WO2007056312A2

WO2007056312A2 - Universal reporter tag for nucleozyme assays

Info

Publication number: WO2007056312A2
Application number: PCT/US2006/043236
Authority: WO
Inventors: Cynthia Chang; Nikoliai Kalnine
Original assignee: Clontech Laboratories, Inc.
Priority date: 2005-11-07
Filing date: 2006-11-06
Publication date: 2007-05-18
Also published as: WO2007056312A3

Abstract

Methods and compositions for detecting a target nucleic acid in a sample are provided. Aspects of the invention include the use of a universal nucleozyme tag. The invention further provides kits and systems for practicing the subject methods.

Description

UNIVERSAL REPORTER TAG FOR NUCLEOZYME ASSAYS

CROSS-REFERENCE TO RELATED APPLICATIONS Pursuant to 35 U. S. C. § 119 (e), this application claims priority to the filing date of United States Provisional Patent Application Serial No. 60/734,432 filed November 7, 2005 and to the filing date of United States Provisional Application Serial No. 60/737,147 filed on November 15, 2005; the disclosures of which are herein incorporated by reference.

INTRODUCTION

Methods of in vitro nucleic acid amplification have wide-spread applications in genetics, disease diagnosis, and forensics. In the last decade, many techniques for amplification of known nucleic acid sequences ("targets") have been described. These include the polymerase chain reaction ("PCR"), the strand displacement amplification assay ("SDA") and transcription-mediated amplification ("TMA") (also known as self-sustained sequence replication ("SSR")). The amplification products ("amplicons") produced by PCR and SDA are DNA, whereas RNA amplicons are produced by TMA. The DNA or RNA amplicons generated by these methods can be used as markers of nucleic acid sequences associated with specific disorders. Several methods allow simultaneous amplification and detection of nucleic acids in a closed system, i.e., in a single homogeneous reaction system. These methods include Sunrise™ primer-based systems, Molecular Beacons, the Taqman™ system, an Amplifluor™ hairpin primer-based system, Scorpion™ detection technology (e.g., bi-functional molecules containing a PCR primer element covalently linked to a probe element), a Light Upon Extension or LUX™- based system, and detection systems based on use of the fluorescent dye SYBR Green™. Using homogeneous sealed tube formats has several advantages over separately analyzing amplicons following amplification reactions. Closed system methods are faster and simpler because they require fewer manipulations. A closed system eliminates the potential for false positives associated with contamination by amplicons from other reactions. Homogeneous reactions can be monitored in real time, with the signal at time zero allowing the measurement of the background signal in the system. Additional control reactions for estimating the background signal are therefore not required. A change in the signal intensity indicates amplification of a specific nucleic acid sequence present in the sample.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts an exemplary FET-labeled nucleozyme substrate. R1 and

R2, substrate recognition domains; CS, cleavage site in the substrate.

Figure 2 provides a schematic diagram of the two-primer (a) and three- primer (b) real-time PCR systems. In conventional two-primer PCR system with the QZyme™ detection, both strands of the amplicon are produced by extension of the forward (F) primer and reverse (R) primers. The F-primer has a QZyme tag (Q-tag) attached to it, which is not fluorogenic itself. The progress of PCR reaction is quantified through the fluorescence produced by the fluorogenic Q-tag created on the "minus" strand of the amplicon. The three-primer PCR system with the linker creates two amplicons, L and T, so that the amplicon L serves as a template for the Q-tag-Linker/R primer pair which originates the fluorogenic amplicon T.

Figure 3. Primer design tools. A: Target mRNA sequence interactive map. The sequence is color-coded according to the BLAST search results with the unique sequence regions shown in green and the genomic repeats regions in black. The red triangles on the top of the colored bar indicate the positions of the splice junctions. The primer pairs are shown as short pink horizontal bars below the mRNA map. B: Primer-dimer analysis table for the 3-plex in table 1 and ten linker sequences from table 2. The numbers in the table represent the length of a dimer that can be formed by a primer pair. Four types of dimers are considered here depending on their potential to be extended and amplified in PCR reaction: 3'- forward to 3'-reverse, 3'-forward to mid-reverse, mid-forward to 3'-reverse and mid- forward to mid-reverse. The colored cells indicate potential problem and corresponding primer pairs have to be check by the sequence inspection.

Figure 4. QZyme 3-plex assay EH63, EH64 and EH60 compared to three 1- plex assays for the same targets. For each primer pair 8 reactions were run: six serial 5-fold dilutions of the cDNA sample and two NTC (no template control). The results are shown in amplification plots and standard plots of Ct versus Log₁₀ of the sample concentration. The experiment setup is summarized in the table below along with the Ct value for the first well (no-dilution sample), PCR efficiency E estimated from Ct/Log(conc.) plot, and Ct values for NTC if detected.

Figure 5. Universal QZyme tag PCR 3-plex assay EH63, EH64 and EH60 compared to three universal QZyme tag 1-plex assays. For each primer pair 8 reactions were run: six serial 5-fold dilutions of the cDNA sample and two NTC. The results are shown in amplification plots A through J and standard plots of Ct versus Logi₀ of the sample concentration. The experiment setup is summarized in the table below along with the Ct for the first well (no-dilution sample), PCR efficiency E estimated from Ct/Log(conc.) plot, the linear fit parameter RSq and Ct values for each of two NTC if detected.

Figure 6. Universal QZyme tag PCR 1-plex (yellow) assays EH63 (A, B),

EH64 (C, D) and EH60 (E, F) compared to the two-primer assays (blue) for the same target and the same gene-specific primer sequences. For each primer pair 8 reactions were run: six serial 5-fold dilutions of the cDNA sample and two NTC. The results are shown as amplification plots and Ct versus Log™ (cone.) plots. The PCR efficiencies E were calculated as described in Materials and Methods section. The details of the experiment setup are summarized in the Fig. 4 and 5.

Figure 7. Evaluation of the Universal QZyme Tag technology for real-time PCR 1-plex assays. For ten randomly selected mRNA targets the PCR primers were designed using on-line BLAST server at http://www.ncbi.nlm.nih.gov/BLAST/ and on-line primer design software Primer3 available at http://frodo.wi.mit.edu/cqi- bin/primer3/primer3 www.cqi . In the case of DH 16 and DH 18 assays, the primer concentration was decreased to ensure negative NTC (no template control).

Figure 8. Evaluation of the Universal QZyme Tag technology for real-time PCR 2- plex assays. For ten randomly selected mRNA targets the PCR primers were designed using on-line BLAST server at http://www.ncbi.nlm.nih.gov/BLAST/ and on-line primer design software Primer3 available at http://frodo.wi.mit.edu/cgi- bin/primer3/primer3 www.cgi . The assays were optimized to ensure negative NTC (no template control) by adjusting the primer concentrations down from the initial ratio of 20 nmol for the universal detection tag, 60 nmol for the forward primer with the linker and 200 nmol for the reverse primer.

DEFINITIONS The terms "nucleic acid enzyme," "nucleozyme," "catalytic nucleic acid molecule," "catalytic nucleic acid," and "catalytic nucleic acid sequence" are used interchangeably herein, and refer to a nucleic acid molecule which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate, such as a DNA molecule or DNA-containing molecule (also known in the art as a "DNAzyme") or an RNA or RNA-containing molecule (also known in the art as a "ribozyme") which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate. The nucleic acid bases in the DNAzymes and ribozymes can be the bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art, and are exemplified in various publications, including, e.g., PCR Systems, Reagents and Consumables Perkin Elmer Catalog 1996-1997. Roche Molecular Systems, Inc. Branchburg, N.J., USA.

"Amplification" of a target nucleic acid sequence refers to the exponential amplification thereof (as opposed to linear amplification), whereby each amplification cycle doubles (or nearly doubles) the number of target amplicons present in the immediately preceding the cycle. Methods of exponential amplification include, but are not limited to, PCR, SDA and TMA. Exponential amplification differs from linear amplification; in linear amplification, each amplification cycle increases by a fixed number the number of target amplicons present in the immediately preceding the cycle.

The terms "reporter substrate," "chemical substrate" and "substrate" are used interchangeably herein, and refer to any molecule which is specifically recognized and modified by a catalytic nucleic acid molecule. "Target," "target nucleic acid" and "target nucleic acid sequence" are equivalent, and each shall mean the nucleic acid that has the sequence of interest to be detected or measured by the instant invention, which comprises a sequence that hybridizes with the primer when contacted therewith in this method, and that can be either an entire molecule or a portion thereof. "Primer" refers to a short segment of a nucleic acid, e.g., DNA or DNA-containing nucleic acid molecule, which (i) anneals under amplification conditions to a suitable portion of a nucleic acid, e.g., DNA or RNA molecule to be amplified, and (ii) initiates, and is itself physically extended, via polymerase-mediated synthesis.

