WO2007058267A1

WO2007058267A1 - Novel protein and gene encoding the protein

Info

Publication number: WO2007058267A1
Application number: PCT/JP2006/322879
Authority: WO
Inventors: Kenichi Mikitani
Original assignee: Kenichi Mikitani
Priority date: 2005-11-16
Filing date: 2006-11-16
Publication date: 2007-05-24
Also published as: JP2007135441A; WO2007058267A8

Abstract

Disclosed is a novel protein involved in ontogeny. The protein is any one selected from the following proteins (a) to (d): (a) a protein which comprises an amino acid sequence depicted in SEQ ID NO:2 or 4; (b) a protein which comprises an amino acid sequence having deletion, substitution or addition of one or several amino acid residues in the amino acid sequence depicted in SEQ ID NO:2 or 4 and is essential for ontogeny; (c) a protein which comprises an amino acid sequence having deletion, substitution or addition of one or several amino acid residues in the amino acid sequence depicted in SEQ ID NO:2 or 4 and has an affinity interaction with the protein (a); and (d) a protein which comprises an amino acid sequence having deletion, substitution or addition of one or several amino acid residues in the amino acid sequence depicted in SEQ ID NO:2 or 4 and has an affinity interaction with Bax inhibitor-1.

Description

Specification

Novel protein and gene encoding the same

Technical field

[0001] The present invention relates to a novel protein and a gene encoding the same.

Background art

[0002] After the present inventor completed the present invention, the present protein was compared with a known protein. As a result, the C-terminal 326 amino acid portion of the protein of the present invention was used as a virtual protein. (PID gl6553765) _{0 The} SAM domain, which is a motif contained in the protein of the present invention, is reviewed in Non-Patent Documents 1-3.

Special Reference 1: Ponting, Shi. P., SAM: A novel motif in yeast sterile and Drosophila pol yhomeotic proteins, Protein Sci ", 1995, 4, 1928-1930

Non-Patent Document 2: Schultz, J., SAM as a protein interaction domain involved in developm ental regulation, Protein Sci., 1997, 6, 249-253

Non-Patent Document 3: Kim, C.A. and Bowie, J.U., SAM domains: Uniform structure, diversit y of lunction, Trends Biochem. Sci., 2003, 28, 625-628

Disclosure of the invention

Problems to be solved by the invention

[0003] The present invention firstly provides a novel protein related to ontogeny, a gene encoding the protein, a recombinant vector containing the gene, a transformant containing the recombinant vector, and an antibody against the protein Alternatively, an object is to provide a fragment thereof. A second object of the present invention is to provide a screening method for substances that affect ontogeny.

Means for solving the problem

In order to achieve the above object, the present invention provides the following protein, gene, recombinant vector, transformant, antibody or fragment thereof, and screening method.

(1) Protein shown in the following (a) or (b). (a) a protein having an amino acid sequence ability described in SEQ ID NO: 2 or 4

(b) an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2 or 4, and is essential for ontogeny

(2) Protein shown in the following (a) or (c).

(a) a protein having an amino acid sequence ability described in SEQ ID NO: 2 or 4

(c) a protein having an affinity interaction with the protein shown in (a) above, wherein one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 or 4

(3) Protein shown in the following (a) or (d).

(d) a protein that also has an amino acid sequence ability in which one or more amino acids are deleted, substituted, or added in the amino acid sequence of SEQ ID NO: 2 or 4, and exhibits an affinity interaction with Bax inhibitor-1

(4) A gene encoding the protein according to any one of (1) to (3).

(5) The gene according to (4) above, which comprises the DNA shown in (e) or (f) below.

(e) DNA consisting of the 19-1452th base sequence in the base sequence described in SEQ ID NO: 1 or DNA having 46-1479th base sequence ability in the base sequence described in SEQ ID NO: 3

(f) DNA that is hybridized under stringent conditions to DNA complementary to the DNA shown in (e) above

(6) A recombinant vector comprising the gene according to (5).

(7) A transformant comprising the recombinant vector according to (6).

(8) The antibody or fragment thereof capable of reacting with the protein according to any one of (1) to (3)

(9) Determine whether the test substance can suppress or promote the affinity interaction between the proteins described in (2) above, and affect the ontogeny of the test substance that can suppress or promote the affinity interaction A method for screening a substance that affects ontogeny, comprising a step of screening as a substance.

(10) The test substance is an affinity reciprocal between the protein described in (3) and Bax inhibitor-1 A method for screening a substance that affects ontogeny, comprising the step of determining whether or not the action can be suppressed or promoted and screening the test substance capable of suppressing or promoting the affinity interaction as a substance that affects ontogeny .

The invention's effect

[0005] According to the present invention, a novel protein related to ontogeny, a gene encoding the protein, a recombinant vector containing the gene, a transformant containing the recombinant vector, and an antibody against the protein or its Fragments are provided. The present invention also provides a method for screening for substances that affect ontogeny.

Brief Description of Drawings

[0006] Fig. 1 is a diagram showing the genomic structures of human gene 1 and mouse gene 1.

FIG. 2 is a graph showing the expression of human gene 1 in tissues such as brain, kidney, lung, muscle, placenta, small intestine, testis, adrenal gland, salivary gland, spleen, and stomach.

FIG. 3 shows the results of observing the localization of a GFP-fused human gene 1 product in COS-7 cells using a fluorescence microscope.

FIG. 4 is a diagram showing the detection result of interaction between human gene 1 products by co-immunoprecipitation method.

FIG. 5 is a diagram showing the results of detecting the interaction between human gene 1 products by the mammalian cell two-hybrid method.

FIG. 6 is a view showing the detection results of the interaction between the human gene 1 product and the human Bax inhibitor 1 gene product by the mammalian cell two-hybrid method.

FIG. 7 is a diagram showing the detection result of human gene 1 product by Western blotting using anti-gene 1 antibody.

FIG. 8 is a block diagram of a GFP human gene 1 vector.

FIG. 9 is a block diagram of a FLAG human gene 1 vector.

FIG. 10 is a block diagram of the HA-human gene 1 vector.

FIG. 11 is a block diagram of a GAL4 human gene 1 vector.

FIG. 12 is a block diagram of a VP16 human gene 1 vector.

FIG. 13 is a block diagram of a VP16 human Bax inhibitor-1 gene vector. FIG. 14 is a block diagram of a mouse gene 1 gene targeting vector. BEST MODE FOR CARRYING OUT THE INVENTION

[0007] Hereinafter, the present invention will be described in detail.

The protein of the present invention is a protein shown in the following (a), (b), (c) or (d).

(a) a protein having an amino acid sequence ability described in SEQ ID NO: 2 or 4 (hereinafter sometimes referred to as “protein (a)”)

(b) In the amino acid sequence set forth in SEQ ID NO: 2 or 4, one or more amino acids are deleted, substituted or added, and it is also an amino acid sequence that is essential for ontogeny (hereinafter referred to as “protein (b)”) There may be cases.)

(c) a protein having an affinity interaction with the protein shown in (a) above, wherein one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 or 4 (Hereafter referred to as “protein (c)”!)

(d) A protein having an amino acid sequence ability in which one or more amino acids are deleted, substituted or added in the amino acid sequence described in SEQ ID NO: 2 or 4, and has an affinity interaction with Bax inhibitor-1 (hereinafter referred to as “protein ( d) "may occur.)

[0008] Among the proteins (a), the protein having the amino acid sequence ability described in SEQ ID NO: 2 is a protein derived from human, and the protein consisting of the amino acid sequence described in SEQ ID NO: 4 is a mouse-derived protein.

[0009] Protein (a) is an essential protein for ontogeny. Protein (a) is essential for ontogeny especially in the embryonic period, and if the gene encoding the protein comprising the amino acid sequence described in SEQ ID NO: 2 becomes homo-deficient in the human genome, the fertilized egg The normal development process cannot be achieved and the human fetus is fatal. In addition, if the gene encoding the protein having the amino acid sequence shown in SEQ ID NO: 4 becomes homo-deficient in the mouse genome, the fertilized egg cannot go through a normal development process, and the mouse fetus It will be lethal. In addition, if it is a hetero deficiency type, a human fetus and a mouse fetus will not be lethal.

[0010] Protein (a) exhibits an affinity interaction with another protein (a). The affinity interaction of protein (a) is considered to be involved in ontogeny, especially in embryonic development. “Affinity interaction between proteins (a)” means protein (a) It means both direct binding between proteins and indirect binding between proteins (a) via other substances, preferably direct binding between proteins (a).

[0011] Protein (a) exhibits an affinity interaction with Bax inhibitor-1. The affinity interaction between protein (a) and Bax inhibitor-1 is thought to be involved in ontogeny, particularly in embryonic development. “Friendly interaction between protein (a) and Bax inhibitor-1” refers to direct binding between protein (a) and Bax inhibitor-1 and protein (a) via other substances. This also means a shift in indirect binding with Bax inhibitor-1, but preferably means direct binding between protein (a) and Bax inhibitor-1.

