WO2006057505A1

WO2006057505A1 - NOVEL COMPOUNDS AS AGONIST FOR PPARϜ AND PPARα, METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME

Info

Publication number: WO2006057505A1
Application number: PCT/KR2005/003943
Authority: WO
Inventors: Geun Tae Kim; Jong Sung Koh; Hee Oon Han; Seung Hae Kim; Kyoung-Hee Kim; Hee-Kyung Chung; Sung Woon Hong; Chang-Seok Lee; Ki Dong Koo; Hyeon Joo Yim; Gwong-Cheung Hur; Hye Jin Kim; Ok Ku Park; Hyun Mi Lee; Sung Ho Woo
Original assignee: Lg Life Sciences, Ltd.
Priority date: 2004-11-25
Filing date: 2005-11-22
Publication date: 2006-06-01
Also published as: KR20060058631A; KR100706600B1

Abstract

The present invention relates to novel compounds accelerating the activity of Peroxisome proliferator-activated receptor gamma (PPARϜ) and alpha (PPARα), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.

Description

NOVEL COMPOUND AS AGONIST FOR PPARGAMMA AND PPARALPHA, METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME

FIELD OF THE INVENTION

The present invention relates to a novel compound as an agonist for peroxisome proliferator-activated receptor gamma (PPARγ) and alpha (PPARα), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.

BACKGROUND OF THE INVENTION

Diabetes mellitus has serious effects on people's health and accompanies various complications. Type II diabetes mellitus accounts for 90% or more of total patients with diabetes mellitus. Representative examples of complications accompanying diabetes include hyperlipidemia, obesity, hypertension, retinopathy and renal insufficiency (Paul Zimmer, et al., Nature, 2001, 414, 782). Sulfonylureas (stimulating insulin secretion in pancreatic cells), biguanides (inhibiting glucose production in the liver), α-glucosidase inhibitors (inhibiting glucose absorption in the intestines), etc. have been used as agents to treat diabetes. Recently, peroxisome

proliferator-activated receptor gamma (PPARy) accelerators (Thiazolidinediones, increasing insulin sensitivity) have drawn attention as therapeutic agents for diabetes. However, these drugs have side effects such as hypoglycemia, weight gain and the like (David E. Moller, Nature, 2001, 414, 821). Furthermore, these agents raise concerns of inducing hypoglycemia. Accordingly, there is a strong need to develop therapeutic agents which can treat hyperglycemia and reduce complications of diabetes mellitus with decreased side effects, without inducing hypoglycemia and weight gain.

Recently, it has been found through in vivo testing that PPARγ accelerators (agonists) increase insulin sensitivity and also decrease serum levels of glucose and insulin, which suggest the possibility of such compounds being used as therapeutic agents for treatment of diabetes (Ricote M., Nature 1998, 391, 79-82). Accordingly, fibrates which activate PPARα were used as agents functioning to decrease blood triglyceride (TG) levels by 20 ~ 50%, decrease LDLc by 10 ~ 15% and increase HDLc by 10 ~ 15%, as observed through various experiments (Isseman, I., et al, Nature 1990, 347, 645-650; Linton, M. R, Curr. Atheroscler. Rep. 2000, 2, 29-35). This fact is supported by reports that the activation of PPARα activates the transcription of enzymes which break down fatty acids to decrease the de novo synthesis of fatty acids in liver, thereby resulting in the decreased production and secretion of TG and VLDL.

Recently, accelerators for human PPARγ and PPARα showed positive effects in various arteriosclerosis animal models, which also suggested the possibility of these compounds being used to treat arteriosclerosis (Li, A.C., et al, J. Clin. Invest. 2000, 106 523, Collins, A., Arterioscler., Thromb., Vase. Biol. 2002, 21, 365-367, Bernadette P. Neve, et al. Biochemical Pharmacology 2000, 60, 1245). Further, since it was reported that PPARγ accelerators inhibit factors inducing inflammation, the possibility of PPARγ accelerators being used as therapeutic agents for treatment of inflammation was also suggested.

Therefore, the possibility was suggested that compounds activating both PPARα and PPARγ can be used in treating diabetes mellitus and hyperlipidemia caused by diabetes mellitus (Auwerx, J., Insulin Resistance, Metabolic Disease Diabetic

Complications 1999, 167-172). Recently, many researchers have also confirmed in animal models that the compounds activating both PPARγ and PPARα modulate the blood glucose and lipid levels (Koji Murakami, et al, Diabetes, 1998, 47, 1841, Dawn A. Brooks, et al., J. Med. Chem. 2001, 44, 2061).

Because of excellent pharmaceutical effects in various fields as described above, many pharmaceutical companies have been trying to find compounds activating both PPARγ and PPARα. Among these compounds, tesaglitazar (AZ-242) and muraglitazar (BMS-298585) are under clinical phase III trial as of year 2004 (Brad R. Henke, J. Med. Chem. 2004, 47, 4118-4127). In particular, the animal test result (ob/ob mouse) of tesaglitazar showed the excellent effects thereof on treatment of hyperglycemia, hyperinsulinism, and hypertriglyceridmia (B.Bjung et al., J. Lipid Res. 2002, 43, 1855-1863).

Meanwhile, side effects such as weight gain and edema may occur along with the excellent effects. These side effects are clearly found in the case of rosiglitazone and pioglitazone as accelators of PPARγ. More specifically, weight gain (3~5kg) has been ascertained in most of patients, and edema has been accompanied in some patients (S. Mudaliar et al, Curr. Opin. Endocrinol. Diabetes 2002, 9, 285-302). The occurrence of edema may be a burden on the heart; therefore, it is important to develop the compounds which activate both PPARγ and PPARα, but not causing these side effects. The weight gain by the action of PPAR accelator is mainly caused by an increse of subcutaneous fat in which secretion of metabolic regulators occurs actively. While such weight gain is accompanied with a decrease of abdominal fat, weight loss is generally recommended for treatment of diabetes, whereby the development of compounds not causing the weight gain is required. In this connection, the accelerator activating both PPARγ and PPARα without weight gain has also been reported (R. K. Virkramadithyan et al., Obesity Res. 2003, 11, 292-303).

SUMMARY OF THE INVENTION

It is an object of the present invention to provide a novel compound of Formula

1 activating both human PPARγ and PPARα with excellent efficacy.

It is a further object of the present invention to provide processes for preparation of such novel compounds.

It is another object of the present invention to provide pharmaceutical compositions for acceleratrating PPARγ and PPARα activity comprising a therapeutically effective amount of the novel compound as an active agent.

It is another object of the present invention to provide methods for treating or preventing PPARγ and PPARα-related diseases, such as diabetes mellitus, its complications, inflammation and the like, by the use of the novel compound of the present invention as an active agent.

Other objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. is a diagram showing the processing of vector pZeo-GAL in Example 15(1).

FIG. 2. is a diagram showing the processing of vector pZeo-GAL-PPARγLBD in Example 15(2).

FIG. 3. is a diagram showing the processing of vector pZeo-GAL-PPARccLBD in Example 15(3).

DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, there is provided a compound as represented by Formula 1 below, or pharmaceutically acceptable salts or isomers thereof. Formula 1

wherein,

A is one of substituents having the below structure;

Hiini) R1

wherein,

Rl is each independently one of substituents having the below structure;

wherein,

R2, R3 and R4 are each independently hydrogen, halogen, or lower alkyl; n is 1 or 2; and m is 0 or 1. As used herein, the lower alkyl is preferably alkyl having carbon atoms less than 7, more preferably, alkyl Of C₁-C₄, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, and the like.

The compound of Formula 1 as an active agent for treatment of diseases, even when a separate explanation is not added thereto, is intended to include pharmaceutically acceptable salts, or isomers thereof. For the convenience of explanation, they are briefly illustrated as the compound of Formula lin the present disclosure.

The compound of Formula 1 according to the present invention has the structure quite different from well-known PPARγ and PPARα accelerators and also an excellent activation effect as to human PPARγ and PPARα associated with prevention and treatment of diabetes mellitus, and complications accompanying diabetes such as hyperlipidemia and arteriosclerosis, and inflammation, as can be seen in the below Experimental Examples,

As used herein, the term "pharmaceutically acceptable salt" means a formulation of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. The pharmaceutical salts includes salts of acids that form non-toxic acid adduct containing pharmaceutically acceptable anion, for example, acid adducts of inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, iodic acid and the like; acid adducts of organic carbonic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid and the like; acid adducts of sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, bezenesulfonic acid or p-toluenesulfonic and the like. The examples of pharmaceutically acceptable salts of carboxylic acid include metal salts or alkaline earth metal salts of lithium, sodium, potassium, calcium magnesium and the like; and salts of amino acids such as lysine, arginine, guanidine and the like; organic salts of dicyclohexylamine, N-methyl-D-glucarmine, tris(hydroxymethyl)methylamine, diethanolamine, choline, tirethylamine and the like. The compound of Formula 1 according to the present invention can be converted to its salts by known methods.

As used herein, the term "isomer" means a compound of the present invention or a salt thereof, that has the same chemical formula or molecular formula but is optically or stereochemically different therefrom. Since a variety of compounds according to the present invention have an oxime structure, they can be present in the form of trans or cis geometric isomers. All of these isomers and mixtures thereof are of course included in the range of the present invention.