The term "zymogene" refers to a nucleic acid sequence which comprises the anti-sense (i.e. complementary) sequence of a catalytic nucleic acid molecule having detectable activity, and whose transcription product is the catalytic nucleic acid molecule.

As used herein, "nucleic acid" refers to either DNA or RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and functionality to the nucleic acid. Such modifications include, but are not limited to, 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4- thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3' and 5' modifications such as capping.

As used herein, "fluorescent group" refers to a molecule that, when excited with light having a selected wavelength, emits light of a different wavelength. Fluorescent groups may also be referred to as "fluorophores." As used herein, "fluorescence-modifying group" refers to a molecule that can alter in any way the fluorescence emission from a fluorescent group. A fluorescence-modifying group generally accomplishes this through an energy transfer mechanism. Depending on the identity of the fluorescence-modifying group, the fluorescence emission can undergo a number of alterations, including, but not limited to, attenuation, complete quenching, enhancement, a shift in wavelength, a shift in polarity, a change in fluorescence lifetime. One example of a fluorescence-modifying group is a quenching group.

As used herein, "energy transfer" refers to the process by which the fluorescence emission of a fluorescent group is altered by a fluorescence- modifying group. If the fluorescence-modifying group is a quenching group, then the fluorescence emission from the fluorescent group is attenuated (quenched). Energy transfer can occur through fluorescence resonance energy transfer, or through direct energy transfer. The exact energy transfer mechanisms in these two cases are different. It is to be understood that any reference to energy transfer in the instant application encompasses all of these mechanistically-distinct phenomena. Energy transfer is also referred to herein as fluorescent energy transfer or FET.

As used herein, "energy transfer pair" refers to any two molecules that participate in energy transfer. Typically, one of the molecules acts as a fluorescent group, and the other acts as a fluorescence-modifying group. Where the energy transfer pair comprises a fluorescent group and a fluorescence-modifying group, the energy transfer pair is also referred to herein as a "fluorescent energy transfer pair." An exemplary energy transfer pair comprises a fluorescent group and a quenching group. In some cases, the distinction between the fluorescent group and the fluorescence-modifying group may be blurred. For example, under certain circumstances, two adjacent fluorescein groups can quench one another's fluorescence emission via direct energy transfer. For this reason, there is no limitation on the identity of the individual members of the energy transfer pair in this application. All that is required is that the spectroscopic properties of the energy transfer pair as a whole change in some measurable way if the distance between the individual members is altered by some critical amount.

"Energy transfer pair" is used to refer to a group of molecules that form a single complex within which energy transfer occurs. Such complexes may comprise, for example, two fluorescent groups which may be different from one another and one quenching group, two quenching groups and one fluorescent group, or multiple fluorescent groups and multiple quenching groups. In cases where there are multiple fluorescent groups and/or multiple quenching groups, the individual groups may be different from one another. As used herein, "quenching group" refers to any fluorescence-modifying group that can attenuate at least partly the light emitted by a fluorescent group. We refer herein to this attenuation as "quenching". Hence, illumination of the fluorescent group in the presence of the quenching group leads to an emission signal that is less intense than expected, or even completely absent. Quenching occurs through energy transfer between the fluorescent group and the quenching group.

As used herein, "fluorescence resonance energy transfer" or "FRET" refers to an energy transfer phenomenon in which the light emitted by the excited fluorescent group is absorbed at least partially by a fluorescence-modifying group. If the fluorescence-modifying group is a quenching group, then that group can either radiate the absorbed light as light of a different wavelength, or it can dissipate it as heat. FRET depends on an overlap between the emission spectrum of the fluorescent group and the absorption spectrum of the quenching group. FRET also depends on the distance between the quenching group and the fluorescent group. Above a certain critical distance, the quenching group is unable to absorb the light emitted by the fluorescent group, or can do so only poorly.

As used herein "direct energy transfer" refers to an energy transfer mechanism in which passage of a photon between the fluorescent group and the fluorescence-modifying group does not occur. Without being bound by a single mechanism, it is believed that in direct energy transfer, the fluorescent group and the fluorescence-modifying group interfere with each others electronic structure. If the fluorescence-modifying group is a quenching group, this will result in the quenching group preventing the fluorescent group from even emitting light. In general, quenching by direct energy transfer is more efficient than quenching by FRET. Indeed, some quenching groups that do not quench particular fluorescent groups by FRET (because they do not have the necessary spectral overlap with the fluorescent group) can do so efficiently by direct energy transfer. Furthermore, some fluorescent groups can act as quenching groups themselves if they are close enough to other fluorescent groups to cause direct energy transfer. For example, under these conditions, two adjacent fluorescein groups can quench one another's fluorescence effectively. For these reasons, there is no limitation on the nature of the fluorescent groups and quenching groups useful for the practice of this invention. As used herein, "3' end" means at any location on the oligonucleotide from and including the 3' terminus to the center of the oligonucleotide, usually at any location from and including the 3' terminus to about 10 bp from the 3' terminus, and more usually at any location from and including the 3' terminus to about 5 bp from the 3' terminus. As used herein, "5' end" means at any location on the oligonucleotide from and including the 5' terminus to the center of the oligonucleotide, usually at any location from and including the 5' terminus to about 10 bp from the 5' terminus, and more usually at any location from and including the 5' terminus to about 5 bp from the 5' terminus.

A "biological sample" encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay. The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as nucleated cells, CD4+ T lymphocytes, glial cells, macrophages, tumor cells, peripheral blood mononuclear cells (PBMC), and the like; enrichment for particular cell fractions, e.g., nuclei, mitochondria, etc.; enrichment for particular macromolecules, e.g., nucleic acids, genomic DNA, mRNA, etc. The term "biological sample" encompasses a clinical sample, and also includes cells in culture, cell supernatants, tissue samples, organs, bone marrow, and the like.

As used herein, the term "isolated," in the context of a nucleic acid, is meant to describe a nucleic acid that is in an environment different from that in which the nucleic acid naturally occurs, or that is in an environment different from that which the nucleic acid was found. As used herein, an "isolated" nucleic acid is one that is substantially free of the nucleic acids or other macromolecules with which it is associated in nature. By substantially free is meant at least 50%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90% free of the materials with which it is associated in nature. As used herein, an "isolated" nucleic acid also refers to recombinant nucleic acids, which, by virtue of origin or manipulation: (1) are not associated with all or a portion of a nucleic acid with which it is associated in nature, (2) are linked to a nucleic acid other than that to which it is linked in nature, or (3) does not occur in nature.

DETAILED DESCRIPTION OF THE INVENTION Nucleozyme based methods and compositions are provided for detecting a plurality of target nucleic acids in a sample. As developed below, aspects of the invention include the use of a universal nucleozyme tag. Also provided are systems and kits for practicing the subject methods.

Before the present invention is described in greater detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described. All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. It is noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

GENERAL CONSIDERATIONS

The present invention provides a rapid and procedurally flexible method of detecting, either qualitatively or quantitatively, the presence of a target nucleic acid(s) of interest in a sample. Aspects of the invention, as developed in greater detail below, include the use of a universal nucleozyme tag. Embodiments of the invention provide for target amplification and detection via catalytic nucleic activity in a single reaction vessel.

In some embodiments, the methods include the following steps. First, a sample to be assayed is contacted with:

(i) a forward primer that includes a primer domain complementary to a region of the target nucleic acid of interest and a linker domain;

(ii) a reverse primer;

(iii) a nucleozyme tag that includes a nucleozyme template domain (i.e., a zymogene) and linker domain, where the linker domain of the tag has a nucleotide sequence that is substantially the same as, and in certain embodiments identical to, the linker domain of the forward primer; and

(iv) a nucleozyme substrate that produces a detectable signal upon cleavage by a nucleozyme having a sequence complementary to the nucleozyme template domain of the tag. Following contact of the sample with the above agents to produce a reaction mixture; signal from the reaction mixture is then detected to determine whether the target nucleic acid is present in the sample.

In one embodiment, the instant method further includes the step of quantitatively determining the amount of catalytic nucleic acid activity in the reaction mixture (e.g., as determined from the signal observed from the reaction mixture), and comparing the amount of activity so determined to a known standard, thereby quantitatively determining the amount of the target nucleic acid in the sample. The known standard can be any standard or control used for quantitative determination. Examples of these standards include, but are not limited to: (i) known reaction kinetic information, as well as (ii) signal measurements obtained using samples containing no catalytic activity, or a pre-determined amount of catalytic activity.