[0012] Bax inhibitor-1 inhibits the action of Bax, a factor that induces apoptosis, and suppresses cell death. Examples of proteins that interact with Bax inhibitor-1 include Be 1-2 and Bel-XL. The amino acid sequence of human-derived Bax inhibitor-1 is shown in SEQ ID NO: 6, and the base sequence of the DNA encoding it is shown in SEQ ID NO: 5.

[0013] Of the amino acid sequence set forth in SEQ ID NO: 2 or 4, the 73rd amino acid force and the 140th amino acid moiety contain a peptide motif characteristic of a signal transduction factor called a SAM (Sterile Alpha Motif) domain. The Ser residue of amino acid 52 is included in the motif characteristic of the MAP kinase substrate, and the region from amino acid 247 to amino acid 250 (Pro-Pro-Leu-Pro) is an SH3 binding region motif.

[0014] The SAM domain is a peptide domain structure of about 70 amino acids, is found in eukaryotic gene products from yeast to humans, and is thought to mediate protein-protein interactions. ing. In some SAM domains, RNA binding ability, lipid binding ability, etc. have been reported. MAP kinase is a serine-threonine kinase that is ubiquitous in eukaryotes and plays an important role in cell proliferation, differentiation, apoptosis, morphogenesis, and the like. A MAP kinase substrate is a protein that is activated or inactivated by being phosphorylated by MAP kinase. Transcription factors such as Elk-1, cMyc, kinases such as RSK, M APKAPK-2, etc. are known. Yes. The SH3 (Src homology 3) binding domain is a domain that binds to the SH3 domain, which is a functional domain in the oncogenic tyrosine kinase gene product Src. Pro- Xaal- Xaa2- ro (X _aa 2 is usually a hydrophobic amino acid). The Src gene product is thought to play an important role in embryonic development and cell proliferation.

In [Protein], the number and position of amino acids deleted, substituted or added to the amino acid sequence shown in SEQ ID NO: 2 or 4 retains the function of protein (a), which is essential for ontogeny. The number is not particularly limited as long as it is one or more, preferably one or several. The specific range for deletion is usually 1 to 40, preferably 1 to 20, more preferably 1 to 10, and the specific range for substitution is usually 1 to 20, preferably 1 to 10. 10, more preferably 1-5, and the specific range for addition is usually 1-10, preferably 1-5, more preferably 1-2. The amino acid sequence of protein (b) has a homology of usually 70% or more, preferably 80% or more, more preferably 90% or more with the amino acid sequence of protein (a).

[0016] In addition to a protein in which mutations such as deletion, substitution and addition are artificially introduced into protein (a), protein (a) is introduced with mutations such as deletion, substitution and addition. It includes proteins that exist in nature and proteins that have been artificially introduced with mutations such as deletions, substitutions, and additions. Naturally occurring proteins with mutations such as deletions, substitutions and additions include, for example, mammals (eg, humans, monkeys, bushes, hidges, goats, horses, pigs, rabbits, And the like (including proteins that can be generated by polymorphism in these mammals).

[0017] In the protein (1), the number and position of amino acids deleted, substituted, or added to the amino acid sequence shown in SEQ ID NO: 2 or 4 indicates an affinity interaction with another protein (a) ( The number is not particularly limited as long as the function of a) is maintained, and the number is one or more, preferably one or several. The specific range for deletion is usually 1 to 40, preferably 1 to 20, more preferably 1 to: LO, and the specific range for substitution is usually 1 to 20, preferably 1. ~: LO, more preferably 1-5, and the specific range for addition is usually 1-10, preferably 1-5, more preferably 1-2. The amino acid sequence of protein (c) usually has a homology of 70% or more, preferably 80% or more, more preferably 90% or more with the amino acid sequence of protein (a).

[0018] Among the amino acid sequences set forth in SEQ ID NO: 2 or 4, the 1st to 62nd amino acids are amino acids. Even if one or more amino acids are deleted, substituted, or added in the sequence part or the amino acid sequence part of the 159th to 478th amino acids, the protein interacts with other proteins (a). The function of protein (a) is retained. In addition, the amino acid sequence portion having 1st to 62nd amino acid force is present on the N-terminal side of the SAM domain, includes a MAP kinase basic motif, and is a portion having a relatively large difference between human and mouse. The amino acid sequence part of the 478th amino acid is located on the C-terminal side of the SAM domain, contains the SH3 binding domain, and has relatively high homology between humans and mice! , Part.

[0019] In protein (), in addition to a protein in which mutations such as deletion, substitution, and addition have been artificially introduced into protein (a), natural mutations in which mutations such as deletion, substitution, and addition have been introduced In addition, proteins that are present in humans and proteins into which mutations such as deletions, substitutions, and additions have been artificially introduced are also included. Naturally occurring proteins with mutations such as deletions, substitutions and additions include, for example, mammals (eg, humans, monkeys, bushes, hidges, goats, horses, pigs, rabbits, And the like (including proteins that can be generated by polymorphism in these mammals).

[0020] In the protein (d), the number and position of amino acids deleted, substituted, or added to the amino acid sequence shown in SEQ ID NO: 2 or 4 is a protein that exhibits an affinity interaction with Bax inhibitor-1 ( The number is not particularly limited as long as the function of a) is maintained, and the number is one or more, preferably one or several. The specific range for deletion is usually 1 to 40, preferably 1 to 20, more preferably 1 to: L0, and the specific range for substitution is usually 1 to 20, preferably 1 ~: L0, more preferably 1-5, and the specific range for addition is usually 1-10, preferably 1-5, more preferably 1-2. The amino acid sequence of the protein (d) has a homology of usually 70% or more, preferably 80% or more, more preferably 90% or more with the amino acid sequence of the protein (a).

[0021] Among the amino acid sequences described in SEQ ID NO: 2 or 4, the amino acid sequence portion having the amino acid strength of 1 to 232 or the amino acid sequence portion having the amino acid strength of 264 to 478 is missing one or more amino acids. Even if it is lost, substituted or added, the function of the protein (a), which shows an affinity interaction with Bax inhibitor-1, is retained. The amino acid sequence portion consisting of amino acids 1 to 232 contains a SAM domain and a MAP kinase substrate motif, The amino acid sequence portion consisting of amino acids 264 to 478 is a portion containing a relatively large amount of hydrophobic amino acids, including the SH3 binding region domain, and a portion containing a relatively large amount of hydrophobic amino acids.

[0022] In protein (), in addition to a protein in which mutations such as deletion, substitution, addition, etc. are artificially introduced into protein (a), a mutation, such as deletion, substitution, addition, etc., is naturally introduced. In addition, proteins that are present in humans and proteins into which mutations such as deletions, substitutions, and additions have been artificially introduced are also included. Naturally occurring proteins with mutations such as deletions, substitutions and additions include, for example, mammals (eg, humans, monkeys, bushes, hidges, goats, horses, pigs, rabbits, And the like (including proteins that can be generated by polymorphism in these mammals).

[0023] The animal derived from Bax inhibitor-1 in which protein (d) exhibits an affinity interaction is not particularly limited. However, when protein (d) is a naturally occurring protein, a protein ( If the animal derived from d) and the animal derived from Bax inhibitor-1 are of the same species, protein (d) is considered to exhibit a high affinity interaction with Bax inhibitor-1.

[0024] The protein (a), (b), (c) or (d) includes a protein to which a sugar chain has been added and a shift of the protein to which the sugar chain has been added. The type and position of the sugar chain added to the protein varies depending on the type of host cell used in the production of the protein. Any host cell can be used for the protein with the added sugar chain. Proteins are also included. In addition, protein), (b) or (d) includes pharmaceutically acceptable salts thereof.

[0025] The gene encoding protein), (b), (c) or (d) is, for example, mammalian brain, kidney, lung, muscle, placenta, small intestine, testis, adrenal gland, salivary gland, spleen, stomach, etc. A cDNA library is prepared using the mRNA extracted from the tissue strength of each, and a clone containing the target DNA is screened from the cDNA library using probes synthesized based on the nucleotide sequences described in SEQ ID NO: 1 or 3, respectively. Can be obtained. The following explains each step of cDNA library preparation and screening of clones containing the target DNA.

[Creation of cDNA library] When preparing a cDNA library, for example, tissue deficiency of mammalian brain, kidney, lung, muscle, placenta, small intestine, testis, adrenal gland, salivary gland, spleen, stomach, etc. Poly (A +) RNA (mRNA) is obtained by the affinity column method, batch method, etc. using cellulose or poly-sepharose. At this time, poly (A +) RNA (mRNA) may be fractionated by sucrose density gradient centrifugation or the like. Next, using the obtained mRNA as a saddle type, single-stranded cDNA is synthesized using an oligo dT primer and reverse transcriptase, and then double-stranded cDNA is synthesized from the single-stranded cDNA. The double-stranded cDNA thus obtained is incorporated into an appropriate cloning vector to prepare a recombinant vector, and the recombinant vector is used to transform host cells such as Escherichia coli, which have tetracycline resistance and ampicillin resistance. By selecting a transformant as an index, a cDNA library can be obtained. The cloning vector for preparing the cDNA library is not particularly limited as long as it can replicate autonomously in the host cell. For example, a phage vector or a plasmid vector can be used. As the host cell, for example, Escherichia coli can be used.