In a particularly preferred embodiment, the compounds of Formula 1 in the present invention are compounds as defined below: 4-{4-[2-(5-methyl-2-phenyl-oxazole-4-yl)-ethoxy]-phenyl}-3-(propoxyimino)-butyric acid

4- [4-(5 -methyl-2-phenyl-oxazole-4-yl)-methoxy] -phenyl] -3 -(propoxyimino)-butyric acid

4- [4-(3 -phenyl- [1 ,2,4]oxadiazole-5-yl methoxy)-phenyl]-3-(propoxyimino)-butyric acid 4- [4-(2-oxo-4H-benzo [e] [ 1 ,3 ] oxazine-3 -yl)-ethoxy] -phenyl } -3 -propoxyimino-butyric acid

3-[4-(5-methyl-2-phenyl-oxazole-4-yl methoxy)-phenyl]-propoxyimino)-butyric acid

3-(ethoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid 3-(propoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid

3-(2-fluoroethoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid 3 -(cyclopropylmethoxyimino)-4- { 4- [2-(5 -methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] - phenyl }butanoic acid

3 -(propoxyimino)-4- { 4- [2-(5 -methyl-2-phenyl- 1 , 3 -oxazole-4-yl)-ethoxy] -phenyl } - butanoic acid

3-(2-propoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl } butanoic acid

4- [4-(2- {4- [(methylsulfonyl)oxy]phenyl } ethoxy)phenyl]-3 -(propoxyimino)butanoic acid

4-[3-(2-{4- [(methylsulfonyl)oxy]phenyl } ethoxy)phenyl] -3 -(propoxyimino)butanoic acid

The present invention also provides processes for preparation of the compounds of Formula 1. A person skilled in the art could easily manufacture the compound of

Formula 1 on the basis of the chemical structure thereof by various processes. In other words, it will be possible to prepare the compound of Formula 1, within the scope of the present invention, by the process described in the present disclosure or by combining some of processes known in the prior art. So the scope of the present invention is not limited to the below processes.

As an illustrative process for such preparation, the compound of Formula 1 can be prepared by reacting the compound of Formula 2 with the compound of Formula 3 in the presence of base, as shwon in Reaction Scheme 1 below. Reaction Scheme 1

wherein A, E, G, and n are the same as defined in Formula 1, and X means Cl, Br, I or methanesulfonyl group.

The reaction can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used. The typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used. The desired compound of Formula 1 can be prepared by hydrolyzing condensed compounds.

The compounds of Formula 2 and 3 above also can be prepared by a person skilled in the art on the basis of the chemical structure by various methods. Representative examples for the preparation processes are illustrated in the below.

Firstly, a compound (2a) in which A in Formula 2 is

and n is 2 can

be prepared as the known method (Koji Ando and Masanobu Suzuki WO99/50267).

Secondly, the compound (2b) in which A in Formula 2 is RI ^{H {} and n is 1

can be prepared as the known method (Peter T. Cheng, Pratik Devasthale, et al US 6,414,002). Thirdly, the compound (2c) in which A in Formula 2 is

^R1 and n is 1 can be prepared as the known method (Chao, Esther, Yu-Hsuan et al. WO01/00603).

Fourthly, the compound (2d) in which A in Formula 2 is

and n is 1 can be prepared as the known method (KR2003-75041 Geun Tae Kim and Hee Oon Han et al).

The compound of Formula 3 a in which m is 1, as a representative example for the compound of Formula 3, can be prepared as the known method (Hartmuth C.kolb, Cullenaro, et al US 6,642,390). The brief explanation of the reaction is in below.

As seen in the Reaction Scheme 2 below, the compound of Formula 6 is firstly synthesized, and hydrogenation is conducted by using 10% Pd/C. The typical examples of the organic solvent which can be used in this reaction include methanol, ethanol, ethylacetate and the like. Oximation in which the compound of Formula 7 reacted with a desired oxim compound is carried out to obtain the compound of Formula 3 a. The typical examples of the solvent which can be used in this reaction include organic solvent such as methanol, ethanol, propanol and the like, and water, and in some cases, two or more kinds of them can be used. The typical examples of the base which can be used in this reaction include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate, etc., and in some cases, two or more kinds of them can be used. Reaction Scheme 2

(7) (3a)

wherein, E and G are the same as defined in Formula 1.

The compound of Formula 3b in which m is 0, as another representative example for the compound of Formula 3, can be prepared by Reaction Scheme 3 below. More specifically, the compound of Formula 8 is hydrogenated by using 10% palladium/carbon to obtain the compound of Formula 9 which is then converted to the compound of Formula 10 by selective hydrolysis. By the use of solvent such as paraformaldehyde, piperidine and pyridine, the compound of Formula 11 is prepared, and then the compound of Formula 3 b can be synthesized through ozonization and oximation.

Reaction Scheme 3

(11 ) (12) (3b) wherein, E and G are the same as defined in Formula 1.

A person skilled in the art to which the present invention pertains can easily understand the detailed reaction conditions for preparation of the compound of the present invention, based upon many PREPARATIONS and EXAMPLES to be illustrated later, thus explanations thereof are omitted herein in the interest of brevity.

Also, the present invention provides a pharmaceutical composition for accelerating PPARγ and PPARα comprising (a) a therapeutically effective amount of the compound of Formula 1, and (b) a physiologically acceptable carrier, diluent, or excipient, or a combination thereof.

The term "pharmaceutical composition" as used herein means a mixture of a compound of the invention with other chemical components, such as diluents or carriers. The pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to oral, injection, aerosol, parenteral, and topical administrations. Pharmaceutical compositions can also be obtained by reacting compounds with acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, niethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.

The term "therapeutically effective amount" means an amount of active ingredients effective to alleviate, ameliorate or prevent symptoms of disease or decrease or delay the onset of clinical markers or symptoms of disease. Thus, a therapeutically effective amount refers to that amount which has the effect of (1) reversing the rate of progress of a disease; (2) inhibiting to some extent progress of the disease; and/or, (3) alleviating to some extent (or, preferably, eliminating) one or more symptoms associated with the disease. The therapeutically effective amount may be determined by experiments on the efficacy of compound as an active agent via in vivo and in vitro known model systems for diseases to be treated.

The term "carrier" means a chemical compound that facilitates the incorporation of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a commonly utilized carrier as it facilitates the uptake of many organic compounds into the cells or tissues of an organism. The term "diluent" defines chemical compounds diluted in water that will dissolve the compound of interest as well as stabilize the biologically active form of the compound. Salts dissolved in buffered solutions are utilized as diluents in the art. One commonly used buffered solution is phosphate buffered saline because it mimics the ionic strength conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a compound.

The compounds described herein can be administered to a human patient per se, or in pharmaceutical compositions in which they are mixed with other active ingredients, as in combination therapy, or suitable carriers or excipient(s). Techniques for formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, 18th edition, 1990.

The pharmaceutical composition of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well- known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences, above. The compound of Formula 1 according to the present invention can be formulated into dasage forms suitable for injection or oral admimistration in accordance with intended use.

For injection, the agents of the present invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution,

Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compound of the present invention to be formulated as tablet, pill, powder, granule, dragee, capsule, liquid, gel, syrup, slurry, suspension and the like, for oral ingestion by a patient. Preferable dosage forms are capsule and tablet. It is preferable that tablets and pills be coated. Pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipient with one or more compounds of the present invention, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl cellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.

The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g. , sterile pyrogen-free water, before use.

The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

When the formulation is presented in unit dosage form, the compound of Formula 1 as an active agent can be preferably contained in an amount of about 0.1 - 1,000 mg unit dosage. The dosage amount of the compound of Formula 1 will be dependent on the subject's weight and age, the nature and severity of the affliction and the judgment of the prescribing physician. For adult administration, the dosage amount required will be in the range of about 1 to 1000 mg a day depending on the frequency and strength of the dosage. For intramuscular or intravenous administration to adults, a total dosage amount of about 1 ~ 500 mg a day will be sufficient. In some patients, the dosage amount in a day will be higher than that. The present invention provides the use of the compound of Formula 1 for manufacture of a medicament for the treatment or prevention of diseases involving human PPARγ and PP ARa. "Diseases involving human PPARγ and PP ARa" mean the diseases which can be treated and prevented by activating human PPARγ and PP ARa, and include, for example, but are in no way limited to diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc. Representative examples of the complications associated with diabetes mellitus are hyperlipidemia, arteriorasclerosis, obesity, hypertension, retinopathy, kidney inefficiency, etc. The term "treating" means ceasing or delaying progress of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting symptoms of diseases. The term "preventing" means ceasing or delaying symptoms of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting no symptoms of diseases, but having high risk of developing symptoms of diseases.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention will now be illustrated in more detail by the following PREPARATIONS and EXAMPLES; however, the scope of the present invention is not limited thereto. In below, processes for synthesis of intermediates for preparing final compounds are illustrated in PREPARATIONS, whereas processes for synthesis of the final compounds using the compound of PREPARATIONS are illustrated in EXAMPLES. Preparation Example 1: 4-(4-hydroxy-phenyl)-3-oxo-butyric acid methyl ester

(1) Preparation of 5-[2-(4-benzyloxy-phenyl)-acetyI]-2,2-dimethyl-

[ 1 ,3] dioxane-4,6-dione

2,2-dimethyl-[l,3]dioxane-4,6-dione (3.05 g, 21.1 mmol) was dissolved in 20 ml of dichloromethane, and pyridine (4.08 ml, 50.4 mmol) was added thereto with the reaction being kept at O⁰C. After 15 minutes, 20 ml of dichloromethane solution in which (4-benzyloxy-phenyl)-acetyl chloride (5.4 g, 20.7 mmol) was dissolved was added dropwise thereto using a syringe pump over 30 minutes. The resulting solution was stirred for 3 hours and then diluted by dichloromethane, followed by washing with I N HCl and 5% sodium bicarbonate in sequence. An organic layer was dried over anhydrous magnesium sulfate and filtered off, then the residue was purified by column chromatography to obtain the title compound.