NUCLEOZYME DETECTION AGENTS

As summarized above, aspects of the invention include the use of a number of different detection agents, which may be viewed as nucleozyme detection agents. Specific nucleozyme detection agents employed in embodiments of the methods include: nucleozyme tags; forward primers; reverse primers and nucleozyme substrates. Each of these agents is now reviewed separately in greater detail.

Nucleozyme Tags Nucleozyme tags employed in embodiments of the subject invention are nucleic acids that include at least two domains, where the first domain is a nucleozyme template domain (i.e., a zymogene) and the second domain is a linker domain. In representative embodiments, the nucleozyme tag includes, in order from 5' to 3', a zymogene which encodes, but which itself has the anti-sense sequence of, a catalytic nucleic acid molecule, and a linker domain. The nucleozyme tags are single stranded nucleic acids, where tags may range in length from about 30 to about 200 nt in length, such as from about 30 to about 100 nt in length. The zymogene domain of this first nucleic acid ranges in length from about 20 nucleotides to about 100 nucleotides, e.g., from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, from about 50 nucleotides to about 60 nucleotides, from about 60 nucleotides to about 75 nucleotides, or from about 75 nucleotides to about 100 nucleotides.

The nucleotide sequence of the zymogene encodes a catalytic nucleic acid, which catalytic nucleic acid includes: a) a recognition nucleotide sequence that is complementary to a recognition nucleotide sequence of a corresponding substrate; and b) a catalytic domain which cleaves a catalytic substrate sequence in the substrate.

Representative nucleotide sequences of zymogenes include, but are not limited to: 5'- TTGACGATACAGCTGCCACCAGGGCCTAGCTACAACGATCCAACTACCACAA GT-3' (SEQ ID NO:1 ; found in GenBank accession number NM_007042); 5'- AAGTGGGCATTTGAACAAC-3' (SEQ ID NO:2). See, e.g., U.S. Patent No. 6,140,055. In representative embodiments, the zymogene comprises a nucleotide sequence complementary to any one of SEQ ID NOS:03-17, as discussed below, which are catalytic nucleic acids.

Also present in the nucleozyme universal tag, e.g., 3¹ of the zymogene domain reviewed above, is a linker domain. The linker domain may have any convenient nucleic acid sequence. In representative embodiments, the linker domain ranges in length from about 5 nucleotides to about 100 nucleotides, such as from about 10 to about 50 nucleotides, including from about 15 to about 30 nucleotides, e.g., from about 5 nucleotides to about 35 nucleotides, from about 5 to about 25 nucleotides, from about 10 nucleotides to about 30 nucleotides, from about 15 nucleotides to about 25 nucleotides, e.g., 20 nucleotides.

In representative embodiments, the linkers have a nucleotide sequence which satisfies one or more conditional filters, where representative conditional filters include low complexity filter, overall and 3'-end homology to the human genome and to the human RNA, balanced GC content, and absence of any homology with the other linkers to be employed. In certain embodiments, linkers of interest are those that have been confirmed empirically to work satisfactorily with other linkers in multiplex assay formats, as reviewed in greater detail below. Sequences of ten representative linkers (as well as the best linkers with which they may be used in multiplex assay formats) are provided in the Table 1.

Table t

Forward Primer

The forward primer is a nucleic acid that initiates synthesis of a first nucleic acid amplification product using the target nucleic acid as a template. The forward primer initiates, or "primes," synthesis of a first, nucleic acid amplification product that includes a nucleotide sequence which is complementary to a nucleotide sequence in the target nucleic acid. A feature of the forward primer is that it includes at least the following two domains, a forward primer domain and a linker domain. In representative embodiments, the forward primer domain is 3' of the linker domain, such that the linker domain is 5' of the forward primer domain. The forward primers are single stranded nucleic acids. The overall length of the forward primer may vary, where the length may range in certain embodiments from about from about 30 to about 200 nt in length, such as from about 30 to about 100 nt in length. As mentioned above, the forward primer includes a nucleotide sequence that is complementary to the target, where this domain (i.e., region) of the forward primer is referred to as the forward primer domain. In representative embodiments, the forward primer domain has a length of from about 10 nucleotides to about 60 nucleotides, e.g., from about 10 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, or from about 50 nucleotides to about 60 nucleotides. The nucleotide sequence of the forward primer domain is chosen based on the nucleotide sequence present within a target nucleic acid to be detected. The forward primer domain hybridizes under stringent hybridization conditions to a complementary nucleotide sequence in the target nucleic acid. The forward primer domain comprises a nucleotide sequence that is at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identical in nucleotide sequence to the complement of a nucleotide sequence of the same length in the target nucleic acid.

Turning now to the linker domain, the linker domain has a sequence substantially the same as, and in representative embodiments a sequence that is identical to, the linker domain of the nucleozyme tag, reviewed above. By substantially the same as is meant that the length of the two linker domains varies by less than about 5 nt, such as less than about 3nt, including less than 2 or 1 nt, where the sequence identity of the two domains is at least about 80%, such as at least about 90%, including at least about 95 or 99 %. In certain embodiments, the linker domains are identical in terms of both length and sequence.

Reverse Primer

The reverse primer is a primer that primes synthesis of an amplification product that is complementary to the product that is primed by the forward primer (and also the nucleozyme tag, as reviewed in greater detail below). As such the reverse primer generally includes a sequence of nucleic acids that is found in the target nucleic acid. This sequence may range in length from about 10 nucleotides to about 60 nucleotides, e.g., from about 10 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, or from about 50 nucleotides to about 60 nucleotides.

In certain embodiments, the reverse primer is a primer that has been "validated," e.g., in a control amplification reaction in the absence of target nucleic acid. Thus, in some embodiments, the reverse primer is one in which, in a reaction that includes a DNA polymerase and the forward primer and nucleozyme tag, but lacks a target nucleic acid, substantially no enzymatically active amplification product is generated, e.g., as determined by lack of signal obtained from the control reaction mixture. Such reverse primer is referred to herein as a "validated 3' primer" or a "validated reverse primer." A feature of this validated 3' primer is that it has been empirically determined to have the above functional properties. A reaction that proceeds in the absence of a target nucleic acid is also referred to as a "no template control." Substantially no enzymatically active nucleic acid amplification product is generated when the amount of enzymatically active nucleic acid amplification product is at or below the detection limit.

In certain embodiments, a validated reverse primer differs in base sequence from a non-validated reverse primer, such that one, two, three, or more mismatches to the target sequence are introduced.

Nucleozyme Substrate

The nucleozyme substrate is an agent that produces a detectable signal upon cleavage by a nucleozyme that is present in an amplification product and has a sequence complementary to the nucleozyme template domain (i.e., zymogene) of the nucleozyme tag. A feature of certain embodiments of the subject invention is that it employs FET-labeled oligonucleotide substrate as the nucleozyme substrate to detect the presence of the catalytic activity produced for each target nucleic acid according to the subject invention. FET occurs when a suitable fluorescent energy donor and an energy acceptor moiety are in close proximity to one another. The excitation energy absorbed by the donor is transferred to the acceptor which can then further dissipate this energy either by fluorescent emission if a fluorophore, or by non-fluorescent means if a quencher. A donor-acceptor pair comprises two fluorophores having overlapping spectra, where the donor emission overlaps the acceptor absorption, so that there is energy transfer from the excited fluorophore to the other member of the pair. It is not essential that the excited fluorophore actually fluoresce, it being sufficient that the excited fluorophore be able to efficiently absorb the excitation energy and efficiently transfer it to the emitting fluorophore.

As such, the FET-labeled oligonucleotides employed in embodiments of the subject methods are nucleic acid detectors that include a fluorophore domain where the fluorescent energy donor, i.e., donor, is positioned and an acceptor domain where the fluorescent energy acceptor, i.e., acceptor, is positioned. As mentioned above, the donor domain includes the donor fluorophore. The donor fluorophore may be positioned anywhere in the nucleic acid detector, but is typically present at the 5' terminus of the detector.

The acceptor domain includes the fluorescence energy acceptor. The acceptor may be positioned anywhere in the acceptor domain, but is typically present at the 3' terminus of the nucleic acid detector.

The nucleic acid detector includes, in representative embodiments: a) a first recognition nucleotide sequence that is complementary to the enzymatically active nucleic acid amplification product, and specifically the nucleozyme domain on the amplification product; b) a substrate for the catalytic domain of the catalytic nucleic acid of the nucleozyme domain; and c) a second recognition nucleotide sequence that is complementary to the second recognition nucleotide_Nsequence on the enzymatically active nucleic acid amplification product.