[0027] Transformation of host cells such as Escherichia coli is carried out by a method in which a recombinant vector is coated on a competent cell prepared in the presence of salt calcium salt, salt magnesium or salt rubidium. Can do. When using a plasmid as a vector, it is preferable to contain a drug resistance gene such as tetracycline or ampicillin.

[0028] When preparing a cDNA library, a commercially available kit such as Superscript Plasmid System for cDNA Synthesis and Plasmid Cloning (Gibco BRL;), ZAP—cDNA Synthesis Kit (Stratagene), etc. is used. it can.

[0029] [Screening of clones containing the target DNA]

When screening a clone containing the target DNA from a cDNA library, a primer is synthesized based on the nucleotide sequence described in SEQ ID NO: 1 or 3, and this is used to perform a polymerase chain reaction (PCR). An amplified fragment is obtained. PCR amplified fragments can be subcloned using an appropriate plasmid vector. The primer set used for PCR is not particularly limited, and can be designed based on the nucleotide sequence described in SEQ ID NO: 1 or 3.

[0030] Colony hybrid to a cDNA library using PCR amplified fragment as a probe The target DNA can be obtained by performing a hybridization or plaque hybridization. As the probe, a PCR-amplified fragment labeled with an isotope (eg, ³² P, ³⁵ S), piotin, digoxigenin, alkaline phosphatase, or the like can be used. A clone containing the target DNA can be obtained by expression screening such as immunoscreening using an antibody.

[0031] The obtained DNA base sequence is obtained by cleaving the DNA fragment as it is or with a suitable restriction enzyme, etc., and then incorporating the DNA fragment into a vector by a conventional method, for example, a commonly used base sequence analysis method, such as Maxam Gilbert's chemistry. It can be determined using the modification method or the dideoxynucleotide chain termination method. For base sequence analysis, a base sequence analyzer such as 373A DNA Sequencer (manufactured by Perkin Elmer) is usually used.

[0032] The gene encoding protein), (b), (c) or (d) includes an open reading frame and a stop codon located at the 3 'end thereof. In addition, the gene encoding protein), (b), (c) or (d) can contain an untranslated region (UTR) at the 5 ′ end and Z or 3 ′ end of the open reading frame.

[0033] Examples of the gene encoding the protein having the amino acid sequence ability described in SEQ ID NO: 2 include a gene containing DNA consisting of the 19th to 1452th base sequences in the base sequence described in SEQ ID NO: 1. Here, in the base sequence described in SEQ ID NO: 1, the open reading frame is located at the 19th to 1452th base sequence, the translation initiation codon is located at the 19th to 21st base sequence, and the stop codon is from 1453 to Located at the 1455th nucleotide sequence. The base sequence of the gene encoding the protein consisting of the amino acid sequence described in SEQ ID NO: 2 is not particularly limited as long as it encodes the protein. The base sequence of the open reading frame is the base sequence described in SEQ ID NO: 1. Of these, the base sequence is not limited to the 19th to 1452st positions.

[0034] Examples of the gene encoding the protein having the amino acid sequence ability described in SEQ ID NO: 4 include a gene containing DNA consisting of the 46th to 1479th base sequences of the base sequence described in SEQ ID NO: 3. Here, in the base sequence described in SEQ ID NO: 4, the open reading frame is located at the 46th to 1479th base sequence, the translation initiation codon is located at the 46th to 48th base sequence, and the stop codon is from 1480 to Located at base 1482 The The base sequence of the gene encoding the protein having the amino acid sequence ability described in SEQ ID NO: 4 is not particularly limited as long as it encodes the protein. The base sequence of the open reading frame is the base sequence described in SEQ ID NO: 4. Of these, it is not limited to the 46th to 1479th nucleotide sequences.

[0035] The gene encoding protein), (b), (c) or (d) can also be obtained by chemical synthesis according to the base sequence. For the chemical synthesis of DNA, a commercially available DNA synthesizer, for example, a DNA synthesizer using the thiophosphite method (manufactured by Shimadzu Corporation), or a DNA synthesizer using the phosphoramidite method (manufactured by Perkin 'Elma Corporation) Can be used.

[0036] The gene encoding protein (c), (c) or (d) is, for example, a stringent to a DNA complementary to the DNA comprising the 19th to 1452th base sequences of the base sequence described in SEQ ID NO: 1. Including DNA that hybridizes under mild conditions, or DNA that hybridizes under stringent conditions to DNA complementary to DNA consisting of the 46th to 1479th nucleotide sequences of the nucleotide sequence set forth in SEQ ID NO: 3. Gene.

“Stringent conditions” include, for example, conditions of 42 ° C., 2 × SSC and 0.1% SDS, preferably conditions of 65 ° C., 0.1 × SSC and 0.1% SDS.

[0037] The DNA that hybridizes under stringent conditions to DNA complementary to the DNA consisting of the 19th to 1452th base sequences of the base sequence set forth in SEQ ID NO: 1 includes 19 of the base sequence set forth in SEQ ID NO: 1. DNA having the homology of at least 70% or more, preferably 80% or more, more preferably 90% or more with DNA consisting of the ˜1452 base sequence, and 46 to 1479 of the base sequence described in SEQ ID NO: 3 The DNA that hybridizes under stringent conditions to DNA complementary to the DNA that also has the second base sequence ability is at least 70% or more of the DNA consisting of the 46th to 1479th base sequences of the base sequence described in SEQ ID NO: 3. A DNA having a homology of preferably 80% or more, more preferably 90% or more is mentioned.

[0038] The gene encoding protein (b), (c) or (d) is artificially added to the gene encoding protein (a) using a known method such as site-directed mutagenesis. It can also be obtained by introducing mutations. For example, mutation introduction kits such as Mutant-K (TAKARA), Mutant-G (TAKARA), TAKARA LA PCR in vitro M Can be performed using the utagenesis series kit. A gene whose base sequence has already been determined can be obtained by chemical synthesis according to the base sequence.

[0039] The protein), (b), (c) or (d) can be produced, for example, by expressing a gene encoding each protein in a host cell according to the following steps.

[Production of recombinant vector and transformant]

When preparing a recombinant vector, prepare a DNA fragment of appropriate length that contains the coding region of the protein of interest. In addition, DNA with a base substitution is prepared so that the base sequence of the coding region of the target protein becomes the optimal codon for expression in the host cell.

[0040] A recombinant protein can be produced by inserting this DNA fragment downstream of the promoter of an appropriate expression vector, and the desired protein can be produced by introducing the recombinant vector into an appropriate host cell. A transformant is obtained. The above DNA fragment must be incorporated into a vector so that its function can be exerted. The vector is not only a propeller motor, but also a cis element such as an enhancer, splicing signal, poly A addition signal, selection A marker (for example, dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene), ribosome binding sequence (SD sequence) and the like can be contained.

[0041] The expression vector is not particularly limited as long as it can replicate autonomously in a host cell, and for example, a plasmid vector, a phage vector, a virus vector, and the like can be used. Examples of plasmid vectors include plasmids derived from E. coli (eg, pRSET, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5), plasmids derived from yeast (eg, YEpl3 YEp24, YCp50), and phage vectors include, for example, λ phage (for example, Charon4A, Charon21A, EMBL3, EMBL4, gtl0, gtll, λZAP), and viral vectors include, for example, retro Examples include viruses, animal viruses such as vaccinia virus, and insect viruses such as baculovirus.

[0042] As a host cell, any of prokaryotic cells, yeast, animal cells, insect cells, plant cells and the like may be used as long as the target gene can be expressed. In addition, animal individuals, plant individuals, Use silkworms, etc.

[0043] When a bacterium is used as a host cell, for example, Escherichia coli and other Escherichia genus, Bacillus subtilis and other Bacillus genus, Pseudomonas putida and Pseudomonas putida genus Bacteria belonging to the genus Rhizobium such as Rhizobium meliloti can be used as host cells. Specifically, Escherichia coli BL21, Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Esch ericnia coli DH1, Escherichia coli K12, Escherichia coli JM109, Escherichia coli HB 101, etc., Bacillus subtilis MI 114, Bacillus subtilis Bacillus subtilis such as 207-21 can be used as the host cell. In this case, the promoter is not particularly limited as long as it can be expressed in bacteria such as Escherichia coli. For example, trp promoter, lac promoter, P promoter

L

Uses promoters derived from E. coli and phages such as motors and P promoters

R

it can. In addition, artificially designed and modified promoters such as tac promoter, lacT7 promoter, let I promoter can also be used.