Mass(EI) 369(M⁺+1)

(2) Preparation of 4-(4-benzyloxy-phenyl)-3-oxo-butyric acid methyl ester

5-[2-(4-benzyloxy-phenyl)-acetyl]-2,2-dimethyl-[l,3]dioxane-4,6-dione obtained in Procedure (1) above was dissolved in 100 ml of methanol without separation, and the reaction was stirred at 70°C for 2 hours. After removal of methanol, the residue was purified by column chromatography to obtain 1.65 g of the title compound in a yield of 26%.

NMR: ¹H-NMR(CDCIa) δ 7.44-7.31(5H, m), 7.12(2H, d, J=8Hz), 6.95(2H, d, J=8Hz), 5.06(2H, s), 3.77(2H, s), 3.76(3H, s), 3.45(2H, s) Mass(EI) 299(M⁺+ 1) (3) Preparation of 4-(4-hydroxy-phenyl)-3-oxo-butyric acid methyl ester

4-(4-benzyloxy-phenyl)-3-oxo-butyric acid methyl ester obtained in Procedure (2) above was dissolved in 30 ml of methanol, and 200 mg of palladium/C was added thereto, then reacted for 3 hours under hydrogen atmosphere. After the reaction, the resulting solution was filtered off to remove palladium, and solvent was removed, then the residue was purified by column chromatograpy to obtain 570 mg of the title compound in a yield of 49%. Mass(EI) 209(M⁺+l)

Preparation Example 2: Preparation of 4-(4-hydroxy-phenyl)-3-(propoxyimino)- butyric acid methyl ester

4-(4-hydroxy-phenyl)-3-oxo-butyric acid methyl ester (500 mg, 2.4 mmol), 400 mg (3.6 mmol) of n-propoxyaminehydrochloride and 590 mg (7.2 mmol) of sodiumacetate were added to 10 ml of methanol, and the reactant solution was reacted at room temperature for 5 hours. After the reaction, solvent was removed, and 50 ml of ethylacetate was added thereto followed by washing with water twice. An organic layer was separated, and dride over anhydrous magnesium sulfate, then the residue was purifed by column chromatograpy (ethylacetate/hexane = 3/7) to obtain 442 mg of the title compound in a yield of 65%. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.09~7.04(2H, m), 6.79~6.74(2H, m), 4.9O(1H, brs), 4.09~4.03(2H, m), 3.73(0.6H, s), 3.66(3H, s), 3.54(1.4Hz, s), 3.18(1.4H, s), 3.11(0.6H, s), 1.73~1.59(2H, m), 0.98~0.91(3H, m) Mass(EI) 266 (M⁺+l) Preparation Example 3: Preparation of 4-{4-[2-(5-methyl-2-phenyl-oxazole-4-yl)- ethoxy]-phenyl}-3-(propoxyimino)-butyric acid methyl ester

(1) Preparation of methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)- ethyl ester 482 mg (2.37 mmol) of 2-(5-metyl-2-phenyl-oxazole-4-yl)-ethanol and 1.0 ml

(9.1 mmol) of triethylamine were dissolved in 6 ml of methylenedichloride, then the resulting solution was cooled to 0⁰C and 0.28 ml (3.6 mmol) of methanesulfonyl chloride was added thereto. After 3 hours, an organic layer was separated by adding 5 ml of saturated sodium hydrogen carbonate and then dried over anhydrous magnesium sulfate. Solvent was removed, without further separation, the next procedure was conducted.

(2) 4-{4-[2-(5-methyl-2-phenyl-oxazole-4-yl)-ethoxy]-phenyl}-3- (propoxyimino)-butyric acid methyl ester Methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester and 4-(4- hydroxy-phenyl)-3-(propoxyimino)-butyric aicd methyl ester (442 mg, 1.58 mmol) were dissolved in 10 ml of acetonitrile, and 773 mg (2.37 mmol) of and cesiumcarbonate and 146 mg (0.58 mmol) of (±) 3-methyloxyimino-2-(4-hydroxy- benzyl)-butyric acid methyl ester were added. The reaction was reacted for 3 hours under reflux, and filtered off to remove solvent, then the residue was purifed by column chromatograpy (ethylacetate/hexane = 3/7) to obtain 406 mg of the title compound in a yield of 56%.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.98~7.96(2H, m), 7.45~7.39(3H, m), 7.12~7.06(2H, m), 6.85~6.81(2H, m), 4.24~4.20(2H, m), 4.09~4.03(2H, m), 3.75(0.8H, s), 3.62(3H, s), 3.53(1.2H, s), 3.16(1.2H, s), 3.09(0.8H, s), 2.98~2.95(2H, m), 2.37(3H, s), 1.71~1.57(2H, m), 0.98~0.91(3H, m)

Mass(EI) 451 (M⁺+l)

Example 1: 4-{4-[2-(5-methyl-2-phenyI-oxazole-4-yl)-ethoxy]-phenyl}-3-

(propoxyimino)-butyric acid

220 ml (0.48 mmol) of 4-{4-[2-(5-methyl-2-phenyl-oxazole-4-yl)-ethoxy]- phenyl}-3-(propoxyimino)-butyric acid methyl ester was added to a solution composed of tetrahydrofuran (2.0 ml), methanol (2.0 ml) and IN sodium hydroxide (1.0 ml), and the reaction was reacted at room temperature for 2 hours. After the reaction, 2.5 ml of saturated ammonium chloride was added, then 20 ml of ethylacetate was added thereto. An organic layer was separated and dried over anhydrous magnesium sulfate to filter off. Solvent was removed, then the residue was purified by column chromatograpy to obtain 152 mg of the title compound in a yield of 72%. NMR: ¹H-NMR(CDCl₃) δ (Z) 7.98~7.96(2H, m), 7.44~7.39(3H, m), 7.11 (2H, d, J=8Hz), 6.84(2H, d, J=8Hz), 4.23~4.20(2H, t, J=6.8Hz), 4.11~4.06(2H, m), 3.54(2H, s), 3.20(2H, s), 2.96(2H, t, J=6.8Hz), 2.37(3H, s), 1.71~1.65(2H, m), 0.93(3H, t, J=6.8Hz); (E) 7.98~7.95(2H, m), 7.43~7.39(3H, m), 7.06(2H, d, J=8Hz), 6.81(2H, d, J=8Hz), 4.20 (2H, t, J=6.4Hz), 4.06(2H, t, J=6.4Hz), 3.70(2H, s), 3.12(2H, s), 2.96(2H, t, J=6.8Hz), 2.36(3H, s), 1.71~1.65(2H, m), 0.93(3H, t, J=6.8Hz) Mass(EI) 437(M⁺+1)

Preparation Example 4: Preparation of 4-[4-(5-methyl-oxazole-4-yl)-methoxy]- phenyl}-3-(propoxyimino)-butyric acid methyl ester 230 mg (yield: 89%) of the title compound was obtained from 4-chloromethyl- 5-methyl-2-phenyl-oxazole (120 mg, 0.59 mmol) and 4-(4-hydroxy-phenyl)-3- (propoxyimino)-butyric acid methyl ester (150 mg, 0.54 mmol) in the same manner as in Preparation Example 3(2). NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 8.02~8.00(2H, m), 7.45~7.42(3H, m), 7.15~7.09(2H, m), 6.97~6.93(2H, m), 4.97(2H, s), 4.11~4.03(2H, m), 3.75(0.8H, s), 3.66(3H, s), 3.55(1.2H, s), 3.18(1.2H, s), 3.10(0.8H, s), 2.44(3H, s), 1.71~1.57(2H, m), 0.98-0.9 l(3H, m) Mass(EI) 437(M⁺+1)

Example 2: 4-[4-(5-methyl-2-phenyl-oxazole-4-yl)-methoxy]-phenyl}-3-

(propoxyimino)-butyric acid

142 mg (yield: 64%) of the title compound was obtained from 4-[4-(5-methyl- 2-phenyl-oxazole-4-yl)-methoxy]-phenyl}-3-(propoxyimino)-butyric acid methyl ester (230 mg, 0.52 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ (Z) 8.02~8.00(2H, m), 7.46~7.42(3H, m), 7.15(2H, d, J=8Hz), 6.98~6.95(2H, m), 4.98(2H, s), 4.09(2H, t, J=8Hz), 3.56(2H, s), 3.23(2H, s), 2.43(3H, s), 1.74~1.65(2H, m), 0.94(3H, t, J=8Hz); (E) 8.02~8.00(2H, m), 7.46~7.41(3H, m), 7.10(2H, d, J=8Hz), 6.96~6.93(2H, m), 4.97(2H, s), 4.10(2H, t, J=8Hz), 3.73(2H, s), 3.18(2H, s), 2.40(3H, s), 1.75~1.68(2H, m), 0.97(3H, t, J=8Hz); Mass(EI) 423(M⁺+1)