Thus, as depicted in Figure 1 , in representative embodiments, a FET- ' labeled substrate comprises a first recognition domain, R1 ; a catalytic substrate domain, CS; and a second recognition domain, R2. Each of R1 , C, and R2 independently has a length of from about 10 nucleotides to about 60 nucleotides, e.g., from about 10 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, or from about 50 nucleotides to about 60 nucleotides. The recognition domains R1 and R2 hybridize to complementary nucleotide sequences R1 and R2 in the catalytic nucleic acid (e.g., a DNAzyme). The catalytic domain of the catalytic nucleic acid recognizes and cleaves a site in the catalytic substrate (CS) domain.

The overall length of the FET-labeled oligonucleotide substrate, which includes all three domains mentioned above, typically ranges from about 10 nucleotides to about 60 nucleotides, e.g., from about 15 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, or from about 50 nucleotides to about 60 nucleotides. The donor fluorophore of the subject FET-labeled substrate is typically one that is excited efficiently by a single light source of narrow bandwidth, particularly a laser source. The emitting or accepting fluorophores are selected to be able to receive the energy from the donor fluorophore and emit light. Usually the donor fluorophores will absorb in the range of about 350-800 nm, e.g., in the range of about 350-600 nm, or 500-750 nm. The transfer of the optical excitation from the donor to the acceptor depends on the distance between the two fluorophores. Thus, the distance must be chosen to provide efficient energy transfer from the donor to the acceptor. The distance between the donor and acceptor moieties on the FET-labeled oligonucleotides employed in the subject invention, at least in certain configurations (such as upon intramolecular association) typically ranges from about 10 to about 100 angstroms.

Suitable fluorophores for FET include, but are not limited to, fluorescein, fluorescein isothiocyanate, succinimidyl esters of carboxyfluorescein, succinimidyl esters of fluorescein, 5-isomer of fluorescein dichlorotriazine, caged carboxyfluorescein-alanine-carboxamide, Oregon Green 488, Oregon Green 514; Lucifer Yellow, acridine Orange, rhodamine, tetramethylrhodamine, Texas Red, propidium iodide, JC-1 (δ.δ'.e.e'-tetrachloro-i .i'.S^¹- tetraethylbenzimidazoylcarbocyanine iodide), tetrabromorhodamine 123, rhodamine 6G, TMRM (tetramethylrhodamine- , methyl ester), TMRE (tetramethylrhodamine, ethyl ester ), tetramethylrosamine, rhodamine B and 4- dimethylaminotetramethylrosamine, green fluorescent protein, blue-shifted green fluorescent protein, cyan-shifted green fluorescent protein, red-shifted green fluorescent protein, yellow-shifted green fluorescent protein, 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'-aminoethyl)aminonaphthalene-1 -sulfonic acid

(EDANS); 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4- anilino-1 -naphthyl)maleimide; anthranilamide; 4,4-difluoro-5-(2-thienyl)-4-bora- 3a,4a diaza-5-indacene-3-propioni-c acid BODIPY; Brilliant Yellow; coumarin and derivatives: coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),7-amino- 4-trifluoromethylcoumarin (Coumarin 151); cyanine dyes; cyanosine; 4',6- diaminidino-2-phenylindole (DAPI); 5',5"-dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red); 7-diethylamino-3~(4'-isothiocyanatophenyl)-4- methylcoumarin; diethylenetriaamine pentaacetate; 4,4'-diisothiocyanatodihydro- stilbene-2- ,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; 5- (dimethylamino)naphthalene-i-sulfonyl chloride (DNS, dansylchloride); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives: eosin, eosin isothiocyanate, erythrosin and derivatives: erythrosin B, erythrosin, isothiocyanate; ethidium; fluorescein and derivatives: 5-carboxyfluorescein (FAM),5-(4,6-dichlorotriazin-2-yl)amino- -fluorescein (DTAF)₁ 2',7^Idimethoxy-4'5^I- dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelli-feroneortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 -pyrene; butyrate quantum dots; Reactive Red 4 (Cibacron™ Brilliant Red 3B-A) rhodamine and derivatives: 6-carboxy-X- rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 , sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS), 4-(4'- dimethylaminophenylazo)benzoic acid (DABCYL), rosolic acid; CAL Fluor Orange 560; terbium chelate derivatives; Cy 3; Cy 5; Cy 5.5; Cy 7; IRD 700; IRD 800; La JoIIa Blue; phthalo cyanine; and naphthalo cyanine, coumarins and related dyes, xanthene dyes such as rhodols, resorufins, bimanes, acridines, isoindoles, dansyl dyes, aminophthalic hydrazides such as luminol, and isoluminol derivatives, aminophthalimides, aminonaphthalimides, aminobenzofurans, aminoquinolines, dicyanohydroquinones, and fluorescent europium and terbium complexes; and the like. Fluorophores of interest are further described in WO 01/42505 and WO 01/86001.

Quenchers that can be used in the methods provided herein include, but are not limited to, diarylrhodamine derivatives, such as the QSY 7, QSY 9, and QSY 21 dyes available from Molecular Probes; dabcyl and dabcyl succinimidyl ester; dabsyl and dabsyl succinimidyl ester; QSY 35 acetic acid succinimidyl ester; QSY 35 iodoacetamide and aliphatic methylamine; a Black Hole Quencher (BHQ), e.g., BHQ-O, BHQ-1 , BHQ-2, etc.; napthalate; and Cy5Q and Cy7Q from Amersham Biosciences. In certain embodiments, the acceptor moiety of at least one of the FET- labeled substrates is a quencher molecule, e.g., a molecule that absorbs transferred energy but does not emit fluorescence, e.g., a dark quencher. In representative embodiments, the dark quencher has maximum absorbance of between about 400 nm and about 700 nm, e.g., between about 400 nm and about 500 nm, between about 500 nm and about 600 nm, or between about 600 nm and about 700 nm.

The fluorescence donor will be paired with a suitable fluorescence acceptor. For example, BHQ-O has a λmax of 495 nm (range = 430-520 nm); BHQ-1 has a λmax of 534 nm (range 480-580 nm); and BHQ-2 has a λmax of 579 nm (range 550-650 nm). The quencher will be paired with an appropriate fluorescence donor (e.g., TAM, TAMRA, JOE, etc.; or a FRET pair such as JOE/ROX, FAM/TAM, JOE/TAM, etc.).

In certain embodiments, the dark quencher comprises a substituted 4- (phenyldiazenyl)phenylamine structure, often comprising at least two residues selected from aryl, substituted aryl, heteroaryl, substituted heteroaryl and combination thereof, wherein at least two of said residues are covalently linked via an exocyclic diazo bond.

In certain embodiments, the dark quencher is described by the following formula:

wherein:

Ro,Ri,R2,R3,R4,R5 are independently: -H, halogen, -O(CH₂)nCH₃, -(CH₂)nCH₃, - NO₂, -SO₃, -N[(CH₂)nCH₃]₂ wherein n=0 to 5 or -CN; R₆ is -H or -(CH₂)nCH₃ where n=0 to 5; and v is a number from 0 to 10. Dark quenchers of interest are further described in WO 01/42505 and WO 01/86001.

The FET-labeled oligonucleotide substrates may be structured in a variety of different ways, so long as they include the above-described donor, acceptor and nucleic acid binding domains.

PRODUCTION OF REΞACTION MIXTURE

Embodiments of the methods include combining one or more sets of nucleozyme detection agents, depending on how many different target nucleic acids are to be detected, with a sample to be assayed under conditions sufficient for primer-initiated nucleic acid amplification, where in representative embodiments the sample and set(s) of nucleozyme detection agents are combined with at least a DNA polymerase; deoxynucleotide triphosphates; and magnesium ions. Exemplary, non-limiting reaction conditions are described in the Examples.

In representative embodiments, the DNA polymerase is one that has high affinity for binding at the 3'-end of an oligonucleotide hybridized to a nucleic acid strand. In representative embodiments, the DNA polymerase is one that has little or no 5¹ → 3' exonuclease activity so as to minimize degradation of primer, termination or primer extension polynucleotides. In representative embodiments, the DNA polymerase is one that has little to no proofreading activity. In representative embodiments, the DNA polymerase is thermostable, e.g., is catalytically active at temperatures in excess of about 75°C. DNA polymerases that are suitable for use in a subject methods include, but are not limited to, DNA polymerases discussed in U.S. Pat. Nos. 5,648,211 and 5744312, which include exo- Vent (New England Biolabs), exo- Deep Vent (New England Biolabs), Bst (BioRad), exo- Pfu (Stratagene), Bca (Panvera), sequencing grade Taq (Promega); thermostable DNA polymerases from Thermoanaerobacter thermohydrosulfuricus; and the like. In some embodiments, the reaction mixture includes an RNAse H.