[0044] The method for introducing the recombinant vector into the bacterium is not particularly limited as long as it is a method capable of introducing DNA into the bacterium, and for example, a method using calcium ions, an electoporation method, or the like can be used.

[0045] When yeast is used as a host cell, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, etc. can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in yeast. For example, gall promoter, gallO promoter, heat shock protein promoter, MFa 1 promoter, PH05 promoter, PGK promoter, GAP promoter, ADH promoter AOX1 promoter, etc. can be used.

[0046] The method for introducing the recombinant vector into yeast is not particularly limited as long as it is a method capable of introducing DNA into yeast, and for example, the electopore position method, the spheroplast method, the lithium acetate method and the like can be used.

[0047] When animal cells are used as host cells, monkey cells such as COS-7, Vero, Chinese nomstar ovary cells (CHO cells), mouse L cells, rat GH3, and human FL cells are used as host cells. Can be used. The promoter in this case is not particularly limited as long as it can be expressed in animal cells. For example, SRa promoter, SV40 promoter, LTR (Long Terminal Repeat) promoter, CMV promoter, human cytomegalovirus early gene Promoters can be used.

[0048] The method for introducing a recombinant vector into an animal cell is not particularly limited as long as it is a method capable of introducing DNA into an animal cell. For example, the electopore position method, the calcium phosphate method, the lipofection method and the like can be used.

[0049] When an insect cell is used as a host, Spodoptera frugiperda ovary cells, Trichoplusia ni ovary cells, silkworm ovary-derived cultured cells, and the like can be used as host cells. Spodopt era frugiperda ovary cells such as S19, Sf21 etc., Trichoplusia ni ovary cells Hi gh 5, ΒΤΙ-ΤΝ-5Β1-4 (manufactured by Invitrogen), etc.

Bombyx mori N4 and so on.

[0050] The method for introducing a recombinant vector into an insect cell is not particularly limited as long as DNA can be introduced into an insect cell. For example, a calcium phosphate method, a lipofusion method, an electopore position method, or the like can be used.

[0051] [Culture of transformant]

Transformants into which a recombinant vector incorporating a DNA encoding the target protein has been introduced are cultured according to a conventional culture method. The transformant can be cultured according to a conventional method used for culturing host cells.

[0052] As a medium for culturing a transformant obtained using a microorganism such as Escherichia coli or yeast as a host cell, the medium contains a carbon source, a nitrogen source, inorganic salts and the like that can be assimilated by the microorganism. As long as the medium can efficiently cultivate the culture medium, a combination of a natural medium and a synthetic medium may be used.

[0053] As the carbon source, carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol can be used. Nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate, peptone, meat extract. Yeast extract, corn steep liquor, casein hydrolyzate and the like can be used. Nothing Examples of the machine salt include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride salt, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

[0054] The transformant obtained by using microorganisms such as Escherichia coli and yeast as host cells is cultured under aerobic conditions such as shaking culture or aeration and agitation culture. The culture temperature is usually 25 to 37 ° C, the culture time is usually 16 to 24 hours, and the pH is maintained at 6.0 to 8.0 during the culture period. The pH can be adjusted using an inorganic acid, organic acid, alkaline solution, urea, calcium carbonate, ammonia or the like. In addition, antibiotics such as ampicillin and tetracycline may be added to the medium as needed during the culture.

[0055] When cultivating a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a microorganism transformed with an expression vector using the lac promoter, cultivate a microorganism transformed with an expression vector using trp promoter, such as isopropyl β-D-thiogalatatopyranoside. When doing so, indoleacrylic acid or the like may be added to the medium.

[0056] As a medium for culturing a transformant obtained by using animal cells as host cells, RPMI1640 medium, Eagle's MEM medium, DMEM medium, Ham F12 medium, Ham F12K medium, or these mediums may be used. A medium supplemented with fetal calf serum or the like can be used. Transformants are usually cultured at 37 ° C for 1 to 3 days in the presence of 5% CO. Also, when culturing

2

If necessary, antibiotics such as kanamycin, penicillin and streptomycin may be added to the medium.

[0057] As a medium for culturing transformants obtained using insect cells as host cells, commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (G¾co BRL) Manufactured), ExCell400, ExCell405 (manufactured by JRH Biosciences), etc. can be used. Transformants are usually cultured at 20-28 ° C for 2-4 days. In addition, an antibiotic such as gentamicin may be added to the medium as needed during the culture.

[0058] The target protein can also be expressed as a secreted protein or a fusion protein. Examples of proteins to be fused include 13-galatatosidase, protein A, IgG binding region of protein A, chloramphee-chol'acetylyltransferase, poly (Arg), poly (Glu), protein G, maltose binding protein, dartathione S-transferase, polyhistidine chain (His-tag), S peptides, DNA-binding protein domains, Tac antigens, thioredoxin, green 'fluorescent' protein (GFP), and the like.

[0059] [Protein isolation and purification]

By collecting the target protein from the transformant culture, the target protein can be obtained. Here, the “culture” includes deviations of culture supernatant, cultured cells, cultured cells, cells or disrupted cells.

When the target protein accumulates in the cells of the transformant, the cells in the culture are collected by centrifuging the culture, and the cells are washed and then disrupted. Extract the protein. When the target protein is secreted outside the transformant, use the culture supernatant as it is, or remove cells or cells from the culture supernatant by centrifugation or the like.

[0060] The protein (a), (b), (c) or (d) thus obtained can be obtained by solvent extraction method, salting-out method using ammonium sulfate, desalting method, precipitation method using organic solvent, jetylaminoethyl (DEAE ) -Sepharose, ion exchange chromatography method, hydrophobic chromatography method, gel filtration method, fineness chromatography method and the like.

[0061] Protein (a), (b), (c) or (d) is based on the amino acid sequence based on the Fmoc method (fluoromethyloxycarbon method), tBoc method (tbutyl). It can also be produced by chemical synthesis methods such as the oxycarbon method. At this time, a commercially available peptide synthesizer can be used.

[0062] The antibody or fragment thereof of the present invention is an antibody or fragment thereof capable of reacting with the protein (a), (b), (c) or (d). Here, “antibodies” include both monoclonal antibodies and polyclonal antibodies, and “monoclonal antibodies and polyclonal antibodies” include all classes of monoclonal antibodies and polyclonal antibodies. In addition, “antibodies” are obtained by immunizing animals such as rabbits and mice with antisera obtained by immunizing protein (a), (b), (c) or (d), human antibodies, or genetic recombination. Also included are humanized antibodies. “Antibody fragments” include Fab fragments, F (ab) ′ fragments, single-chain antibodies (scFv) and the like. [0063] The antibody of the present invention or a fragment thereof can be prepared by using the protein), (b), (c) or (d) as an immunizing antigen. Examples of immunizing antigens include, for example, disrupted cells or tissues expressing (0 protein), (b), (c) or (d) or purified products thereof, and (ii) gene recombination techniques. , A recombinant protein expressed by introducing a gene encoding protein (a), (b), (c) or (d) into a host such as Escherichia coli, insect cells or animal cells, (m) chemically synthesized Peptides etc. can be used.

[0064] In the production of a polyclonal antibody, mammals such as rats, mice, guinea pigs, rabbits, hidges, horses, horseshoes, etc. are immunized using an immunizing antigen. It is preferable that rabbits use rabbits because immunized animals can easily produce antibodies. In immunization, in order to induce antibody production, it is preferable to immunize several times after emulsification using an immune assistant such as Freund's complete adjuvant. As an immunity assistant, Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), aluminum hydroxide gel, and the like can be used. The dose of antigen per mammal can be set as appropriate according to the type of mammal, but in the case of rabbits it is usually 10 to: LOOO / zg. The administration site is, for example, intravenous, intradermal, subcutaneous, intraperitoneal or the like. Immunization is usually performed every few days to several weeks, preferably 5 days to 3 weeks, for a total of 3 to 8 times, preferably 4 to 6 times. Then, 10 to 14 days after the last immunization day, the antibody titer against the protein (a), (b), (c) or (d) is measured, blood is collected after the antibody titer is increased, and antiserum is collected. obtain. Antibody titer can be measured by enzyme immunoassay (ELISA), radioimmunoassay (RIA), or the like.

[0065] Antiserum ability When purification of the antibody is required, a known method such as salting out with ammonium sulfate, gel chromatography, ion exchange chromatography, and affinity chromatography is appropriately selected. Or they can be used in combination.

[0066] For the production of a monoclonal antibody, a mammal is immunized with an immunizing antigen as in the case of a polyclonal antibody, and antibody-producing cells are collected 3 to 4 days after the final immunization. Examples of antibody-producing cells include spleen cells, lymph node cells, thymocytes, and peripheral blood cells, and spleen cells are generally used.

