1phenvn-2- (propoxyimino')ethyl'|oxy)-5-isopropoxybenzoate
78 mg (0.20 mmol) of 3-[(lZ)-2-bromo-N-propoxyethaneimidoyl]phenyl butane-1-sulfonate obtained in PREPARATION 39 and 42 mg (0.20 mmol) of methyl 3- hydroxy-5-isopropoxybenzoate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 1, then the product was subjected to prep-HPLC and lyophilized to obtain 9 mg of the title compound in a yield of 50%.
Figure imgf000117_0001
NMR: 1H-NMR(CDCl3) free acid form δ 7.64~7.39(2H, m), 7.37(1 H, t, J=8Hz), 7.28~7.21(3H, m), 6.68(1H, s), 5.22(2H, s), 4.58~4.52(1H, m), 4.22(2H, t, J=7Hz), 3.24~3.21(2H, m), 1.98~1.92(2H, m), 1.84~1.78(2H, m), 1.53~1.46(2H, m), 1.31(6H, d, J=7Hz), 1.29-1.22(2H, m), 1.02~0.92(6H, m)
Mass (EI) 508 (M++l)
EXAMPLE 59: Preparation of l-U2ZV2-(3-phenoxyphenylV2-(propoxyiminoVlH- indol-3-carboxylic acid
Figure imgf000117_0002
25 mg of the title compound was obtained in a yield of 42% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 50 mg (0.14 mmol) of (lZ)-2- bromo-l-(3-phenoxyphenyl)ethanone O-propyloxime obtained in PREPARATION 23 and 25 mg (0.14 mmol) of lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.18~8.16(1H, m), 7.81(1H, s), 7.36~7.22(5H, m), 7.19~7.15(2H, m), 7.08(1H, t, J=8Hz), 7.04~6.82(4H, m), 5.34(2H, s), 4.24(2H, t, J=7Hz), 1.78-1.74(2H, m), 0.95(3H, t, J=7Hz)
Mass (EI) 429 (M++l)
PREPARATION 53: Preparation of methyl l-IY2ZV2-(3-nitrophenylV2- (propoxyimino)ethyl] - 1 H-indol-3 -carboxylate
85 mg of the title compound was obtained in a yield of 72% in the same manner as in PREPARATION 2, except that 90 mg (0.30 mmol) of (lZ)-2-bromo-l-(3- nitrophenyl)ethanone O-propyloxime obtained in PREPARATION 40 and 952 mg (0.30 mmol) of 1 H-indol-3 -carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.42(1H, t, J=2Hz), 8.15~8.12(2H, m), 7.75(1H, s), 7.71~7.68(1H, m), 7.45~7.37(2H, m), 7.30~7.26(3H, m), 5.43(2H, s), 4.32(2H, t, J=7Hz), 3.87(3H, s), 1.87~1.78(2H, m), 1.00(3H, t, J=7Hz)
Mass (EI) 396 (M++!)
PREPARATION 54: Preparation of methyl l-{(2ZV2-r3-famino)phenyl1-2- (propoxyimino)ethyl } - 1 H-indol-3 -carboxylate
68 mg of the title compound was obtained in a yield of ~100% by reducing nitro group in the same manner as in Sours, A. J.; Bioorg. Med. Chem. Lett. 2005, 15(11), 2752-2757, except that 73 mg (0.19 mmol) of methyl l-[(2Z)-2-(3-nitrophenyl)- 2-(propoxyimino)ethyl]-lH-indol-3-carboxylate was used. NMR: 1H-NMR(CDCl3) δ 8.14~8.12(1H, m), 7.76(1H, s), 7.42~7.39(1H, m), 7.28~7.24(2H, m), 7.06(1H, t, J=8Hz), 6.86~6.82(2H, m), 6.65~6.63(1H, m), 5.30(2H, s), 4.22(2H, t, J=7Hz), 3.86(3H, s), 1.80-1.75(2H, m), 0.94(3H, t, J=7Hz)
Mass (EI) 366 (M++l)
EXAMPLE 60: Preparation of l-(f2ZV2-{3-[fmethylsulfonvDaminolρhenvU-2- (propoxyiminokthyl } - 1 H-indol-3 -carboxylic acid
Figure imgf000119_0001
20 mg of the title compound was obtained in a yield of 60% in the same manner as in PREPARATION 40-(l) and EXAMPLE 2, except that 28 mg (0.077 mmol) of methyl l-{(2Z)-2-[3-(amino)phenylJ-2-(propoxyimino)ethyl}-l H-indol-3 -carboxylate obtained in PREPARATION 54 and 8.8 mg (0.077 mmol) of methanesulfonylchloride were used.
NMR: 1H-NMR(CDCl3) δ 8.10(1H, d, J=7Hz), 7.9O(1H, s), 7.53~7.00(5H, m), 6.64~6.56(1H, m), 5.43(2H, s), 4.29(2H, t, J=7Hz), 2.80(3H, s), 1.84~1.81(2H, m), 0.95(3H, t, J=7Hz)
Mass (EI) 430 (M++l) EXAMPLE 61: Preparation of l-r(2ZV2-O-(r(4-chlorophenylWlfonyllammolphenvn- 2-(propoxyimino)ethyl1-lH-indol-3-carboxylic acid
Figure imgf000120_0001
25 mg of the title compound was obtained in a yield of 86% in the same manner as in PREPARATION 40-(l) and EXAMPLE 2, except that 20 mg (0.055 mmol) of methyl l-{(2Z)-2-[3-(amino)phenyl]-2-(propoxyimino)ethyl}-lH-indol-3-carboxylate obtained in PREPARATION 54 and 14 mg (0.066 mmol) of 4- chlorobenzensulfonylchlori.de were used.
NMR: 1H-NMR(CDCl3) δ 8.15~8.14(1H, m), 7.85(1H, s), 7.50~7.45(2H, m), 7.39~7.35(1H, m), 7.30~7.23(3H, m), 7.16~7.10(2H, m), 7.04(1H, s), 6.99~6.94(1H, m), 5.35(2H, s), 4.25(2H, t, J=7Hz), 1.80-1.75(2H, m), 0.97(3H, t, J=7Hz)
Mass (EI) 527 (M++l)
EXAMPLE 62: Preparation of l-{(2ZV2-(propoxyiminoV2-r3- (trifluoromethoxy)phenyli ethyl 1-1 H-indol-3 -carboxylic acid
Figure imgf000120_0002
55 mg of the title compound was obtained in a yield of 45% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 100 mg (0.29 mmol) of (lZ)-2- bromo-l-[3-(trifluoromethoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 44 and 52 mg (0.29 mmol) of lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.18~8.17(1H. m), 7.83(1H, s), 7.43~7.27(5H, m), 7.19~7.13(2H, m), 5.37(2H, s), 4.28(2H, t, J=7Hz), 1.84~1.75(2H, m), 0.93(3H, t, J=7Hz)
Mass (EI) 421 (M++l)
EXAMPLE 63: Preparation of l-r(2ZV2-(ethoxyimmoV2-f3-phenoxyphenyr)ethyl"l-5- methoxy- 1 H-indol-3 -carboxylic acid
Figure imgf000121_0001
55 mg of the title compound was obtained in a yield of 56% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 73 mg (0.22 mmol) of (1Z>2- bromo-l-(3-phenoxyphenyl)ethanone O-propyloxime obtained in PREPARATION 23 and 45 mg (0.22 mmol) of ethyl 5 -methoxy- 1 H-indol-3 -carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 7.75(1H, s), 7.63(1H, s), 7.33~7.22(4H, m), 7.17~7.07(2H, m), 6.96~6.85(5H, m), 5.30(2H, s), 4.32(2H, q, J=7Hz), 3.07(3H, s), 1.34(3H, t, J=7Hz)
Mass (EI) 445 (M++l) EXAMPLE 64: Preparation of r3-((r2ZV2-(propoxviminoV2-r4-
(trifluoromethyπphenyliethvUoxytohenyliacetic acid
Figure imgf000122_0001
135 mg of the title compound was obtained in a yield of 66% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 170 mg (0.52 mmol) of (lZ)-2-bromo-l-[4-(trifluoromethyl)phenyl]ethanone O-propyloxime and 89 mg (0.52 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.78(2H, d), 7.58(2H, d), 7.21(1H, m), 6.87(1H, d), 6.83(2H, s), 5.21(2H, s), 4.22(2H, t, J=7Hz), 3.59(2H, s, J=7Hz), 1.76(2H, J=7Hz), 1.00(3H, t, J=7Hz)
Mass (EI) 396 (M++l)
EXAMPLE 65: Preparation of O-W2ZV2-{3-{(butylsulfonvnoxylphenvU-2- (propoxyimino)ethyll oxy } phenvDacetic acid
Figure imgf000122_0002
90 mg of the title compound was obtained in a yield of 39% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 196 mg (0.50 mmol) of 3-[(lZ)-2-bromo-N-propoxyethaneimidoyl]phenyl butane- 1 -sulfonate obtained in
PREPARATION 39 and 83 mg (0.50 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.60(2H, m), 7.36(1H, t), 7.25(1H, d), 7.21(1H, t), 6.87(1H, d), 6.82(2H, d), 5.18(2H, s), 4.22(2H, t), 3.60(2H, s), 3.21(2H, m), 1.95(2H, m), 1.77(2H, m), 1.49(2H, m), 0.99(6H, m)
Mass (EI) 464 (M++l)
EXAMPLE 66: Preparation of sodium 5-chloro-l-[(2Z>2-fethoxyiminoV2-(3- phenoxyphenvDethyll - 1 H-indol-3 -carboxylate
Figure imgf000123_0001
134 mg (0.40 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O- ethyloxime obtained in PREPARATION 47 and 90 mg (0.40 mmol) of ethyl 5-chloro- lH-indol-3-carboxylate were subjected to hydrolization in the same manner as in
PREPARATION 2 and EXAMPLE 2, then the product was subjected to prep-HPLC and lyophilized to obtain 65 mg of the title compound in a yield of 35%.
NMR: 1H-NMR(CD3OD) δ 8.16(1H, d), 7.64(1H, s), 7.29-7.23(1H, m), 7.21(1H, d), 7.05-7.01(2H, m), 6.86(1H, m), 6.77(1H, d), 5.42(2H, s), 4.32(2H, q, J=7Hz), 1.34(3H, t, J=7Hz)
Mass (EI) 449 (M++!)
EXAMPLE 67: Preparation of sodium 5-fluoro-l-((2ZV2-(propoxyiminoV2-r4- (trifluoromethyPphenyll ethyl 1-1 H-indol-3 -carboxylate
Figure imgf000124_0001
170 mg (0.52 mmol) of (lZ)-2-bromo-l-[4-(trifluoromethyl)phenyl]ethanone
O-propyloxime and 104 mg (0.50 mmol) of ethyl 5 -fluoro-1 H-indol-3 -carboxylate were subjected to hydrolization to in the same manner as in PREPARATION 2 and
EXAMPLE 2, then the product was subjected to prep-HPLC and lyophilized to obtain
60 mg of the title compound in a yield of 26%.
NMR: 1H-NMR(CD3OD) δ 7.8O(1H, d), 7.69(1H, s), 7.66(2H, d), 7.53(2H5 d), 7.3O(1H, m), 6.87(1H, m), 5.52(2H, s), 4.29(2H, t, J=7Hz), 1.81(2H, m, J=7Hz), 1.00(3H, t, J=7Hz)
Mass (EI) 423 (M++l)
EXAMPLE 68: Preparation of sodium 5-chloro-l-{(2ZV2-(propoxyiminoV2-r4- (trifluoromethvDphenvH ethyl } - 1 H-indol-3 -carboxylate
Figure imgf000125_0001
170 mg (0.52 mmol) of (lZ)-2-bromo-l-[4-(trifluoromethyl)phenyl]ethanone
O-propyloxime and 112 mg (0.50 mmol) of ethyl 5 -chloro-1 H-indol-3 -carboxylate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE
2, then the product was subjected to prep-HPLC and lyophilized to obtain 65 mg of the title compound in a yield of 27%
NMR: 1H-NMR(CD3OD) δ 8.16(1H, d), 7.67(3H, m), 7.54(2H, d), 7.32(1H, d), 7.08(1H, m), 5.52(2H, s), 4.28(2H, t, J=7Hz), 1.81(2H, m, J=7Hz), 1.00(3H, t, J=7Hz)
Mass (EI) 439 (M++l)
EXAMPLE 69: Preparation of l-r(2Zy2-α.4-difluorophenyl>2-φropoxyimino)enyl1- 1 H-indol-3 -carboxylic acid
Figure imgf000125_0002
50 mg of the title compound was obtained in a yield of 67% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 49 mg (0.20 mmol) of (1ZV2- chloro-l-(3-phenoxyphenyl)ethanone O-ethyloxime and 35 mg (0.20 mmol) of methyl lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.15(1H, d), 7.72(1H, s), 7.46(1H, m), 7.27(2H, m), 7.14(1H, m), 6.77(1H, m), 6.67(1H, m), 5.15(2H, s), 4.28(2H, t, J=7Hz), 1.83(2H, m, J=7Hz), 1.03(3H, t, J=7Hz)
Mass (EI) 373 (M++l)
EXAMPLE 70: Preparation of l-r(2ZV2-α.4-difluorophenylV2-rpropoxyimino)enyl]- 5-trifluoromethoxy- 1 H-indol-3 -carboxylic acid
Figure imgf000126_0001
15 mg of the title compound was obtained in a yield of 33% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 25 mg (0.10 mmol) of (lZ)-2- chloro-l-(3-phenoxyphenyl)ethanone O-ethyloxime and 27 mg (0.10 mmol) of methyl 5-trifluoromethoxy-lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 8.03(1H, d), 7.8O(1H, s), 7.47(1H, d), 7.24(1H, m), 7.18(1H, m), 6.83(1H, m), 6.75(1H, m), 5.16(2H, s), 4.29(2H, t, J=7Hz), 1.84(2H, m, J=7Hz), 1.01(3H, t, J=7Hz)
Mass (EI) 457 (M++l) EXAMPLE 71: Preparation of sodium 5-fluoro-l-rf2Z>2-r(2-fluoroethoxy)imino"l-2-C3- phenoxyphenvDethyll - 1 H-indol-3 -carboxylate
Figure imgf000127_0001
100 mg (0.284 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-(2- fluoroethyl)oxime and 59 mg (0.284 mmol) of ethyl S-chloro-lH-indol-S-carboxylate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 2, then the product was subjected to prep-HPLC and lyophilized to obtain 70 mg of the title compound in a yield of 52%.
NMR: 1H-NMR(CD3OD) δ 7.82(1H, d), 7.66(1H, s), 7.29-7.26(3H, m), 7.19(2H, m), 7.05(1H, t), 7.01(1H, s), 6.85(2H, m), 6.77(2H, d), 5.48(2H, s), 4.76(1H, t), 4.66(1H, t), 4.53(1H, t), 4.47(1H, t)
Mass (EI) 451 (M++l)
EXAMPLE 72: Preparation of sodium 5-fluoro-l-r(2ZVf2-methoxyimino)-2-(3- phenoxyphenyltethyli-lH-indol-S-carboxylate
Figure imgf000127_0002
100 mg (0.312 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O- methyloxime and 65 mg (0.312 mmol) of ethyl S-chloro-lH-indoW-carboxylate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 2, then the product was subjected to prep-HPLC and lyophilized to obtain 70 mg of the title compound in a yield of 51%.
NMR: 1H-NMR(CD3OD) δ 7.82(1H, d), 7.65(1H, s), 7.28(2H, m), 7.23-7.18(3H, m), 7.05(1H, t), 7.01(1H, s), 6.85(2H, m), 6.78(2H, d), 5.41(2H, s), 4.06(2H, s)
Mass (EI) 419 (M++l)
EXAMPLE 73: Preparation of sodium (l-r(2Z)-(3-phenoxyphenylV2- (propoxyiminotethyli-lH-indol-S-yU acetate
Figure imgf000128_0001
174 mg (0.50 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O- propyloxime obtained in PREPARATION 23 and 95 mg (0.50 mmol) of methyl (IH- indol-3-yl)acetate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 2, then the product was subjected to prep-HPLC and lyophilized to obtain 90 mg of the title compound in a yield of 39%.
NMR: 1H-NMR(CD3OD) δ 7.55(1H, d), 7.27(2H, m), 7.23-7.18(3H, m), 7.07-7.01(3H, m), 6.99(1H, s), 6.95(1H, t), 6.85(1H, m), 6.79(2H, m), 5.36(2H, s), 4.21(2H, t, J=7Hz), 3.47(2H, s), 1.77(2H, m, J=7Hz), 0.99(3H51, J=7Hz)
Mass (EI) 443 (M++l)
EXAMPLE 74: Preparation of [3-(((2ZV2-(DropoxyiminoV2-r3- (trifluoromethvDphenyliethyl } oxytohenyliacetic acid
Figure imgf000129_0001
25 mg of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 34 mg (0.10 mmol) of (lZ)-2-bromo-l-[3-(trifluoromethoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 44 and 18 mg (0.11 mmol) of methyl 3-hydroxyphenylacetate were used.
NMR: 1H-NMR(CDCl3) δ 7.58(2H, m), 7.34(1H, t), 7.19(2H, m), 6.88(1H, d), 6.82(2H, m), 5.18(2H, s), 4.21(2H, t, J=7Hz), 3.59(2H, s), 1.76(2H, m, J=7Hz), 0.99(3H, t, J=7Hz)
Mass (EI) 412 (M++l)
EXAMPLE 75: Preparation of 5-fluoro-l-{(2ZV2-[(2-fluoroethoxy)iminol-2-r3- (trifluoromethoxy)phenyllethvU - 1 H-indol-3-carboxylic acid
Figure imgf000130_0001
95 mg of the title compound was obtained in a yield of 59% in the same manner as in PREPARATION 2 and EXAMPLE 2, except that 100 mg (0.365 mmol) of (lZ)-2- bromo-l-[3-(trifluoromethoxy)phenyl]ethanone O-(2-fluoroethyl)oxime obtained in PREPARATION 44 and 76 mg (0.365 mmol) of ethyl S-chloro-lH-indolO-carboxylate were used.
NMR: 1H-NMR(CDCl3) δ 7.84(1H, s), 7.81(1H, s), 7.36(1H, m), 7.34-7.29(3H, m), 7.2O(1H, d), 7.03(1H, m), 5.41(2H, s), 4.78(1H, t), 4.69(1H, t), 4.61(1H5 1), 4.55(1H, t)
Mass (EI) 443 (M++l)
EXAMPLE 76: Preparation of sodium d-((2ZV2-φropoxyiminoV2-r3- (trifluoromethoχy)phenyliethyl 1-1 H-indol-3 - vDacetate
Figure imgf000130_0002
170 mg (0.50 mmol) of (lZ)-2-bromo-l-[3-(trifluoromethoxy)phenyl]ethanone O-propyloxime obtained in PREPARATION 44 and 95 mg (0.50 mmol) of methyl (IH- indol-3-yl)acetate were subjected to hydrolization in the same manner as in
PREPARATION 2 and EXAMPLE 1, then the product was seperated and purified using HPLC and lyophilized to obtain 80 mg of the title compound in a yield of 35%.
NMR: 1H-NMR(CD3OD) δ 7.53(1H, d), 7.39(2H, m), 7.30-7.27(2H, m), 7.14(1H, d), 7.04(2H, m), 6.95(1H, t), 5.42(2H, s), 4.27(2H, t, J=7Hz), 3.47(2H, s), 1.80(2H, m, J=7Hz), 1.02(3H, t, J=7Hz)
Mass (EI) 435 (M++l)
EXAMPLE 77: Preparation of f3-etfaoxy-5-(r(2ZV2-f3-phenoxyphenylV2- (propoxyiminotethylioxyl phenvDacetic acid
Figure imgf000131_0001
15 mg of the title compound was obtained in a yield of 65% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 17 mg (0.050 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-propyloxime obtained in PREPARATION 23 and 11 mg (0.050 mmol) of methyl (3-ethoxy-5- hydroxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.35(2H, m), 7.31-7.25(3H, m), 7.07(1H, t), 6.97(3H, d), 6.42-6.36(3H, m), 5.12(2H, s), 4.19(2H, t, J=7Hz), 1.75(2H, m, J=7Hz), 0.98(3H5 t, J=7Hz)
Mass (EI) 464 (M++l) EXAMPLE 78: Preparation of sodium 5-fluoro-l-{(2ZV(2-methoxyimino>2-r3- (trifluoromethoxy)phenyl1 ethyl ) - 1 H-indol-3 -carboxylate
Figure imgf000132_0001
94 mg (0.30 mmol) of (lZ)-2-bromo-l-[3-(trifluoromethoxy)phenyl]ethanone
O-methyloxime obtained in PREPARATION 43 and 82 mg (0.30 mmol) of ethyl 5- chloro-1 H-indol-3 -carboxylate were subjected to hydrolization in the same manner as in PREPARATION 2 and EXAMPLE 2, then the product was seperated and purified using HPLC and lyophilized to obtain 80 mg of the title compound in a yield of 62%.
NMR: 1H-NMR(CD3OD) δ 7.8O(1H, d), 7.69(1H, s), 7.42(1H, m), 7.39(1H, s), 7.31(2H, m), 7.16(1H, d), 6.88(1H, m), 5.48(2H, s), 4.12(2H, s)
Mass (EI) 411 (M++!)
EXAMPLE 79: Preparation of 4-isopropoxy-2-(2-(3-phenoxyphenylV2-r(ZV
propoxyiminol-ethoxyl -benzoic acid
Figure imgf000132_0002
20 mg of the title compound was obtained in a yield of 39% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 40 mg (0.11 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanon O-propyloxime and 24 mg (0.11 mmol) of 2- hydroxy-4-isopropoxybenzoic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.38~7.28(5H, m), 7.02~6.98(4H, m), 6.57~6.62(3H, m), 5.32(2H, s), 4.61~4.58(1H, m), 4.23~4.21(2H, m), 1.78-1.74(2H, m), 1.37-1.35(6H, m), 0.98~0.95(3H, m)
Mass(EI) 464 (M++l)
EXAMPLE 80: Preparation of {3-isopropoxy-5-[2-[(ZVmethoxyiminol-2-(3- phenoxyphenvD-ethoxyl-phenvU-acetic acid
Figure imgf000133_0001
60 mg of the title compound was obtained in a yield of 56% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 80 mg (0.24 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanon O-methyloxime and 54 mg (0.24 mmol) of (3-hydroxy-5-isopropoxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.40~7.36(2H, m), 7.33~7.28(3H, m), 7.06(1H, t, 7Hz), 7.00~6.96(3H, m), 6.42~6.35(3H, m), 5.10(2H, s), 4.49~4.43(1H, m), 4.02(3H, s), 3.53(2H, s), 1.29(6H, d, J=6Hz) Mass(EI) 450 (M++l)
EXAMPLE 81: Preparation of {3-[2-[(ZVmethoxyimino1-2-(3-phenoxyphenylV ethoxyi-phenyll-acetic acid
Figure imgf000134_0001
70 mg of the title compound was obtained in a yield of 58% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.31 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanon O-methyloxime and 52 mg (0.31 mmol) of (3-hydroxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.41~7.39(1H, m), 7.36~7.34(1H, m), 7.33~7.27(3H, m), 7.19(1H5 t, J=7Hz), 7.06(1H, t, J=7Hz), 7.00~6.95(3H, m), 6.86(1H, d, J=7Hz), 6.80~6.78(2H, m), 5.13(2H, s), 4.02(3H, s), 3.59(2H, s)
Mass(EI) 392 (M++l)
PREPARATION 55: Preparation of 5-(2-r3-(4-fluorophenylVisoxazol-5-vπ-2-r(E> propoxyiminoi-ethoxyl-isophthalic acid monomethyl ester