Magnesium ions are present in the reaction mix in representative embodiments, e.g., in a concentration of from about 1 mM to about 100 mM, e.g., from about 1 mM to about 3 mM, from about 3 mM to about 5 mM, from about 5 mM to about 10 mM, from about 10 mM to about 25 mM, from about 25 mM to about 50 mM, from about 50 mM to about 75 mM, or from about 75 mM to about 10O mM.

In representative embodiments, the reaction mixture includes four different types of dNTPs corresponding to the four naturally occurring bases are present, i.e. dATP, dTTP, dCTP and dGTP. In the subject methods, each dNTP is present in certain embodiments at a final concentration in the reaction mixture ranging from about 10 μM to 5000 μM, e.g., from about 10 μM to about 50 μM, from about 50 μM to about 100 μM, from about 100 μM to about 200 μM, from about 200 μM to about 500 μM, from about 500 μM to about 1000 μM, from about 1000 μM to about 2000 μM, from about 2000 μM to about 3000 μM, from about 3000 μM to about 4000 μM, or from about 4000 μM to about 5000 μM. In many embodiments, each dNTP will be present at a final concentration in the reaction of from about 20 μM to 1000 μM, from about 100 μM to about 200 μM, or from about 50 μM to about 200 μM. The reaction mixture prepared in these embodiments further includes an aqueous buffer medium that includes a source of monovalent ions, a source of divalent cations and a buffering agent. Any convenient source of monovalent ions, such as KCI, K-acetate, NH₄-acetate, K-glutamate, NH₄CI, ammonium sulfate, and the like may be employed. The divalent cation may be magnesium, manganese, zinc and the like, where the cation will typically be magnesium. Any convenient source of magnesium cation may be employed, including MgCI₂, Mg-acetate, and the like. Representative buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS and the like, where the amount of buffering agent will typically range from about 5 to 150 mM, usually from about 10 to 100 mM, and more usually from about 20 to 50 mM, where in certain preferred embodiments the buffering agent will be present in an amount sufficient to provide a pH ranging from about 6.0 to 9.5, e.g., pH 7.3 at 72 ⁰C. Other agents which may be present in the buffer medium include chelating agents, such as EDTA, EGTA and the like. Each primer nucleic acid, e.g., forward and reverse primer, is present in the reaction mixture in representative embodiments at a concentration of from about 50 nM to about 900 nM, e.g., the forward and reverse primers are each independently present at a concentration of from about 50 nM to about 75 nM, from about 75 nM to about 100 nM, from about 100 nM to about 150 nM, from about 150 nM to about 200 nM, from about 200 nM to about 250 nM, from about 250 nM to about 300 nM, from about 300 nM to about 400 nM, from about 400 nM to about 500 nM, from about 500 nM to about 600 nM, from about 600 nM to about 700 nM, from about 700 nM to about 800 nM, or from about 800 nM to about 900 nM.

In preparing the reaction mixture, the various constituent components of the reaction mixture, e.g., the set(s) of nucleozyme detection agents, sample, etc., may be combined in any convenient order. For example, the buffer may be combined with detection agents, polymerase and then combined with the sample, or all of the various constituent components may be combined at the same time to produce the reaction mixture.

SUBJECTING THE REACTION MIXTURE TO PRIMER EXTENSION REACTION CONDITIONS

Following preparation of the reaction mixture, the reaction mixture is subjected to primer extension reaction conditions, i.e., to conditions that permit for polymerase mediated primer extension by addition of nucleotides to the end of the primer molecule using the template strand as a template. In representative embodiments, the primer extension reaction conditions are amplification conditions, which conditions include a plurality of reaction cycles, where each reaction cycle comprises: (1) a denaturation step, (2) an annealing step, and (3) a polymerization step. The number of reaction cycles will vary depending on the application being performed, but will usually be at least 15, more usually at least 20 and may be as high as 60 or higher, where the number of different cycles will typically range from about 20 to 40. For methods where more than about 25, usually more than about 30 cycles are performed, it may be convenient or desirable to introduce additional polymerase into the reaction mixture such that conditions suitable for enzymatic primer extension are maintained.

The denaturation step includes heating the reaction mixture to an elevated temperature and maintaining the mixture at the elevated temperature for a period of time sufficient for any double stranded or hybridized nucleic acid present in the reaction mixture to dissociate. For denaturation, the temperature of the reaction mixture may be raised to, and maintained at, a temperature ranging from about 85 to 100, such as from about 90 to 98 and including from about 93 to 96 ⁰C for a period of time ranging from about 3 to 120 sec, such as from about 5 to 30 sec.

Following denaturation, the reaction mixture will be subjected to conditions sufficient for primer annealing to template DNA present in the mixture. The temperature to which the reaction mixture is lowered to achieve these conditions may be chosen to provide optimal efficiency and specificity, and will range in certain embodiments from about 50 to 75, such as from about 55 to 70 and including from about 60 to 68°C. Annealing conditions may be maintained for a period of time ranging from about 15 sec to 30 min, such as from about 30 sec to 5 min.

Following annealing of primer to template DNA or during annealing of primer to template DNA, the reaction mixture will be subjected to conditions sufficient to provide for polymerization of nucleotides to the primer ends in manner such that the primer is extended in a 5' to 3¹ direction using the DNA to which it is hybridized as a template, i.e., conditions sufficient for enzymatic production of primer extension product. To achieve polymerization conditions, the temperature of the reaction mixture may be raised to or maintained at a temperature ranging from about 65 to 75, such as from about 67 to 73°C and maintained for a period of time ranging from about 15 sec to 20 min, such as from about 30 sec to 5 min.

The above cycles of denaturation, annealing and polymerization (i.e., temperature cycling conditions) may be performed using an automated device, typically known as a thermal cycler. Thermal cyclers that may be employed are described in U.S. Pat. Nos 5,612,473; 5,602,756; 5,538,871; and 5,475,610, the disclosures of which are herein incorporated by reference.

CATALYTIC NUCLEIC ACIDS

Subjecting the reaction mixture of the sample and nucleozyme detection agents to template dependent primer extension conditions as described above results in the production of enzymatically active nucleic acid amplification product ("catalytic nucleic acid"). The catalytic nucleic acid of the amplification product is one that is encoded by the zymogene portion of the nucleozyme tag and recognizes and cleaves a sequence present in the nucleozyme substrate, as described above. The enzymatically active portion of the catalytic nucleic acid is a nucleic acid enzyme (i.e., nucleozyme) such as a ribozyme or a DNAzyme. In one embodiment, the catalytic nucleic acid molecule is a ribozyme. In representative embodiments, the catalytic nucleic acid molecule is a DNAzyme.

In some embodiments, a catalytic nucleic acid comprises first recognition domain, R1 ; a catalytic domain, C; and a second recognition domain, R2. Each of R1 , C, and R2 independently has a length of from about 10 nucleotides to about 60 nucleotides, e.g., from about 10 nucleotides to about 15 nucleotides, from about 15 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 25 nucleotides to about 30 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 40 nucleotides to about 50 nucleotides, or from about 50 nucleotides to about 60 nucleotides. The recognition domains hybridize, e.g., under stringent hybridization conditions, to complementary nucleotide sequences in a substrate, as described in more detail below.

Catalytic nucleic acids comprise a catalytic domain. Any catalytic domain can be used in the instant invention. In some embodiments, the catalytic nucleic acid comprises a Mg²⁺-dependent catalytic domain. A non-limiting example of a Mg²⁺-dependent catalytic domains is the 15-nucleotide sequence 5'- GGCTAGCTACAACGA-S¹ (SEQ ID NO:13). In some embodiments, the catalytic nucleic acid comprises a Zn²⁺-dependent catalytic domain. In some embodiments, the catalytic nucleic acid is a DNAzyme. In some embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- GGCTAGCTACAACGA-S¹ (SEQ ID NO:14). In some embodiments, the DNAzyme is a 10-23 DNAzyme comprising a catalytic motif having the nucleotide sequence set forth in SEQ ID NO: 13. See, e.g., Figure 2 of Santoro and Joyce (1997) Proc. Natl. Acad. Sci. USA 94:4262-4266. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- TCCGAGCCGGACGA-3' (SEQ ID NO:14), 5'-CCGAGCCGGACGA-3' (SEQ ID NO: 15), or 5'-CATATACT CCGAGCCGGACGACACGTCGC-3' (SEQ ID NO: 16). In some embodiments, the DNAzyme is an 8-17 DNAzyme that comprises a nucleotide sequence as set forth in SEQ ID NO:2, 13, or 14. See, e.g., See, e.g., Figure 2 of Santoro and Joyce (1997) supra; Figure 1 of Peracchi (2000) J. Biol.