[0067] Next, in order to obtain a hyperidoma, cell fusion between the antibody-producing cells and the myeloma cells is performed. Myeloma cells to be fused with antibody-producing cells include human and mouse mammals A cell line derived from a product and generally available can be used. Preferred cell lines are those that have drug selectivity and cannot survive in a selective medium (for example, HAT medium) in an unfused state, but can survive only in a state fused with antibody-producing cells. Better ,. Specific examples of myeloma cells include mouse myeloma cell lines such as P3X63-Ag.8.Ul (P3Ul), P3 / NSI / 1-Ag4-1, Sp2 / 0-Agl4.

[0068] In cell fusion, antibody-producing cells and myeloma cells are mixed in a predetermined ratio (for example, 3: 1 to 1.5: 1) in animal cell culture media such as serum-free DMEM, RPMI-1640 medium, etc. And the fusion reaction is carried out in the presence of a cell fusion promoter such as polyethylene glycol, or by electric pulse treatment (eg, electoral positioning).

[0069] After the cell fusion treatment, the cells are cultured using a selective medium, and the desired hyperidoma is selected. Subsequently, the culture supernatant of the grown hyperidoma is screened for the presence of the antibody of interest. Hypridoma screening is not particularly limited as long as it is in accordance with a normal method. For example, a part of the culture supernatant contained in the wells grown as robin and hybridoma can be collected and screened by enzyme immunoassay (ELISA), radioimmunoassay (RIA) and the like.

[0070] Cloning of the hybridoma can be performed, for example, by limiting dilution, soft agar, fibrin gel, fluorescence excitation cell sorter, or the like, and finally a hyperidoma that produces a monoclonal antibody is obtained.

[0071] As a method for collecting the acquired monoclonal antibody monoclonal antibody, a normal cell culture method or the like can be used. In the cell culture method, for example, Hypridoma is used in animal cell culture media such as RPMI-1640 medium containing 10 to 20% fetal calf serum and MEM medium under normal culture conditions (for example, 37 ° C, 5% CO concentration). By culturing for ~ 14 days,

2

Monoclonal antibodies can also be obtained from the culture supernatant strength. It is also possible to transplant a hyperidoma into the abdominal cavity of a mouse or the like, collect ascites after 10 to 20 days, and obtain a monoclonal antibody from the ascites.

[0072] When purification of the monoclonal antibody is required, a known method such as salting out with ammonium sulfate, gel chromatography, ion exchange chromatography, affinity chromatography, or the like is appropriately selected or These can be used in combination. [0073] When the monoclonal antibody is used for human administration (antibody therapy), it is preferable to use a human antibody or a humanized antibody in order to reduce immunogenicity. Human antibodies or humanized antibodies can be obtained, for example, by preparing mice or hybridomas using a mouse into which a human antibody gene has been introduced as an immunized animal, or by using a library that displays antibodies on phage. You can get it. Specifically, a transgenic animal having a repertoire of human antibody genes is immunized with an antigen protein, a protein-expressing cell, or a solution thereof to obtain antibody-producing cells, which are fused with myeloma cells. A human antibody against the protein of interest can be obtained using the thus-prepared hybridoma (see International Publication Nos. W09 2-03918, W093-2227, WO94-02602, W096-33735 and WO96-34096). In addition, by selecting a phage displaying an antibody that binds to a protein serving as an antigen, a protein-expressing cell, or a lysate thereof, from an antibody library in which a plurality of different human scFvs are displayed on a phage. The scFv that binds to the protein of interest can be selected (Griffiths. Et al., EMBO J. 12, 725-734, 1993).

[0074] In the first screening method of the present invention, the test substance determines whether or not the affinity interaction between the proteins (a) or (c) can be suppressed or promoted, and the affinity interaction is suppressed or Includes screening of test substances that can be accelerated as substances that affect ontogeny.

[0075] Affinity interaction between proteins (a) or (c) is considered to be involved in ontogeny, particularly ontogeny in the embryonic period, so affinity between proteins (a) or (c) By selecting substances that can suppress or promote interactions, substances that may affect ontogeny, particularly ontogeny during the embryonic period, can be screened.

[0076] Whether or not the test substance can suppress or promote the affinity interaction between the proteins (a) or (c) can be determined, for example, as follows, but the determination method is limited to this. It is not a thing.

[0077] After contacting the protein (a) or (c) with another protein (a) or (c) in the presence or absence of the test substance, the protein (a) or (c) is bound to each other. Measure the amount and compare the amount of binding in the presence of the test substance with the amount of binding in the absence of the test substance. As a result, the amount of binding in the presence of the test substance is greater than the amount of binding in the absence of the test substance. If it is less, it can be determined that the test substance can suppress the binding between the proteins (a) and (c). On the other hand, if the amount of binding in the presence of the test substance is greater than the amount of binding in the absence of the test substance, it can be determined that the test substance can promote the binding between the proteins (a) or (c).

[0078] The substance capable of suppressing or promoting the binding between proteins (a) or (c) may be a substance acting on one protein (a) or (c)! /, And both proteins It may be a substance that acts on (a) or (c). Further, the substance capable of suppressing the binding between the proteins (a) or (c) may be a substance capable of suppressing the binding between the proteins (a) or (c) in a dissociated state or in a bound state. It may be a substance capable of dissociating proteins (a) or (c).

[0079] Protein (a) or (c) and another protein (a) or (c) may be contacted in vitro or in vivo.

[0080] When contacting in vitro, as protein (a) or (c), (i) a cell or tissue that expresses the target protein or extracted endogenous protein, (ii) the target protein A recombinant vector capable of expressing the quality can be introduced into a host cell to produce a transformant, and a recombinant protein extracted from the culture of the transformant, () a chemically synthesized peptide, or the like can be used.

[0081] When contacting in vivo, as a protein (a) or (c), (i) an endogenous protein present in the cell, (ii) a recombinant vector capable of expressing the target protein is introduced into the host cell. A recombinant protein or the like present in the transformant produced by the introduction can be used.

[0082] When proteins (a) or (c) are brought into contact with each other, the protein (a) or (c)

, Mutants, wild-type or mutant derivatives, fusion proteins of wild-type or mutants with other proteins or peptides, and the like can be used.

[0083] When proteins (a) or (c) are brought into contact with each other, conditions affecting the binding between proteins (a) or (c) are adjusted, and the binding between proteins (a) or (c) is tested. Depend on the presence or absence of substances.

[0084] Examples of conditions that affect the binding between proteins (a) and (c) include temperature, Examples include medium type, protein (a) or (c) concentration, stirring intensity, coexistence time, gravity, and magnetic field.

[0085] The temperature at which the proteins (a) or (c) are brought into contact with each other can be set to 2 to 65 ° C, for example. As the solvent for bringing the proteins (a) or (c) into contact with each other, for example, PBS, TBS, Hepes buffer, etc. can be used. The concentration of the protein (a) or (c) can be set to, for example, lng Zml to 1 OOmgZml.

[0086] The amount of binding between proteins (a) or (c) is, for example, the amount of binding between proteins (a) or (c), the amount of signal produced by the binding between proteins (a) or (c), etc. It can be measured as an index.

[0087] The amount of the conjugate between the proteins (a) or (c) is determined by, for example, adding a labeling substance to the protein (a) or (c) and bringing the proteins (a) or (c) into contact with each other. Thereafter, the conjugate of protein (a) or (c) can be separated, and the amount of labeling substance possessed by the conjugate can be measured as an index. Specifically, it can be measured using a known method such as the GST pull down method.

[0088] The amount of the conjugate between the proteins (a) and (c) is determined using a known protein analysis technique, for example, an antibody or fragment thereof that can react with the conjugate between the proteins (a) or (c). Western blotting method, immunoprecipitation method, ELISA, yarn and tissue immunostaining method, etc. The “antibody” includes both monoclonal antibodies and polyclonal antibodies, and “monoclonal antibodies” and “polyclonal antibodies” include all classes of monoclonal antibodies and polyclonal antibodies. “Antibody fragments” include Fab fragments, F (ab) ′ fragments, single-chain antibodies (scFv) and the like.

2

[0089] The type of signal generated by the binding between proteins (a) or (c) is not particularly limited. For example, reporter gene expression, fluorescence energy transfer (FRET), surface plasmon resonance (SPR) or For example, detection of changes in local density due to frequency shift of the crystal unit.

[0090] Examples of the reporter gene include β-galactosidase gene, chloramphenicol acetyltransferase gene, luciferase gene, ampicillin resistance gene, tetracycline resistance gene, kanamycin resistance gene and the like. Reporter activity includes, for example, j8 galactosidase activity, Chloramhue-Coleacetillan Examples include sulferase activity, luciferase activity, ampicillin resistance, tetracycline resistance, strength namicin resistance, and the like.

[0091] The second screening method of the present invention determines whether or not the test substance can suppress or promote the affinity interaction between the protein (a) or (d) and Baxinhibitor-1, and Screening a test substance capable of suppressing or promoting sex interaction as a substance affecting ontogenesis.