135 mg of 5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)-propoxyimino]- ethoxy}-isophthalic acid dimethyl ester was obtained in a yield of 99% in the same manner as in PREPARATION 2, except that 100 mg (0.29 mmol) of 2-bromo-l-[3-(4- fluorophenyl)-isoxazol-5-yl]-ethanon O-propyloxime and 62 mg (0.29 mmol) of 5- hydroxyisophthalic acid dimethyl ester was used. Then, 16 mg (0.29 mmol) of potassiumhydroxide, 2 mL of tetrahydrofuran, and 2 mL of methanol were added to 135 mg (0.29 mmol) of ester obtained, followed by refluxing for 12 hours. The pH of the resulting solution was adjusted to neutrality by adding IN HCl, followed by removal of solvent under reduced pressure. To the reacton solution, ethyl acetate was added, followed by washing with IN HCl. An organic layer was dried over anhydrous magnesium sulfate, and filtered off, followed by removing the solvent under reduced pressure. 120 mg of the title compound was obtained using column chromatography in a yield of 91%.
NMR: 1H-NMR(CDCl3) . 8.38(1H, s), 7.93(1H, s), 7.88(1H, s), 7.84~7.80(2H, m), 7.37(1H, s), 7.18~7.12(2H, m), 5.27(2H, s), 4.36~4.32(2H, m), 3.94(3H, s), 1.87~1.82(2H, m), 1.04~0.99(3H, m)
Mass(EI) 457 (M++l)
PREPARATION 56: Preparation of 3-{2-[3-r4-fluorophenylVisoxazol-5-yll-2-r(EV propoxyiminol-ethoxy}-5-(3-methyl-[L2,4]oxadiazol-5-yπ-benzoic acid methyl ester
50 mg (0.11 mmol) of 5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)- propoxyimino]-ethoxy}-isophthalic acid monomethyl ester obtained in PREPARATION 55, 18 mg (0.11 mmol) of l,l'-carbonyldiimidazole, and 9 mg (0.12 mmol) of N- hydroxy-acetamidine were dissolved in dimethylformamide solvent, followed by stirring for 5 hours at room temperature. After addition of water, the resulting solution was extracted with ethyl acetate. 25 mg of the title compound was obtained using column chromatography in a yield of 46%.
NMR: 1H-NMR(CDCl3) δ 8.4O(1H, s), 7.92~7.80(4H, m), 7.37(1H, s), 7.18~7.12(2H, m), 5.29~5.17(2H, m), 4.36~4.31(2H, m), 3.93(3H, s), 2.48(3H, s), 1.86~1.78(2H, m), 1.04~0.98(3H, m)
Mass(EI) 495 (M++l)
EXAMPLE 82: Preparation of 3-{2-[3-(4-fluorophenvn-isoxazol-5-yll-2-r(EV propoxyiminol-ethoxy} -5 -(3 -methyl- F 1 ,2,41oxadiazol-5-ylVbenzoic acid
Figure imgf000136_0001
15 mg of the title compound was obtained in a yield of 61% in the same manner as in EXAMPLE 1, except that 25 mg (0.051 mmol) of 3-{2-[3-(4-fluoroρhenyl)- isoxazol-5-yl]-2-[(E)-propoxyimino]-ethoxy}-5-(3-methyl-[l,2,4]oxadiazol-5-yl)- benzoic acid methyl ester obtained in PREPARATION 56 was used.
NMR: 1H-NMR(CDCl3) δ 8.49(1H, s), 8.05~7.81(4H, m), 7.20~7.12(2H, m), 6.92(1H, s), 5.30~5.23(2H, m), 4.38~4.32(2H, m), 2.49(3H, s), 1.86-1.83(2H, m), 1.01~0.99(3H, m) Mass(EI) 481 (M++l)
PREPARATION 57: Preparation of 5-{2-r3-(4-fluorophenviyisoxazol-5-yll-2-IΪE> propoxyimino]-ethoxyl-N-(2-oxopropyl)-isophthalamic acid methyl ester
70 mg (0.15 mmol) of 5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)- propoxyimino]-ethoxy}-isophthalic acid monomethyl ester obtained in PREPARATION 55, 14 mg (0.19 mmol) of l-aminopropane-2-ol, 44 mg (0.23 mmol) of N-(3- dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride, and 35 mg (0.26 mmol) of 1-hydroxybenzotriazole hydrate were dissolved in dimethylformamide, followed by addition of 19 mg (0.19 mmol) of triethylamine. After stirring for 12 hours at room temperature, water and ethyl acetate was added thereto, and an organic layer was washed with water and brine. The organic layer obtained was dried over anhydrous magnesium sulfate, and filtered off to remove the solvent under reduced pressure. 161 mg (0.38 mmol) of Dess-Martin periodinane was added to the amide compound without any further purification, and then stirred using methylene chloride as a solvent for 2 hours at room temperature. To the resulting solution, water and methylene chloride was added, and an organic layer was washed with water and brine. The organic layer obtained was dried over anhydrous magnesium sulfate, and solvent was removed under reduced pressure. The residue was purified by column chromatography to give 60 mg of the title compound in a yield of 78%.
NMR: 1H-NMR(CDCl3) δ 8.03(1H, d, J=7Hz), 7.84~7.79(3H, m), 7.67(1H, m), 7.36(1H, s), 7.18~7.12(2H, m), 6.95(1H, bs), 5.24(2H, s), 4.36~4.31(4H, m), 3.94(3H, s), 2.27(2H, s), 1.84~1.79(2H, m), 1.02~0.98(3H, m) Mass(EI) 512 (M++l)
EXAMPLE 83: Preparation of 5-(2-r3-(4-fluorophenylVisoxazol-5-yll-2-|"fE> propoxyiminol-ethoxyl -N-(2-oxopropyD-isophthalamic acid
Figure imgf000138_0001
45 mg of the title compound was obtained in a yield of 75% in the same manner as in EXAMPLE 1, except that 60 mg (0.12 tnmol) of 5-{2-[3-(4-fluorophenyl)- isoxazol-5-yl]-2-[(E)-propoxyimino]-ethoxy}-N-(2-oxopropyl)-isophthalamic acid methyl ester obtained in PREPARATION 57 was used.
NMR: 1H-NMR(CDCl3) δ 8.03(1H, d, J=7Hz), 7.85~7.78(3H, m), 7.68(1H, d, J=8Hz), 7.36(1H, s), 7.17~7.12(2H, m), 6.94(1H, bs), 6.91(1H, s), 5.24(2H, s), 4.36~4.32(4H, m), 3.94(3H, s), 2.74(3H, s), 1.84~1.79(2H, m), 1.02~0.98(3H, m)
Mass(EI) 498 (M++l)
EXAMPLE 84: Preparation of N-cvclopropyl-5-(2-r3-(4-fluorophenyl)-isoxazol-5-vn- 2-r(EVpropoxyimino1-ethoxyl-isophthalamic acid
Figure imgf000139_0001
35 mg (0.076 mmol) of 5-{2-[3-(4-fluorophenyl)-isoxazol-5-yl]-2-[(E)- propoxyimino]-ethoxy}-isophthalic acid monomethyl ester obtained in PREPARATION 55, 5.3 mg (0.092 mmol) of cyclopropylamine, 22 mg (0.12 mmol) of N-(3- dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride, and 18 mg (0.13 mmol) of 1-hydroxybenzotriazole hydrate were dissolved in dimethylformamide, followed by addition of 9.3 mg (0.092 mmol) of triethylamine. After stirring for 12 hours at room temperature, water and ethyl acetate was added thereto, and then an organic layer was washed with water and brine. The organic layer obtained was dried over anhydrous magnesium sulfate and filtered off to remove solvent under reduced pressure. 24 mg of the title compound was obtained in a yield of 65% in the same manner as in EXAMPLE 1, without any further purification.
NMR: 1H-NMR(CDCl3) δ 7.91~7.73(3H, m), 7.66(1H, s), 7.35(1H, s), 7.18~7.12(2H, m), 6.89(1H, s), 6.35(1H, bs), 5.23(2H, s), 4.35~4.30(2H, m), 2.94~2.86(1H, m), 1.85-1.76(2H, m), 1.04~0.97(3H, m), 0.89~0.85(2H, m), 0.65~0.60(2H, m)
Mass(EI) 482 (M++l)
EXAMPLE 85: Preparation of 2-bromo-5-(2-r3-(4-fluorophenvn-isoxazol-5-yll-2-r(EV propoxyiminol-ethoxyl -benzoic acid
Figure imgf000140_0001
75 mg of the title compound was obtained in a yield of 31% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 170 mg (0.50 mmol) of 2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 122 mg (0.50 mmol) of 2-bromo-5-hydroxybenzoic acid ethyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.84~7.79(2H, m), 7.59~7.57(2H, m), 7.18~7.12(2H, m), 7.02~6.99(lH, m), 6.89(1H, s), 5.19(2H, s), 4.34~4.30(2H, m), 1.84~1.78(2H, m), 1.02~0.98(3H, m)
Mass(EI) 478 (M++l)
PREPARATION 58: Preparation of 3-hydroxγ-5-(pyrirnidine-2-yloχy)benzoic acid methyl ester
0.51 g of the title compound was obtained in a yield of 61% in the same manner as in PREPARATION 2, except that 0.58 g (3.4 mmol) of 3,5-dihydroxy-benzoic acid methyl ester, 0.39 g (3.4 mmol) of 2-chloropyrimidine and 1.35 g (4.1 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.62(2H, m), 7.45(2H, d), 7.12(1H, m), 6.98(1H, m), 5.89(1H, s), 3.94(3H, s)
Mass(EI) 247 (M++l)
EXAMPLE 86: Preparation of 3-([(2EV2-r3-(4-fluoroρhenvnisoxazol-5-yl1- 2("propoxyimino)ethvnoχy} -5(pyrimidine-2-yloxy)benzoic acid
Figure imgf000141_0001
0.07 g of the title compound was obtained in a yield of 54% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.097 g (0.28 mmol) of 2-bromo-l-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-ethanon O-propyl-oxime, 0.07 g (0.28 mmol) of 3-hydroxy-5-(pyrimidine-2-yloxy)benzoic acid methyl ester and 0.19 g (0.56 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCIa) δ 8.62(2H, m), 7.86(2H, s), 7.72(1H5 m), 7.62(1H, m), 7.4O(1H, s), 7.20-7.15(2H, m), 7.11-7.13(2H, m), 5.20(2H, s), 4.33(2H, m), 1.85(2H, m), 1.02(3H, m)
Mass(EI) 493 (M++l)
PREPARATION 59: Preparation of 4-hvdroxv-biphenvl-2-carboχylic acid methyl ester 0.07 g (0.28 mmol) of 4-methoxy-biphenyl-2-carboxylic acid methyl ester was dissolved in N-methylmorpholine. 0.18 mL (1.0 mmol) of octanethiol and 0.052 g (1.3 mmol) of sodiumhydroxide were added thereto while stirring. And then the reaction solution was refluxed at 120 "C for 10 hours. The pH of the resulting solution was adjusted to pH 2 with IN hydrochloric acid. Ethyl acetate was added thereto. An organic solvent was removed. The product was dissolved in methanol, and 0.7 mL of (2.8 mmol) of 4M hydrochloric acid was added thereto, followed by refluxing for 2 hours. Ethyl acetate was added therto, and the resulting solution was washed with saturated ammonium chloride and water, and then dried over anhydrous magnesium sulfate and filtered off, and solvent was removed. The residue was purified by column chromatography to give 0.007 g of the title compound in a yield of 11%.
NMR: 1H-NMR(CDCl3) δ 7.5O(1H, d), 7.42-7.37(5H, m), 7.32(1H, m), 7.15(1H, m), 3.92(3H, s),
Mass(EI) 229 (M++l)
EXAMPLE 87: Preparation of 4-{[(2EV2-[3-(4-fluoroρhenvnisoxazol-5-yll- 2(PrOPOXvJmJnOIeIJiVnOXvI -biphenyl-2-carboχylic acid
Figure imgf000142_0001
0.005g of the title compound was obtained in a yield of 36% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.01 g (0.03 mmol) of 2-bromo-l-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-ethanon O-propyl oxime, 0.007 g (0.03 mmol) of 4-hydroxy-biphenyl-2-carboxylic acid methyl ester and 0.02 g (0.06 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.85(2H, m), 7.74(2H, m), 7.64(2H, m), 7.51(1H, m), 7.40(3H, m), 7.20(2H, m), 6.96(1H, m), 5.22(2H, s), 4.37(2H, m), 1.85(2H, m), 1.05(3H, m)
Mass(EI) 475 (M++l)
EXAMPLE 88: Preparation of 5-{r(2EV2-[3-(4-fluorophenvnisoxazol-5-yl1- 2("propoxyimino)ethviloxyl-2- morpholine -4-ylbenzoic acid
Figure imgf000143_0001
0.01 g (0.21 mmol) of 2-bromo-5-{2-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-2- [(E)-propoxyimino]-ethoxy}benzoic acid was dissolved in acetonitrile, 0.05 mL of (0.42 mmol) of morpholine and 0.01 mL of (0.42 mmol) of diisopropylethylamine were added thereto. The reaction solution was refluxed for 15 hours. Ethyl acetate was added thereto, and the resulting solution was washed with saturated ammonium chloride and water, and then dried over anhydrous magnesium sulfate and filtered off, and solvent was removed. The residue was purified by column chromatography to give 0.008 g of the title compound in a yield of 87%.
NMR: 1H-NMR(CDCl3) δ 7.86(2H, m), 7.5O(1H, d), 7.39(1H, s), 7.18(2H, m), 6.94(1H, s), 6.86(1H, m), 5.19(2H, s), 4.35(2H, m), 3.88(2H, t), 3.15(2H, t), 1.85(2H, m), 1.05(3H, m)
Mass(EI) 483 (M++l)
EXAMPLE 89: Preparation of 3-{r(2Zy2-[3-(4-chloroρhenoxV)phenyll- 2(propoxyimino>)ethylloxyl -5-(pyrimidine-2-yloxy)benzoic acid
Figure imgf000144_0001
0.023 g of the title compound was obtained in a yield of 49% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.034 g (0.09 mmol) of 2-bromo-l-[3-(4-chloro-phenoxy)-phenyl]-ethanon O-propyl-oxime, 0.022 g (0.09 mmol) of 3-hydroxy-5-(pyrimidine-2-yloxy)benzoic acid methyl ester and 0.058 g (0.18 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.57(1H, s), 7.57(1H, d), 7.44(1H, m), 7.35(2H, m), 7.27(2H, s), 7.08(2H, m), 6.99-6.92(4H, m), 6.6O(1H, s), 5.25(2H, s), 4.22(2H5 m), 1.76(2H5 m), 0.99(3H5 m)
Mass(EI) 534 (M++l) EXAMPLE 90: Preparation of 3-{rr2ZV2-r3-phenoxyphenylV
2(propoxyiminotethylloxy}-5-(pyrimidine-2-yloxy')benzoic acid
Figure imgf000145_0001
0.024g of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.033 g (0.1 mmol) of 2-bromo-l-(3-phenoxy-phenyl)-ethanon 0-propyl-oxime, 0.024 g (0.1 mmol) of 3-hydroxy-5-(pyrimidine-2-yloxy)benzoic acid methyl ester and 0.062 g (0.2 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.59(1H, s), 7.57(1H, d), 7.43(2H, m), 7.33(3H, m), 7.18- 6.98(7H5 m), 6.6O(1H, s), 5.25(2H, s), 4.20(2H, m), 1.75(2H, m), 1.00(3H, m)
Mass(EI) 500 (M++l)
PREPARATION 60: Preparation of 3-hvdroxy-5-hydroxymethyl-benzoic acid methyl ester
2.64 g (13.4 mmol) of 5-hydroxy-5-isophthalic acid monomethyl ester was dissolved in 30 mL of anhydride tetrahydrofuran, then 8.1 mL of (16.15 mmol) of borane dimethylsulfide was slowly added thereto while stirring at 0°C . The reaction solution was stirred for 15 hours at 60 °C. After neutralization using acetic acid, the resulting solution was washed with saturated sodium bicarbonate and water, and then dried over anhydrous magnesium sulfate and filtered off, and solvent was removed. The residue was purified by column chromatography to give 1.1 g of the title compound in a yield of 46%.
NMR: 1H-NMR(CDCl3) δ 7.64(1H, s), 7.47(1H5 s), 7.14(1H, s), 4.75(2H, s), 3.98(1H, s), 3.95(3H, s),
Mass(EI) 183 (M++l)
EXAMPLE 91; Preparation of 3-{r(2EV2-r3-(4-fluoroρhenvnisoxazol-5-yl1- 2(propoxyimino')ethylloxy) -S-fliydroxymethvDbenzoic acid
Figure imgf000146_0001
0.013 g of the title compound was obtained in a yield of 68% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.084 g (0.25 mmol) of 2-bromo-l-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-ethanon O-propyl-oxime, 0.045 g (0.25 mmol) of 3-hydroxy-5-hydroxymethyl-benzoic acid methyl ester and 0.16 g (0.50. mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.86(2H, m), 7.76(1H, s), 7.66(1H, d), 7.4O(1H, m), 7.22- 7.16(2H, m), 6.96(1H, s), 5.26(2H, s), 4.77(2H, m), 4.38(1H, s), 4.17(2H, m), 1.88(2H, m), 1.05(3H, m)
Mass(EI) 429 (M++l)
EXAMPLE 92: Preparation of 3-(r(2EV2-r3-(4-fruorophenynisoxazol-5-yll- 2("propoxyimino)ethvnoxyl -5 (pyrrolidine- 1 -ylmethvDbenzoic acid
Figure imgf000147_0001
0.044 g (0.1 mmol) of 3-{2-[3-(4-fluoro-phenyl)-isoxazol-5-yl]-2-[(E)-
propoxyimino]-ethoxy}-5-methanesulfonyloxymethyl-benzoic acid methyl ester was dissolved in 10 mL of acetonitrile, and then 0.01 mL (0.12 mmol) of pyrrolidine was slowly added thereto while stirring at 0°C . Then, 0.03 mL of (0.2 mmol) of diisopropylethylamine was slowly added thereto while stirring at 0°C . The resulting solution was refluxed for 3 hours. The reaction solution was washed with saturated ammonium chloride and water, dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed, followed by purification by column chromatography. Then, based upon the same manner as in EXAMPLE 15, 0.01 g of the title compound
was obtained in a yield of 24%.
NMR: 1H-NMR(CDCl3) δ 8.35(1H, m), 7.84(2H, s), 7.74(1H, m), 7.38(1H, s), 7.19- 7.17(2H, m), 6.95(1H, s), 5.21(2H, s), 4.35(2H, m), 4.05(2H, s), 3.22(4H, m), 2.14- 2.05(4H, m), 1.83(2H, m), 1.04(3H, m) Mass(EI) 482 (M++!)
EXAMPLE 93: Preparation of 3-{[f2EV2-r3-(4-fluorophenvnisoxazol-5-yll- 2(propoxvimino)ethvl1oxy}-5(isopropoxvmethyl)benzoic acid
Figure imgf000148_0001
0.009 g of the title compound was obtained in a yield of 30% in the same manner as in PREPARATION 10 and EXAMPLE 15 in sequence, except that 0.03 g
(0.07 mmol) of 3-{[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-
2(propoxyimino)ethyl]oxy}-5-(hydroxymethyl)benzoic acid methyl ester, 0.01 mL (0.11 mmol) of 2-bromopropane and 0.004 g (0.11 mmol) of sodium hydride were used.
NMR: 1H-NMR(CDCl3) δ 7.75(1H, m), 7.58(3H, m), 7.15(2H, s), 7.01(2H, m), 5.07(2H, s), 4.70(2H, m), 4.51(2H, s), 3.75(1H, m), 2.05(2H, m), 1.25(6H, d), 0.92(3H, m)
Mass(EI) 471 (M++l)
EXAMPLE 94: Preparation of 3-r(acetylamino)methyl1-5-(2EV2-r3-(4- fluorophenvπisoxazol-5-vll-2('propoxvimino')ethvlloxv>benzoic acid
Figure imgf000149_0001
0.02 g (0.05 mmol) of 3-aminomethyl-5-{2-[3-(4-fluoro-phenyl)-isoxazol-5- yl]-2-[(E)-propoxyimino]-ethoxy} -benzoic acid methyl ester was dissolved in 10 mL of dichloro methane, 0.01 mL (0.06 mmol) of acetyl chloride was slowly added thereto while stirring at 0°C . Then, 0.012 mL (0.1 mmol) of trimethylamine was slowly added thereto while stirring at 0°C . And the resulting solution was stirred for 2 hours at room temperature. The resulting solution was washed with saturated ammonium chloride and water, dried over anhydrous magnesium sulfate, filtered off and solvent was removed, followed by purification by column chromatography. Then, based upon the same manner as in EXAMPLE 15, 0.01 g of the title compound in a yield of 48% was obtained.
NMR: 1H-NMR(CDCl3) δ 7.77(2H, m), 7.46(2H, m), 7.10(2H, m), 6.89(2H, m), 5.06(2H, s), 4.25(4H, m), 2.08(3H, s), 1.92(2H, m), 0.95(3H, m)
Mass(EI) 470 (M++l)
EXAMPLE 95: Preparation of 3-{|"(2EV2-P-r4-fluoroρhenvnisoxazol-5-yll- 2(propoxyimino')ethyl'loxyl -5 { [(methylsulfonvDaminolmethyUbenzoic acid
Figure imgf000150_0001
0.01 g of the title compound was obtained in a yield of 34% in the same manner as in EXAMPLE 15, except that 0.025 g (0.06 mmol) of 3-aminomethyl-5-{2-[3-(4- fluoro-phenyl)-isoxazol-5-yl]-2-[(E)-propoxyimino]-ethoxy}-benzoic acid methyl ester and 0.01 mL (0.07 mmol) of methanesulfonyl chloride and 0.05 mL (0.12 mmol) of trimethylamine were used.