Chem. 275:11693-11697; and the variants listed in Figure 2 of Peracchi (2000), supra. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'-GTCAGCGACACGAA-S¹ (SEQ ID NO: 17) or 5'-GCTGTTGATCTGTCAGCGACACGAAATGGTGAT-S' (SEQ ID NO: 18). In some embodiments, the DNAzyme is an Mg5 DNAzyme that comprises a nucleotide sequence as set forth in SEQ ID NO:5 or 6. See, e.g., Figure 4 of Peracchi (2000), supra. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'-

GGAGAACGCGAGGCAAGGCTGGGAGAAATGTGGATCACGATT-S' (SEQ ID NO: 19) or 5'- GGAGAACGCGAGGCAAGGCTGGGAGAAATGTGGATCACGATTGTCTGAATC GGTCTGTATC-3' (SEQ ID NO:20). See, e.g., Chinnapen and Sen (2004) Proc. Natl. Acad. Sci. USA 101 :65-69. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence δ'-ACGTGGAGGTGGGCTC- 3' (SEQ ID NO:21). In some embodiments, the DNAzyme is a 7Q10 DNAzyme that comprises the nucleotide sequence set forth in SEQ ID NO:9. See, e.g.,

Figure 1 of Ricca et al. (2003) J. MoI. Biol. 330:1015-1025. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-S¹ (SEQ ID NO:22), where the catalytic activity is Zn²⁺ dependent. In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'-

AGCGATCCGGAACGGCACCCATGT-3' (SEQ ID NO:23). In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- GGCTAGCTACAACGA-3' (SEQ ID NO:24). In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- AACGGGGCTGTGCGGCTAGGAAGTA-S' (SEQ ID NO:25). In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence δ'-GAAGTAGCGCCGCCG-S' (SEQ ID NO:26). In other embodiments, the DNAzyme comprises a catalytic motif comprising the nucleotide sequence 5'- CCGAGCCGGTCGAA-3' (SEQ ID NO:27). In other embodiments, the DNAzyme comprises a catalytic domain comprising a nucleotide sequence as depicted in U.S. Patent No. 6,706,474.

The catalytic nucleic acid activity measured in the instant methods can be any activity which can occur (and, optionally, be measured) simultaneously and in the same milieu with a nucleic acid amplification reaction. The catalytic nucleic acid activity can comprise, for example, the modification of a detectable chemical substrate (e.g., nucleozyme substrate), which modification is selected from the group consisting of phosphodiester bond formation and cleavage, nucleic acid ligation and cleavage, porphyrin metallation, and formation of carbon-carbon, ester and amide bonds. In one embodiment, the detectable chemical substrate modification is cleavage of a fluorescently labeled nucleic acid molecule, and in representative embodiments a FET-labeled substrate, as described above in greater detail.

In certain embodiments, the reporter substrate is cleaved, and measuring this cleavage is a means of measuring the catalytic activity. For example, the presence of the cleaved substrate can be monitored by phosphorimaging following gel electrophoresis provided the reporter substrate is radiolabeled. The presence of cleaved substrate can also be monitored by changes in fluorescence resulting from the separation of fluoro/quencher dye molecules incorporated into opposite sides of the cleavage site within the substrate. Such systems provide the opportunity for a homogeneous assay which can be monitored in real time. Methods for monitoring changes in fluorescence include, by way of example, visual observation and monitoring with a spectrofluorometer, and are reviewed in the next section in greater detail.

SIGNAL DETECTION

The next step in the subject methods is signal detection, e.g., detecting a change in a fluorescent signal from the nucleozyme substrate present in the reaction mixture, to obtain an assay result. In other words, the next step in the ^' subject methods is to detect any modulation in the fluorescent signal generated by the nucleozyme substrate present in the reaction mixture. The change may be an increase or decrease in fluorescence, depending on the nature of the label employed. The sample may be screened for a change in fluorescence using any convenient means, e.g., a suitable fluorimeter, such as a thermostable-cuvette or plate-reader fluorimeter. Fluorescence is suitably monitored using a known fluorimeter. The signals from these devices, for instance in the form of photo- multiplier voltages, are sent to a data processor board and converted into a spectrum associated with each sample tube. Multiple tubes, for example 96 tubes, can be assessed at the same time. Data may be collected in this way at frequent intervals, for example once every 10 ms, throughout the reaction. By monitoring the fluorescence of the reactive molecule from the sample during each cycle (e.g., such that temperature cycling said reaction mixture while signal is being detected from said reaction mixture), the progress of the amplification reaction can be monitored in various ways. For example, the data provided by melting peaks can be analyzed, for example by calculating the area under the melting peaks and this data plotted against the number of cycles.

The spectra generated in this way can be resolved, for example, using "fits" of pre-selected fluorescent moieties such as dyes, to form peaks representative of each signaling moiety (i.e. fluorophore). The areas under the peaks can be determined which represents the intensity value for each signal, and if required, expressed as quotients of each other. The differential of signal intensities and/or ratios will allow changes in signal to be recorded through the reaction or at different reaction conditions, such as temperatures. The integral of the area under the differential peaks will allow intensity values for the signal effects to be calculated.

Screening the mixture for a change in fluorescence provides one or more assay results, depending on whether the sample is screened once at the end of the primer extension reaction, or multiple times, e.g., after each cycle, of an amplification reaction (e.g., as is done in real time PCR monitoring).

EMPLOYING THE ASSAY RESULTS

The data generated as described above can be interpreted in various ways.

In its simplest form, an increase or decrease in fluorescence from the reaction mixture produced from combination of the nucleozyme detection agents and sample in the course of or at the end of the amplification reaction is indicative of an increase in the amount of the target sequence present in the reaction mixture, i.e., primer extension product present, suggestive of the fact that the amplification reaction has proceeded and therefore the target sequence was in fact present in the initial sample from which the reaction mixture was prepared. Quantitation is also possible by monitoring the amplification reaction throughout the amplification process. In this manner, a reaction mixture is readily screened for the presence of primer extension products. The methods are suitable for detection of a single primer extension product as well as multiplex analyses, in which two or more different sets of detection agents (each specific for a given target nucleic acid of interest) are employed to screen for two or more different primer extension products. In these latter multiplex situations, the number of different types of sets of reagents that may be employed may range from about 2 to about 20 or higher, such as from about 2 to about 15, from about 2 to about 10, e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10, where any two given sets of detection agents may differ from each other with respect to label and/or linker, such that many different sets can be generated from a minimum number of different labels and linkers.

The above described methods of detecting the presence of one or more types of primer extension reaction products in a primer extension reaction mixture find use in a variety of different applications, representative ones of which are now reviewed in greater detail.

UTILITY

The subject methods find use in a variety of different applications. Representative applications include screening a sample for the presence of one or more different target nucleic acids (i.e., nucleic acid analytes). The target sequence(s) detected or quantitated in the instant methods can be any nucleic acid sequence. In one embodiment, the target nucleic acid sequence is a DNA molecule. In another embodiment, the target nucleic acid sequence is an RNA molecule (e.g., where the methods further include first reverse transcribing the target RNA sequence to a complementary DNA molecule). In some embodiments, the target is the coding strand of a nucleic acid. In other embodiments, the target nucleic acid is the non-coding strand of a nucleic acid.

The target nucleic acid sequence can be from any organism, and the sample can be any composition containing, or suspected to contain, nucleic acid molecules. In one embodiment, the target nucleic acid is found in a cell or organism of any of the six kingdoms, e.g., Bacteria (e.g., Eubacteria); Archaebacteria; Protista; Fungi; Plantae; and Animalia. Target nucleic acids include nucleic acids from cells or organisms that include, but are not limited to, a protozoan, a plant, a fungus, an algae, a yeast, a reptile, an amphibian, a mammal, a marine microorganism, a marine invertebrate, an arthropod, an isopod, an insect, an arachnid, an archaebacterium, and a eubacterium. Mammalian sources of target nucleic acids include, but are not limited to, primates, felines, canines, ungulates, equines, bovines, ovines, etc.