Preparation Example 5: Preparation of 4-[4-(3-phenyl-[l,2,4]oxadiazole-5-yl methoxy)-phenyl]-3-(propoxyimino)-butyric acid methylester 100 mg (yield: 89%) of the title compound was obtained from 5-chloromethyl- 3-phenyl-[l,2,4]-oxadiazole (240 mg, 1.23 mmol) and 4-(4-hydroxy-phenyl)-3- (propoxyimino)-butyric acid methyl ester (150 mg, 0.54 mmol) in the same manner as in Preparation Example 3-2. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 8.1 l~8.08(2H, m), 7.53~7.47(3H, m), 7.19~7.13(2H, m), 6.99~6.94(2H, m), 5.33(2H, s), 4.09~4.03(2H, m), 3.76(0.8H, s), 3.61(3H, s), 3.56(1.2H, s), 3.18(1.2H, s), 3.11(0.8H, s), 1.71~1.64(2H, m), 0.97-0.91(3H, m) Mass(EI) 424(M⁺+1)

Example 3: 4-[4-(3-phenyl-[l,2,4]oxadiazole-5-yl methoxy)-phenyl]-3- (propoxyimino)-butyric acid

75 mg (yield: 76%) of the title compound was obtained from 4-[4-(3-phenyl- [l,2,4]oxadiazole-5-yl methoxy)-phenyl]-3-(propoxyimino)-butyric acid methyl ester (100 mg, 0.24 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ (Z) 8.11~8.09(2H, m), 7.53~7.47(3H, m), 7.14(2H, d, J=8Hz), 6.98~6.96(2H, m), 5.34(2H, s), 4.12(2H, t, J=8Hz), 3.71 (2H, s), 3.23(2H, s), 1.77-1.68(2H, m), 0.95(3H, t, J=8Hz); (E) 8.11-8.08(2H, m), 7.53~7.47(3H, m), 7.18(2H, d, J=8Hz), 6.99~6.97(2H, m), 5.34(2H, s), 4.10(2H, t, J=8Hz), 3.57(2H, s), 3.23(2H, s), 1.74~1.65(2H, m), 0.94(3H, t, J=8Hz) Mass(EI) 410(M⁺+l)

Preparation Example 6: Preparation of 4-[4-(2-bromo-ethoxy)-phenyl]-3- propoxyimino-butyric acid methyl ester 4-(4-hydroxy-phenyl)-3-(propoxyimino)-butyric acid methyl ester (40 mg, 0.14 mmol) was dissolved in 3 ml of acetonitrile, and stirred at 80°C with 0.5 ml of dibromoethane and cesiumcarbonate (93 mg, 0.28 mmol). After 3 hours, the reaction was filtered off to distill solvent, then the residue was purified by column chromatograpy to obtain 36 mg of the title compound in a yield of 69%.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.15~7.09(2H, m), 6.86~6.82(2H, m), 4.29~4.10(2H, m), 4.10~4.04(2H, m), 3.75(0.8H, s), 3.64~3.55(2H, m), 3.66(3H, s), 3.55(1.2Hz, s), 3.17(1.2H, s), 3.10(0.8H, s), 1.73~1.66(2H, m), 0.98~0.91(3H, m) Mass(EI) 373(M⁺+1)

Preparation Example 7: Preparation of 4-[4-(2-oxo-4H-benzo[e][l,3]oxazine-3-yl)- ethoxy]-phenyl}-3-propoxyimino-butyric acid methyl ester

8 mg (yield: 18%) of the title compound was obtained from 4-[4-(2-bromo- ethoxy)-phenyl]-3-propoxyimino-butyric acid methyl ester (14 mg, 0.097 mmol) and 2,3-dihydro-benzo[e][l,3]oxazine-4-one (36 mg, 0.097 mmol) in the same manner as in Preparation Example 3(2).

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.96~7.93(1H, m), 7.46~7.41(1H, m), 7.13~7.07(3H, m), 6.97QH, d, J=8Hz), 6.83~6.78(2H, m), 5.36(2H, s), 4.19~4.16(2H, m), 4.08~4.03(2H, m), 3.95~3.93(2H, m), 3.93(0.8H, s), 3.61(3H, s), 3.53(1.2H, s), 3.15(1.2H, s), 3.08(0.8H, s), 1.72~1.63(2H, m), 0.97~0.90(3H, m) Mass(EI) 441 (M⁺+l)

Example 4: 4-[4-(2-oxo-4H-benzo[e] [l,3]oxazine-3-yl)-ethoxy]-phenyl}-3- propoxyimino-butyric acid 6 mg (yield: 76%) of the title compound was obtained from 4-[4-(2-oxo-4H- benzo[e][l,3]oxazine-3-yl)-ethoxy]-phenyl}-3-propoxyimino-butyric acid methyl ester (8 mg, 0.018 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.96~7.93(1H, m), 7.46~7.26(1H, m), 7.26~7.07(3H, m), 6.97(1H, d, J=8Hz), 6.83~6.80(2H, m), 5.36(2H, s), ), 4.20~4.13(2H, m), 4.13~4.08(2H, m), 3.96~3.94(2H, m), 3.71(1.4H, s), 3.54(0.6H, s), 3.21(0.6H, s), 3.18(1.2H, s), 1.73~1.63(2H, m), 0.99~0.92(3H, m) Mass(EI) 427(M⁺+1)

Preparation Example 8: Preparation of 2-(4-hydroxy-benzyl)-malonic acid diethyl ester

2-(4-hydroxy-benzlyidene)-malonic acid diethyl ester (2.86 g, 10.7 mmol) was dissolved in 100 ml of methanol solution, and 300 mg of palladium/C was added thereto, then reacted for 3 hours under hydrogen atmosphere. After the reaction, the resulting solution was filtered off to remove palladium, and solvent was removed, then the residue was purified by column chromatograpy to obtain 2.90 mg of the title compound in a yield of 100%. Mass(EI) 267(M⁺+1)

Preparation Example 9: Preparation of 2-(4-hydroxy-benzyl)-malonic acid monoethyl ester

2-(4-hydoxy-benzyl)-malonic acid diethyl ester (1.33 g, 4.99 mmol) was stirred for 6 hours with 30 ml of ethanol and 10 ml of IM potassiumhydroxide. The reaction was concentrated, then the pH of the resulting solution was adjusted to 3 using IM hydrochloric solution, followed by extracting with ethylacetate. An organic layer was dried over anhydrous magnesium sulfate to distill solvent, then the residue was purified by column chromatograpy to obtain 1.1 g of title compound in a yield of 92%. NMR: ¹H-NMR(CDCl₃) δ 7.09~7.06(2H, m), 6.76~6.72(2H, m), 4.20(2H, q, J=8Hz), 3.67~3.59(1H, m), 3.20~3.13(2H, m), 1.28~1.20(3H, t, J=8Hz) Mass(EI) 239(M⁺+l)

Preparation Example 10: Preparation of 2-(4-hydroxy-benzyl)-acrylic acid ethyl ester 2-(4-hydroxy-benzyl)-malonic acid monoethyl ester (300 mg, 1.26 mmol) was stirred with paraformaldehyde (36 mg, 0.95 mmol) and piperidine (0.013 ml, 0.1 mmol) in 1 ml of pyridine solution at 80⁰C. After 2 hours, the reaction was cooled to room temperature, then the pH of the resulting solution was adjusted to 3 using hydrochloric solution, followed by extracting with ethylacetate. An organic layer was dried over anhydrous magnesium sulfate to distill solvent, then the residue was purified by column chromatograpy to obtain 140 mg of the title compound in a yield of 53%. NMR: ¹H-NMR(CDCl₃) δ 7.07~7.05(2H, m), 6.77~6.74(2H, m), 6.2O(1H, s), 5.44(1H, d, J=4Hz), 4.19(2H, q, J=8Hz), 3.55(2H, s), 1.26QH, t, J=8Hz) Mass(EI) 207(M⁺+ 1)

Preparation Example 11: Preparation of 3-(4-hydroxy-phenyl)-2-oxo-propionic acid ethyl ester

2-(4-hydroxy-benzyl)-acrylic acid ethyl ester (150 mg, 0.72 mmol) was dissolved in 10 ml of dichloromethane, followed by bubbling of ozone at -78°C. After 30 minutes, the ozone bubbling was stopped, then 2 ml of dimethylsulfate was added dropwise thereto. The temperature of the reaction was heated to 0⁰C, and solvent was removed, then the residue was purified by column chromatograpy to obtain 40 mg of the title compound in a yield 53%. NMR: ¹H-NMR(CDCl₃) δ 7.68~7.66(2H, m), 7.09~7.07(2H, m), 6.49(1H, s), 6.37(1H, brs), 4.35(2H, q, J=8Hz), 1.37(3H, t, J=8Hz) Mass(EI) 209(M⁺+l)

Preparation Example 12: Preparation of 3-(4-hydroxy-phenyl)-2-propoxyimino- propionic acid ethyl ester

30 mg (yield: 59%) of the title compound was obtained from 3-(4-hydroxy- phenyl)-2-oxo-propionic acid ethyl ester (40 mg, 0.19 mmol) in the same manner as in Preparation Example 2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.46~7.44(0.6H, m), 7.14-7.05(1.4H, m), 6.82~6.75(0.6H, m), 6.72-6.70(1.4H, m), 4.30-4.04(2H, m), 3.85(1.4H, s), 3.63(0.6H, s), 1.77-1.66(2H, m), 1.31-1.24(2H, m), 0.98~0.90(3H, m) Mass(EI) 266(M⁺+1)

Preparation Example 13: Preparation of 3-[4-(5-methyl-2-phenyl-oxazole-4-yl methoxy)-phenyI]-2-(propoxyimino)-butyric acid methylester