[0092] The affinity interaction between the protein (a) or (d) and Bax inhibitor-1 is considered to be involved in ontogeny, particularly ontogeny in the embryonic period. By selecting a substance that can suppress or promote the affinity interaction between (d) and Bax inhibitor-1, it is possible to screen for substances that may affect ontogeny, particularly ontogenesis during the embryonic period.

[0093] Whether or not the test substance can suppress or promote the affinity interaction between the protein (a) or (d) and Bax inhibitor-1 can be determined, for example, as follows. It is not limited to this.

[0094] The amount of protein (a) or (d) and Bax inhibitor-1 bound after contacting protein (a) or (d) with Bax inhibitor-1 in the presence or absence of the test substance The amount of binding in the presence of the test substance is compared with the amount of binding in the absence of the test substance. As a result, if the amount of binding in the presence of the test substance is less than the amount of binding in the absence of the test substance, the test substance will interact with the protein (a) or (d) and Bax inhibitor-1. It can be determined that the action can be suppressed. On the other hand, if the amount of binding in the presence of the test substance is greater than the amount of binding in the absence of the test substance, the test substance has an affinity interaction between the protein (a) or (d) and Bax inhibitor-1. Can be determined to promote

[0095] A substance capable of suppressing or promoting the affinity interaction between protein (a) or (d) and Bax inhibitor-1 acts on one of protein (a) or (d) and Bax inhibitor-1. It may be a substance or a substance that acts on both. In addition, a substance capable of inhibiting the affinity interaction between protein (a) or (d) and Bax inhibitor-1 binds to protein (a) or (d) in the dissociated state and Bax inhibitor-1. Even a substance that can be suppressed Or it may be a substance that can dissociate Bax inhibitor-1 from protein (a) or (d) in a bound state! /.

[0096] The protein (a) or (d) and Bax inhibitor-1 may be contacted in vitro! Or in vivo.

[0097] When contacting in vitro, as protein (a) or (d), (i) a cell or tissue expressing the target protein, extracted endogenous protein, (ii) target protein A recombinant vector capable of expressing the quality can be introduced into a host cell to produce a transformant, and a recombinant protein extracted from the culture of the transformant, () a chemically synthesized peptide, or the like can be used. The same applies to Bax inhibitor-1.

[0098] When contacted in vivo, as a protein (a) or (d), (i) an endogenous protein present in the cell, (ii) a recombinant vector capable of expressing the target protein is introduced into the host cell. A recombinant protein or the like present in the transformant produced by the introduction can be used. The same applies to Bax inhibitor-1.

[0099] When the protein (a) or (d) is contacted with Bax inhibitor-1, the protein (a) or (d) is a wild type, mutant type, wild type or mutant type derivative, wild type or mutation. A fusion protein of a mold with another protein or peptide can be used. The same applies to Bax inhibitor-1.

[0100] When contacting protein (a) or (d) with Bax inhibitor-1, adjust the conditions that affect the binding of the two so that the binding of both depends on the presence or absence of the test substance. Conditions that affect the binding of the two include, for example, temperature, solvent type, protein (a) or (d) concentration, Bax inhibitor-1 concentration, stirring intensity, coexistence time, gravity, magnetic field, and the like. I can get lost.

[0101] The temperature can be set to 2 to 65 ° C, for example. As the solvent, for example, PBS, TBS, Hepes buffer, etc. can be used. The concentration of the protein (a) or (d) can be set to, for example, lngZml to lOOmgZml. The concentration of Bax inhibitor-1 can be set to, for example, lngZml to 100 mgZml.

[0102] The amount of binding between protein (a) or (d) and Bax inhibitor-1 is, for example, the amount of binding between protein (a) or (d) and Bax inhibitor-1 as in the amount of binding between proteins (a) or (c). inhibitor — binding to 1 The combined amount, the amount of signal produced by the binding of protein (a) or (d) and Bax inhibitor-1, etc. can be measured as indicators.

Example

[Example 1] Isolation and identification of human gene 1 and mouse gene 1

Human gene 1 was isolated from human lung cDNA by polymerase chain reaction (PCR). PCR is a reaction in which a DNA amplification cycle consisting of a denaturation step, a primer annealing step, and an extension step using DNA polymerase is repeated. For example, Saiki et al., Science, 230, 1350 (1985) , Williams et al., Nucleic Acid Research, Vol. 18, No. 22, pages 6531-6535 (1991), etc.

[0104] Specifically, 5 '— aagcagttccggttcggctccgagcagctgccg— 3' is used as a 5 'primer, 5' — ggcatctaagacacctagggggaacgc— 3 'is used as a 3' primer, and heat-resistant DN A polymerase (Expand Long Template PCR System, manufactured by Roche) 5 units, 200 μΜ dNTP (dATP, dTTP, dCTP, dGTP), human lung tissue-derived cDNA 0.5 ng, and 1.75 mM magnesium chloride 94 after treatment for 10 minutes at ° C. C for 30 seconds, 62. C for 45 seconds, 68. Repeat 5 minutes with C for 35 cycles and 68 more. Processing for C10 minutes was performed.

[0105] Primers were designed as follows. In Drosophila, a homologous cDNA was searched from human EST based on the DNA sequence encoding a protein (GH24627p) that interacts with a receptor involved in developmental differentiation (etadyson receptor). Based on this cDNA sequence, 5'-RACE was performed using human testis-derived cDNA as a saddle, and a 5 'primer was designed based on the sequence obtained. The 3 'primer was designed assuming the human genome sequence.

[0106] After completion of the reaction, the reaction solution was subjected to electrophoresis using 1% agarose gel (TBE buffer), and then the gel was stained with ethidium bromide and amplified by observing with a transilluminator. DNA fragments were detected. Furthermore, this DNA fragment was recovered from an agarose gel using a QUIAquick Gel Extraction Kit (manufactured by QUIAGEN), inserted into a multicloning site of a cloning vector plasmid such as pGEMTE, and then E. coli was used as a host. Amplified and sequenced. Cloning vector clone The insertion into the site was performed by TA clawing. That is, the PCR product in which T (thymidine) was added to the 3, end of the vector that had been blunt-ended by EcoRV digestion and A (adenine) was added to the 3, end was ligated. This was introduced into Escherichia coli by electroporation, and positive clones were selected, followed by agitation culture at 37 ° C. for 16 to 20 hours in LB liquid medium. The cultured Escherichia coli was recovered by centrifugation, and the plasmid was purified using a QIAGEN miniprep kit (manufactured by Qiagen). The insertion sequence was determined using a fluorescent sequencer by the dye terminator method.

Furthermore, mouse gene 1 was isolated from mouse cDNA based on human gene 1. We searched mouse cDNAs that are homologous to the partial cDNA of human gene 1, and also searched the public database. Designed the RACE primer (5 and cttcggtcatggagaaggcccacgggatcct—3), and designed the mouse sperm-derived cDNA into a vertical shape. 5'-RACE was performed, and 5 'primer (5—ccaaaggggccggagcgatgcccgctggtagccg—3) was set up from the obtained sequence. OPhufuima and 3 ′ puffima (5′—ctcattacagagagagagtcttcatcc—3, 15pmole each, heat resistance DNA polymerase (Ex pand Long Template PCR System, Roche) 5 units, 200 μ 200 dNTP (dATP, dTTP, dCTP, dGTP), mouse sperm-derived cDNA 0.5 ng and 1. 75 mM magnesium chloride amplification In buffer for 10 minutes at 94 ° C, followed by 35 cycles of 94 ° C for 30 seconds, 62 ° C for 45 seconds, 68 ° C for 5 minutes, and 68 ° C for 10 minutes After completion of the reaction, the reaction mixture was diluted with 1% agarose gel (TBE buffer). The gel fragment was stained with ethidium bromide and observed with a transilluminator to detect the amplified DNA fragment. It was recovered from agarose gel using Extraction Kit (manufactured by QIAGEN), inserted into the cloning site of a cloning vector plasmid such as pGEMTE, and then amplified using Escherichia coli as a host to determine the sequence. -Insertion of the vector for cloning into the cloning site was performed by TA cloning, that is, by digestion with EcoRV, T (thymidine) was added to the 3, end of the blunt-ended vector, and A ( A PCR product with adenine was ligated, and the product was introduced into E. coli by electroporation and stirred in LB liquid medium at 37 ° C for 16-20 hours. Was. E. coli after culture, were harvested by centrifugation, the plasmid using QIAGEN mini prep kit (Qiagen) Purification was performed. The insertion sequence was determined using a fluorescent sequencer by the dye terminator method.

[0108] The nucleotide sequence of human gene 1 is shown in SEQ ID NO: 1. Human gene 1 contains an open reading frame encoding 478 amino acids. The amino acid sequence of the protein encoded by human gene 1 is shown in SEQ ID NO: 2. In SEQ ID NO: 2, the 73rd amino acid part and the 140th amino acid part contain a peptide motif characteristic of a signaling factor called SAM (Sterile Alpha Motif) domain. The Ser residue of the 52nd amino acid is included in the motif characteristic of the MAP kinase substrate, and the region from the 247th to the 250th amino acid (PPLP: Pro-Pro-Leu-Pro) is the SH3 binding region motif. is there.