NMR: 1H-NMR(CDCl3) δ 7.79(2H, m), 7.64(1H, m), 7.52(1H, m), 7.12(2H, m), 7.04(1H, s) 6.91(1H, s), 5.12(2H, s), 4.28(2H, m), 4.17(2H, m), 2.86(3H, s), 1.80(2H, m), 0.99(3H, m)
Mass(EI) 506 (M++l)
EXAMPLE 96: Preparation of l-rαEV2-(ethoxyiminoV2-(3-phenoxyphenvnethyll-5- fluoro-1 H-indol-2-carboxylic acid
Figure imgf000150_0002
0.034 g of the title compound was obtained in a yield of 59% in the same manner as in PREPARATION 10 and EXAMPLE 15 in sequence, except that 0.17 g (0.5 mmol) of 2-bromo-l-(3-phenoxy-phenyl)-ethanon O-ethyl oxime, 0.1 g (0.5 mmol) of 5-fluoro-lH-indol-2-carboxylic acid methyl ester and 0.025 g (0.6 mmol) of sodium hydride were used.
NMR: 1H-NMR(CDCl3) δ 7.44-7.38(2H, m), 7.25-7.19(5H, m), 7.10-6.98(3H, m), 6.86- 6.79(2H, m), 6.71(1H, d), 5.98(2H, s), 4.38(2H, q, J=7Hz), 1.42(3H, t, J=7Hz)
Mass(EI) 433 (M++l)
EXAMPLE 97: Preparation of l-rf2E>2-(ethoxyiminoV2-(3-phenoxyphenvnethyll-5- methoxy-1 H-indol-3-carboxylic acid
Figure imgf000151_0001
0.06 g of the title compound was obtained in a yield of 38% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.15 g (0.45 mmol) of 2-bromo-l-(3-phenoxy-phenyl)-ethanon O-ethyl oxime, 0.1 g (0.45 mmol) of 5- methoxy-lH-indol-3-yl-carboxylic acid methyl ester and 0.22 g (0.67 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.32(2H, m), 7.22-7.19(2H, m), 7.14(2H, m), 6.99(2H, m), 6.92-6.85(5H, m), 5.26(2H, s), 4.37(2H, q, J=7Hz), 3.85(3H, s), 1.39(3H, t, J=7Hz)
Mass(EI) 459 (M+H-I) EXAMPLE 98: Preparation of sodium l-r(2ZV2-(ethoxyiminoV2-(3- phenoxyphenyr)ethyll-5-fluoro- 1 H-indol-3-carboxylate
Figure imgf000152_0001
0.035 g of the title compound was obtained in a yield of 51% in the same manner as in PREPARATION 10 and EXAMPLE 15 in sequence, except that 0.16 g (0.5 mmol) of 2-bromo-l-(3-phenoxy-phenyl)-ethanon O-ethyl oxime, 0.1 g (0.5 mmol) of 5-fluoro-lH-indol-3-carboxylic acid ethyl ester and 0.03 g (0.6 mmol) of sodium hydride were used.
NMR: 1H-NMR(CD3OD) δ 7.86(1H, d), 7.7O(1H, s), 7.34-7.23(5H, m), 7.07(2H, m), 6.88(2H, m), 6.81(2H, d), 5.46(2H, s), 4.36(2H, q, J=7Hz), 1.39(3H, t, J=7Hz)
Mass(EI) 455 (M++l)
EXAMPLE 99: Preparation of l-r(2ZV2-(4-chlorophenvD-2-(propoxyiminokthyll-5- fluoro-1 H-indol-3-carboxylic acid
Figure imgf000152_0002
0.03 g of the title compound was obtained in a yield of 65% in the same manner as in PREPARATION 10 and EXAMPLE 15 in sequence, except that 0.056 g (0.2 mmol) of 2-bromo-l-(4-chlorophenyl)-ethanon O-propyl oxime, 0.04 g (0.2 mmol) of
S-fluoro-lH-indol-S-carboxylic acid ethyl ester and 0.01 g (0.24 mmol) of sodium hydride were used.
NMR: 1H-NMR(CDCl3) δ 86(2H, d), 7.46(2H, d), 7.33(2H, m), 7.16(1H, m), 7.06(1H, m), 5.39(2H, s), 4.31(2H, t, J=7Hz), 1.83(2H, m, J=7Hz), 1.01(3H, t, J=7Hz).
Mass(EI) 389 (M++l)
EXAMPLE 100: Preparation of sodium 5-fluoro-l-IT2ZV2-(3-hvdroχyρhenylV2- (propoxyiminotethyli - 1 H-indol-3 -carboxvlate
Figure imgf000153_0001
0.055 g of the title compound was obtained using Prep-HPLC in a yield of 60% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 0.122 g (0.3 mmol) of 2-bromo-l-[3-(6-trifluoromethyl-pyridine-2-yloxy)phenyl]- ethanon 0-propyl-oxime, 0.06 g (0.45 mmol) of 5 -fluoro-1 H-indol-3 -carboxylic acid ethyl ester and 0.19 g (0.45 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CD3OD) δ 85(1H, d), 7.75(1H, s), 7.32(1H5 m), 7.03(1H, t), 6.94(1H, s), 6.86(2H, m), 6.7O(1H, d), 5.42(2H, s), 4.23(2H5 t, J=7Hz), 1.80(2H5 m, J=7Hz)5 1.00(3H, t, J=7Hz)
Mass(EI) 393 (M++!)
PREPARATION 61: Preparation of methyl 3-hydroχy-5-[(methylsulfonvDoxy"|benzoate
344 mg (2.05 mmol) of methyl 3,5-dihydroxybenzoate was dissolved in 7 mL of dichloromethane, then 0.34 mL of (2.46 mmol) of triethylamine and 0.15 mL of (1.94 mmol) of methanesulfonylchloride were slowly added thereto while stirring at 0 °C . After 1 hour, solvent was removed, and the resulting solution was extracted with water and ethyl acetat. An organic layer was dried over anhydrous magnesium sulfate, filtered off, and then solvent was removed to obtain 54 mg of the title compound using column chromatography in a yield of 11%.
NMR: 1H-NMR(CDCl3) δ 7.51(1H, m), 7.49(1H, s), 7.03(1H, m), 3.92(3H, s), 3.19(3H,
s)
Mass(EI) 246(M++1)
PREPARATION 62: Preparation of methyl 3-{r(2EV2-r3-(4-fluorophenyl)isoxazol-5- yll-2-(propoxyimino)ethyl]oxyl-5-[(methylsulfonvπoxy1benzoate
68 mg (0.20 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5- yl]ethanon O-propyloxime obtained in PREPARATION l-(2), 54.0 mg (0.22 mmol) of methyl 3-hydroxy-5-[(methylsulfonyl)oxy]benzoate and 108 mg (0.33 mmol) of cesium carbonate were stirred in the acetonitrile solvent under reflux for 1 hour, and then solvent was removed to obtain 82 mg of the title compound using column chromatography in a yield of 81%.
NMR: 1H-NMR(CDCl3) δ 7.84~7.79(2H, m), 7.68~7.62(1H, m), 7.56(1H, s), 7.37(1H, s), 7.21~7.11(3H, m), 5.15(2H, s), 4.36~4.30(2H, m), 3.92(3H, s), 3.16(3H, s), 1.83-1.80(2H, m), 1.02~0.99(3H, m)
Mass(EI) 506(M+H-I)
EXAMPLE 101: Preparation of 3-(f(2EV2-f3-(4-fluorophenylMsoxazol-5-vn-2- (propoxyimino)ethylloxy}-5-r(methylsulfonvπoxylbenzoic acid
Figure imgf000155_0001
82 mg (0.16 mmol) of methyl 3-{[(2E)-2-[3-(4-fluoroρhenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl] oxy } -5 - [(methylsulfonyl)oxy]benzoate obtained in
PREPARATION 62 was dissolved in tetrahydrofuran: IN NaOH(2:l), then stirred for 5 hours, and the resulting solution was acidificated with 1 N HCl to pH 2 and extracted with ethyl acetate. The reaction solution was dried over anhydrous sodiumsulfate and filtered off to give 27 mg of the title compound in a yield of 34%.
NMR: 1H-NMR(CDCl3) δ 7.84~7.79(2H, m), 7.75~7.68(1H, m), 7.62(1H, s), 7.37(1H, s), 7.21~7.12(3H, m), 5.16(2H, s), 4.35~4.33(2H, m), 3.17(3H, s), 1.83~1.81(2H, m), 1.01~0.99(3H, m)
Mass(EI) 492(M++1)
PREPARATION 63: Preparation of methyl 2,5-dihydroxybenzoate
5 g (32.5 mmol) of 2,5-dihydroxybenzoic acid was well dissolved in 60 mL of methanol, 41 mL (162 mmol) of hydrogen chloride 4M dioxane solution was slowly added thereto while stirring. After the reaction for 12 hours, solvent was removed and the resulting solution was extracted with water and ethyl acetate. An organic layer thus separated was neutralized with sodium bicarbonate, dried over anhydrous magnesium sulfate, and filtered off, and then solvent was removed to give 3.2g of the title compound in a yield of 59%.
NMR: 1H-NMR(CDCl3) δ 7.2O(1H, d, J=3.1Hz), 6.95(1H, dd, J=3.1Hz, 9.2Hz), 6.77(1H, d, J=9.2Hz), 3.91(3H, s)
Mass(EI) 168(M++1)
PREPARATION 64: Preparation of methyl 5-U(2EV2-r3-(4-fluorophenvnisoxazol-5- yll-2-(propoxyimino)ethyl1oxyl-2-hydroxybenzoate
50 mg (0.15 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5- yl]ethanon O-propyloxime obtained in PREPARATION l-(2), 74 mg (0.44 mmol) of methyl 2,5-dihydroxybenzoate and 95 mg (0.29 mmol) of cesium carbonate was stirred in acetonitrile solvent under reflux for 1 hour, and solvent was removed to obtain 55 mg of the title compound using column chromatography in a yield of 87%.
NMR: 1H-NMR(CDCl3) δ 1O.41(1H, s), 7.85~7.78(2H, m), 7.47~7.38(1H, m), 7.35(1H, s), 7.18-7.11(3H, m), 6.9O(1H, s), 5.05(IH, s), 4.32~4.30(2H, m), 3.94(3H, s), 1.82-1.79(2H, m), 1.02~0.99(3H, m)
Mass(EI) 428(M++1)
PREPARATION 65: Preparation of methyl 5-{r(2E>2-[3-(4-fluorophenvnisoxazol-5- yl] -2-(propoxyimino)ethyl] oxy 1-2- [("methylsulfonyπoxy]benzoate
53 mg (0.12 mmol) of methyl 5-{[(2E)-2-[3-(4-fluoroρhenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]oxy}-2-hydroxybenzoate obtained in PREPARATION 64 was dissolved in 3 mL of dichloromethane. Then, 55 mg of the title compound was obtained in a yield of 88% in the same manner as in PREPARATION 61, except that 0.021 mL (0.15 mmol) of triethylamine and 0.010 mL of (0.12 mmol) of methanesulfonylchloride were used.
NMR: 1H-NMR(CDCl3) δ 7.84~7.81(2H, m), 7.61~7.53(1H, m), 7.36(1H, s), 7.36- 7.33(1H, m), 7.20~7.13(3H, m), 5.12(2H, s), 4.33~4.31(2H, m), 3.91(3H, s), 3.24(3H, s), 1.82~1.79(2H, m), 1.01~0.99(3H, m)
Mass(EI) 506(M++l)
EXAMPLE 102: Preparation of 5-{[(2Ey2-r3-f4-fluorophenvnisoxazol-5-yl1-2- (propoxyimino)ethyli oxy } -2- [(methylsulfonyDoxylbenzoic acid
Figure imgf000158_0001
52 mg of the title compound was obtained in a yield of 97% in the same manner as in EXAMPLE 1, except that 55 mg (0.11 mmol) of methyl 5-{[(2E)-2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}-2- [(methylsulfonyl)oxy]benzoate obtained in PREPARATION 65 was used.
NMR: 1H-NMR(CDCl3) δ 7.84~7.79(2H, m), 7.72~7.66(1H, m), 7.4O-7.38(1H, m), 7.36(1H, s), 7.22-7.14(3H, m), 5.14(2H, s), 4.34-4.31(2H, m), 3.24(3H, s), 1.83~1.80(2H, m), 1.01~0.99(3H, m)
Mass(EI) 492(M+-H)
PREPARATION 66: Preparation of ethyl 2-ethoxy-5-hvdroxybenzoate
(1) Preparation of ethyl 5-(acetyloxy')-2-ethoxybenzoate
1 g (4.23 mmol) of ethyl 5-acetyl-2-ethoxybenzoate was dissolved in 25 mL of dichloromethane, then 877 mg (5.08 mmol) of 3-chloroperoxybenzoic acid and 80 mg (0.42 mmol) of para-toluenesulfonic acid monohydrate were added thereto, followed by stirring under reflux for 12 hours. 40 mL of dichloromethane was further added thereto, and an organic layer was washed with aqueous potassium iodide solution and aqueous sodiumthiosulfate solution. The organic layer was dried over anhydrous magnesium sulfate, then solvent was removed and the residue was purified by column chromatography. The compound thus purified was extracted with ethyl acetate and 0.5N aqueous sodiumhydroxide solution, dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain 470 mg of the title compound in a yield of 44%.
NMR: 1H-NMR(CDCl3) δ 7.51(1H, d, J=3.1Hz), 7.16(1H, dd, J=9.2Hz, 3.1Hz), 6.93(1H, d, 9.2Hz), 4.34(2H, q, J=7.3Hz), 4.09(2H, q, J=7.3Hz), 2.28(3H, s), 1.45(3H, t, J=7.3Hz), 1.36(3H, t, J=7.3Hz)
Mass(EI) 252(M++1)
(2) Preparation of ethyl 2-ethoxy-5-hydroxybenzoate
470 mg (1.86 mmol) of ethyl 5-(acetyloxy)-2-ethoxybenzoate was dissolved in 20 mL of ethanol at room temperature, and 127 mg (1.86 mmol) of sodium ethoxide was added thereto, followed by stirring for 1 hour. After neutralization with IN aqueous hydrochloride solution, solvent was removed, and then resulting solution was extracted with dichloromethane and water. The organic layer was dried over anhydrous magnesium sulfate and filtered off, and solvent was removed to obtain 390 mg of the title compound in a yield of 99%.
NMR: 1H-NMR(CDCl3) δ 7.26(1H, d, J=3.1Hz), 6.93(1H, dd, J=8.5Hz, 3.1Hz), 6.86(1H, d, 8.5Hz), 4.7O(1H, s), 4.35(2H, q, J=7.3Hz), 4.03(2H, q, J=7.3Hz), 1.43- 1.35(6H, m)
Mass(EI) 210(M++l) PREPARATION 67: Preparation of ethyl 2-ethoxy-5-{rf2E>2-r3-f4- fluorophenvDisoxazol-S -yl] -2-(propoxyimino)ethyl] oxy> benzoate
48 mg of the title compound was obtained in a yield of 54% in the same manner as in PREPARATION 2, except that 64 mg (0.19 mmol) of (lZ)-2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime obtained in PREPARATION l-(2),
40 mg (0.19 mmol) of ethyl 2-ethoxy-5-hydroxybenzoate and 92 mg (0.28 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.84~7.78(2H, m), 7.45~7.38(1H, m), 7.35(1H, s), 7.17~7.02(3H, m), 6.9O~6.87(1H, m), 5.13 (2H, s), 4.35~4.26(4H, m), 4.08~4.01(2H, m), 1.84-1.76(2H, m), 1.44-1.34(6H, m), 0.99 (3H, m)
Mass(EI) 470(M++l)
EXAMPLE 103: Preparation of 2-ethoxy-5-(r(2EV2-r3-(4-fluorophenylMsoxazol-5-vn- 2-(propoxyimino')ethylloxy>benzoic acid
Figure imgf000160_0001
48 mg (0.10 mmol) of ethyl 2-ethoxy-5-{[(2E)-2-[3-(4-fluorophenyl)isoxazol- 5-yl]-2-(propoxyimino)ethyl]oxy}benzoate was dissolved in tetrahydrofuran: methanol: IN NaOH(1 :1:1), and 12 mg (0.10 mmol) of 30% aqueous hydrogen peroxide solution was added thereto, then stirred for 5 hours, and the resulting solution was acidificated with 1 N HCl to pH 2 and extracted with ethyl acetate. The reaction solution was dried over anhydrous sodiumsulfate and filtered off to give 18 mg of the title compound in a yield of 40%.
NMR: 1H-NMR(CDCl3) δ 7.85~7.78(3H, m), 7.36(1H, s), 7.19~7.12(3H, m), 6.98~6.96(1H, m), 5.09(2H, s), 4.36~4.25(4H, m), 1.82-1.78(2H, m), 1.55-1.50(3H, m), 1.02~0.98(3H, m)
Mass(EI) 442(M++!)
PREPARATION 68: Preparation of methyl 2-(ethylaminoV5-hydroxybenzoate
(1) Preparation of methyl 2-amino-5-hydroxybenzoate
1.85 g of the title compound was obtained in a yield of 34% in the same manner as in PREPARATION 63, except that 5 g (32.7 mmol) of 2-amino-5-hydroxybenzoic acid was used.
NMR: 1H-NMR(CD3OD) δ 7.21(1H, d, J=3.1Hz), 6.81(1H, dd, J=9.2Hz, 3.1Hz), 6.65(lH, d, 9.2Hz), 3.81(3H, s)
Mass(EI) 167(M++1)
(2) Preparation of methyl 2-(ethylaminoV5-hvdroxybenzoate 117 mg (0.70 nimol) of methyl 2-amino-5-hydroxybenzoate and 0.12 mL of (2.10 mmol) of acetaldehyde were dissolved in 3 mL of 1,2-dichloroethane, then 445 mg (2.10 mmol) of sodium triacetoxy borohydride was added thereto, followed by stirring at room temperature. After 5 hours, solvent was removed, and the resulting solution was extracted with ethyl acetate and water. An organic layer separated was dried over anhydrous magnesium sulfate and filtered off, and solvent was removed to give 118 mg of the title compound using column chromatographyin a yield of 86%.
NMR: 1H-NMR(CDCl3) δ 7.18(1H, d, J=3.1Hz), 6.89(1H, dd, J=9.2Hz, 3.1Hz)5 6.59(1H, d, 9.2Hz), 3.73(3H, s), 3.08(2H, q, J=7.4Hz), 1,15(3H, t, J=7.4Hz)
Mass(EI) 195(M++!)
PREPARATION 69: Preparation of methyl 2-(ethylaminoV5-([r2EV2-r3-r4- fluorophenvπisoxazol-5-yll-2-('propoxyimino>)ethyl]oxylbenzoate
24 mg of the title compound was obtained in a yield of 25% in the same manner as in PREPARATION 2, except that 72 mg (0.21 mmol) of (lZ)-2-bromo-l-[3-(4- fluorophenyl)isoxazol-5-yl]ethanon 0-propyloxime obtained in PREPARATION l-(2),
41 mg (0.21 mmol) of methyl 2-(ethylamino)-5-hydroxybenzoate and 103 mg (0.32 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.82~7.79(2H, m), 7.5O(1H, d, J=3.1Hz), 7.18-7.11(2H, m), 7.08~7.05(lH, dd, J=9.2Hz, 3.1Hz), 6.92(1H, s), 6.62(1H, d, J=9.2Hz), 5.09(2H, s), 4.29(2H, q, J=6.8Hz), 3.84(3H, s), 3.19(2H, q, J=6.8Hz), 1.79(2H, m), 1.29(3H, t, J=6.8Hz), 0.99 (3H, t, J=7.3Hz) Mass(EI) 455(M++!)
EXAMPLE 104: Preparation of 2-(ethylaminoV5-{[(2EV2-r3-r4-fluorophenvnisoxazol- 5-yπ-2-(propoxyimino)ethyl1oxylbenzoic acid
Figure imgf000163_0001
24 mg (0.053 mmol) of methyl 2-(ethylamino)-5-{[(2E)-2-[3-(4- fluorophenyl)isoxazol-5-yl]-2-(propoxyimino)ethyl]oxy}benzoate was dissolved in tetrahydrofuran: methanol: IN NaOH(1 :1:1), then stirred, and the resulting solution was acidificated with 1 N HCl to pH 2 and extracted with ethyl acetate. The reaction solution was dried over anhydrous sodiumsulfate and filtered off to give 17 mg of the title compound using column chromatography in a yield of 73%.
NMR: 1H-NMR(CDCl3) δ 7.82~7.79(2H, m), 7.58(1H, d, J=3.1Hz), 7.18~7.10(3H, m), 6.92(1H, s), 6.73(1H, d, J=9.2Hz), 5.12(2H, s), 4.30(2H, q, J=6.8Hz), 3.23(2H, q, J=6.8Hz), 1.80(2H, m), 1.30(3H, t, J=6.8Hz), 0.99 (3H, t, J=7.3Hz)
Mass(EI) 441(M++1)
PREPARATION 70: Preparation of methyl 2-fdimethylaminoV5-hvdroxybenzoate
70 mg of the title compound was obtained in a yield of 37% in the same manner as in PREPARATION 68-(2), except that 160 mg (0.96 mmol) of methyl 2-amino-5- hydroxybenzoate, 0.51 mL (5.74 mmol) of 32wt% formaldehyde and 1.2 g (5.74 mmol) of sodium triacetoxy borohydride were used.
NMR: 1H-NMR(CDCl3) δ 7.04(2H, m), 6.89(1H, m), 3.83(3H, s), 2.68(6H, s)
Mass(EI) 195(M++1)
EXAMPLE 105: Preparation of 2-(dimethylaminoV5-(r(2E)-2-[3-(4- fluorophenyl)isoxazol-5-yl1-2-(propoxyimino)ethyl1oxy}benzoic acid
Figure imgf000164_0001
41 mg of the title compound was obtained in a yield of 26% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 122 mg (0.36 mmol) of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime and 70 mg (0.36 mmol) of methyl 2-(dimethylamino)-5-hydroxybenzoate were used.
NMR: 1H-NMR(CDCl3) δ 7.88(2H, d, J=3.1Hz), 7.84~7.78(2H, m), 7.36(1H, s), 7.17~7.12(3H, m), 6.9O(1H, s), 5.22(2H, s), 4.34(2H, q, J=7.3Hz), 2.79(6H, s), 1.82(2H, m), 1.00(3H, t, J=7.3Hz)
Mass(EI) 441(M+H-I) PREPARATION 71: Preparation of methyl ό-methoxy-lH-indol-S-carboxylate
( 1 ) Preparation of 1 -methoxy-3 -nitrobenzen
3 g (21.6 mmol) of 3-nitrophenol was dissolved in acetone, then 4.5 g (32.4 mmol) of potassium carbamate was added thereto at 0°C, 3.3 g (25.9 mmol) of dimethylsulfate was further added thereto, followed by stirring for 2 hours at room temperature. After solvent was removed, the resulting solution was extracted with dichloromethane and water. An organic layer was dried over anhydrous magnesium sulfate and filtered off to obtain 3.0 g of the title compound using column chromatographyin a yield of 91%.
NMR: 1H-NMR(CDCl3) δ 7.83~7.81(1H, m), 7.73~7.72(1H, m), 7.42(1H, m), 7.23~7.21(1H, m), 3.89(3H, s)
Mass(EI) 153(M++1)
(2) Preparation of benzyl hvdroxy(3 -methoxyphenvDcarbamate