32 mg (yield: 66%) of the title compound was obtained from 4-chloromethyl-5- methyl-2-phenyl-oxazole (24 mg, 1.23 mmol) and 4-(4-hydroxy-phenyl)-3- (propoxyimino)-butyric acid methyl ester (30 mg, 0.11 mmol) in the same manner as in Preparation Example 3(2). NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 8.04~8.00(2H, m), 7.54~7.52(0.6H, m), 7.45~7.42(3H, m), 7.21-7.19(1.4H, m), 7.02~7.00(0.6H, m), 6.92-6.90(1.4H, m), 5.03(0.6H, s), 4.96(1.4H, s), 4.31~4.06(4H, m), 3.87(1.4H, s), 3.65(0.6H, s), 2.43(0.6H, s), 2.41(1.4H, s), 1.78~1.70(2H, m), 1.32~1.20(2H, m), 0.98~0.91(3H, m) Mass(EI) 437(M⁺+1)

Example 5: 3-[4-(5-methyl-2-phenyl-oxazole-4-yl methoxy)-phenyl]-2- (propoxyimino)-butyric acid

24 mg (yield: 80%) of the title compound was obtained from 3-[4-(5-methyl-2- phenyl-oxazole-4-1 methoxy)-phenyl]-2-(propoxyimino)-butyric acid methylester (32 mg, 0.073 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ 8.04~7.98(2H, m), 7.54~7.52(0.6H, m), 7.42~7.41(3H, m), 7.21-7.19(1.4H, m), 7.00~6.99(0.6H, m), 6.89-6.87(1.4H, m), 5.01(0.6H, s), 4.94(1.4H, s), 4.22~4.06(2H, m), 3.83(2H, s), 2.43(0.6H, s), 2.39(1.4H, s), 1.72-1.70(2H, m), 0.96~0.92(3H, m) Mass(EI) 409(M⁺+l)

Preparation Example 14: Preparation of 4-(4-hydroxy-phenyl)-3-(ethoxyimino)- butyric acid methyl ester 230 mg (yield: 91%) of the title compound was obtained from 4-(4-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (210 mg, 1.0 mmol) and 98 mg (1.0 mmol) of n-ethoxyaminehydrochloride in the same manner as in Preparation Example 2. Mass(EI) 252 (M⁺+l) Preparation Example 15: Preparation of 4-(4-hydroxy-phenyl)-3-[(2- propoxyimino)] -butyric acid methyl ester

110 mg (yield: 86%) of the title compound was obtained from 4-(4-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (100 mg, 0.48 mmol) and 59 mg (0.53 mmol) of 2-propoxyaminehydrochloride in the same manner as in Preparation Example 2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.09~7.04(2H, m), 6.78~6.74(2H, m),

4.76(1H, brs), 4.41~4.34(1H, m), 3.76(0.5H, s), 3.63(3H, s), 3.54(1.5Hz, s), 3.16(1.5H, s), 3.11(0.5H, s), 1.26(1.5H, d, J=4Hz), 1.22(4.5H, d, J=4Hz)

Mass(EI) 266 (M⁺+l)

Preparation Example 16: Preparation of 4-(4-hydroxy-phenyl)-3-[(2- fluoroethoxyimino)]-butyric acid methyl ester

100 mg (yield: 77%) of the title compound was obtained from 4-(4-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (100 mg, 0.48 mmol) and 61 mg (0.53 mmol) of 2-fluoroethoxyaminehydrochloride in the same manner as in Preparation Example 2.

4.73~4.55(3H, m), 4.40~4.28(2H, m), 3.76(0.5H, s), 3.64(3H, s), 3.54(1.5Hz, s),

3.22(1.5H, s), 3.11(0.5H, s)

Mass(EI) 270 (M⁺+l)

Preparation Example 17: Preparation of 4-(4-hydroxy-phenyl)-3-

[(cyclopropylmethoxyimino)] -butyric acid methyl ester

102 mg (yield: 76%) of the title compound was obtained from 4-(4-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (100 mg, 0.48 mmol) and 65 mg (0.53 mmol) of cyclopropylmethoxyaminehydrochloride in the same manner as in Preparation Example 2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.09~7.06(2H, m), 6.77~6.73(2H, m), 4.68(1H, brs), 3.93~3.89(2H, m), 3.74(0.5H, s), 3.62(3H, s), 3.53(1.5Hz, s), 3.19(1.5H, s), 3.09(0.5H, s), 1.20-1.10(1 H, m), 0.54~0.50(2H, m), 0.29~0.25(2H, m) Mass(EI) 278 (M⁺+l)

Preparation Example 18: Preparation of 4-(3-hydroxy-phenyl)-3-oxo-butyric acid methyl ester (1) Preparation of 4-(3-benzyloxy-phenyl)-3-oxo-butyric acid methyl ester

300 mg (yield: 48%) of the title compound was obtained from 2,2-dimethyl- [l,3]dioxane-4,6-dione (370 mg, 2.1 mmol) and (3-benzyloxy-phenyl)-acetyl chloride (540 mg, 2.1 mmol) in the same manner as in Preparation Example 1-1 and 1-2. NMR: ¹H-NMR(CDCl₃) δ 7.52~7.26(6H, m), 6.92~6.80(3H, m), 5.30(2H, s), 4.11(2H, s), 3.79(3Hz, s), 3.53(2H, s) Mass(EI) 299(M⁺+1)

(2) Preparation of 4-(3-hydroxy-phenyl)-3-oxo-butyric acid methyl ester

200 mg (yield: 96%) of the title compound was obtained from 4-(3-benzyloxy- phenyl)-3-oxo-butyric acid methyl ester (300 mg, 1.00 mmol) in the same manner as in Preparation Example 1-3.

NMR: ¹H-NMR(CDCl₃) δ 7.20~7.18(2H, m), 6.77~6.68(2H, m), 4.95(1H, brs), 3.76(2H, s), 3.71(3H, s), 3.46(2Hz, s) Mass(EI) 209(M⁺+ 1) Preparation Example 19: Preparation of 4-(3-hydroxy-phenyl)-3-(ethoxyimino)- butyric acid methyl ester

115 mg (yield: 91%) of the title compound was obtained from 4-(3-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (104 mg, 0.5 mmol) in the same manner as in Preparation Example 2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.19~7.13(1H, m), 6.80~6.67(3H, m), 4.85(1H, brs), 4.21~4.13(2H, m), 3.77(0.6H, s), 3.64(3H, s), 3.57(1.4Hz, s), 3.20(1.4H, s), 3.12(0.6H, s), 1.32~1.18(3H, m) Mass(EI) 252 (M⁺+l)

Preparation Example 20: Preparation of 4-(3-hydroxy-phenyl)-3-(propoxyimino)- butyric acid methyl ester

46 mg (yield: 91%) of the title compound was obtained from 4-(3-hydroxy- phenyl)-3-oxo-butyric acid methyl ester (40 mg, 0.19 mmol) and 25 mg (0.20 mmol) of n-propoxyaminehydrochloride in the same manner as in Preparation Example 2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.17~7.14(1H, m), 6.78~6.65(3H, m),

4.85(1H, brs), 4.12~4.03(2H, m), 3.76(0.6H, s), 3.62(3H, s), 3.55(1.4Hz, s), 3.18(1.4H, s), 3.11(0.6H, s), 1.72~1.65(2H, m), 1.00~0.92(3H, m) Mass(EI) 266 (M⁺+l)

Preparation Example 21: Preparation of methyl-3-(ethoxyimino)-4-{3-[2-(5- methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoate

110 mg (yield: 72%) of the title compound was obtained from methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester synthesized in Preparation Example 3-1 and 4-(3-hydroxy-phenyl)-3-(ethoxyimino)-butyric acid methyl ester (90 mg, 0.35 mmol) in the same manner as in Preparation Example 3-2.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.98~7.96(2H, m), 7.44~7.40(3H, m), 7.21~7.15(1H, m), 6.80~6.74(3H, m), 4.24~4.20(2H, m), 4.18~4.12(2H, m), 3.77(0.8H, s), 3.62(3H, s), 3.57(1.2H, s), 3.18(1.2H, s), 3.10(0.8H, s), 2.99~2.96(2H, m), 2.38(3H, s), 1.31~1.23(3H, m) Mass(EI) 437 (M⁺+l)

Example 6: 3-(ethoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid

100 mg (yield: 94%) of the title compound was obtained from methyl 3-

(ethoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-ly)-ethoxy]-phenyl}butanoate

(110 mg, 0.25 mmol) in the same manner as in Example 1. NMR: ¹H-NMR(CDCl₃) δ (E) 7.90(2H, d, J=7.5Hz), 7.35~7.31(3H, m), 7.00~6.95(lH, m), 6.70~6.58(3H, m), 4.10~4.05(2H, m), 4.02~3.92(2H, m), 3.62(2H, s), 2.90(2H, s),

2.90~2.80(2H, m), 2.24(3H, s), 1.10~1.00(3H, m)

NMR: ¹H-NMR(CDCl₃) δ (Z) 7.90(2H, d, J=6.5Hz), 7.36~7.32(3H, m), 7.1O~6.95(1H, m), 6.75~6.58(3H, m), 4.09~3.99(4H, m), 3.42(2H, s), 3.04(2H, s), 2.85(2H, t, J=6Hz), 2.26(3H, s), 1.05(3H, t, J=6.5Hz)

Mass(EI) 423 (M⁺+l)