The target nucleic acid may be derived from a variety of different sources, depending on the application for which the subject method is being performed, where such sources include organisms that comprise nucleic acids, i.e. viruses; prokaryotes, e.g. bacteria, archaea and cyanobacteria; and eukaryotes, e.g. members of the kingdom protista, such as flagellates, amoebas and their relatives, amoeboid parasites, ciliates and the like; members of the kingdom fungi, such as slime molds, acellular slime molds, cellular slime molds, water molds, true molds, conjugating fungi, sac fungi, club fungi, imperfect fungi and the like; plants, such as algae, mosses, liverworts, hornworts, club mosses, horsetails, ferns, gymnosperms and flowering plants, both monocots and dicots; and animals, including sponges, members of the phylum cnidaria, e.g. jelly fish, corals and the like, combjellies, worms, rotifers, roundworms, annelids, molluscs, arthropods, echinoderms, acorn worms, and vertebrates, including reptiles, fishes, birds, snakes, and mammals, e.g. rodents, primates, including humans, and the like. The target nucleic acid may be used directly from its naturally occurring source and/or preprocessed in a number of different ways, as is known in the art. In some embodiments, the target nucleic acid is from a synthetic source.

In some embodiments, the target nucleic acid(s) will be from a tissue taken from an organism; from a particular cell or group of cells isolated from an organism; etc. For example, where the organism is a plant, the nucleic acid will in some embodiments be from the xylem, the phloem, the cambium layer, leaves, roots, etc. Where the organism is an animal, the nucleic acid will in some embodiments be isolated from a particular tissue (e.g., lung, liver, heart, kidney, brain, spleen, skin, fetal tissue, etc.), or a particular cell type (e.g., neuronal cells, epithelial cells, endothelial cells, astrocytes, macrophages, glial cells, islet cells, T lymphocytes, B lymphocytes, etc.). In another embodiment, the target is in a sample obtained from a source such as water or soil. In a further embodiment, the target is from a sample containing bacteria, viruses or mycoplasma. In certain embodiments, the target nucleic acid is from a human cell, organ, tissue, or other biological sample containing nucleic acids. The instant methods can be used for a variety of purposes including, for example, diagnostic, public health and forensic. In some embodiments, the target nucleic acid is present in a biological sample, e.g., a nucleic acid-containing sample obtained from an individual. Suitable biological samples include any that contain nucleic acids. Suitable biological samples include, but are not limited to, blood; solid tissue samples such as a biopsy specimen; bone marrow; cells obtained from the individual and cultured in vitro, and cells derived therefrom and the progeny thereof; sputum; vaginal swabs; oral swabs; bronchoalveolar lavage; and the like. Suitable biological samples also include samples that have been manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as CD4+ T lymphocytes, glial cells, macrophages, tumor cells, peripheral blood mononuclear cells (PBMC), and the like; or enrichment for particular macromolecules, e.g., nucleic acids, genomic DNA, mRNA, etc.

In another embodiment, the sample being tested for the presence or amount of target nucleic acid molecule is a sample taken for public health purposes. Examples of such samples include water, food, and soil, possibly containing harmful pathogens such as bacteria, viruses, protozoa, helminths, and mycoplasma.

In a further embodiment, the sample being tested for the presence or amount of target nucleic acid molecules is a forensic sample. Examples of such samples include bodily fluids, tissues and cells, which can be obtained from any source such as a crime scene.

In some embodiments, nucleic acids containing a target nucleic acid, or nucleic acids to be tested for the presence of a target nucleic acid, are isolated from the cell, organism, or biological sample containing the target nucleic acid. In some embodiments, nucleic acids containing a target nucleic acid, or nucleic acids to be tested for the presence of a target nucleic acid are purified, e.g., the nucleic acids are at least 80%, at least 95%, at least 97%, or at least 99% pure. The subject methods and compositions are useful in a variety of applications, including experimental applications and diagnostic applications. The subject methods are useful for gene expression analysis; analytical polymerase chain reaction assays; transgene quantification; insert screening; viral load determinations; and the like.

In one embodiment, the instant method is used for diagnostic purposes. Specifically, the invention can be used to diagnose a disorder in a subject characterized by the presence of at least one target nucleic acid sequence which is not present when such disorder is absent. Such disorders are well known in the art and include, by way of example, cancer, cystic fibrosis, and various hemoglobinopathies. The invention can also be used to diagnose disorders associated with the presence of infectious agents. Such disorders include, by way of example, acquired immunodeficiency syndrome, Hepatitis C virus infection, and tuberculosis. In an exemplary embodiment, the subject being diagnosed is human and the disorder is cancer.

One type of representative application is in monitoring the progress of nucleic acid amplification reactions, such as polymerase chain reaction applications, including both linear and geometric PCR applications. As used herein, the term monitoring includes a single evaluation at the end of a series of reaction cycles as well as multiple evaluations, e.g., after each reaction cycle, such that the methods can be employed to determine whether a particular amplification reaction series has resulted in the production of primer extension product, e.g., a non-real time evaluation, as well as in a real -time evaluation of the progress of the amplification reaction.

The subject methods find use in both 5' nuclease methods of monitoring a PCR amplification reaction (e.g., where a Taqman type probe is employed); and non-5' nuclease methods of monitoring a PCR amplification reaction (e.g., where a molecular beacon type probe is employed). Again, the subject methods find use in evaluating the progress of an amplification reaction at a single time (e.g., non-real time monitoring) and in real-time monitoring.

Monitoring a PCR reaction according to the subject methods finds use in a variety of specific applications. Representative applications of interest include, but are not limited to: (1) detection of allelic polymorphism; (2) single nucleotide polymorphism (SNP) detection; (3) detection of rare mutations; (4) detection of allelic stage of single cells; (5) detection of single or low copy number DNA analyte molecules in a sample; etc. For example, in detection of allelic polymorphism, a nucleic acid sample to be screened, e.g., a genomic DNA cellular extract, is employed as template (target) nucleic acid in the preparation of a primer extension reaction mixture, as described above, where the reaction mixture includes a different and distinguishable FET-labeled substrates that is specific for each different allelic sequence to be identified, if present. The assay is then carried out as described above, where the sample is screened for a change in signal from each different FET-labeled substrate. A change in signal from a given FET-labeled substrate is indicative of the presence the allelic variant to which that FET-labeled substrate is specific in the sample. Likewise, an absence of change in signal is indicative of the absence of the allelic variant in the sample. In this manner, the sample is readily screened for the presence of one or more allelic variants. A similar approach can be used for SNP detection, where a different FET-labeled substrate for each SNP of interest to be screened in a nucleic acid sample is employed.

MULTIPLEX EMBODIMENTS

This invention also provides a method of simultaneously detecting the presence of a plurality of target nucleic acid sequences in a sample. In these embodiments, the method generally involves contacting the sample with a plurality of sets of nucleozyme detection agents, where for each target being detected, there exists a separate set of detection agents specific for that target nucleic acids, where a given set includes at least: nucleozyme tag and nucleozyme substrate, where in certain embodiments a given set further includes a forward primer, reverse primer. As reviewed above, in these multiplex situations, the number of different types of sets of detection agents that may be employed may range from about 2 to about 20 or higher, such as from about 2 to about 15, from about 2 to about 10, e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10, where any two given sets of detection agents may differ from each other with respect to label and/or linker, such that many different sets can be generated from a minimum number of different labels and linkers.

. In one embodiment, the method of simultaneously detecting the presence of a plurality of targets further comprising the step of quantitatively determining the amount of each catalytic nucleic acid activity in the reaction mixture produced from the sample and sets of detection agents, and comparing the amount of each activity so determined to a known standard, thereby quantitatively determining the amount of each target nucleic acid sequence. In these embodiments, the sample comprises multiple (e.g., at least two) different target nucleic acids. The sample comprises from two different target nucleic acids to 20 or more different target nucleic acids, e.g., two different target nucleic acids, three different target nucleic acids, four different target nucleic acids, five different target nucleic acids, six different target nucleic acids, seven different target nucleic acids, eight different target nucleic acids, nine different target nucleic acids, ten different target nucleic acids, more than ten different target nucleic acids, or more than 20 different target nucleic acids.

Multiple target nucleic acids include, e.g., samples from two or more different mammalian subjects (e.g., two or more different crime suspects; etc.); samples from two or more different plant species of the same genus; samples from two or more different animal species of the same genus; two or more different bacterial species of the same genus; two or more bacterial strains (e.g., two or more bacterial strains of the same species); two or more different archaebacteria of the same genus; and the like. Further examples of multiple targets which can be simultaneously detected by the instant methods are disclosed in, e.g., WO 96/32500.