3 g (19.6 mmol) of 1 -methoxy-3 -nitrobenzen was dissolved in water and ethanol at a ratio of 1/1 as a solvent, then 3.8 g (58.7 mmol) of zinc metal powder was suspended therein. 1.2 g (21.5 mmol) of ammonium chloride was added thereto while the resulting solution was kept at 100C, followed by stirring. After completion of a reaction, ethanol was removed, the resulting solution was extracted with ethyl acetate and water, an organic layer was dried over anhydrous magnesium sulfate, and then solvent was removed to obtain a mixture compound of 3.0 g (21.53 mmol) of N- hydroxy-3-methoxyaniline. The mixture compound was dissolved in 60 mL of diethyl ether without any further purification, then 3.4 mL of (23.68 mmol) of benzyl chloroformate was added thereto and then 3.0 g (21.53 mmol) of potassiumcarbonate and 15 mL of water were further added thereto while the resulting solution was kept at 0 °C . The reaction solution was extracted with diethyl ether and water, an organic layer was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain 3.5 g of the title compound using column chromatography in a yield of 59%.
NMR: 1H-NMR(CDCl3) δ 7.40~7.29(5H, m), 7.10~7.06(2H, m), 7.42(1 H, m), 6.77~6.7O(1H, m), 5.27(2H, s), 3.76(3H, s)
Mass(EI) 273(M++!)
(3) Preparation of methyl 6-methoxy-lH-indol-3-carboxylate
3.5 g (12.81 mmol) of benzyl hydroxy(3-methoxyphenyl)carbamate was dissolved in nitromethane, and then 2.3 mL of (25.61 mmol) of methyl propiolate and 5.5 mL of (32.02 mmol) of diisopropyl ethyl amine were added thereto, followed by stirring for 12 hours. After completion of the reaction, solvent was removed to obtain
0.5g of the title compound using column chromatography in a yield of 19%.
NMR: 1H-NMR(CDCl3) δ 8.53(1H, bs), 8.04(1H, d, J=8.6Hz), 7.8O(1H, s), 6.92(1H, d=8.6Hz), 6.87(1H, s), 3.91(3H, s), 3.84(3H, s)
Mass(EI) 205(M++!) PREPARATION 72: Preparation of methyl 4-methoxy-lH-indol-3-carboxylate
0.5 g of the title compound was obtained as a side product in a yield of 19%, when methyl 6-methoxy- 1 H-indol-3 -carboxylate had been synthesized in the same manner as in PREPARATION 12-(4).
NMR: 1H-NMR(CDCl3) δ 8.69(1H, bs), 7.82(1H, d, J=8.6Hz), 7.8O(1H, s), 6.92(1H, d=8.6Hz), 6.87(1H, s), 3.91(3H, s), 3.84(3H, s)
Mass(EI) 205(M++l)
PREPARATION 73: Preparation of methyl l-[(7E>2-r3-r4-fluorophenvπisoxazol-5-yl1- 2-(propoχyimino)ethyl] -6-methoxy- 1 H-indol-3 -carboxylate
33 mg (0.16 mmol) of methyl 6-methoxy- 1 H-indol-3 -carboxylate was dissolved in N,N-dimethylformamide at 0°C, then 9 mg (0.20 mmol) of 55 wt% sodium hydride was slowly added thereto. After 30 minutes, 46 mg (0.14 mmol) of (lZ)-2-bromo-l-[3- (4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime obtained in PREPARATION 1- (2) was added thereto, and stirred for 1 hour at room temperature, then N9N- dimethylformamide was removed as much as possible. The resulting solution was extracted with water and ethyl acetate. An organic layer was dried over anhydrous magnesium sulfate, and then solvent was removed to give 26 mg of the title compound using column chromatography in a yield of 41%.
NMR: 1H-NMR(CDCl3) δ 8.01~7.78(lH, m), 7.96(1H, s), 7.78~7.75(2H, m), 7.29(1H, s), 7.15-7.11(3H, m), 6.92~6.88(1H, m), 5.30(2H, s), 4.35~4.32(2H, m), 3.89(3H, s), 3.87(3H, s), 1.84~1.79(2H, m), 1.02-0.98 (3H, m) Mass(EI) 465(M++!)
EXAMPLE 106: Preparation of l-|"(2EV2-r3-(4-fluorophenvnisoxazol-5-yll-2- (propoxyimino)ethyll -6-methoxy- 1 H-indol-3 -carboxylic acid
Figure imgf000168_0001
26 mg (0.056 mmol) of methyl l-[(2E)-2-[3-(4-fluorophenyl)isoxazol-5-yl]-2- (propoxyimino)ethyl]-6-methoxy-lH-indol-3-carboxylate was dissolved in tetrahydrofuran: methanol: 6N NaOH(l:l:l), and stirred under reflux for 5 hours. After acidification with IN HCl to pH 2, the resulting solution was extracted with ethyl acetate. The reaction solution was dried over anhydrous sodiumsulfate and filtered off to give 13 mg of the title compound in a yield of 52%.
NMR: 1H-NMR(CDCl3) δ 8.06(1H, s), 8.04(1H, s), 7.79~7.74(2H, m), 7.3O(1H, s), 7.15~7.10(2H, m), 6.99~6.98(1H, m), 6.95~6.9O(1H, m), 5.33(2H, s), 4.33(2H, m), 3.90(3H, s), 1.82(2H, m), 0.99(3H, m)
Mass(EI) 451(M++l)
PREPARATION 74: Preparation of methyl l-r(2ZV2-(3-phenoxyphenyl>2- ("propoxyimino)ethyll - 1 H-indol-3 -carboxylate 80 mg of the title compound was obtained in a yield of 31% in the same manner as in PREPARATION 73, except that 201 mg (0.58 mmol) of (lZ)-2-bromo-l-(3- phenoxyphenyl)ethanone O-propyloxime obtained in PREPARATION 23, 121 mg (0.69 mmol) of methyl 1 H-indol-3 -carboxylate, and 38 mg (0.87 mmol) of 55wt% sodium hydride were used.
NMR: 1H-NMR(CDCl3) δ 8.14~8.11(1H, m), 7.73(1H, s), 7.35~7.28(4H, m), 7.27~7.20(3H, m), 7.16~7.14(2H, m), 7.11~7.O7(1H, m), 6.95~6.92(1H, m), 6.90~6.88(2H, m), 5.32(2H, s), 4.25(2H, m), 3.88(3H, s), 1.77(2H, m), 0.97(3H, m)
MaSs(EI) 442(M++1)
EXAMPLE 107: Preparation of sodium l-r(2Z)-2-(3-phenoxyphenylV2- (propoxyimino)ethyli - 1 H-indol-3 -carboxylate
Figure imgf000169_0001
80 mg (0.18 mmol) of methyl l-[(2Z)-2-(3-ρhenoxyρhenyl)-2- (propoxyimino)ethyl]-l H-indol-3 -carboxylate obtained in PREPARATION 74 was dissolved in tetrahydrofuran: methanol: 6N NaOH(1 :1:1), and stirred under reflux for 5 hours. After removal of tetrahydrofuran, 44 mg of the title compound was obtained from the residue using high performance liquid chromatography (HPLC) in a yield of 54%
NMR: 1H-NMR(CD3OD) δ 8.04~8.00(1H, m), 7.81(1H, s), 7.37~7.34(1H, m), 7.30~7.14(7H, m), 7.07~7.03(2H, m), 6.89~6.87(1H, m), 6.80~6.77(2H, m), 5.49(1H, s), 4.24(2H, t, J=6.8Hz), 1.80-1.75(2H, m), 0.99(3H, t, J=7.4Hz)
Mass(EI) 429(M++1)
EXAMPLE 108: Preparation of sodium l-f(2ZV2-(ethoxyiminoV2-(3- phenoxyphenyPethyli - 1 H-indol-3 -carboxylate
Figure imgf000170_0001
44 mg of the title compound was obtained in a yield of 17% in the same manner as in PREPARATION 73 and EXAMPLE 107 in sequence, except that 201 mg (0.60 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in
PREPARATION 47, 126 mg (0.72 mmol) of methyl 1 H-indol-3 -carboxylate and 40 mg
(0.90 mmol) of 55 wt% sodium hydride were used.
NMR: 1H-NMR(CD3OD) δ 8.16~8.14(1H, m), 7.64(1H, s), 7.29~7.25(3H, m), 7.20~7.15(2H, m), 7.10~7.03(4H, m), 6.85~6.82(1H, m), 6.80~6.77(2H, m), 5.43(2H, s), 4.32(2H, q, J=7.4Hz), 1.37(3H, t, J=7.4Hz)
Mass(EI) 415(M++1)
EXAMPLE 109: Preparation of sodium l-[(2ZV2-(ethoxyimino>2-(3- phenoxyphenyPethyli-o-methoxy- 1 H-indol-3 -carboxylate
Figure imgf000171_0001
180 mg of the title compound was obtained in a yield of 41% in the same manner as in PREPARATION 73 and EXAMPLE 107 in sequence, except that 309 mg (0.93 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in
PREPARATION 47, 228 mg (1.11 mmol) of methyl 6-methoxy-l H-indol-3 -carboxylate and 61 mg (1.39 mmol) of 55 wt% sodium hydride were used.
NMR: 1H-NMR(CD3OD) δ 8.00~7.98(lH, m), 7.53(1H, s), 7.29~7.25(2H, m), 7.21~7.19(2H, m), 7.05(2H, m), 6.86~6.83(1H, m), 6.78~6.76(3H, m), 6.74~6.71(1H, m), 5.39(2H, s), 4.32(2H, m), 1.36(3H, m)
MaSs(EI) 445(M++1)
EXAMPLE 110: Preparation of l-r(2ZV2-(ethoxyiminoV2-('3-phenoxyphenvnethyll-4- methoxy- 1 H-indol-3 -carboxylic acid
Figure imgf000171_0002
37 mg of the title compound was obtained in a yield of 16% in the same manner as in PREPARATION 73 and EXAMPLE 106 in sequence, except that 170 mg (0.51 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in PREPARATION 47, 125 mg (0.61 mmol) of methyl 4-methoxy-lH-indol-3-carboxylate, and 33 mg (0.76 mmol) of 55 wt% sodium hydride were used.
NMR: 1H-NMR(CD3OD) δ 7.88(1H, s), 7.33~7.30(2H, m), 7.26~7.19(2H, m), 7.16~7.14(1H, m), 7.10~7.06(3H, m), 6.94~6.86(3H, m), 6.73(1H, d, J=7.9Hz), 5.30(2H, s), 4.33(2H, q, J=6.8Hz), 4.09(3H, s), 1.34(3H, t, J=6.8Hz)
Mass(EI) 466(M++1)
EXAMPLE 111: Preparation of (4-{[(2ZV2-(ethoxyimino)-2-(3- phenoxyphenyHethylloxylphenyPacetic acid
Figure imgf000172_0001
126 mg of the title compound was obtained in a yield of 87% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 120 mg (0.36 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in
PREPARATION 47, 66 mg (0.40 mmol) of methyl (4-hydroxyρhenyl)acetate, and 175 mg (0.54 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.42(1H, d, J=8.0Hz), 7.39(1H, s), 7.35~7.28(3H, m), 7.16(2H, d, J=8.6Hz), 7.09(1H, t, J=7.9Hz), 6.98(3H, m), 6.85(2H, d, J=8.6Hz), 5.16(2H5 s), 4.29(2H, t, J=6.8Hz), 3.57(2H, s), 1.35(3H, t, J=6.8Hz)
Mass(EI) 405(M++!)
PREPARATION 75: Preparation of methyl Q-hvdroxyphenvOacetate
1.1 g of the title compound was obtained in a yield of 99% in the same manner as in PREPARATION 63, except that 1 g (6.57 mmol) of (2-hydroxyρhenyl)acetic acid was used.
NMR: 1H-NMR(CDCl3) δ 7.33(1H, bs), 7.19(1H, dt, J=I.9Hz, 8.0Hz), 7.09(1H, dt, J=I.9Hz, 8.0Hz), 6.93(1H, d, J=7.4Hz), 6.88(2H, t, J=7.4Hz), 3.75(3H, s), 3.68(2H, s)
Mass(EI) 166(M++!)
EXAMPLE 112: Preparation of (2-{[(2ZV2-(ethoxyiminoV2-(3- phenoxyphenvDethvπoxylphenvDacetic acid
Figure imgf000173_0001
115 mg of the title compound was obtained in a yield of 52% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 183 mg (0.55 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in PREPARATION 47, 100 mg (0.60 mmol) of methyl (2-hydroxyphenyl)acetate, and 267 mg (0.82 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.35~7.27(4H, m), 7.26~7.22(2H, m), 7.14~7.12(1H, dd, J=1.9Hz, 7.4Hz), 7.07(1H, t, J=8.0Hz), 6.98~6.91(5H, m), 5.20(2H, s), 4.28(2H, q, J=7.4Hz), 3.47(2H, s), 1.33(3H, t, J=7.4Hz)
Mass(EI) 405(M++l)
PREPARATION 76: Preparation of methyl-3-(2-hvdroxyphenvnpropanoate
540 mg of the title compound was obtained in a yield of 99% in the same manner as in PREPARATION 63, except that 500 mg (3.01 mmol) of 3-(2- hydroxyphenyl)propanoic acid was used.
NMR: 1H-NMR(CDCl3) δ 7.13~7.1O(1H, m), 7.09-7.07(1H5 d, J=7.4Hz), 6.99(1H, bs), 6.88~6.84(2H, m), 3.68(3H, s), 2.90(2H, t, J=6.9Hz), 2.72(2H, t, J=6.9Hz)
Mass(EI) 180(M++l)
EXAMPLE 113: Preparation of 3-f2-{r(2ZV2-(ethoxyiminoV2-(3- phenoxyphenvDethyll oxy I phenyDpropanoic acid
Figure imgf000174_0001
110 mg of the title compound was obtained in a yield of 26% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 169 mg (0.50 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanone O-ethyloxime obtained in PREPARATION 47, 100 mg (0.55 mmol) of methyl-3-(2-hydroxyphenyl)propanoate, and 247 mg (0.76 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.39(1H, d, J=8.0Hz), 7.36(1H, m), 7.34~7.28(3H, m), 7.2O(1H, m), 7.14~7.12(1H, dd, J=1.2Hz, 7.4Hz), 7.09(1H, t, J=7.4Hz), 7.00~6.97(3H, m), 6.94~6.88(2H, m), 5.22(2H, s), 4.33(2H, q, 7.3Hz), 2.77(2H, m), 2.43(2H, m), 1.38(3H, t, J=7.3Hz)
Mass(EI) 419(M++1)
PREPARATION 77: Preparation of 3-[dZV2-bromo-N-ethoxyethaneimidoyllphenyl propane- 1 -sulfonate
(1) Preparation of 3 -acetylphenyl propane- 1 -sulfonate
1 g (7.35 mmol) of l-(3-hydroxyphenyl)ethanon was dissolved in dichloromethane, then 0.91 mL (8.08 mmol) of propane- 1-sulfonyl chloride and 1.6 mL
(11.03 mmol) of triethylamine, respectively, were slowly added thereto, while the resulting solution was kept at 0 °C . After stirring for 5 hours at room temperature, the resulting solution was extracted with dichloromethane and water, then an organic layer obtained was dried over anhydrous magnesium sulfate and filtered off. Solvent was removed from the filtrate to give 1.8 g of the title compound using column chromatography in a yield of 99%.
NMR: 1H-NMR(CDCl3) δ 7.9O~7.88(1H, m), 7.81(1H, m), 7.54~7.47(2H, m), 3.28~3.25(2H, m), 2.61(3H, s), 2.05~2.00(2H, m), 1.16~1.12(3H, m)
Mass(EI) 242(M++1)
(2) Preparation of 3 -(2-bromoacetvDphenyl propane- 1 -sulfonate
1.8 g (7.64 mmol) of 3-acetylphenyl propane- 1 -sulfonate and 3.7 g (7.64 mmol) of tetrabutylammoniumtribromide were dissolved in 20 mL of chloroform /6 mL of methanol, followed by stirring for 12 hours at room temperature. The resulting solution was extracted with water and ethyl acetate, then an organic layer was dried over anhydrous magnesium sulfate and filtered off, solvent was removed to obtain 2.4 g of the title compound using column chromatography in a yield of 99%.
NMR: 1H-NMR(CDCl3) δ 7.94~7.92(1H, m), 7.85(1H, s), 7.58~7.53(2H, m), 3.30~3.26(2H, m), 2.08~2.01(2H, m), 1.16~1.12(3H, m)
Mass(EI) 321, 323(M++l)
(3) Preparation of 3-[(lZV2-bromo-N-ethoxyethaneimidoyllphenyl 4- methylbenzensulfonate
198 mg of the title compound was obtained in a yield of 34% in the same manner as in PREPARATION 1 -(2), except that 518 mg (1.61 mmol) of 3-(2- bromoacetyl)phenyl propane- 1 -sulfonate and 174 mg (1.78 mmol) of ethoxyamine hydrochloride were used. NMR: 1H-NMR(CDCl3) δ 7.66~7.64(1H, m), 7.62~7.6O(1H, m), 7.44(1H, t=8.0Hz), 7.32~7.3O(1H, m), 4.53(2H, s), 4.35~4.31(2H, m), 3.26~3.22(2H, m), 2.22~2.01(2H, m), 1.37~1.33(3H, m), 1.14-1.11(3H9 In)
Mass(EI) 364, 366(M++1)
EXAMPLE 114: Preparation of l-[f2ZV2-(ethoxyiminoV2-f3- lYpropylsulfonvDoxyiphenyl 1 ethyll - 1 H-indol-3 -carboxylic acid
Figure imgf000177_0001
5 mg of the title compound was obtained in a yield of 6% in the same manner as in PREPARATION 73 and EXAMPLE 106 in sequence, except that 66 mg (0.18 mmol) of 3-[(lZ)-2-bromo-N-ethoxyethaneimidoyl]phenyl 4-methylbenzensulfonate,
39 mg (0.69 mmol) of methyl 1 H-indol-3 -carboxylate, and 12 mg (0.27 mmol) of 55 wt% sodium hydride were used.
NMR: 1H-NMR(CDCl3) δ 8.17~8.15(1H, m), 7.85(1H, s), 7.42~7.38(3H, m), 7.33~7.28(3H, m), 7.25~7.22(1H, m), 5.38(2H, s), 4.39(2H, q, J=7.3Hz), 3.07(2H, m), 1.96~1.88(2H, m), 1.39(3H, t, J=7.4Hz), 1.05(3H, t, J=7.3Hz)
Mass(EI) 444(M++l) PREPARATION 78; Preparation of (lZV2-bromo-l-r3-
(trifluoromethoxy)phenyl] ethanon O-ethyloxime
561 mg of the title compound was obtained in a yield of 66% in the same manner as in PREPARATION 1 -(2), except that 733 mg (2.6 mmol) of 2-bromo-l-[3- (trifluoromethoxy)phenyl]ethanon and 253 mg (2.6 mmol) of ethoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 7.63~7.61(1H, m), 7.6O(1H, s), 7.42(1H, t=8.0Hz), 7.26~7.23(1H, m), 4.53(2H, s), 4.37-4.31(2H, m), 1.38~1.34(3H, m)
Mass(EI) 326, 328(M++1)
EXAMPLE 115: Preparation of sodium- 1- ((2ZV2-rethoxyiminoV2-r3- (trifluoromethoxy>)phenyl1ethvU-5-fluoro-lH-indol-3-carboxvlate
Figure imgf000178_0001
21 mg of the title compound was obtained in a yield of 16% in the same manner as in PREPARATION 2 and EXAMPLE 107 in sequence, except that 100 mg (0.30 mmol) of (lZ)-2-bromo-l-[3-(trifluoromethoxy)phenyl]ethanon O-ethyloxime, 74 mg
(0.36 mmol) of ethyl 5-fluoro-lH-indol-3-carboxylate, and 146 mg (0.45 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.81~7.78(1H, m), 7.69(1H, s), 7.45~7.43(1H, m), 7.4O(1H, s), 7.33~7.29(2H, m), 7.17~7.13(1H, m), 6.9O~6.85(1H, m), 5.49(2H, s), 4.38~4.35(2H, m), 1.38(3H, m)
Mass(EI) 425(M++1)
PREPARATION 79: Preparation of 3-rriZV2-bromo-N-proρoxyethaneimidoyl]phenyl propane- 1 -sulfonate
360 mg of the title compound was obtained in a yield of 16% in the same manner as in PREPARATION l-(2), except that 1.9 g (6.07 mmol) of 3-(2- bromoacetyl)phenyl propane- 1 -sulfonate and 745 mg (1.78 mmol) of propyloxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 7.66~7.64(1H, m), 7.61(1H, m), 7.44(1H, t=8.0Hz), 7.32~7.3O(1H, m), 4.53(2H, s), 4.24(2H, t, J=6.8Hz), 3.26~3.22(2H, m), 2.08~2.00(2H, m), 1.80~1.72(2H, m), 1.14~1.10(3H, m), 1.00~0.97(3H, m)
Mass(EI) 378, 380(M++l)
PREPARATION 80: Preparation of methyl- lH-indol-3-ylacetate
2.1 g of the title compound was obtained in a yield of 97% in the same manner as in PREPARATION 63, except that 2 g (11.4 mmol) of lH-indol-3-ylacetic acid was used.
NMR: 1H-NMR(CDCl3) δ 8.08(1H, bs), 7.61(1H5 d, J=7.9Hz), 7.36(1H, d, J=7.9Hz), 7.22-7.12(3H, m), 3.77(2H, s), 3.70(3H, s)
Mass(EI) 189(M++1)
PREPARATION 81: Preparation of methyl (l-[(2ZV2-(proρoxyiminoV2-(3- [(propylsulfonyl*)oxy]phenyl I ethyl] - 1 H-indol-3 - yl I acetate
126 mg of the title compound was obtained in a yield of 35% in the same manner as in PREPARATION 2, except that 277 mg (0.73 mmol) of 3-[(lZ)-2-bromo- N-propoxyethaneimidoyl]phenyl propane- 1 -sulfonate, 152 mg (0.81 mmol) of methyl- 1 H-indol-3 -ylacetate, and 358 mg (1.10 mmol) of cesiumcarbamate were used.
NMR: 1H-NMR(CD3OD) δ 7.56(1H, d, J=7.9Hz), 7.37~7.34(3H, m), 7.27(1H, m), 7.23~7.16(2H, m), 7.13~6.9O(1H, m), 7.02(1H, s), 5.29(2H, s), 4.28(2H, t, J=6.7Hz), 3.79(2H, s), 3.66(3H, s), 3.02(2H, m), 1.92~1.87(2H, m), 1.82~1.78(2H, m), 1.06~0.99(6H, m)
Mass(EI) 486(M++1)
EXAMPLE 116: Preparation of sodium (l-r(2Z)-2-(propoxyiminoV2-(3- lYpropylsulfonyOoxylphenyl 1 ethyli - 1 H-indol-3 -yl } acetate
Figure imgf000180_0001
126 mg (0.26 mmol) of methyl {l-[(2Z)-2-(propoxyimino)-2-{3-
[(propylsulfonyl)oxy]phenyl}ethyl]-lH-indol-3-yl}acetate was dissolved in a mixture of tetrahydrofuran and IN NaOH (2:1), and stirred for 5 hours, and then tetrahydrofuran was removed. 110 mg of the title compound was obtained from the filtrate using high performance liquid chromatography (HPLC) in a yield of 86%.
NMR: 1H-NMR(CD3OD) δ 7.54(1H, d, J=8.0Hz), 7.46(1H, d, J=8.0Hz), 7.35(1H, m), 7.31~7.27(2H, m), 7.19~7.16(1H, m), 7.09~7.05(lH, t, J=7.4Hz), 7.05(1H, s), 6.96(1H, t, J=7.4Hz), 5.42(2H, s), 4.27(2H, t, J=6.8Hz), 3.48(2H, s), 3.06(2H, m), 1.83-1.79(4H, m), 1.10~0.99(6H, m)
Mass(EI) 473(M++l)
PREPARATION 82: Preparation of 3-rαzy2-bromo-N-ethoxyethaneimidoyl1ρhenyl 4- methylbenzensulfonate
( 1 ) Preparation of 3 -acetylphenyl 4-methylbenzensulfonate