Preparation Example 22: Preparation of methyl-3-(propoxyimino)-4-{3-[2-(5- methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoate 200 mg (yield: 98%) of the title compound was obtained from methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester (190 mg, 0.68 mmol) synthesized in Preparation Example 3-1 and 4-(3-hydroxy-phenyl)-3-(ethoxyimino)-butyric acid methyl ester (120 mg, 0.45 mmol) in the same manner as in Preparation Example 3-2. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.99~7.96(2H, m), 7.44~7.40(3H, m), 7.21~7.15(1H, m), 6.80~6.74(3H, m), 4.24~4.20(2H, m), 4.09~4.03(2H, m), 3.77(0.8H, s), 3.62(3H, s), 3.57(1.2H, s), 3.17(1.2H, s), 3.10(0.8H, s), 2.99~2.96(2H, m), 2.38(3H, s), 1.73~1.64(2H, m), 0.97~0.90(3H, m) Mass(EI) 451 (M⁺+l)

Example 7: 3-(propoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)- ethoxy] -phenyl} butanoic acid

87 mg (yield: 45%) of the title compound was obtained from methyl 3- (propoxyimino)-4-{3-[2-(5-methyl-2-phenyl-l,3-oxazole-4-ly)-ethoxy]- phenyl }butanoate (200 mg, 0.44 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ (E) 7.97~7.90(2H, m), 7.42~7.32(3H, m), 7.00~6.95(lH, m), 6.70~6.59(3H, m), 4.07(2H, t, J=4Hz), 3.88(2H, t, J=4Hz), 3.64(2H, s), 2.92(2H, s), 2.85(2H, t, J=8Hz), 2.26(3H, s), 1.50-1.40(2H, m), 0.75(3H, t, J=8Hz) NMR: ¹H-NMR(CDCl₃) δ (Z) 7.93(2H, d, J=8Hz), 7.37~7.34(3H, m), 7.10~7.00(lH, m), 6.70~6.64(3H, m), 4.10(2H, t, J=4Hz), 3.93(2H, t, J=4Hz), 3.43(2H, s), 3.06(2H, s), 2.87(2H, t, J=8Hz), 2.28(3H, s), 1.55-1.45(2H, m), 0.71(3H, t, J=8Hz) Mass(EI) 437 (M⁺+l)

Preparation Example 23: Preparation of 3-(2-fluoroethoxyimino)-4-{4-[2-(5- methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoate methylester

130 mg (yield: 77%) of the title compound was obtained from methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester (130 mg, 0.46 mmol) synthesized in Preparation Example 3-1 and 4-(4-hydroxy-phenyl)-3-(2-fluoroethoxyimino)-butyric acid methyl ester (100 mg, 0.37 mmol) in the same manner as in Preparation Example 3. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.99~7.96(2H, m), 7.44~7.40(3H, m), 7.10~7.05(2H, m), 6.84~6.80(2H, m), 4.70~4.56(2H, m), 4.40~4.25(2H, m), 4.22~4.20(2H, m), 3.74(0.8H, s), 3.61(3H, s), 3.53(1.2H, s), 3.19(1.2H, s), 3.08(0.8H, s), 2.97~2.95(2H, m), 2.36(3H, s) Mass(EI) 455 (M⁺+l)

Example 8 : 3-(2-fluoroethoxy imino)-4- {4- [2-(5-methy 1-2-pheny 1- 1 ,3-oxazole-4-y I)- ethoxy]-phenyl}butanoic acid

110 mg (yield: 89%) of the title compound was obtained from 3-(2- fluoroethoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid methylester (130 mg, 0.28 mmol) in the same manner as in

Example 1.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.99~7.96(2H, m), 7.44~7.40(3H, m),

7.11~7.07(2H, m), 6.84~6.81(2H, m), 4.70~4.55(2H, m), 4.42~4.30(2H, m), 4.22~4.19(2H, m), 3.75(1H, s), 3.54(1H, s), 3.24(1H, s), 3.15(1H, s), 2.96(2H, t, J=7Hz),

2.36(3H, s)

Mass(EI) 441 (M⁺+l)

Preparation Example 24: Preparation of 3-(cyclopropylmethoxyimino)-4-{4-[2-(5- methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoic acid methylester

100 mg (yield: 61%) of the title compound was obtained from methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester (100 mg, 0.35 mmol) synthesized in Preparation Example 3-1 and 4-(4-hydroxy-phenyl)-3-(cyclopropylmethoxyimino)- butyric acid methyl ester (100 mg, 0.36 mmol) in the same manner as in Preparation

Example 3.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.99~7.96(2H, m), 7.41~7.38(3H, m), 7.11~7.08(2H, m), 6.83~6.80(2H, m), 4.22~4.19(2H, m), 3.91~3.89(2H, m), 3.74(0.8H, s), 3.61(3H, s), 3.52(1.2H, s), 3.18(1.2H, s), 3.08(0.8H, s), 2.97~2.94(2H, m), 2.36(3H, s), 1.20-1.05(1H, m), 0.60~0.50(2H, m), 0.28~0.24(2H, m) Mass(EI) 463 (M⁺+l)

Example 9: 3-(cyclopropylmethoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole- 4-yl)-ethoxy] -phenyljbutanoic acid 80 mg (yield: 85%) of the title compound was obtained from 3-

(cyclopropylmethoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl}butanoic acid methylester (100 mg, 0.21 mmol) in the same manner as in Example 1. NMR: ¹H-NMR(CDCl₃) δ (E) 7.98~7.96(2H, m), 7.44~7.40(3H, m), 7.09(2H, d, J=8Hz), 6.83(2H, d, J=8Hz), 4.22(2H, t, J=8Hz), 3.97(2H, d, J=8Hz), 3.72(2H, s), 3.20(2H, s), 2.97(2H, t, J=8Hz), 2.37(3H, s), 1.25-1.10(1H, m), 0.61~0.57(2H, m), 0.32~0.30(2H, m)

NMR: ¹H-NMR(CDCl₃) δ (Z) 7.98~7.96(2H, m), 7.43~7.40(3H, m), 7.11(2H, d, J=12Hz), 6.85(2H, d, J=I 2Hz), 4.22(2H, t, J=8Hz), 3.96(2H, d, J=4Hz), 3.54(2H, s), 3.26(2H, s), 2.97(2H, t, J=8Hz), 2.37(3H, s), 1.25-1.1O(1H, m), 0.58~0.54(2H, m), 0.30~0.27(2H, m)

Preparation Example 25: Preparation of 3-(propoxyimino)-4-{4-[2-(5-methyl-2- phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoic acid methylester

15 mg (yield: 47%) of the title compound was obtained from 20 mg of methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester (0.07 mmol) synthesized in Preparation Example 3-1 and 4-(4-hydroxy-phenyl)-3-(propoxyimino)- butyric acid methyl ester (20 mg, 0.075 mmol) in the same manner as in Preparation Example 3.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.97~7.95(2H, m), 7.45~7.38(3H, m), 7.10~7.05(2H, m), 6.84~6.80(2H, m), 4.25~4.19(2H, m), 4.07~4.00(2H, m), 3.72(1.2H, s), 3.61(3H, s), 3.52(0.8H, s), 3.15(0.8H, s), 3.08(1.2H, s), 2.97~2.94(2H, m), 2.36(3H, s), 1.70~1.63(2H, m), 0.95~0.90(3H, m) Mass(EI) 451 (M⁺+l)

Example 10: 3-(propoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)- ethoxy]-phenyl}butanoic acid

10 mg (yield: 76%) of the title compound was obtained from 3-(propoxyimino)- 4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoic acid methyl ester (15 mg, 0.03 mmol) in the same manner as in Example 1.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.98~7.96(2H, m), 7.44~7.39(3H, m), 7.12~7.06(2H, m), 6.85~6.82(2H, m), 4.23~4.20(2H, m), 4.12~4.06(2H, m), 3.72(1.2H, s), 3.54(0.8H, s), 3.21(0.8H, s), 3.17(1.2H, s), 2.99~2.95(2H, m), 2.37(3H, s), 1.74~1.66(2H, m), 0.99~0.91(3H, m) Mass(EI) 437 (M⁺+l)

Preparation Example 26: Preparation of 3-(2-propoxyimino)-4-{4-[2-(5-methyl-2- phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoic acid methylester

110 mg (yield: 59%) of the title compound was obtained from 117 mg of methanesulfonic acid 2-(5-methyl-2-phenyl-oxazole-4-yl)-ethyl ester (0.41 mmol) synthesized in Preparation Example 3-1 and 4-(4-hydroxy-phenyl)-3-(2-propoxyimino)- butyric acid methyl ester (110 mg, 0.41 mmol) in the same manner as in Preparation Example 3.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.98~7.96(2H, m), 7.52~7.39(3H, m), 7.11~7.00(2H, m), 6.85~6.80(2H, m), 4.39~4.33(1H, m), 4.24~4.20(2H, m), 3.71(0.8H, s), 3.62(3H, s), 3.54(1.2H, s), 3.14(0.8H, s), 3.09(1.2H, s), 2.98~2.95(2H, m), 1.28~1.21(6H, m) Mass(EI) 451 (M⁺+l)

Example 11: 3-(2-propoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)- ethoxy] -phenyl} butanoic acid