[0109] SEQ ID NO: 3 shows the base sequence of mouse gene 1. Mouse gene 1 contains an open reading frame encoding 478 amino acids. The amino acid sequence of the protein encoded by mouse gene 1 is shown in SEQ ID NO: 4. Of SEQ ID NO: 4, the 73rd amino acid force and the 140th amino acid part contain a peptide motif characteristic of a signal transduction factor called SAM (Sterile Alpha Motif) domain. The Ser residue at amino acid 52 is contained in a motif characteristic of the MAP kinase substrate, and the region from amino acid 247 to amino acid 250 (PPLP: Pro-Pro-Leu-Pro) is a SH3 binding region motif.

[0110] Regarding the open reading frame region, human gene 1 and mouse gene 1 showed homology of 89.5% at the DNA level and 90.2% at the protein level.

[Example 2] Genomic structure of human gene 1 and mouse gene 1

The genomic structure of human gene 1 was determined by homologous search of the cDNA sequence of human gene 1 with the published human genome sequence. The genomic structure of mouse gene 1 was determined by homologous searching of the mouse gene 1 cDNA sequence against the published mouse genome sequence.

[0112] The genomic structures of human gene 1 and mouse gene 1 are shown in FIG. As shown in FIG. 1, the genomic structures of human gene 1 and mouse gene 1 were very similar. In particular, all homologous exoregions had the same number of bases. Intron length was found to differ between human gene 1 and mouse gene 1.

[Example 13] Human gene 1 expression tissue Nylon membrane blotted with polyA RNA prepared for human tissue, using ³² P-labeled human gene 1 as a probe in a hybridization buffer (ULTRAhyb Ultrasensitive Hybridization Buffer, Ambion) at 42 ° C After hybridization for 22 hours, the cells were washed with LS buffer (composition: 2XSSC, 0.1% SDS) or HS buffer (composition: 0.1% SSC, 0.1% SDS). Hybridized images were detected using an image analyzer (Fuji).

As a result, as shown in FIG. 2, the expression of human gene 1 was confirmed in tissues such as brain, kidney, lung, muscle, placenta, small intestine, testis, adrenal gland, salivary gland, spleen, and stomach.

[Example 4] Observation of presence of GFP-fused human gene 1 product in cells

A gene expression vector 1 designed to produce a protein in which the human gene 1 product was fused to the C-terminus of GFP (Green Fluorescent Protein) in mammalian cells was constructed (Figure 8). In other words, a basic GFP vector designed so that expression of GFP fusion protein is induced in mammalian cells by CMV promoter by adding EcoRI-Notl site to the 3 'end of the GFP coding region cDNA was performed. Digested with restriction. The human gene lcDNA was introduced with an EcoRI site at the 5 'end and a Notl site at the 3' end. The gene fragment cleaved with both enzymes was ligated to the basic GFP vector digested with EcoRI and Notl, and the gene was introduced into Escherichia coli. Then, gene expression vector 1 was cloned.

[0116] Gene vector 1 was introduced into COS-7 cells using Fugene6 (Roche). That is, 1 μg of gene vector 1 and 3 μ1 of serum-free medium 100 1 containing Fugene6 (Roche) were mixed, allowed to stand at room temperature for 15 minutes, and then COS-7 was mixed 24 hours before. The gene was introduced by dripping and mixing into the best cell culture dish. The transfected COS-7 cells were cultured for 24 hours at 37 ° C in the presence of 5% CO. 1.5 in medium to stain cell nuclei

1106 ^ 13 33342 was added to the sample, incubated at 37 ° C for 10 minutes, and then washed 4 times with PBS. The localization of the GFP-fused human gene 1 product in COS-7 cells was observed by fluorescence microscopy. As a result, as shown in FIG. 3, the GFP-fused human gene 1 product was found to exhibit a fibrous or vesicular structure in COS-7 cells.

[Example 5] Detection of interaction between human gene 1 products by co-immunoprecipitation method A gene expression vector capable of expressing in a mammalian cell a protein in which a FLAG tag or HA tag was fused to the N-terminus of one human gene product was constructed (FIGS. 9 and 10). That is, a basic FLAG tag vector designed so that the expression of GFP fusion protein is induced in mammalian cells by CMV promoter, with EcoRI-Notl site attached to the 3, terminal part of FLAG tag cDNA. Restricted digest with EcoRI and Notl. Human gene lcDNA gene fragment introduced with EcoRI site at 5 'end and Notl site at 3' end is ligated to EcoRI-Notl digested basic GFP vector, introduced into E. coli, and FLAG-human gene 1 vector is cloned. -I ran. An HA tag vector was prepared in the same manner.

[0118] Gene transfer was performed on HEK293T cells using Fugene6 (Roche). After culturing for 2 days, a cell lysate (25 mM Tris-Cl, 225 mM NaCl, 0.2% NP-40, pH 7.4) was added to the culture plate to prepare a cell extract. Add anti-FLAG antibody, mix by inversion at 4 ° C for 60 minutes, add protein G—Sepharose to the cell extract, mix by inversion at 4 ° C for 60 minutes, centrifuge, and pellet with cell lysate. After washing 3 times and washing once with 20 mM Tris-Cl (pH7.4), proteins were separated by SDS-PAGE. After the electrophoresis, the protein is transferred to a nitrocellulose membrane and mouse anti-HA (hemagglutin) antibody (

Roche) was used as the primary antibody, and peroxidase-labeled anti-mouse immunoglobulin antibody (Ama Shamaf Almacia) was used as the secondary antibody to detect the presence of the HA tag protein.

As a result, as shown in FIG. 4, when the FLAG tag-human gene 1 product (lane 1) or the HA tag-human gene 1 product (lane 3) was expressed alone, the HA-human gene 1 product was detected. It was not issued. However, when the FLAG tag—human gene 1 product and the HA tag—human gene 1 product (lane 2) were expressed simultaneously, the HA tag—human gene 1 product was detected. This indicates that the FLAG tag—human gene 1 product and HA tag—human gene 1 product have affinity, and the immunoprecipitation complex by FLAG antibody contains the HA tag—human gene 1 product. .

[0120] [Example 6] Detection of interaction between one product of human gene by mammalian cell two-hybrid method

1 human gene product is fused to the C-terminal region of yeast-derived GAL4 DNA binding protein The gene expression vector for mammalian cells (PGAL4—human gene 1 vector, Fig. 11) and the human gene 1 product designed to be able to be expressed are fused to the C-terminal region of the VP 16 gene expression activation protein derived from Herpes Simplex Virus. We constructed a gene expression vector for mammalian cells (PVP16—human gene 1 vector, Fig. 12) that was designed so that it could be expressed in a stable manner. In other words, the pGAL4—human gene 1 vector has an EcoRI—Sail site attached to the GAL4DNA binding region cDNA at the 3, end of the cDNA, and the early SV40 promoter allows expression of the GAL4DNA binding region fusion protein in mammalian cells. A basic GAL4 vector designed to be induced was digested with EcoRI and Sail. Human gene lcDNA is introduced into EcoRI site at 5 'end, Xhol site at 3' end and cleaved with both enzymes and ligated to EcoRI — Sail digested basic GAL4 vector, introduced into Escherichia coli, pGAL 4-human gene 1 vector cloned. The pVP16-human gene 1 vector has an EcoRI-Notl site attached to the 3 'end of the VP16 transcriptional activation region cDNA, and expression of the VP16 transcriptional activation region fusion protein in mammalian cells using the CMV promoter. The basic VP16 vector, designed to induce, was restriction digested with EcoRI and Notl. The human gene lcDNA was ligated to the basic VP16 vector introduced with EcoRI and Notl at the 5 'end and Notl site at the 3' end and digested with both enzymes, and introduced into Escherichia coli. PVP16—human gene 1 vector was cloned. These vectors were transfected into COS-7 cells. After incubation for 24 hours at 37 ° C in the presence of 5% CO

2

Wash the cells with PBS, and prepare a cell lysate for luciferase activity measurement (25 mM TAE, lm M EDTA, 10% Glycerol, l% TritonX-100, 2 mM DTT), and luminometer in the presence of noreciferin and ATP. Was used to measure the luciferase activity in the cell extract.