2.1 g of the title compound was obtained in a yield of 99% in the same manner as in PREPARATION 77-(l), except that 1 g (7.35 mmol) of l-(3- hydroxyphenyl)ethanon, 1.2 mL (8.08 mmol) of 4-methylbenzensulfonyl chloride, and 1.6 mL (11.03 mmol) of triethylamine were used.
NMR: 1H-NMR(CDCl3) δ 7.85~7.82(1H, dd, J=I.2Hz, 9.2Hz)5 7.71(2H, d, J=8.0Hz), 7.51(1H, m), 7.41(1H, t, J=8.0Hz), 7.32(2H, d, J=8.0Hz), 7.24~7.21(1H, m), 2.52(3H, s), 2.45(3H, s) Mass(EI) 290(M+-I-I)
(2) Preparation of 3 -(2-bromoacetvDphenyl 4-methylbenzensulfonate
2.7 g of the title compound was obtained in a yield of 98% in the same manner as in PREPARATION 77-(2), except that 2.1 g (7.52 mmol) of 3-acetylphenyl 4- methylbenzensulfonate and 3.6 g (7.52 mmol) of tetrabutylammoniumtribromide were used.
NMR: 1H-NMR(CDCl3) δ 7.87(1H, d, J=8.0Hz), 7.71(2H, d, J=8.6Hz), 7.52(1H, m), 7.45(1H, t, J=8.0Hz), 7.33(2H, d, J=8.0Hz), 7.3O(1H, dd, J=2.5Hz, 8.0Hz), 4.32(2H5 s), 2.45(3H, s)
Mass(EI) 369, 371(M++1)
(3) Preparation of 3-[dZ)-2-bromo-N-ethoxyethaneimidoyl]phenyl 4- methylbenzensulfonate
205 mg of the title compound was obtained in a yield of 34% in the same manner as in PREPARATION l-(2), except that 546 mg (1.48 mmol) of 3-(2- bromoacetyl)phenyl 4-methylbenzensulfonate and 159 mg (1.63 mmol) of ethoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 7.72(2H, d, J=8.6Hz), 7.59(1H, d, J=8.0Hz), 7.33~7.29(3H, m), 7.24~7.22(1H, m), 7.07~7.03(lH, m), 4.41(2H, s), 4.30~4.26(2H, m), 2.43(3H, s), 1.35~1.31(3H, m) Mass(EI) 412, 414(M++1)
EXAMPLE 117: Preparation of sodium g-|Y2Zy2-fethoxyimino>2-(3-{r(4- methylphenvDsulfbnyll oxyl phenyHethyli - 1 H-indol-3 -yl 1 acetate
Figure imgf000183_0001
80 mg of the title compound was obtained in a yield of 49% in the same manner as in PREPARATION 2 and EXAMPLE 116 in sequence, except that 128 mg (0.31 mmol) of 3-[(lZ)-2-bromo-N-ethoxyethaneimidoyl]phenyl 4-methylbenzensulfonate,
65 mg (0.34 mmol) of methyl- 1 H-indol-3 -ylacetate, and 152 mg (0.47 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.40(2H, d, J=8.6Hz), 7.33(1 H, d, J=8.0Hz), 7.08~7.03(3H, m), 6.97(2H, d, J=8.6Hz), 6.93(1H, t, J=7.4Hz), 6.83~6.76(3H, m), 6.54(1H, m), 4.85(1H, s), 4.19(2H, q, J=7.3Hz), 3.31(2H, s), 2.20(3H, s), 1.25(3H, t, J=7.3Hz)
Mass(EI) 507(M++l)
PREPARATION 83: Preparation of methyl (3-ethoχy-5-hydroxyphenvDacetate
1 g (5.49 mmol) of methyl (3,5-dihydroxyphenyl)acetate was dissolved in 1.14 g (8.23 mmol) of N,N-dimethylformamide, then potassiumcarbonate and 0.2 mL of (2.75 tnmol) of bromoethane were added thereto followed by stirring for 3 hours, while heating to 80 °C . The resulting solution was extracted with ethyl acetate and water, then an organic layer obtained was separated and dried over anhydrous magnesium sulfate, then solvent was removed to give 364 mg of the title compound using column chromatography in a yield of 32%.
NMR: 1H-NMR(CDCl3) δ 6.39(1H, s), 6.35(1H, s), 6.3O(1H, m), 5.2O(1H, bs), 3.98(2H, q, J=6.8Hz), 3.69(3H, s), 3.51(2H, s), 1.38(3H, t, J=6.8Hz)
Mass(EI) 210(M++l)
EXAMPLE 118: Preparation of (3-ethoxy-5-(r(2ZV2-(methoxyiminoV2-(3- phenoXVphenyDethVnoXVlphenyDacetic acid
Figure imgf000184_0001
110 mg of the title compound in a yield of 69% in the same manner as in
PREPARATION 2 and EXAMPLE 1 in sequence, except that 118 mg (0.37 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanon O-methyloxime, 85 mg (0.41 mmol) of methyl (3-ethoxy-5-hydroxyphenyl)acetate, and 180 mg (0.55 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.39(1H, d, J=8.0Hz), 7.36(1H, s), 7.32~7.27(3H, m), 7.08(1H, t, J=7.4Hz), 7.00~6.96(3H, m), 6.43(1H, s), 6.4O(1H, s), 6.36(1H, m), 5.10(2H, s), 4.02(3H, s), 3.95(2H, m), 3.53(2H, s), 1.37(3H, m)
Mass(EI) 435(M++!)
PREPARATION 84: Preparation of methyl r3-ethoxy-5-(r(2E)-2-f3-(4- fluorophenvπisoxazol-5-yll-2-(propoxyimino>)ethyl]oxy}phenyl)acetate
423 mg of the title compound was obtained in a yield of 99% in the same manner as in PREPARATION 2, except that 310 mg (0.91 mmol) of (lZ)-2-bromo-l-[3-
(4-fluorophenyl)isoxazol-5-yl]ethanon O-propyloxime obtained in PREPARATION 1- (2), 210 mg (1.0 mmol) of methyl (3-ethoxy-5-hydroxyphenyl)acetate and 445 mg (1.4 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 7.80(2H, m), 7.16~7.12(2H, m), 6.9O(1H, s), 6.47~6.45(2H, m), 6.42(1H, m), 5.12(2H, s), 4.32~4.29(2H, m), 4.00~3.96(2H, m), 3.68(3H, s), 3.53(2H, s), 1.83~1.78(2H, m), 1.40-1.36(3H, m), 1.02~0.98(3H, m)
Mass(EI) 470(M++l)
EXAMPLE 119: Preparation of sodium (3-ethoxy-5-(r(2EV2-r3-(4- fluorophenvDisoxazol-5-yl1-2-(propoxyimino)ethylloxy|phenvπacetate
Figure imgf000186_0001
240 mg of the title compound was obtained in a yield of 55% in the same manner as in EXAMPLE 116, except that 430 mg (0.91 mmol) of methyl (3-ethoxy-5- { [(2E)-2- [3 -(4-fluorophenyl)isoxazol-5 -yl] -2-(propoxyimino)ethyl] oxy } phenyl)acetate was used.
NMR: 1H-NMR(CD3OD) δ 7.88(2H, dd, J=8.6Hz, 4.9Hz), 7.21(2H, t, J=8.6Hz), 6.54(2H, d, J=12.2Hz), 6.34(1H, s), 5.14(2H, s), 4.28(2H, t, J=6.8Hz), 3.96(2H, q, J=7.3Hz), 3.37(2H, s), 1.80(2H, m), 1.32(3H, t, J=6.8Hz), 1.00(3H, t, J=7.3Hz)
Mass(EI) 457(M++1)
PREPARATION 85: Preparation of qZV2-bromo-l-r3-φyridine-2- yloxy)phenyl]ethanon O-ethyloxime
( 1) Preparation of 3 -(2-methyl- 1 „3 -dioxolan-2- vDphenol
10 g (73.45 mmol) of l-(3-hydroxyphenyl)ethanon was dissolved in 100 mL of benzene, then 20.5 mL (367.2 mmol) of ethylene glycol, 335 mg (2.20 mmol) of para- toluene sulfonic acid monohydrate were added in sequence thereto. While strong a reaction solution under reflux using Dean-stack, water which was produced during a reaction was removed. After completion of the reaction, solvent was removed and the resulting solution was extracted with ethyl acetate and sodium bicarbonate solution. An organic layer was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain 4.8 g of the title compound using column chromatography in a yield of 36%.
NMR: 1H-NMR(CDCl3) δ 7.25~7.19(1H, m), 7.05-7.03(1H5 m), 7.00~6.97(lH, m), 6.78~6.75(1H, m), 5.21(bs, IH), 4.04~4.02(2H, m), 3.80~3.78(2H, m), 1.65(3H, s)
Mass(EI) 180(M++l)
(2) Preparation of 2- ["3 -(2-methyl- 1.3 -dioxolan-2-yl)phenoχy"|pyridine
4.8 g (26.6 mmol) of 3-(2-methyl-l,3-dioxolan-2-yl)phenol was dissolved in 50 mL of 2-chloropyridine as a solvent as well as a reactant. Herein, 50 mg (0.50 mmol) of l-methylpyrrolidine-2-one was added thereto to increase the solubility. After confirming they were dissolved, 3.6 g (32 mmol) of potassium t-butoxide was added thereto, and stirred while heating to 150°C. After completion of the reaction, solvent was removed and the resulting solution was extracted with ethyl acetate and water. An organic layer separated was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain 6.0 g of the title compound using column chromatography in a yield of 88%.
NMR: 1H-NMR(CDCl3) δ 8.20~8.18(lH, m), 7.68~7.66(1H, m), 7.36~7.33(1H, m), 7.31~7.29(1H, m), 7.26~7.24(1H, m), 7.08~7.06(lH, s), 7.02~6.99(lH, s), 6.91~6.9O(1H, s), 4.02~4.00(2H, m), 3.79~3.77(2H, m), 1.62(3H, s) Mass(EI) 257(M++!)
(3) Preparation of 1 -r3-(pyridine-2-yloxy)phenyl1ethanon
6 g (23.3 mmol) of 2-[3-(2-methyl-l,3-dioxolan-2-yl)phenoxy]pyridine was dissolved in acetone, then 2.6 niL of (35.0 mmol) of trifluoroacetic acid was added thereto followed by stirring under reflux. After completion of the reaction, solvent was removed and the resulting solution was extracted with ethyl acetate and 6 N aqueous sodiumhydroxide solutions. An organic layer was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain 5 g of the title compound using column chromatography in a yield of 99%.
NMR: 1H-NMR(CDCl3) δ 8.18(1H, m), 7.79~7.77(1H, m), 7.73~7.71(2H, m), 7.49(1H, t, J=8.0Hz), 7.36~7.33(1H, m), 7.03~7.01(lH, m), 6.96(1H, d, J=8.6Hz), 2.59(3H, s)
Mass(EI) 213(M++1)
(4) Preparation of 2-bromo-l -|"3-(pyridine-2-yloxy)phenyl1ethanon
5 g (23.3 mmol) of l-[3-(pyridine-2-yloxy)phenyl]ethanon was dissolved in 50 mL of acetic acid, then a solution in which 7.5 g (23.3 mmol) of pyridinehydrobromide perbromide was dissolved in 150 mL of acetic acid was added thereto. The resulting solution was stirred while heating to 40 °C . After completion of the reaction, solvent was removed and the resulting solution was extracted with ethyl acetate and water. An organic layer was dried over anhydrous magnesium sulfate and filtered off, and then solvent was removed to obtain column 1.6 g of the title compound using column chromatography in a yield of 23%.
NMR: 1H-NMR(CDCl3) δ 8.17(1H, dd, J=I.9Hz, 4.9Hz), 7.8O(1H, d, J=8.0Hz), 7.76~7.71(2H, m), 7.52(1H, t, J=8.0Hz), 7.4O(1H, dd, J=2.5Hz, 7.4Hz), 7.03(1H, dd, J=4.9Hz, 7.4Hz), 6.97(1H, d, J=7.1Hz), 4.43(2H, s)
Mass(EI) 292(M++1)
(5) Preparation of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O- ethyloxime
334 mg of the title compound was obtained in a yield of 36% in the same manner as in PREPARATION l-(2), except that 800 mg (2.74 mmol) of 2-bromo-l-[3- (pyridine-2-yloxy)phenyl]ethanon and 267 mg (2.74 mmol) of ethoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 8.2O(1H, d, J=4.9Hz), 7.71~7.67(1H, m), 7.56~7.52(2H, m), 7.41(1H, t, J=8.0Hz), 7.18~7.16(1H, m), 7.01~6.98(lH, m), 6.92(1H, d, J=8.0Hz), 4.51(2H, s), 4.33~4.30(2H, m), 1.35~1.31(3H, m)
Mass(EI) 335(M++1)
EXAMPLE 120: Preparation of sodium l-((2Z)-2-(ethoxyiminoV2-r3-(pyridine-2- yloxy)phenyl1ethvU-5-fluoro-lH-indol-3-carboxylate
Figure imgf000190_0001
30 mg of the title compound was obtained in a yield of 22% in the same manner as in PREPARATION 2 and EXAMPLE 107 in sequence, except that 100 mg (0.29 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O-ethyloxime, 68 mg (0.33 mmol) of 5-fluoro-lH-indol-3-carboxylate, and 146 mg (0.45 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CD3OD) δ 8.09~8.07(lH, m), 7.82~7.79(1H, m), 7.77~7.73(1H, m), 7.68(1H, s), 7.37~7.34(1H, m), 7.30~7.26(2H, m), 7.18(1H, m), 7.09~7.05(lH, m), 7.01-6.98(IH, m), 6.85~6.8O(1H, m), 6.59(1H, d, J=8.0Hz), 5.46(2H, s), 4.32(2H, q, J=6.8Hz), 1.37(3H, J=6.8Hz)
Mass(EI) 434(M++l)
PREPARATION 86: Preparation of (lZV2-bromo-l-[3-(ρyridine-2- yloxy*)phenyllethanon θ-propyloxime
234 mg of the title compound was obtained in a yield of 24% in the same manner as in PREPARATION l-(2), except that 800 mg (2.74 mmol) of 2-bromo-l-[3- (pyridine-2-yloxy)phenyl]ethanon and 305 mg (2.74 mmol) of propyloxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 8.19(1H, m), 7.71~7.67(1H, m), 7.56~7.51(2H, m), 7.41(1H, t, J=8.0Hz), 7.17~7.15(1H, m), 7.01~6.98(lH, m), 6.92(1H, d, J=8.6Hz), 4.52(2H, s), 4.22(2H, q, t=6.8Hz), 1.78~1.71(2H, m), 1.00~0.96(3H, m)
Mass(EI) 349(M++1)
EXAMPLE 121: Preparation of r3-({r2Z)-2-(propoxyimino)-2-r3-(pyridine-2- yloxytohenyli ethyl ) oxy^phenyli acetic acid
Figure imgf000191_0001
30 mg of the title compound was obtained in a yield of 25% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.29 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O-propyloxime, 52 mg (0.31 mmol) of methyl (3-hydroxyphenyl)acetate, and 140 mg (0.43 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.26(1H, m), 7.71~7.67(1H, m), 7.52~7.5O(1H, m), 7.46~7.44(1H, m), 7.33(1H, t, J=8.0Hz), 7.19~7.16(1H, t, J=8.0Hz), 7.06~7.00(2H, m), 6.89(1H, d, J=8.6Hz), 6.86~6.80(2H, m), 6.75(1H, s), 5.22(2H, s), 4.18(2H, t, J=6.8Hz), 3.51(2H, s), 1.78-1.71(2H, m), 0.97(3H, t, J=6.8Hz)
Mass(EI) 420(M++l) EXAMPLE 122: Preparation of sodium l-((2Zy2-fpropoxyiminoV2-[3-(pyridine-2- yloxytohenyliethyl 1-1 H-indol-3 -carboxylate
Figure imgf000192_0001
120 mg of the title compound was obtained in a yield of 53% in the same manner as in PREPARATION 2 and EXAMPLE 107 in sequence, except that 175 mg (0.50 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O-propyloxime and 97 mg (0.50 mmol) of 1 H-indol-3 -carboxylate were used.
NMR: 1H-NMR(CD3OD) δ 8.16~8.14(1H, m), 8.08~8.07(lH, m), 7.77~7.73(1H, m), 7.65(1H5 s), 7.37~7.34(1H, m), 7.33~7.31(1H, m), 7.29~7.25(1H, m), 7.2O~7.19(1H, m), 7.08~7.05(3H, m), 6.99~6.97(1H, m), 6.57(1H, d, J=8.0Hz), 5.47(2H, s), 4.25(2H, t, J=6.8Hz), 1.81~1.78(2H, m), 1.00(3H, t, J=6.8Hz)
Mass(EI) 430(M++l)
EXAMPLE 123: Preparation of sodium l-{f2Zy2-(ethoxyimino>2-[3-(pyridine-2- yloxy)phenyll ethyl ) - 1 H-indol-3 -carboxylate
Figure imgf000192_0002
130 mg of the title compound was obtained in a yield of 59% in the same manner as in PREPARATION 2 and EXAMPLE 107 in sequence, except that 168 mg (0.50 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O-ethyloxime and 97 mg (0.50 mmol) of lH-indol-3-carboxylate were used.
NMR: 1H-NMR(CD3OD) δ 8.16~8.14(1H, m), 8.08~8.07(lH, m), 7.77~7.73(1H, m), 7.65(1H, s), 7.36~7.34(1H, m), 7.33~7.31(1H, m), 7.28~7.25(1H, m), 7.2O~7.19(1H, m), 7.08~7.05(3H, m), 6.99~6.97(1H, m), 6.58(1H5 d, J=8.0Hz), 5.46(2H, s), 4.34(2H, q, J=6.8Hz), 1.38(3H, t, J=6.8Hz)
Mass(EI) 416(M++l)
EXAMPLE 124: Preparation of sodium (3-isopropyloxy-5-{[(2Z)-2-('ethoxyiminoV2- n-phenoxyphenyPethylioxylphenyPacetate
Figure imgf000193_0001
14 mg of the title compound was obtained in a yield of 41% in the same manner as in PREPARATION 2 and EXAMPLE 116 in sequence, except that 23 mg (0.069 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanon O-ethyloxime, 17 mg (0.076 mmol) of methyl (3-isopropyloxy-5-hydroxyphenyl)acetate, and 34 mg (0.10 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CD3OD) δ 7.39~7.37(1H, d, J=8.0Hz), 7.33~7.28(3H, m), 7.25(1H, m), 7.09~7.05(lH, t, J=7.4Hz), 6.96~6.92(3H, m), 6.46(1H, s), 6.41 (IH, s), 6.23(1H, m), 5.14(2H, s), 4.48(1H, m), 4.25(2H, q, J=7.3Hz), 3.36(2H, s), 1.32(3H, t, J=7.3Hz), 1.24(3H, s), 1.23(6H, s)
Mass(EI) 464(M++!)
EXAMPLE 125: Preparation of sodium (3-isopropyloxy-5-{|Y2Z>2-(propyloxyiminoV 2-(3-phenoxyphenγDethvπoxy}phenyl)acetate
Figure imgf000194_0001
16 mg of the title compound was obtained in a yield of 37% in the same manner as in PREPARATION 2 and EXAMPLE 116 in sequence, except that 28 mg (0.081 mmol) of (lZ)-2-bromo-l-(3-phenoxyphenyl)ethanon O-propyloxime, 20 mg (0.089 mmol) of methyl (3-isopropyloxy-5-hydroxyphenyl)acetate, and 40 mg (0.122 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CD3OD) δ 7.39~7.37(1H, m), 7.33~7.28(3H, m), 7.25(1H, m). 7.09~7.05(lH, t, J=7.4Hz), 6.97~6.91(3H, m), 6.49(1H, s), 6.42(1H, s), 6.22(1H, m), 5.14(2H, s), 4.49(1H, m), 4.16(2H, t, J=6.7Hz), 3.33(2H, s), 1.74(2H, m), 1.24(3H, s), 1.23(3H, s), 0.98(3H51, J=7.4Hz)
Mass(EI) 478(M++1) PREPARATION 87: Preparation of 3-(3-rOZV2-bromo-N- propoxyethaneimidoyπphenyl 1-1.,3-oxazolidine-2-one
(1) Preparation of 3-[3-(bromoacetyr)phenyl]-l,,3-oxazolidine-2-one
190 mg (0.925 mmol) of 3-[3-(acetyl)phenyl]-l,3-oxazolidine-2-one obtained in the same manner as in Org. Lett. 2001, 3, 2539-2541 was added to a solution of chloroform: acetic acid=10:l, then 148 mg (2.87 mmol) of bromine was added thereto. After stirring for 3 hours at room temperature, 5% sodium thiosulfate was added thereto, the resulting solution was extracted with ethyl acetate, an organic layer was dried over anhydrous magnesium sulfate and the residue was purified by column chromatography to obtain 170 mg of the title compound in a yield of 64%.
Mass (EI) 284, 286 (M++l)
(2) Preparation of 3-(3-[2-bromo-N-propoxyethaneimidoyllphenvU-l,3- oxazolidine-2-one
52 mg of the title compound was obtained in a yield of 19% in the same manner as in PREPARATION 1-2, except that 220 mg (0.77 mmol) of 3-[3- (bromoacetyl)phenyl]-l,3-oxazolidine-2-one was used.
NMR: 1H-NMR(CDCl3) δ 7.81(1H, s), 7.71~7.68(1H, m), 7.48~7.26(2H, m), 4.51~4.47(2H, m), 4.37(1H, s), 4.32~4.24(2H, m), 4.10(2H, t, J=8Hz), 1.80~1.73(2H, m), 0.99(3H, t, J=8Hz)
Mass (EI) 341, 343 (M++l) PREPARATION 88: Preparation of (ZVmethyl f3-(2-r3-(2-oxo-1.3-oxazolidine-3- vDphenyl] -2-(propoxyimino*)ethyl } oxy)phenyl acetate
18 mg of the title compound was obtained in a yield of 68% in the same manner as in PREPARATION 2, except that 21 mg (0.06 mmol) of 3-{3-2-bromo-N- propoxyethaneimidoyl]phenyl}-l,3-oxazolidine-2-one and 10 mg (0.06 mmol) of methyl (3-hydroxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.74~7.71(1H, m), 7.66~7.65(1H, m), 7.44~7.33(2H, m), 7.22~7.18(1H, m), 6.87~6.82(3H, m), 5.20(2H, s), 4.47~4.43(2H, m), 4.21(2H, t, J=6.4Hz), 4.05~3.97(2H, m), 3.68(3H, s), 3.56(2H, s), 1.82~1.73(2H, m), 0.93(3H, t, J=8Hz)
Mass (EI) 427 (M++l)
EXAMPLE 126: Preparation of (ZV3-(2-r3-(2-oxo-1.3-oxazolidine-3-yl)phenvn-2- (propoxyimino^ethvUoxy^phenyl acetic acid
Figure imgf000196_0001
8 mg of the title compound was obtained in a yield of 45% in the same manner as in EXAMPLE 1, except that 18 mg (0.04 mmol) of methyl (3-{2-[3-(2-oxo-l,3- oxazolidine-3-yl)phenyl]-2-(propoxyimino)ethyl}oxy)phenyl acetate was used. NMR: 1H-NMR(CDCl3) δ 7.65~7.61(2H, m), 7.43-7.31(2H, m), 7.2O~7.16(1H, m), 6.85~6.81(3H, m), 5.21(2H, s), 4.42~4.36(2H, m), 4.21(2H, t, J=8Hz), 3.98~3.92(2H, m), 3.55(2H, s), 1.81~1.68(2H, m), 0.99(3H, t, J=8Hz)
Mass (EI) 413 (M++!)
PREPARATION 89: Preparation of methyl (3-ethoxy-5-f|T2ZV2-r3-(2-oxo-1.3- oxazolidine-3 -vDphenyl] -2-(propoxyimino)ethyl] oxy } phenvDacetate