100 mg (yield: 97%) of the title compound was obtained from 3-(2- propoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]-phenyl}butanoic acid methylester (110 mg, 0.24 mmol) in the same manner as in Example 1. NMR: ¹H-NMR(CDCl₃) δ (E) 7.98~7.96(2H, m), 7.44~7.40(3H, m), 7.07(2H, d, J=8Hz), 6.83(2H, d, J=12Hz), 4.46~4.4O(1H, m), 4.22(2H, t, J=8Hz), 3.68(2H, s), 3.20(2H, s), 2.97(2H, t, J=8Hz), 2.37(3H, s), 1.30(6H, d, J=4Hz) NMR: ¹H-NMR(CDCl₃) δ (Z) 7.98~7.96(2H, m), 7.44~7.40(3H, m), 7.11(2H, d,

J=8Hz), 6.84(2H, d, J=8Hz), 4.47~4.41(1H, m), 4.22(2H, t, J=8Hz), 3.54(2H, s),

3.22(2H, s), 2.97(2H, t, J=8Hz), 2.37(3H, s), 1.27(6H, d, J=8Hz)

Mass(EI) 437 (M⁺+l)

Preparation Example 27: Preparation of 4-[4-(2-{4-

[(methylsulfonyl)oxy]phenyl}ethoxy)phenyl]-3-(propoxyimino)butanoic acid methylester

20 mg (yield: 57%) of the title compound was obtained from 22 mg (0.075 mmol) of 4-{2-[(methylsulfonyl)oxy]ethyl}phenyl methanesulfonate and 4-(4-hydroxy- phenyl)-3-(propoxyimino)-butyric acid methylester (20 mg, 0.075 mmol) in the same manner as in Preparation Example 3.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.32(2H, d, J=8.5Hz), 7.22(2H, d,

J=8.5Hz), 7.11~7.06(2H, m), 6.82~6.80(2H, m), 4.15~4.11(2H, m), 4.07~4.02(2H, m), 3.72(0.8H, s), 3.61(3H, s), 3.53(1.2H, s), 3.15(0.8H, s), 3.12(3H, s), 3.08(1.2H, s),

3.10~3.08(2H, m), 1.70~1.64(2H, m), 0.96~0.90(3H, m)

Mass(EI) 464 (M⁺+l)

Example 12: 4-[4-(2-{4-[(methylsulfonyl)oxy]phenyl}ethoxy)phenyl]-3- (propoxyimino)butanoic acid

19 mg (yield: 79%) of the title compound was obtained from 4-[4-(2-{4- [(methylsulfonyl)oxy]phenyl}ethoxy)phenyl]-3-(propoxyimino)butanoic acid methylester (25 mg, 0.053 mmol) in the same manner as in Example 1. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.32(2H, d, J=8.5Hz), 7.22(2H, d, J=8.5Hz), 7.12~7.06(2H, m), 6.82~6.79(2H, m), 4.15~4.08(4H, m), 3.71(1.2H, s),

3.53(0.8H, s), 3.20(0.8H, s), 3.17(1.2H, s), 3.12(3H, s), 3.10~3.08(2H, m),

1.75-1.68(2H, m), 0.99~0.90(3H, m)

Mass(EI) 450 (M⁺+ 1)

Preparation Example 28: Preparation of 4-[3-(2-{4-

15 mg (yield: 43%) of the title compound was obtained from 22 mg (0.075 mmol) of 4- { 2- [(methylsulfonyl)oxy] ethyl} phenyl methanesulfonate and 4-(4-hydroxy- phenyl)-3-(propoxyimino)-butyric acid methylester (20 mg, 0.075 mmol) in the same manner as in Preparation Example 3.

NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.33(2H, d, J=8.0Hz), 7.23-7.15(3H, m), 6.80~6.71(3H, m), 4.15~4.12(2H, m), 4.08~4.03(2H, m), 3.76(0.8H, s), 3.60(3H, s), 3.56(1.2H, s), 3.17(0.8H, s), 3.14(3H, s), 3.12(1.2H, s), 3.10~3.08(2H, m),

1.70-1.65(2H, m), 0.96~0.90(3H, m)

Mass(EI) 464 (M⁺+l)

Example 13: 4-[3-(2-{4-[(methylsuIfonyl)oxy]phenyl}ethoxy)phenyl]-3- (propoxyimino)butanoic acid

10 mg (yield: 69%) of the title compound was obtained from 4-[3-(2-{4- [(methylsulfonyl)oxy]phenyl}ethoxy)phenyl]-3-(propoxyimino)butanoic acid methylester (15 mg, 0.032 mmol) in the same manner as in Example 1. NMR: ¹H-NMR(CDCl₃) δ (a mixture of E and Z) 7.33(2H, d, J=7.5Hz), 7.23-7.15(3H, m), 6.80~6.69(3H, m), 4.15~4.09(4H, m), 3.74(1.2H, s), 3.57(0.8H, s), 3.22(0.8H, s), 3.18(1.2H, s), 3.12(3H, s), 3.10~3.08(2H, m), 1.71~1.67(2H, m), 0.97~0.90(3H, m) Mass(EI) 450 (M⁺+l)

Example 14: Construction of reporter vector containing lucif erase structural gene in GAL4 transcription gene sequence

A GAL4 response sequence containing 8 repeats of the basic subunit (UAS), containing an MM site at the 5' end and HindIII site at 3' end, as follows: 5'-GTGCAGGTGCCAGAACATTT CTCTATCGAT AGG TA(CTCGGAGGACAGTACTCCG) TA(CTCGGAGGACAGTACTCCG)

TA(CTCGGAGGACAGTACTCCG) TA(CTCGGAGGACAGTACTCCG)

TA(CCTCGGAGGACAGTACTCCG)

(CTCGGAGGACAGTACTCCG)(CTCGGAGGACAGTACTCCG)(CTCGGAGGACA GTACTCCG) TA CCGTCGACTT TAGAGGGTAT AT-3' (parentheses indicatethe basic subunit UAS), was synthesized by a DNA synthesizer and then subcloned into the multiple cloning site of pGL3 -Basic vector (Promega, Cat. No. El 751). As a result, pGL3-GAL4 vector containing 8xUAS, followed by luciferase structural gene, was constructed.

Example 15: Construction of vector expressing fusion protein of GAL4 and ligand- binding domain of PPAR protein

A vector, expressing a protein in which the DNA-binding domain of GAL4 is fused with the ligand-binding domain of PPAR under control of SV40 promoter, was constructed using pZeoSV (Invitrogen, Cat. No. V85001) being a mammalian cell expression vector as a basic vector.

(1) Amplification of cDNA encoding DNA-binding domain of GAL4 transcription factor, and insertion thereof into expression vector. To amplify the DNA-binding domain of GAL4 protein, a basal transcription activator in yeast, the following primer was synthesized using a DNA synthesizer: primer GAL4-HIII (5'-GC AAGCTT GAAGCAAGCCTCCTGAAAG ATG AAG CTA CTG TCT TCT ATC GAA C-3¹) contains the sequence encoding amino acids 1 to 8 of the N-terminal of the GAL4 DNA-binding domain, and also the restriction enzyme HindIII recognition domain. Another primer GAL4-KI (5'-AA GGTACC GGT AAA TTC CGG CGA TAC AGT CAA CTG TCT TTG A-3¹) contains the sequence encoding amino acids 141 to 147 of the C-terminal of the DNA-binding domain of GAL4, and also the restriction enzyme Kpnl recognition domain. 2 μg of the primer GAL4-HIII and 2 μg of the primer GAL4-KI were added into a reaction tube, then 10 ng of plasmid pGBT9 (Clonetech, Cat. No. K1605-A) as a template, and 10 μl of 10 x polymerization buffer (50 mM KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton X-100, 2.5 mM MgCl₂), 10 μl of 2 mM dNTP (2 mM dGTP, 2 mM dATP, 2 mM dCTP and 2 mM dTTP), 2.5 units of Taq polymerase, and distilled water were further added to a total volume of 100 μl, and PCR was carried out for 25 cycles with denaturation at 95⁰C for 40 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute. When the PCR product was separated in 2% agarose gel, it was confirmed that a sequence of about 488 base pairs was amplified, then the product was seperated and purified from the agarose gel. The DNA fragment thus seperated and purified (hereinafter, referred to as 'fragment GAL4-H/K') was fully restricted with HindIII and Kpnl in NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM dithiothreitol (pH 7.9)), and extracted with phenol/chloroform, then eluted with 20 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) solution.

Meanwhile, 2 μg of plasmid pZeoSV was fully restricted with restriction enzymes HindIII and Kpnl in NEB buffer 2, and a nucleic acid fragment of about 3.5 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as "fragment pZeoSV-H/K".

100 ng of the fragment GAL4-H/K obtained above and 100 ng of the fragment pZeoSV-H/K obtained above were added into a ligation reaction tube, then 2 μl of 10 x ligation reaction solution (50 mM Tris-HCl(pH 7.8), 10 mM MgCl₂, 10 mM dithiothreitol, 1 mM ATP, 25 μg /ml BSA) and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 ml, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain plasmid pZeo-GAL containing the DNA- binding domain of GAL4 (refer to Fig. 1 ).