As a result, as shown in FIG. 5, when pGAL4-human gene 1 and pVP16-human gene 1 were introduced simultaneously, pGAL4-human gene 1 and PVP16 without the gene 1 region were simultaneously introduced. The luciferase activity was detected by a factor of 9.3 compared to when the gene was introduced. This result suggests an affinity interaction between one human gene product

[Example 7] Human gene 1 product and human Bax inhi by mammalian cell two-hybrid method Detection of interactions between bitor-1 gene products

Gene expression vector for mammalian cells (PGAL4 human gene 1, Fig. 11) and human Bax inhibitor-1 gene product designed so that the human gene 1 product can be expressed by fusing to the C-terminal region of yeast-derived GAL4 DNA binding protein Constructed a gene expression vector for mammalian cells (pVP 16- Bax inhibitor-1, 13) designed to be fused and expressed in the C-terminal region of the Herpes Simplex Virus-derived VP 16 gene expression activity protein. That is, the pVP16-Bax inhibitor-1 vector has an EcoRI-Notl site attached to the 3 'end of the VP16 transcriptional activation region cDNA, and a VP16 transcriptional activity fusion region fusion protein in a mammalian cell by the CMV promoter. A basic VP16 vector designed to induce expression of E. coli was digested with EcoRI and Notl. Human Bax inhibitor—A gene fragment that had an EcoRI site at the 5 'end and a Notl site at the 3' end, and a Notl site at the end and was cleaved with both enzymes was ligated to the basic VP16 vector digested with EcoRI and Notl, and introduced into E. coli. Human Bax inhibitor-1 vector was cloned. The base sequence of Bax inhibit or-1 gene is shown in SEQ ID NO: 5, and the amino acid sequence of Bax inhibitor-1 gene product is shown in SEQ ID NO: 6. These vectors were transfected into COS-7 cells. 3 After culturing for 24 hours in the presence of 7 ° C and 5% CO, the cells are washed with PBS and luciferase activity

2

Cell lysate for measurement (25 mM TAE, ImM EDTA, 10% Glycerol, 1% TritonX 100, 2 mM DTT) was prepared, and the luciferase activity in the cell extract was measured with a luminometer in the presence of luciferin and ATP. .

As a result, as shown in FIG. 6, pGAL4 human gene 1 and pVP16—Bax inhibitor

When gene 1 was introduced at the same time, 11.3 times more luciferase activity was detected than when PGAL4 and pVP16 were introduced simultaneously. This result suggests an affinity interaction between the human gene 1 product and the Bax inhibitor-1 gene product.

[Example 8] Detection of human gene 1 product by Western blotting using anti-gene 1 antibody

30th to 49th amino acids of a human gene product (NH-GEAGRAPDSDGGSD

2

ADSEVG-COOH) was synthesized as a peptide, KLH (Keyhole Limpet Hemocyanin) was used as the carrier, and the mice were injected intramuscularly and subcutaneously into rabbits (2 birds) together with adjuvant. further After 2 weeks, 5 weeks, 11 weeks, and 17 weeks, the peptide and adjuvant mixture was also injected, and antisera was prepared 25 weeks after the first antigen injection. The FLAG tag-human gene 1 product was transiently expressed in HEK 293T cells, treated with SDS-PAGE sample buffer, and then separated by SDS-PAGE electrophoresis and transferred to a nitrocellulose membrane. Was under 1 hour at room temperature the membranes in blocking buffer (0. 1% T _W een20 and 5% non-fat dry milk containing P BS), in the new blocking buffer one containing antiserum diluted 1000-fold, 4 ° C, 2 Incubated for hours. The membrane was washed 3 times with PBST (0.1% Tween20-containing PBS), and then incubated at room temperature for 1 hour in a blocking buffer containing rabbit antiperoxidase-labeled anti-rabbit IgG antibody. After washing the membrane three times with PBST (0.1% Tween20-containing PBS), an antibody-specific band was detected using a chemiluminescence method (for example, WestPico Chemiluminescent Substrate, PIERCE).

As a result, as shown in FIG. 7, an antigen-specific band was detected in the HEK293T cell-extracted protein lane in which human gene 1 was forcibly expressed.

[Example 9]

(1) Mouse gene 1 Gene targeting vector construction

The 5 ′ genomic DNA containing the first and second exons of mouse gene 1 and the 3 ′ genomic DNA containing the second exon and the third and fourth exons PCR amplification was performed with a restriction enzyme site added. That is, the 5 'genomic DNA containing part of the first and second exons is 5, the primer (5'-gactcgtcctcttcagtgctggatgtaggc gtg-3') and the 3 'primer designed with the Sail site attached. (5'-tcgtcgacacagccacatgcttggta gtccagcggc-3,) 15pmole metathermal DNA polymerase (Expand Long Template PCR System, Roche) 5 units, dNTP (dATP, dTTP, dCTP, dGTP), mouse sperm-derived cDNAO. 5ng And 1.Amplification buffer containing 75 mM magnesium chloride. Treat for 10 minutes at 94 ° C, then for 30 seconds at 94 ° C, 45 seconds at 65 ° C, and 15 minutes at 68 ° C. Repeated 26 cycles and further treated at 68 ° C for 15 minutes. The 3 'genomic DNA containing part of the second exon, the third and fourth exons, was designed by adding a Clal site to 5' pima ¹ ~~ (o catcgatttaggttattgttcatgagcgagtgcctg-) and d zofima ¹ ~~ (5— caggtgctg tcctggcacggagagggaggtc— 3,) 15 pmole each, heat-resistant DNA polymerase (Expand Long Template PCR System, Roche) 5 units, 200 ^ M dNTP (dATP, dTTP, dC TP, dGTP), mouse sperm-derived cDNA 0.5 ng And 1.In an amplification buffer containing 75 mM magnesium chloride, after treatment at 94 ° C for 10 minutes, treatment at 94 ° C for 30 seconds, 62 ° C for 45 seconds, and 68 ° C for 20 minutes 26 The cycle was repeated and further treated at 68 ° C for 20 minutes. GFP Neo gene is connected to GFP cDNA and mouse gene 1 second exon protein coding region in-frame, and mouse gene 1 gene targeting vector with stop codon introduced on the 3 'side of Neo gene is constructed. (Fig. 14).

[0127] (2) Generation of gene 1 knockout mice

The mouse gene 1 gene targeting vector was made double-stranded by digestion with restriction enzyme Notl and introduced into mouse ES cells by electroporation. Select the cells at 37 ° C, 5% CO

The cells were cultured in the presence of G418 and ganciclovir, which are two selective drugs. Resistant cell colonies were also prepared with genomic DNA, and homologous recombination-positive ES cells were selected by PCR, Southern nose and hybridization. Positive ES cells were introduced into blastocysts by microinjection and then transplanted into pseudopregnant female mice. The resulting chimeric mouse was bred with a wild-type mouse, and the resulting baby was genotyped using the agouti hair color as a marker to produce a heterozygous mouse deficient in gene 1.

[0128] (3) Genotype analysis of infants and fetuses obtained by crossing between gene 1 hetero-deficient mice Mating heterozygous female mice with gene 1 and male mice deficient with gene 1 were obtained Typing was done. In addition, a heterozygous female mouse with gene 1 and a male male with gene 1 are mated, and after a certain period of time, the pregnant female mouse is dissected, genomic DNA is prepared from the fetus or amnion, and genotyping is performed. It was.

As a result, as shown in Table 1, the genotype of the infant produced by crossing between the gene 1 hetero-deficient mice was wild-type or hetero-deficient, and homozygous was not obtained. In addition, as shown in Table 2, the genotypes of each fetus obtained after mating between gene 1 hetero-deficient mice after 12.5 days, 9.5 days, and 8.5 days were either wild-type or hetero-deficient. A homo-deficient type was not obtained. From these results, it is considered that fetuses with homozygous gene 1 were dead at the developmental stage 8.5 days before fertilization. [0129] [Table 1] Stage Infant genotype ft

+ / + +/--/-* P21 0 29 27 56

* P: Days after production

[0130] [Table 2] Developmental stage Fetal genotype Total

-/-+/- + / +

* E12.5 0 5 4 9

E9.5 0 7 5 12

E8.5 0 13 5 18

0 25 14 39

* E: Days after fertilization

Claims

The scope of the claims

[1] A protein shown in (a) or (b) below.

[2] A protein shown in (a) or (c) below.

[3] Protein shown in the following (a) or (d).

[4] A gene encoding the protein according to any one of claims 1 to 3.

[5] The gene according to claim 4, comprising the DNA shown in (e) or (f) below.

[6] A recombinant vector comprising the gene according to claim 5.

[7] A transformant comprising the recombinant vector according to claim 6.

[8] An antibody or fragment thereof capable of reacting with the protein according to any one of claims 1 to 3.

[9] Determine whether or not the test substance can suppress or promote the affinity interaction between the proteins according to claim 2, and affect the ontogeny of the test substance that can suppress or promote the affinity interaction. A method for screening a substance that affects ontogeny, comprising a step of screening as a given substance. Determine whether the test substance can inhibit or promote the affinity interaction between the protein of claim 3 and Bax inhibitor-1, and affect the ontogeny by the test substance capable of inhibiting or promoting the affinity interaction. A method for screening a substance that affects ontogenesis, which comprises a step of screening as a substance that imparts odor.