18 mg of the title compound was obtained in a yield of 68% in the same manner as in PREPARATION 2, except that 21 mg (0.06 mmol) of 3-{3-2-bromo-N- propoxyethaneimidoyl}phenyl}-l,3-oxazolidine-2-one and 13 mg (0.06 mmol) of methyl (3-ethoxy-5-hydroxyphenyl)acetate were used.
NMR: 1H-NMR(CDCl3) δ 7.76~7.73(1H, m), 7.68~7.64(1H, m), 7.43~7.33(2H, m), 6.45~6.38(3H, m), 5.20(2H, s), 4.48~4.44(2H, m), 4.21(2H, t, J=6Hz), 4.09~4.07(2H, m), 3.97(2H, q, J=4Hz), 3.68(3H, s), 3.51(2H, s), 1.80(2H, q, J=7.2Hz), 1.37(3H, t, J=7.2Hz) 1.01 (3H, t, J=9.6Hz)
Mass (EI) 470 (M++!)
EXAMPLE 127: Preparation of methyl (3-ethoxy-5-(|T2Zy2-r3-(2-oxo-1.3- oxazolidine-3-yl)phenyll-2-(propoχyimino)ethylloxy}phenyπacetate
Figure imgf000198_0001
10 mg of the title compound was obtained in a yield of 48% in the same manner as in EXAMPLE 1, except that 21 mg (0.06 mmol) of methyl (3-ethoxy-5-{[(2Z)-2-[3- (2-oxo- 1 ,3-oxazolidine-3-yl)phenyl]-2-(propoxyimino)ethyl]oxy}phenyl) acetate was used.
NMR: 1H-NMR(CDCl3) δ 7.68-7.63(2H5 m), 7.42-7.31(2H, m), 6.45-6.39(3H5 m), 5.19(2H, s), 4.86~4.35(2H, m), 4.20(2H5 t, J=8Hz), 4.01-3.93(4H5 m), 3.52(2H, s), 1.81-1.67(2H5 m), 1.36(3H5 1, J=4Hz)5 0.99(3H51, J=8Hz)
Mass (EI) 457 (M++l)
EXAMPLE 128: Preparation of (3-r2-r(Zyethoχyimino1-2-(3-phenoxyphenylVethoxyl- phenvU -acetic acid
Figure imgf000198_0002
70 mg of the title compound was obtained in a yield of 58% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg of 2-bromo- l-(3-phenoxyphenyl)-ethanon 0-ethyloxime and 52 mg (0.31 mmol) of (3- hydroxyphenyl)-acetic acid methyl ester were used.
Mass(EI) 406 (M++l)
EXAMPLE 129: Preparation of [3-f{('2Z)-2-(ethoxyimino)-2-r3-(pyridine-2- yloxy*)phenvnethvUoxy)phenvnacetic acid
Figure imgf000199_0001
90 mg of the title compound was obtained in a yield of 41% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.30 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon 0-ethyloxime, 50 mg (0.30 mmol) of methyl (3-hydroxyphenyl)acetate, and 140 mg (0.43 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.3O~8.28(1H, m), 7.74~7.7O(1H, m), 7.51(1H, d, J=8Hz), 7.44(1H, t, J=2Hz), 7.33(1H, t, J=8Hz), 7.18(1H, t, J=8Hz), 7.06~7.00(2H, m), 6.94(1H, d, J=8Hz), 6.87~6.85(1H, m), 6.81(1H, d, J=8Hz), 6.71(1H, t, J=2Hz), 5.24(2H, s), 4.28(2H, q, J=7Hz), 3.49(2H, s), 1.33(3H, t, J=7Hz)
Mass(EI) 407(M++l)
EXAMPLE 130: Preparation of r3-(((2ZV2-(methoxyiminoV2-|"3-('pyridine-2- yloxy)phenyll ethyl I oxy)phenyl1 acetic acid
Figure imgf000200_0001
50 mg of the title compound was obtained in a yield of 62% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 120 mg (0.37 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanon O-methyloxime, 60 mg (0.37 mmol) of methyl (3-hydroxyphenyl)acetate, and 140 mg (0.43 mmol) of cesium carbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.28~8.26(1H, m), 7.72~7.69(1H, m), 7.5O(1H, d, J=8Hz), 7.44(1H, t, J=2Hz), 7.34(1H, t, J=8Hz), 7.18(1H, t, J=8Hz), 7.05~7.01(2H, m), 6.92(1H, d, J=8Hz), 6.84~6.82(1H, m), 6.80(1H5 d, J=8Hz), 6.72(1H, s), 5.20(2H5 s), 4.01(3H, s), 3.49(2H5 s)
Mass(EI) 393(M++l)
PREPARATION 90: Preparation of methyl (3-r2-(2-naphthylV2- oxoethoxylphenvU acetate
340 mg of the title compound was obtained in a yield of 63% in the same manner as in PREPARATION 2, except that 400 mg (1.61 mmol) of 2-bromo-l-(2- naphthyl)ethanone, 400 mg (2.41 mmol) of methyl (3-hydroxyphenyl)acetate and 1.05 g (3.21 mmol) of cesiumcarbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.54(1H5 s), 8.05-8.03(1H5 dd, J=I.2Hz5 8.6Hz)5 7.99(1H5 d, J=8.6Hz), 7.93(1H5 d, J=8.6Hz)5 7.89(1H5 d, J=8.6Hz)5 7.63(1H5 td, J=I.2Hz5 8.0Hz)5 7.58(1H, td, J=1.2Hzs 8.0Hz), 7.25(1H, t, J=8.0Hz), 6.94(3H, m), 5.40(2H, s), 3.68(3H, s), 3.60(2H, s)
Figure imgf000201_0001
EXAMPLE 131: Preparation of (3-{r(2ZV2-(methoxyiminoV2-(2-
naphthyl)ethyrioxy)phenyl)acetic acid
Figure imgf000201_0002
40 mg of the title compound was obtained in a yield of 22% in the same manner as in PREPARATION l-(2) and EXAMPLE 1 in sequence, except that 170 mg (0.51 mmol) of methyl { 3 -[2-(2-naρhthyl)-2-oxoethoxy]ρhenyl} acetate and 42 mg (0.51 mmol) of methoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 8.10(1H, s), 7.86~7.78(4H, m), 7.49~7.44(2H, m), 7.22(1H, t, J=8.0Hz), 6.88(3H, m), 5.27(2H, s), 4.09(3H, s), 3.59(2H, s)
Mass(EI) 350(M++l)
EXAMPLE 132: Preparation of (3-{K2ZV2-(ethoxyiminoV2-(2- naphthvDethyli oxy } phenvDacetic acid
Figure imgf000202_0001
19 mg of the title compound was obtained in a yield of 11% in the same manner as in PREPARATIONl-(2) and EXAMPLE 1 in sequence, except that 170 mg (0.51 mmol) of methyl {3-[2-(2-naphthyl)-2-oxoethoxy]phenyl}acetate and 50 mg (0.51 mmol) of ethoxyamine hydrochloride were used.
NMR: 1H-NMR(CDCl3) δ 8.11(1H, s), 7.87~7.77(4H, m), 7.48~7.44(2H, m), 7.22(1H, m), 6.90~6.86(3H, m), 5.30(2H, s), 4.35(2H, q, J=7.4Hz), 3.59(2H, s), 1.38(3H, t, J=7.4Hz)
Mass(EI) 364(M++1)
PREPARATION 91: Preparation of methyl r3-(cvclopentyloxyV5- hydroxyphenyl] acetate
0.40 g of the title compound was obtained in a yield of 29% in the same manner as in PREPARATION 83, except that 1.0 g (5.5 mmol) of methyl (3,5- dihydroxyphenyl)acetate was used.
NMR: 1H-NMR(CDCl3) δ 6.37(1H, s), 6.32(1H, s), 6.28(1H, s), 5.06(1H5 s), 4.72~4.67(1H, m), 3.69(3H, s), 3.51(2H, s), 1.91~1.73(6H, m), 1.63~1.55(2H, m)
Mass(EI) 251(M++l) EXAMPLE 133: Preparation of r3-(cvclopentyloxy)-5-f |"(2Z)-2-(ethoxyiminoV2-(3- phenoxyphenvDethylloxylphenvπacetic acid
Figure imgf000203_0001
90 mg of the title compound was obtained in a yield of 47% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 130 mg (0.39 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-ethyloxime and 97 mg (0.39 mmol) of (3-cyclopentyloxy-5-hydroxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.41(1H, d, J=8Hz), 7.37(1H, s), 7.33~7.28(3H, m), 7.09(1H, t, J=8Hz), 6.98~6.96(3H, m), 6.4O(1H, s), 6.38(1H, s), 6.34(1H5 s), 5.12(2H, s), 4.69~4.66(1H, m), 4.29(2H, q, J=7Hz), 3.52(2H, s), 1.90-1.72(6H, m), 1.64-1.55(2H, m), 1.35(3H, t, J=7Hz)
Mass(EI) 490(M++l)
EXAMPLE 134: Preparation of {3-cvcloρentyloxy-5-r2-r('ZVmethoxyimino1-2-(3- phenoxyphenvD-ethoxyl-phenvU-acetic acid
Figure imgf000204_0001
45 mg of the title compound was obtained in a yield of 31 % in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.31 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-methyloxime and 78 mg (0.31 mmol) of (3-cyclopentyloxy-5-hydroxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.4O(1H, d, J=8Hz), 7.36(1H, s), 7.32~7.28(3H, m), 7.09(1H, t, J=8Hz), 6.99~6.96(3H, m), 6.41(1H, s), 6.38(1H, s), 6.33(1H, s), 5.10(2H, s), 4.68~4.65(1H, m), 4.02(3H, s), 3.53(2H, s), 1.89~1.73(6H, m), 1.53-1.47(2H, m)
Mass(EI) 476(M++l)
PREPARATION 92: Preparation of methyl r3-methoxy-5-hvdroxyρhenyl1 acetate
0.40 g of the title compound was obtained in a yield of 37% in the same manner as in PREPARATION 83, except that 1.0 g (5.5 mmol) of methyl (3,5- dihydroxyphenyl)acetate was used.
NMR: 1H-NMR(CDCl3) δ 6.41(1H, s), 6.36(1H, s), 6.32(1H, s), 4.88(1H, s), 3.76(3H, s), 3.69(3H, s), 3.53(2H, s)
Mass(EI) 197(M++1) EXAMPLE 135: Preparation of (3-methoxy-5-r2-[(ZVmethoxyiminol-2-G- phenoxyphenvD-ethoxyi -phenyl I -acetic acid
Figure imgf000205_0001
65 mg of the title compound was obtained in a yield of 81 % in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 60 mg (0.19 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-methyloxime and 33 mg (0.19 mmol) of (3-hydroxy-5-methoxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.4O(1H, d, J=8Hz), 7.36(1H, s), 7.33~7.28(3H, m), 7.09(1H, t, J=8Hz), 7.00~6.96(3H, m), 6.44(1H, s), 6.42(1H, s), 6.37(1H, s), 5.11(2H, s), 4.02(3H, s), 3.74(3H, s), 3.55(3H, s)
MaSs(EI) 422(M++1)
EXAMPLE 136: Preparation of {3-[2-f(ZVethoxyiminol-2-(3-phenoχyphenylVethoxyl- 5 -methoxyphenvU -acetic acid
Figure imgf000205_0002
35 mg of the title compound was obtained in a yield of 42 % in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 80 mg (0.24 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-ethyloxime and 47 mg (0.24 mmol) of (3-hydroxy-5-methoxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.41(1H, d, J=8Hz), 7.38(1H, s), 7.33~7.28(3H, m), 7.09(1H, t, J=8Hz), 6.98~6.97(3H, m), 6.44(1H, s), 6.42(1H, s), 6.38(1H, s), 5.13(2H, s), 4.30(2H, q, J=7Hz), 3.74(3H, s), 3.55(2H, s), 1.35(3H, t, J=7Hz)
Mass(EI) 436(M++1)
EXAMPLE 137: Preparation of (3-ethoxy-5-f2-r(ZVethoxyimino1-2-(3- phenoxyphenvD-ethoxyi -phenyl ) -acetic acid
Figure imgf000206_0001
40 mg of the title compound was obtained in a yield of 47 % in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 80 mg (0.24 mmol) of 2-brorno-l-(3-phenoxyphenyl)-ethanone O-ethyloxime and 50 mg (0.24 mmol) of (3-hydroxy-5-ethoxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) 7.42(1H, d, J=8Hz), 7.37(1H, s), 7.34~7.28(3H, m), 7.09(1H, t, J=8Hz), 6.99~6.97(3H, m), 6.43(1H, s), 6.40(1H, s), 6.38(1H, s), 5.13(2H, s), 4.30(2H, q, J=7Hz), 3.98(2H, q, J=7Hz), 3.53(2H, s), 1.38-1.32(6H, m) Mass(EI) 450(M++l)
EXAMPLE 138: Preparation of (3-isopropoxy-5-r2-r(ZVmethoxyiminol-2-(3- phenoxyphenylV ethoxyl -phenyl } -acetic acid
Figure imgf000207_0001
0.65 g of the title compound was obtained in a yield of 43 % in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 1.1 g (3.4 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-methyloxime and 0.77 g (3.4 mmol) of (3-hydroxy-5-isopropoxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.4O(1H, d, J=8Hz), 7.36(1H, s), 7.32~7.28(3H, m), 7.09(1H, t, J=8Hz), 6.99~6.96(3H, m), 6.42(1H, s), 6.39(1H, s), 6.35(1H, s), 5.10(2H, s), 4.48~4.44(1H, m), 4.02(3H, s), 3.53(2H, s), 1.30(6H5 d, J=6Hz)
Mass(EI) 450(M++l)
EXAMPLE 139: Preparation of (3-r2-rrZVmethoxyiminol-2-(3-phenoxyρhenylV ethoxyl -phenyl! -acetic acid
Figure imgf000208_0001
55 mg of the title compound was obtained in a yield of 45% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.31 mmol) of 2-bromo-l-(3-phenoxyphenyl)-ethanone O-methyloxime and 52 mg (0.31 mmol) of (3-hydroxyphenyl)-acetic acid methyl ester were used.
NMR: 1H-NMR(CDCl3) δ 7.4O(1H, d, J=8Hz), 7.35(1H, s), 7.32~7.27(3H, m), 7.22(1H5 1, J=8Hz), 7.09(1H, t, J=8Hz), 6.99~6.96(3H, m), 6.88(1H, d, J=7Hz), 6.80~6.79(2H, m), 5.13(2H, s), 4.02(3H, s), 3.59(2H, s)
Mass(EI) 392(M++1)
EXAMPLE 140: Preparation of r3-methoxy-5-({(2ZV2-(methoxyiminoV2-|"3-(ρyridine- 2-yloxy>)phenyllethvUoxy)phenyllacetic acid
Figure imgf000208_0002
50 mg of the title compound was obtained in a yield of 38% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.31 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanone O-methyloxime, 120 mg (0.61 mmol) of methyl (3-hydroxy-5-methoxyphenyl)acetate and 299 mg (0.92 mmol) of cesiumcarbonate were used.
NMR: 1H-NMR(CDCl3) 8.23(1H, dd, J=I .9Hz, 4.9Hz), 7.67(1H, td, J=I .9Hz, 8.0Hz), 7.49(1H5 d, J=8.0Hz), 7.43(1H, d, J=I.9Hz), 7.33(1H, t, J=8Hz), 7.07(1H, dd, J=2.5Hz, 8.0Hz), 7.02-6.99(1H5 m), 6.81(1H, d, J=8.6Hz), 6.41(1H, s), 6.38(1H, m), 6.36(1H, s), 5.13(2H, s), 4.02(3H, s), 3.71(3H, s), 3.49(2H, s)
Mass(EI) 423(M++1)
EXAMPLE 141: Preparation of r3-isopropoxy-5-(((2ZV2-(niethoxyiminoV2-r3- (pyridine-2-yloxy)phenyllethvUoxy)phenyllacetic acid
Figure imgf000209_0001
37 mg of the title compound was obtained in a yield of 27% in the same manner as in PREPARATION 2 and EXAMPLE 1 in sequence, except that 100 mg (0.31 mmol) of (lZ)-2-bromo-l-[3-(pyridine-2-yloxy)phenyl]ethanone O-methyloxime, 117 mg (0.52 mmol) of methyl (3-hydroxy-5-isopropoxyphenyl)acetate and 255 mg (0.78 mmol) of cesiumcarbonate were used.
NMR: 1H-NMR(CDCl3) δ 8.24(1 H, dd, J=I.9Hz, 4.9Hz), 7.68(1H, td, J=I.9Hz, 8.0Hz), 7.5O(1H, d, J=8.0Hz), 7.46(1H, d, J=I.9Hz), 7.34(1H, t, J=8Hz), 7.08(1H, dd, J=2.5Hz, 8.0Hz)5 7.02~6.99(lH, m), 6.87(1H, d, J=8.6Hz)5 6.40(1H5 s), 6.38(1H5 m), 6.35(1H, s), 5.14(2H, s), 4.46(1H, m), 4.01(3H5 s), 3.47(2H5 s), 1.28(6H5 d5 J=6Hz Mass(EI) 451(M++l)
Experimental Example 1: Construction of reporter vector containing luciferase structural gene in GAL4 transcription gene sequence
A GAL4 response sequence containing 8 repeats of the basic subunit (UAS), containing an MIuI site at the 5' end and HindIII site at 3' end, as follows: 5'- GTGCAGGTGCCAGAACATTT CTCTATCGAT AGG TA
(CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CCTCGGAGGACAGTACTCCG) (CTCGGAGGACAGTACTCCG)
(CTCGGAGGACAGTACTCCG) (CTCGGAGGACAGTACTCCG) TA
CCGTCGACTT TAGAGGGTAT AT-3' (parentheses indicatethe basic subunit UAS), was synthesized by a DNA synthesizer and then subcloned into the multiple cloning site of pGL3-Basic vector (Promega, Cat. No. El 751). As a result, pGL3-GAL4 vector containing 8xUAS, followed by luciferase structural gene, was constructed.
Experimental Example 2: Construction of vector expressing fusion protein of GAL4 and ligand-binding domain of PPAR protein
A vector, expressing a protein in which the DNA-binding domain of GAL4 is fused with the ligand-binding domain of PPAR under control of SV40 promoter, was constructed using pZeoSV (Invitrogen, Cat. No. V85001) being a mammalian cell expression vector as a basic vector. ( 1 ) Amplification of cDN A encoding DN A-binding domain of G AL4 transcription factor, and insertion thereof into expression vector.
To amplify the DNA-binding domain of GAL4 protein as a basal transcription activator in yeast, the following primer was synthesized using a DNA synthesizer: primer GAL4-HIII (5'-GC AAGCTT GAAGCAAGCCTCCTGAAAG ATG AAG CTA CTG TCT TCT ATC GAA C-3') contains the sequence encoding amino acids 1 to 8 of the N-terminal of the GAL4 DNA-binding domain, and also the restriction enzyme HindIII recognition domain. Another primer GAL4-KI (5'-AA GGTACC GGT AAA TTC CGG CGA TAC AGT CAA CTG TCT TTG A-3 ') contains the sequence encoding amino acids 141 to 147 of the C-terminal of the DNA-binding domain of GAL4, and also the restriction enzyme Kpnl recognition domain. 2 βg of the primer GAL4-HIII and 2 βg of the primer GAL4-KI were added into a reaction tube, then 10 ng of plasmid pGBT9 (Clonetech, Cat. No. K1605-A) as a template, and 10 μl of 10 x polymerization buffer (50 mM KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton X-100, 2.5 mM MgCl2), 10 μl of 2 mM dNTP (2 mM dGTP, 2 mM dATP, 2 mM dCTP and 2 mM dTTP), 2.5 units of Taq polymerase, and distilled water were further added to a total volume of 100 μl, and PCR was carried out for 25 cycles with denaturation at 950C for 40 seconds, annealing at 550C for 30 seconds, and polymerization at 720C for 1 minute. When the PCR product was separated in 2% agarose gel, it was confirmed that a sequence of about 488 base pairs was amplified, then the product was seperated and purified from the agarose gel. The DNA fragment thus seperated and purified (hereinafter, referred to as 'fragment GAL4-H/K') was fully restricted with HindIII and Kpnl in NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol (pH 7.9)), and extracted with phenol/chloroform, then eluted with 20 μl of TE (10 mM Tris-HCl, 1 niM EDTA, pH 8.0) solution.
Meanwhile, 2 βg of plasmid pZeoSV was fully restricted with restriction enzymes HindIII and Kpnl in NEB buffer 2, and a nucleic acid fragment of about 3.5 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as "fragment pZeoSV-H/K".
100 ng of the fragment GAL4-H/K obtained above and 100 ng of the fragment pZeoSV-H/K obtained above were added into a ligation reaction tube, then 2 βi of 10 x ligation reaction solution (50 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP, 25 μg /ml BSA) and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 ml, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain plasmid pZeo-GAL containing the DNA- binding domain of GAL4 (refer to Fig. 1).
(2) Preparation of DNA fragment encoding human PPARγ ligand-binding domain and construction of expression vector of GAL4 - Human PPARγ chimeric receptor protein
The below primers were synthesized from the gene sequence data of human PPARγ gene (Genebank NM_015869). Primer GLBD-f (5'-GG GGTACC TCT CAT
AAT GCC ATC AGG TTT GGG CGG ATG C -3') contains the sequence encoding from
Ser176 to Met185 of human PPARγ gene and also the restriction enzyme Kpnl - recognition domain. Primer GLBD-r (5'-CC ACGCGT CTA GTA CAA GTC CTT GTA GAT CTC C -3') contains the sequence encoding from GIu472 to Tyr478 of human PPARγ gene and the termination codon, allowing the termination of translation at the 478th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment encoding from Ser176 to Tyr478 containing the human PPARγ ligand-binding domain was amplified by PCR using the above-described primer and also using the full- length cDNA of human PPARγ, isolated from human liver cDNA library, as a template. When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The fragment thus seperated and purified (hereinafter, referred to as 'fragment GLBD-K/M') was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μi of TE solution.
Meanwhile, 2 μg of plasmid pZeo-GAL obtained above was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and a nucleic acid fragment of 4.0 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as "fragment pZeoGAL-K/M".