(2) Preparation of DNA fragment encoding human PPARγ ligand-binding domain and construction of expression vector of GAL4 - Human PPARγ chimeric receptor protein The below primers were synthesized from the gene sequence data of human

PPARγ gene (Genebank NMJ)15869). Primer GLBD-f (5'-GG GGTACC TCT CAT AAT GCC ATC AGG TTT GGG CGG ATG C -3') contains the sequence encoding from Ser¹⁷⁶ to Met¹⁸⁵ of human PPARγ gene and also the restriction enzyme Kpnl - recognition domain. Primer GLBD-r (5'-CC ACGCGT CTA GTA CAA GTC CTT GTA GAT CTC C -3') contains the sequence encoding from GIu⁴⁷² to Tyr⁴⁷⁸ of human PPARγ gene and the termination codon, allowing the termination of translation at the 478^th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment encoding from Ser¹⁷⁶ to Tyr⁴⁷⁸ containing the human PPARγ ligand-binding domain was amplified by PCR using the above described primer and also using the full- length cDNA of human PPARγ, isolated from human liver cDNA library, as a template. When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The fragment thus seperated and purified (hereinafter, referred to as 'fragment GLBD-K/M') was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μl of TE solution.

Meanwhile, 2 μg of plasmid pZeo-GAL obtained above was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and a nucleic acid fragment of 4.0 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as "fragment pZeoGAL-K/M".

100 ng of the fragment GLBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μl of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μl, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARγ ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL- PPARγLBD").

(3) Preparation of DNA fragment encoding human PPARα ligand-binding domain and construction of expression vector of GAL4-human PPARα chimeric receptor protein

The below primers were synthesized from the gene sequence information of human PPARα gene. Primer ALBD-f (5'-GG GGTACC TCA CAC AAC GCG ATT CGT T-3¹) contains the sequence encoding from Ser¹⁶⁷ to Arg¹⁷⁵ of human PPARα and also the restriction enzyme Kpnl - recognition domain. Primer ALBD-r (5'-CC ACGCGT TCA GTA CAT GTC CCT GTA GAT CTC CTG C-3¹) contains the sequence encoding from GIn⁴⁶¹ to Tyr including the human PPARα ligand-binding domain and the termination codon, allowing the termination of translation at the 468^th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment, encoding from Ser¹⁶⁷ to Tyr⁴⁶⁸ containing the human PPARα ligand-binding domain, was amplified by PCR using the above described primer and also using the full length cDNA of human PPARα, isolated from human liver cDNA library, as a template. When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The nucleic acids thus seperated and purified (hereinafter, referred to as 'fragment ALBD-K/M') were fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μl of TE solution.

100 ng of the fragment ALBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μl of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μl, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARα ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL- PPARaLBD").

Example 16: Transformation CV-I cells derived from monkey kidney were aliquoted into each well of 24- well plate at a density of 6.OxIO⁴ per/well, suspended in DMEM medium (Life Technologies Inc) supplemented with 10% FBS, and cultured for 24 hours at 37°C in 5% CO₂ atmosphere. After culturing, the growth medium was replaced with 200 μl of OptiMEM™ medium (Life Technologies Inc) and the cells were used for transformation. The amount of DNA was 480 ng of pGL3-GAL4, 48 ng of pZeo-GAL-PPARγLBD or pZeo-GAL-PPARαLBD and 128 ng of pCHllO (Amersham, Cat.No. 27-4508-01) per well. 29 μl of DNA was suspended in OptiMEM™ medium, and 1 μl of PLUS reagent (Invitrogen) was added thereto and stirred, followed by incubation for 15 minutes at room temperature. To a mixture of DNA and PLUS reagent, 1 μl of LIPOFECTAMINE (Invitrogen) diluted with OptiMEM™ medium was added and stirred, followed by incubation for 15 minutes at room temperature. A solution containing the complex of DNA and LIPOFECTAMINE thus prepared was added dropwise to CV-I cells being cultured in 24-well plate and then gently stirred, followed by culturing for 3 hours at 37⁰C in 5% CO₂ atmosphere. After the culturing, 260 μl of DMEM™ medium supplemented with 20% FBS was added to each well and cultured at 37°C in 5% CO₂ atmosphere for 24 hours, and the resulting culture was used for analysis.

Example 17: Determination of accelerating activity for human PPARα or PPARγ (1) Measurement of degree of expression of Luciferase

The growth medium was removed from the transformed cells in Example 8, and the compounds of Examples 1 to 13 were suspended in DMSO and added in DMEM medium supplemented with 5% FBS, then the resulting mixture was added to each well, followed by culturing at 37⁰C in 5% CO₂ atmosphere for 24 hours. After the culturing, the culture media was removed and cells were washed twice with PBS (Life Technologies Inc). To each well, 100 μl of Passive Lysis Buffer (PLB) solution (Promega Corporation) was added and then gently stirred for 20 minutes at room temperature. 20 μl of cell lysate taken from each well was removed to a Costar 96- well Luminometer and luciferase activity was determined using Luciferase Assay System™ kit (Promega Corporation) following the instructions of the manufacturer.

(2) Measurement of β-galactosidase activity

20 μl of cell lysate as obtained above was moved to 96-well plate (Falcon,

Cat.No. 353911) and added with 100 μl of ONPG (O-nitrophenyl β-galacti-pyranoside) solution to each well, followed by incubation at 37°C for 2 hours. Then, 50 μl of 1 M sodium carbonate (Na₂CO₃) was added to each well and the absorbance was measured at 415 nm by a spectrophotometer.

(3) Degree of activity of ligand The efficacy of transformation in cell lysis buffer was represented by the activity of beta-galactosidase measured in the above, and the comparative activity of luciferase was measured, thereby comparing the degree of the activity of each compound. The experimental results were expressed as an increasing multiple on the basis of the value of the control, in which only 5% DMSO without compound was added. On the basis of this, ECs₀ being the efficacy of the compounds obtained in Examples 1 to 13, was presented in Table 1 and 2 below. EC₅₀ (Effective concentration fifty) expresses the concentration of a compound which shows 50% of the maximum possible response of the compound. TABLE 1

TABLE 2

As seen in the above table 1 and 2, it is clear that the compound of Formula 1 according to the present invention is very effective for accelerating the activity of PPARγ and PPARα. Accordingly, the compound according to the present invention can be used as a drug for treatment or prevention of diseases involving human PPARα and PPARγ, for example, diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc.

Other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the scope of particular embodiments of the invention indicated by the following claims.

Claims

WHAT IS CLAIMED IS :

1. A compound of Formula 1, or pharmaceutically acceptable salts or isomers thereof:

wherein,

A is one of substituents having the below structure;

wherein,

Rl is each independently one of substituents having the below structure;

wherein,

R2, R3 and R4 are each independently hydrogen, halogen, or lower alkyl; n is 1 or 2; and m is O or l.

2. The compound according to claim 1, or pharmaceutically acceptable salts or isomers thereof, wherein said G is hydrogen.

3. The compound according to claim 1, or pharmaceutically acceptable salts or isomers thereof, wherein said lower alkyl is C₁-C₄ alkyl.

4. The compound according to claim 1, or pharmaceutically acceptable salts or isomers thereof, wherein the compound of Formula 1 is selected from the compounds below:

4-{4-[2-(5 -methyl-2-phenyl-oxazole-4-yl)-ethoxy] -phenyl } -3 -(propoxyimino)-butyric acid

4-[4-(5-methyl-2-phenyl-oxazole-4-yl)-methoxy]-phenyl]-3-(propoxyimino)-butyric acid

3 - [4-(5 -methyl -2-phenyl-oxazole-4-yl methoxy)-phenyl] -propoxyimino)-butyric acid

3 -(ethoxyimino)-4- { 3 - [2-(5 -methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] - phenyl }butanoic acid 3 -(propoxyimino)-4- { 3 - [2-(5 -methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] - phenyl }butanoic acid

3 -(2-fluoroethoxyimino)-4- {4- [2-(5-methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] - phenyl }butanoic acid

3 -(cyclopropylmethoxyimino)-4- { 4- [2-(5 -methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] - phenyl } butanoic acid

3 -(propoxyimino)-4- { 4- [2-(5 -methyl-2-phenyl- 1 ,3 -oxazole-4-yl)-ethoxy] -phenyl } - butanoic acid

3-(2-propoxyimino)-4-{4-[2-(5-methyl-2-phenyl-l,3-oxazole-4-yl)-ethoxy]- phenyl} butanoic acid 4-[4-(2-{4- [(methylsulfonyl)oxy] phenyl } ethoxy)phenyl] -3 -(propoxyimino)butanoic acid

4- [3 -(2- { 4- [(methylsulfonyl)oxy]phenyl } ethoxy)phenyl] -3 -(propoxyimino)butanoic acid

5. A process for preparation of the compound of the Formula 1 as defined in claim

1 comprising the step of reacting the compound of Formula 2 with the compound of Formula 3 in the presence of base:

wherein, A, E, G and n are the same as in Formula 1, and X means Cl, Br, I or methanesulfonyl group.

6. A pharmaceutical composition comprising (a) a therapeutically effective amount of the compound of Formual 1 as defined in claim 1, and (b) a physiologically acceptable carrier, diluent, or excipient, or a combination thereof.

7. The composition according to claim 6 wherein the pharmaceutical composition is used to treat or prevent diseases associated with PPARγ and PPARα.

8. The composition according to claim 7 wherein the diseases associated with PPARγ and PPARα above is diabetes mellitus, implications associated with diabetes mellitus, or inflammation.

9. The composition according to claim 8 wherein the implications associated with diabetes mellitus is hyperlipiemia, arteriosclerosis, obesity, hypertension, retinopathy, or renal insufficiency.

10. Use of the compound of Formula 1 as defined in claim 1 for manufacture of a medicament for the treatment or prevention of diseases involving human PPARγ and PPARα.