100 ng of the fragment GLBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μi of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μi, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARγ ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL- PPARγLBD")(referto Fig. 2).
(3) Preparation of DNA fragment encoding human PPARα ligand-binding domain and construction of expression vector of GAL4-human PPARα chimeric receptor protein
The below primers were synthesized from the gene sequence information of human PPARα gene. Primer ALBD-f (5'-GG GGTACC TCA CAC AAC GCG ATT CGT T-3') contains the sequence encoding from Ser167 to Arg175 of human PPARα and also the restriction enzyme Kpnl - recognition domain. Primer ALBD-r (5'-CC ACGCGT TCA GTA CAT GTC CCT GTA GAT CTC CTG C-3 ') contains the sequence encoding from GIn461 to Tyr468 including the human PPARα ligand-binding domain and the termination codon, allowing the termination of translation at the 468th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment, encoding from Ser167 to Tyr468 containing the human PPARα ligand-binding domain, was amplified by PCR using the above described primer and also using the full length cDN A of human PPARα, isolated from human liver cDNA library, as a template. When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The nucleic acids thus seperated and purified (hereinafter, referred to as 'fragment ALBD-K/M') were fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μi of TE solution.
100 ng of the fragment ALBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μl of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μi, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARα ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL- PPARaLBD") (refer to Fig. 3).
Experimental Example 3: Transformation
HepG2 cells derived from a human hepatoblastoma were aliquoted into each well of 24-well plate at a density of 6.OxIO4 per/well, suspended in DMEM™ medium (Life Technologies Inc) supplemented with 10% FBS, and cultured for 24 hours at 370C in 5% CO2 atmosphere. After culturing, the growth medium was replaced with 200 μJt of OptiMEM™ medium (Life Technologies Inc) and the cells were used for transformation. The amount of DNA was 480 ng of pGL3-GAL4, 48 ng of pZeo- GAL-PP ARγLBD or pZeo-GAL-PP ARaLBD and 128 ng of pCHllO (Amersham, Cat.No. 27-4508-01) per well. 29 μi of DNA was suspended in OptiMEM™ medium, and 1 μi of PLUS reagent (Invitrogen) was added thereto and stirred, followed by incubation for 15 minutes at room temperature. To a mixture of DNA and PLUS reagent, 1 μi of LIPOFECTAMINE (Invitrogen) diluted with OptiMEM™ medium was added and stirred, followed by incubation for 15 minutes at room temperature. A solution containing the complex of DNA and LIPOFECTAMINE thus prepared was added dropwise to CV-I cells being cultured in 24-well plate and then gently stirred, followed by culturing for 3 hours at 370C in 5% CO2 atmosphere. After the culturing, 260 μi of DMEM™ medium supplemented with 20% FBS was added to each well and cultured at 370C in 5% CO2 atmosphere for 24 hours, and the resulting culture was used for analysis.
Experimental Example 4: Determination of accelerating activity for human PPARα or PPARγ
( 1 ) Measurement of degree of expression of Luciferase
The growth medium was removed from the transformed cells of Experimental
Example 3, and the compounds of Examples 1 to 139 were suspended in DMSO and added in DMEM™ medium supplemented with 5% FBS, then the resulting mixture was added to each well, followed by culturing at 37°C in 5% CO2 atmosphere for 24 hours. After the culturing, the culture media was removed and cells were washed twice with PBS (Life Technologies Inc). To each well, 100 μl of Passive Lysis Buffer (PLB) solution (Promega Corporation) was added and then gently stirred for 20 minutes at room temperature. 20 μi of cell lysate taken from each well was removed to a Costar 96-well Luminometer and luciferase activity was determined using Luciferase Assay System™ kit (Promega Corporation) following the instructions of the manufacturer.
(2) Measurement of β-galactosidase activity
20 μi of cell lysate as obtained above was moved to 96-well plate (Falcon, Cat.No. 353911) and 100 μi of ONPG (O-nitrophenyl β-galacti-pyranoside) solution was added to each well, followed by incubation at 370C for 2 hours. Then, 50 μi of 1 M sodium carbonate (Na2CO3) was added to each well and the absorbance was measured at 415 nm by a spectrophotometer.
(3) Degree of activity of ligand
The efficacy of transformation in cell lysis buffer was represented by the activity of beta-galactosidase measured in the above, and the comparative activity of luciferase was measured, thereby comparing the degree of the activity of each compound. The experimental results were expressed as an increasing multiple on the basis of the value of the control, in which only 5% DMSO without compound was added. On the basis of this, EC50 being the efficacy of the compounds obtained in Examples 1 to 139 was presented in Table 1 below. EC50 (Effective concentration fifty) expresses the concentration of a compound which shows 50% of the maximum possible response of the compound.
[TABLE 1]
Figure imgf000217_0001
Figure imgf000218_0001
Figure imgf000219_0001
Figure imgf000220_0001
Figure imgf000221_0001
Figure imgf000222_0001
Experimental Example 5: Determination of accelerating activity for PPARγ through the maP2 gene expression in rat cell
The experiment was conducted by treating the compound synthesized to a mouse preadipocyte cell line (3T3-L1) to measure the degree of control to a messenger RNA expression level of maP2 being a target gene of PPARγ.
The mouse preadipocyte cell was moved to each well of 12 well plate, at a saturation degree of about 70%, in DMEM™ medium (Life Technologies Inc.) supplemented with 10% Bovine Serum (BS), then observed for 1 day to allow its growth to 100%, followed by incuvation for 48 hours. Thereafter, the growth medium was removed, and then the cells were cultured for 72 hours in DMEM™ medium supplemented with 5% Fetal Bovine Serum(FBS) which was treated with 50 uM IBMX(3-Isobutyl-l-methylxanthine), 250 nM Dexamethasone, and 10 jt/g/ml of Insulin together with the compound. After culture, the growth medium was removed and the cells were washed with PBS (Life Technologies Inc.), then RNA was extracted in the below manner.
12 well was treated with 167 μl of trizol, and the cells were broken after reaction for 5 minutes at room temperature and then added to 34 μl of chloroform, followed by stirring. The cells were centrifuged at 13200 rpm for 15 minutes at 4°C to accomplish a layer separation, and then 70 μl of supernatant thus obtained was trensfered to a new vial. 50 μl of Isopropanol was added thereto, and preserved for 10 minutes at room temperature. The cells were centrifuged at 13200 rpm for 10 minutes at room temperature to precipitate out RNA, and washed once with 70% ethanol. After drying for 5 minutes at room temperature, the cells were dissolved in Rnase-free distilled water.
On the basis of the RNA thus extracted, the amount of target gene expressed was measured by performing quantitative RT-PCR (quantitative Real-Time DNA Polymerase Chain Reaction) method using the Rotor-Gene 3000(Corbett Research) according to the instruction of a supplier (Qiagen kit-204443). As an experimental result, aP2 gene expression in rat cell was shown in FIG. 4, and Acrp30 gene expression in rat cell was shown in FIG. 5.
Experimental Example 6: Measurement of lipid accumulation by PPARγ in mouse adipocyte cell line
Commerically available, diabetes treatment agents concerning PPARγ decrease the blood glucose at high efficiency, but result in serious side effects such as weight gain and edema. Herein, the weight gain is associated with division and differentiation of adipocyte cell. 3T3-L1 being a preadipocyte cell line deriven from mouse was used as a model cell in which the division and differentiation of adipocyte cell can be measured in vitro. Where the activation of PPARγ is active, 3T3-L1 accumulates lipid called TG (Triglyceride) in cell. Therefore, if it is measured the contribution degree of compound, synthesized as an agonist to PPARγ, to lipid accumulation, the level of the weight gain as a side effect can be indirectly anticipated when the compound is used as a treatment agent. On this basis, Lipid Accumulation Assay system was constructed.
(1) Division of preadipocyte cell line from mouse (3T3-L1)
First day, 3T3-L1 cell was diluted at a concentration of 2X105/ml in DMEM
(Dulbecco's Modified Eagle Medium, Life Technologies Inc.) containing 10% Bovine Serum and then aliquoted into 24- well plate. 2 X 105/ml is a concentration having the saturation degree of 70% in 24-well Plate, and the cells were cultured in culture medium at 37 °C for 48 hours until the saturation degree of 100% is reached.
(2) Differentiation of preadipocyte cell line from mouse (3T3-L1)
Third day, 0.5 mM of IBMX (3-isobutyl-l-methylxanthine) as a differentiating agent of 3T3-L1, 0.25 μM of DEX(dexmetasone), 10 μg/ml of Insulin, in which each amount is expressed as the final concentration, the control compound, and the candidate compound, as an agonist of PPARγ, were mixed in DMEM (Dulbecco's Modified Eagle Medium, Life Technologies Inc.) which is mixed with 5% Fetal Bovine Serum purified with active carbon. The growth medium of 3T3-L1 divided at the saturation degree of 100% was removed from 24-well plate, followed by washing with PBS (Life Technologies Inc.). The mixed medium thus prepared was aliquoted at 400 μi per well into each well of 24-well plate in which 3T3-L1 is cultured, and the cells were cultured in culture medium at 37 °C for 72 hours. After 72 hours, the growth medium of 3T3-L1 was removed and 400 μJt of Fetal Bovine Serum was added therto, by further incuvation for 72 hours.
(3) Lipid Accumulation Assay
After 72 hours, it was confirmed through a microscope whether a sufficient lipid has been accumulated, then Fetal Bovine Serum was removed, and herein, a mixture of Adipored Reagent (Cambrex), which emits light of a specific wavelength by staining only lipid in cell, and PBS was aliquoted into 1 ml/well, followed by staining for 20 minutes. After confirming whether or not of staining through a microscope, the light of 485 nm was irradiated using Victor3 (fluorimeter) to detect the amount of the wavelength of 535 nm. Herein, the greater the energy of wavelength of 535 nm is, the larger the lipid accumulation in cell is.
Experimental Example 7: Effect on osteoblast
(1 ) Culture of osteoblast cell
To examine the effect of sample on an osteoblast cell, an osteoblast cell line and primary culture mouse calvaria cell were cultured. MC3T3/E1 cell stemmed from mouse calvaria and MG63 cell stemmed from human osteosarcoma, which were purchased from the ATCC (American Type Culture Collection, Rockville, USA), were used in this experiment, and the cells were cultured in α-minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS) and Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS for use in the experiment.
As a primary culture cell, calvaria (frontal bone and parietal bone) were exstracted from 2~3 -day-old mouse and collected in minimum essential medium (MEM), and then stirred for 10 minutes(I), 10 minutes(II), 10 minutes(III), 20 minutes(IV) and 20 minutes(V), respectively, at 37°C in an enzyme solution containing 0.1% collagenase (Gibco), 0.05% trypsin and 0.5 mM EDTA (Gibco) to separated into 5 groups of bone cells. Among them, IV group and V group of bone cell groups (mouse calvarial cell (MCC)), which were having a phenotype of osteoblast cell, were used. FBS of the same amount as the enzyme solution was added to the separated bone cell groups, and centrifuged to collect each cells, then the cells were washed with Hank's balanced salt solution (HBSS) and cultured in a tissue culture plate with MEM containing 10% FBS. The cells were curtured for 7 days while the culture medium was changed after 24 hours at first, and then every 48 hours. During culture, the temperature of 37 °C and the humidity of 95% were kept and 5% CO2 and 95% air were contisuously supplied.
(2) Measurement of degree of activity of alkaline phosphatase in osteoblast cell (ALP assay) MC3T3/E1 cell and MCC cell were were aliquoted into each well of 24-well plate at 2X104 cells/well, then cultured for 48 hours using α-MEM containing 10% FBS as a growth medium, and the sample was added thereto while changing to a new growth medium containing 50 μg/ml of ascorbic acid and 10 mM of β- glycerophosphate, and then the cells were further cultured for 72 hours.
After culturing was completed, the cells were treated with 0.1% Triton X- 100/saline, and then some quantity of the cell treatment solution was used to measure the activity of ALP enzyme, and the amount of p-nitrophenol (PNP), which was isolated from p-nitrophenyl phosphate (PNPP) used as a substrate, when reacting the cells with 100 mM of PNPP as the substrate and 0.1 N glycine-NaOH buffer (pH 10.3) in a tartrate solution at 37 °C for 30 minutes, was determined by conducting colorimetric analysis at 405 nm. The predeterminded quantity of cell treatment solution was used for measurement of the amount of protein using the modified Lowry method, and ALP activity was calculated (activity: umol substrate cleaved/min/mg protein). The result is shown in the below Table 2.
[TABLE 2]
Figure imgf000227_0001
Figure imgf000228_0001
(3) Determination of formation of calcified nodule from osteoblast cell
MCC cell was aliquoted into each well of 24- well plate at 2X104 cells/well, then cultured for 48 hours using α-MEM containing 10% FBS as a growth medium, and then sample was added thereto while changing to a new culture medium containing 50 jUg/ml of ascorbic acid and 10 mM of β -glycerophosphate, and the cells were cultured for 12 days. After culture, the culture medium was removed and the cells were washed with DPBS and fixed with 10% formalin for 15 minutes, then 2% Alizarin red S solution was added thereto to react for 15 minutes. The resulting product was observed with optical microscope, the result is shown in FIG. 7.
Experimental Example 8: Effect on osteoclast
(1) Separation and Culture of osteoclast (M-CSF dependent bone marrow
macrophage, MDBM)
To separate mouse bone marrow cells, a femur and tibia of male mouse was extracted and a soft tissue was removed. A bone marrow was taked out by injection of an enzyme solution containg 0.1% collagenase, 0.05% trypsin and 0.5 mM EDTA at one end of the bone-marrow cavity, stirred for 30 minutes to collect bone marrow cells, and the cells were cultured in α-minimum essential medium (α-MEM) containg 10% FBS for 24 hours, and non-adhered cells were collected. The non-adhered cells which are progenitor cells of osteoclast were aliquoted into each well of 96-well culture plate at 5 X 104 of cells per well and cultured. During culture, the sample was added to the medium containing 10 ng/ml of macrophage-colony stimulating factor (M-CSF) and 50 ng/ml of receptor activator of NFkB ligand (RANKL), and the cells were cultured.
(2) Effect on formation of osteoclast
Osteoclast progenitor cells were aliquoted into each well of 96-well plate at 5 X 104 cells/well and cultured for 3 days in α-MEM supplemented with M-CSF. Then, RANKL was added to induce differentiation of osteoclast, and at the same time, the sample was added thereto. After addition of RANKL and the sample, the cells were cultured for 6 days and the osteoclast was fixed and stained using TRAP stain kit. During culture, the medium was changed every 3 days. Among the stained osteoclast, the cells of which the number of nucleus is more than 3 were counted under microscope, and the result is shown in the below Table.
[TABLE 3]
Figure imgf000229_0001
Figure imgf000230_0001
(3) Effect on activity of osteoclast
Osteoclast progenitor cells were aliquoted into each well of 96-well OAAS plate (Oscotec Inc.) coated with Ca-P at 5 X 104 cells/well, and cultured for 3 days in α- MEM containing M-CSF. Then, RANKL was added to induce differentiation of osteoclast, and at the same time, the sample was added thereto. After addition of RANKL and the sample, the cells were cultured for 6 days, and the absorption degree and the extent of Resorption pit were measured after the cells were detached. The result is shown in the below Table 4.
[TABLE 4]
Figure imgf000230_0002
As has been explained in the above, it is clear that the compound of Formula 1 according to the present invention is very effective for accelerating the activity of PPARγ and PPARα. Accordingly, the compound according to the present invention can be used as a drug for treatment or prevention of diseases involving human PPARα and PPARγ, for example, diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc.
Other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the scope of particular embodiments of the invention indicated by the following claims.

Claims

WHAT IS CLAIMED IS;
1. A compound of Formula 1 ,
Figure imgf000232_0001
or a pharmaceutically acceptable salt, or isomer thereof,
wherein,
A is selected from the group consisting of the below substituents;
Figure imgf000232_0002
Figure imgf000232_0003
(iii)
wherein, R1 is a below substituent,
Figure imgf000232_0004
wherein, R2, R3 and R4 are each independently hydrogen, halogen, or substituted or unsubstituted C1-C6 alkyl;
Figure imgf000233_0001
wherein, R5 is one or more substituents selected from the group consisting of the below substituents;
(a) hydrogen, halogen, hydroxy, substituted or unsubstituted Ci-C6 alkyl, nitro, or substituted or unsubstituted amine;
(b) substituted or unsubstituted Ci~C6 alkoxy;
Figure imgf000233_0002
(d) rv
Figure imgf000233_0003
Figure imgf000234_0001
(h) -NH-SO2-R8
wherein, R6 is hydrogen, halogen, substituted or unsubstituted C1-C6 alkyl, or substituted or unsubstituted C1-C6 alkoxy;
R7 and Rg are each independently hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, or substituted or unsubstituted aryl;
in case where R5 is two or more substituents, they are each independently selected from the above substituents;
Figure imgf000234_0002
wherein, R9 is hydrogen, or substituted or unsubstituted C1-C6 alkyl, and Y is -CH-, -O-, -S- or -N-;
Figure imgf000234_0003
(vii)
D is selected from the group consisting of the below substituents;
Figure imgf000235_0001
(iii)
wherein, E1 and E2 are each independently selected from the group consisting of the below substituents,
(a) hydrogen, halogen, substituted or unsubstituted Ci-C6 alkyl, or substituted or unsubstituted Ci-C6 alkoxy;
O
(b) -(CH2-^CO-G
O
(c) -(CH(CH3))-CO-G
wherein, n is 0 or 1, G is hydrogen, or substituted or unsubstituted Ci-C6 alkyl;
Figure imgf000235_0002
wherein, E3 is selected from the group consisting of the below substituents,
(a) hydrogen, halogen, hydroxy, substituted or unsubstituted C1-C6 alkyl, or substituted or unsubstituted C1-C6 alkoxy;
(b) -OSO2Ri0, -NHR10, -NRi0Ri i, or -CH2ORi0;
wherein, R10 and R11 are each independently substituted or unsubstituted C1-C6 alkyl,
Figure imgf000236_0001
(e) -CH2OH, -CH2NCOMe, or -CH2NHSO2Me;
Figure imgf000236_0002
^ N O
(i) N /
G) -CONHCH2COR12 or -CONHR12
wherein, R12 is hydrogen, or substituted or unsubstituted Ci-C6 alkyl;
(
Figure imgf000237_0001
vi)
wherein, E4 is hydrogen, substituted or unsubstituted Q-C6 alkyl, or substituted or unsubstituted Ci-C6 alkoxy;
X is C1-C6 alkyl substituted with halogen or unsubstituted.
2. The compound according to claim 1, wherein alkyl is unsubstituted alkyl or alkyl substituted with halogen, or a pharmaceutically acceptable salt, or isomer thereof.
3. The compound according to claim 1, wherein A is
Figure imgf000237_0002
or
Figure imgf000238_0001
, or a pharmaceutically acceptable salt, or isomer thereof.
4. The compound according to claim 1, wherein R5 is
Figure imgf000238_0002
or a pharmaceutically acceptable salt, or isomer thereof.
5. The compound according to claim 1, wherein D is
Figure imgf000238_0003
or
Figure imgf000238_0004
, or a pharmaceutically acceptable salt, or isomer thereof.
6. The compound according to claim 1, wherein one of E1 and E2 Formula
O O
Il Il -{CH27YCO-G or 4CH(CH3))-CO-G) or a pharmaceutically acceptable salt, or isomer thereof.
7. The compound according to claim 1, wherein G is hydrogen, or a pharmaceutically acceptable salt, or isomer thereof.
8. The compound according to claim 1, wherein the compound is selected from the compound below, or a pharmaceutically acceptable salt, or isomer thereof:
3-{[2-[3-(4-fluorophenyl)isooxazol-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
(3-{[(2E)-2-(propoxyimino)-2-{3-[4-(trifluoromethyl)phenyl]isooxazol-5- yl}ethyl]oxy}phenyl)acetic acid
3-{[(2E)-2-[3-(4-fluorophenyl)isooxazol-5-yl]-2-(propoxyimino)ethyl]oxy-5- isopropoxy benzoic acid
3 - { [(2E)-2- [3 -(4-fluorophenyl)isooxazol-5 -yl] -2-(propoxyimino)ethyl] oxy-5 - isobutoxy benzoic acid
(3-{[(2Z)-2-(3-phenoxyphenyl)2-(propoxyimino)ethyl]oxy}phenyl)acetic acid
(3-{[(2Z)-2-[4-(cyclopentyloxy)ρhenyl]-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid
[3-({(2Z)-2-(propoxyimino)-2-[3-(4- methoxyphenoxy)phenyl]ethyl } oxy)phenyl]acetic acid
sodium 5-fluoro-l-[(2Z)-(2-methoxyimino)-2-(3-phenoxyphenyl)ethyl]-lH-
indol-3 -carboxylate
(3-ethoxy-5-{[(2Z)-2-(3-phenoxyphenyl)-2- (propoxyimino)ethyl]oxy}phenyl)acetic acid { 3 -isopropoxy-5- [2- [(Z)-methoxyimino] -2-(3 -phenoxyphenyl)-ethoxy] - phenyl} -acetic acid
{ 3 - [2- [(Z)-methoxyimino] -2-(3 -phenoxyphenyl)-ethoxy] -phenyl } -acetic acid
(3-ethoxy-5-{[(2Z)-2-(methoxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl)acetic acid
sodium 1 - { (2Z)-2-(ethoxyimino)-2- [3 -(pyridine-2-yloxy)phenyl] ethyl } -5- fluoro- 1 H-indol-3 -carboxylate
[3-({(2Z)-2-(propoxyimino)-2-[3-(pyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid
sodium (3-isopropyloxy-5-{[(2Z)-2-(ethoxyimino)-2-(3- phenoxyphenyl)ethyl]oxy}phenyl)acetate
[3-({(2Z)-2-(ethoxyimino)-2-[3-(pyridine-2- yloxy)phenyl]ethyl}oxy)phenyl]acetic acid
[3-({(2Z)-2-(methoxyimino)-2-[3-(pyridine-2- yloxy)phenyl] ethyl } oxy)phenyl] acetic acid.
{3-isopropoxy-5-[2-[(Z)-methoxyimino]-2-(3-phenoxyphenyl)-ethoxy]-
phenyl} -acetic acid.
9. A process for preparation of the compound as defined in claim 1 as shwon in Reaction Scheme 1 below:
Figure imgf000241_0001
wherein, A, D and X are the same as in Formula 1 of claim 1, and L is Cl, Br, I or methansulfonyl group.
10. A process for preparation of the compound as defined in claim 1 as shwon in Reaction Scheme 1 below:
Figure imgf000241_0002
wherein, A, D, L and X are the same as in Formula 1 of claim 1, and L is Cl, Br, I or OMs (methansulfonyloxy group).
11. A pharmaceutical composition for accelerating the activity of PPARγ and PP ARa, comprising the compound of Formula 1 or a pharmaceutically acceptable salt thereof, as defined in claim 1.
12. The pharmaceutical composition according to claim 11, wherein the pharmaceutical composition is used to treat or prevent diseases involving PPARγ and PPARα.
13. The pharmaceutical composition according to claim 12, wherein the diseases involving PPARγ and PP ARa is diabetes mellitus, implications associated with diabetes mellitus, inflammation, or osteoporosis.
PCT/KR2006/004867 2005-11-21 2006-11-18 Novel compounds as agonist for ppar gamma and ppar alpha, method for preparation of the same, and pharmaceutical composition containing the same WO2007058504A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2005-0111079 2005-11-21
KR20050111079 2005-11-21

Publications (1)

Publication Number Publication Date
WO2007058504A1 true WO2007058504A1 (en) 2007-05-24

Family

ID=38048851

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2006/004867 WO2007058504A1 (en) 2005-11-21 2006-11-18 Novel compounds as agonist for ppar gamma and ppar alpha, method for preparation of the same, and pharmaceutical composition containing the same

Country Status (2)

Country Link
KR (1) KR20070053622A (en)
WO (1) WO2007058504A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012001040A1 (en) 2010-07-02 2012-01-05 Syngenta Participations Ag Novel microbiocidal dioxime ether derivatives
WO2012013754A1 (en) 2010-07-29 2012-02-02 Syngenta Participations Ag Novel microbiocidal dioxime ether derivatives
WO2012038521A1 (en) 2010-09-23 2012-03-29 Syngenta Participations Ag Novel microbiocides
WO2012062844A1 (en) 2010-11-12 2012-05-18 Syngenta Participations Ag Novel microbiocides
WO2012117021A2 (en) 2011-03-03 2012-09-07 Syngenta Participations Ag Novel microbiocidal oxime ethers
WO2013026866A2 (en) 2011-08-23 2013-02-28 Syngenta Participations Ag Novel microbiocides
WO2013092460A1 (en) 2011-12-20 2013-06-27 Syngenta Participations Ag Cyclic bisoxime microbicides
EP2641901A1 (en) 2012-03-22 2013-09-25 Syngenta Participations AG. Novel microbiocides
US8889730B2 (en) 2012-04-10 2014-11-18 Pfizer Inc. Indole and indazole compounds that activate AMPK
US9394285B2 (en) 2013-03-15 2016-07-19 Pfizer Inc. Indole and indazole compounds that activate AMPK
CN105899496A (en) * 2013-07-11 2016-08-24 安达卢西亚健康服务部 Oxazolidinone derivatives as ppar ligands

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002096358A2 (en) * 2001-05-30 2002-12-05 Bristol-Myers Squibb Company Substituted azole acid derivatives useful as antidiabetic and antiobesity agents and method
WO2004066963A2 (en) * 2003-01-17 2004-08-12 Merck & Co., Inc. N-cyclohexylaminocarbonyl benzenesulfonamide derivatives
US20040220215A1 (en) * 2001-05-29 2004-11-04 Hiroshi Matsui Novel heterocyclic compound and medicinal use thereof
WO2005092382A1 (en) * 2004-03-29 2005-10-06 Sankyo Company, Limited Therapeutic agent for diabetes containing insulin resistance improving agent

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040220215A1 (en) * 2001-05-29 2004-11-04 Hiroshi Matsui Novel heterocyclic compound and medicinal use thereof
WO2002096358A2 (en) * 2001-05-30 2002-12-05 Bristol-Myers Squibb Company Substituted azole acid derivatives useful as antidiabetic and antiobesity agents and method
WO2004066963A2 (en) * 2003-01-17 2004-08-12 Merck & Co., Inc. N-cyclohexylaminocarbonyl benzenesulfonamide derivatives
WO2005092382A1 (en) * 2004-03-29 2005-10-06 Sankyo Company, Limited Therapeutic agent for diabetes containing insulin resistance improving agent

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012001040A1 (en) 2010-07-02 2012-01-05 Syngenta Participations Ag Novel microbiocidal dioxime ether derivatives
WO2012013754A1 (en) 2010-07-29 2012-02-02 Syngenta Participations Ag Novel microbiocidal dioxime ether derivatives
WO2012038521A1 (en) 2010-09-23 2012-03-29 Syngenta Participations Ag Novel microbiocides
WO2012062844A1 (en) 2010-11-12 2012-05-18 Syngenta Participations Ag Novel microbiocides
WO2012117021A2 (en) 2011-03-03 2012-09-07 Syngenta Participations Ag Novel microbiocidal oxime ethers
WO2013026866A2 (en) 2011-08-23 2013-02-28 Syngenta Participations Ag Novel microbiocides
WO2013092460A1 (en) 2011-12-20 2013-06-27 Syngenta Participations Ag Cyclic bisoxime microbicides
EP2641901A1 (en) 2012-03-22 2013-09-25 Syngenta Participations AG. Novel microbiocides
WO2013139822A1 (en) 2012-03-22 2013-09-26 Syngenta Participations Ag Novel bisoxime microbiocides
US8889730B2 (en) 2012-04-10 2014-11-18 Pfizer Inc. Indole and indazole compounds that activate AMPK
US9394285B2 (en) 2013-03-15 2016-07-19 Pfizer Inc. Indole and indazole compounds that activate AMPK
CN105899496A (en) * 2013-07-11 2016-08-24 安达卢西亚健康服务部 Oxazolidinone derivatives as ppar ligands
EP3020710A4 (en) * 2013-07-11 2016-12-14 Consejo Superior De Investig Científicas (Csic) Oxazolidinone derivatives as ppar ligands

Also Published As

Publication number Publication date
KR20070053622A (en) 2007-05-25

Similar Documents

Publication Publication Date Title
WO2007058504A1 (en) Novel compounds as agonist for ppar gamma and ppar alpha, method for preparation of the same, and pharmaceutical composition containing the same
EP1480642B1 (en) Peroxisome proliferator activated receptor modulators
US7648999B2 (en) Activator for peroxisome proliferator-activated receptor δ
US7153878B2 (en) Peroxisome proliferator activated receptor modulators
JP2003502369A (en) Arylthiazolidinedione derivatives and aryloxazolidinedione derivatives
US7528160B2 (en) Fused heterocyclic derivatives as PPAR modulators
NO341476B1 (en) Activation agent for proxy proliferator-activated receptor 
WO2006046779A1 (en) Carbazole derivative, solvate thereof, or pharmaceutically acceptable salt thereof
JP2007515484A (en) PPAR modifiers of triazole, oxadiazole, and thiadiazole derivatives
IE911006A1 (en) 3,5-di-tertiarybutyl-4-hydroxyphenylmethylene derivatives of¹2-substituted thiazolidinones, oxazolidinones, and¹imidazolidinones as antiinflammatory agents
CZ2001490A3 (en) Oxazole and thiazole derivatives
JP3373198B2 (en) Arylthiazolidinedione derivative
HU215450B (en) Process for preparing 2,4-dioxo-thiazolidine derivatives
EP0449223A1 (en) 3,5-di-tertiary-butyl-4-hydroxyphenyl thiazolyl, oxa-zolyl, and imidazolyl methanones and related compounds as antiinflammatory agents
WO2006057503A1 (en) NOVEL COMPOUNDS AS AGONIST FOR PPARϜ AND PPARα, METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME
JP2003502370A (en) Arylthiazolidinedione derivatives and aryloxazolidinedione derivatives
US20060166983A1 (en) Indole derivatives as ppar modulators
WO2006057505A1 (en) NOVEL COMPOUNDS AS AGONIST FOR PPARϜ AND PPARα, METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME
KR20080061599A (en) COMPOUNDS AS AGONIST FOR PPARGamma;, METHOD FOR THE PREPARATION THEREOF, AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME
KR20080061610A (en) COMPOUNDS AS AGONIST FOR PPARGamma;, METHOD FOR THE PREPARATION THEREOF, AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06843851

Country of ref document: EP

Kind code of ref document: A1