COMPOSITIONS OF NUCLEOZYME DETECTION AGENTS

Also provided are compositions of nucleozyme detection agents, where the compositions include one or more sets of nucleozyme detection agents, where a given set includes at least a nucleozyme tag and a nucleozyme substrate, and may further include a forward and reverse primer, where these components have been reviewed above.

As such, compositions are provided that include two or more different nucleozyme, e.g., FET-labeled, substrates. A subject set of FET-labeled substrates includes a collection of from about two to about 100, or more, different FET-labeled substrates. For example, a subject set of FET-labeled substrates includes a collection of from about 2 FET-labeled substrates to about 5 FET- labeled substrates, from about 5 FET-labeled substrates to about 10 FET-labeled substrates, from about 10 FET-labeled substrates to about 20 FET-labeled substrates, from about 20 FET-labeled substrates to about 25 FET-labeled substrates, from about 25 FET-labeled substrates to about 50 FET-labeled substrates, from about 50 FET-labeled substrates to about 75 FET-labeled substrates, or from about 75 FET-labeled substrates to about 100 FET-labeled substrates. In some embodiments, a subject set of FET-labeled substrates comprises more than 100 FET-labeled substrates.

Sets of FET-labeled substrates, e.g., sets of two or more, three or more, four or more, five or more, etc., FET-labeled substrates, include two or more FET- labeled substrates, each of which differs from the other in some manner, such as: i) nucleotide sequences of the substrate recognition domains ("recognition nucleotide sequence"); and ii) the FET labels, e.g., in the fluorescence donor and/or the fluorescence quencher.

The recognition nucleotide sequences of the FET-labeled substrates are complementary to recognition nucleotide sequences in the catalytic nucleic acid of the enzymatically active second nucleic acid amplification product. The recognition nucleotide sequences of the FET-labeled substrates are such that they hybridize only to the corresponding recognition nucleotide sequences in the catalytic nucleic acid of the enzymatically active second nucleic acid amplification product, e.g., the enzymatically active amplification product that comprises a nucleotide sequence of the target nucleic acid, and not to recognition nucleotide sequences in catalytic nucleic acids of other second nucleic acid amplification products.

In certain embodiments, the FET-labeled substrates in a set of FET-labeled substrates are distinguishable from one another, because, after being cleaved by the catalytic nucleic acid of the enzymatically active second nucleic acid amplification product, they fluoresce at different wavelengths that are distinguishable one from another. In a subject FET-labeled substrate set, any two FET-labeled substrates fluoresce, after being cleaved, at wavelengths that differ by from about 10 nm to about 400 nm, e.g., from about 10 nm to about 20 nm, from about 20 nm to about 30 nm, from about 30 nm to about 40 nm, from about 40 nm to about 50 nm, from about 50 nm to about 60 nm, from about 60 nm to about 70 nm, from about 70 nm to about 80 nm, from about 80 nm to about 90 nm, from about 90 nm to about 100 nm, from about 100 nm to about 125 nm, from about 125 nm to about 150 nm, from about 150 nm to about 175 nm, from about 175 nm to about 200 nm, from about 200 nm to about 250 nm, from about 250 nm to about 300 nm, from about 300 nm to about 350 nm, or from about 350 nm to about 400 nm. Thus, e.g., in certain embodiments where two different target nucleic acids are being detected, a set of FET-labeled substrates includes: (a) a first FET- labeled substrate comprising a first recognition nucleotide sequence (e.g., a recognition domain R1 and a recognition domain R2, which are complementary to recognition domains R1 and R2, respectively, of a first catalytic nucleic acid); and further comprising a first fluorescence donor and a first fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence (e.g., a recognition domain R3 and a second recognition domain R4, which are complementary to recognition domains R3 and R4, respectively, of a second catalytic nucleic acid); and further including a second fluorescence donor and a second fluorescence acceptor. The recognition nucleotide sequences of the first FET-labeled substrate are such that they do not hybridize to the recognition nucleotide sequences of the second catalytic nucleic acid; and the recognition nucleotide sequences of the second FET-labeled substrate are such that they do not hybridize to the recognition nucleotide sequences of the first catalytic nucleic acid.

As one non-limiting example, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising FAM as a first fluorescence donor and BHQ as the fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and BHQ as a second fluorescence acceptor.

In some embodiments, the fluorescent donor is a FRET pair. For example, in one embodiment, a set of FET-labeled substrates includes: (a) a first FET- labeled substrate comprising a first recognition nucleotide sequence; and further comprising FAM/TAMRA as a first fluorescence donor and BHQ as a first fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and BHQ as a second fluorescence quencher. As another non-limiting example, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising JOE/TAMRA as a first fluorescence donor and BHQ as the fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising TAMRA as a second fluorescence donor and BHQ as a second fluorescence acceptor.

As another non-limiting example, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising TET-TAMRA as a first fluorescence donor and BHQ as the fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and BHQ as a second fluorescence acceptor. As another non-limiting example, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising JOE/ROX as a first fluorescence donor and BHQ as the fluorescence quencher; and (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising TAMRA as a second fluorescence donor and BHQ as a second fluorescence acceptor.

Where three different target nucleic acids are being detected, a set of FET- labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence (e.g., a recognition domain R1 and a recognition domain R2, which are complementary to recognition domains R1 and R2, respectively, of a first catalytic nucleic acid); and further comprising a first fluorescence donor and a first fluorescence quencher; (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence (e.g., a recognition domain R3 and a recognition domain R4, which are complementary to recognition domains R3 and R4, respectively, of a second catalytic nucleic acid); and further comprising a second fluorescence donor and a second fluorescence acceptor; and (c) a third FET-labeled substrate comprising a third recognition nucleotide sequence (e.g., a recognition domain R5 and a recognition domain R6, which are complementary to recognition domains R5 and R6, respectively, of a third catalytic nucleic acid; and further comprising a third fluorescence donor and a third fluorescence acceptor.

As one non-limiting example, where three different target nucleic acids are being detected, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising FAM as a first fluorescence donor and a BHQ as a first fluorescence quencher; (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and a BHQ as a second fluorescence acceptor; and (c) a third FET-labeled substrate comprising a third recognition nucleotide sequence; and further comprising FAIWTAMRA as a third fluorescence donor and a BHQ as a third fluorescence acceptor.

As another non-limiting example, where three different target nucleic acids are being detected, a set of FET-labeled substrates includes: (a) a first FET- labeled substrate comprising a first recognition nucleotide sequence; and further comprising FAM as a first fluorescence donor and a BHQ as a first fluorescence quencher; (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and a BHQ as a second fluorescence acceptor; and (c) a third FET-labeled substrate comprising a third recognition nucleotide sequence; and further comprising JOE/TAMRA as a third fluorescence donor and a BHQ as a third fluorescence acceptor.

As one non-limiting example, where three different target nucleic acids are being detected, a set of FET-labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence; and further comprising FAM as a first fluorescence donor and a BHQ as a first fluorescence quencher; (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence; and further comprising JOE as a second fluorescence donor and a BHQ as a second fluorescence acceptor; and (c) a third FET-labeled substrate comprising a third recognition nucleotide sequence; and further comprising JOE/ROX as a third fluorescence donor and a BHQ as a third fluorescence acceptor.

Where four different target nucleic acids are being detected, a set of FET- labeled substrates includes: (a) a first FET-labeled substrate comprising a first recognition nucleotide sequence (e.g., a recognition domain R1 and a recognition domain R2, which are complementary to recognition domains R1 and R2, respectively, of a first catalytic nucleic acid); and further comprising a first fluorescence donor and a first fluorescence quencher; (b) a second FET-labeled substrate comprising a second recognition nucleotide sequence (e.g., a recognition domain R3 and a recognition domain R4, which are complementary to recognition domains R3 and R4, respectively, of a second catalytic nucleic acid); and further comprising a second fluorescence donor and a second fluorescence acceptor; (c) a third FET-labeled substrate comprising a third recognition nucleotide sequence (e.g., a recognition domain R5 and a recognition domain R6, which are complementary to recognition domains R5 and R6, respectively, of a third catalytic nucleic acid; and further comprising a third fluorescence donor and a third fluorescence acceptor; and (d) a fourth FET-labeled substrate comprising a fourth recognition nucleotide sequence (e.g., a recognition domain R7 and a recognition domain R8, which are complementary to recognition domains R7 and R8, respectively, of a fourth catalytic nucleic acid); and further comprising a fourth fluorescence donor and a fourth fluorescence quencher.

Other fluorescence donor/acceptor pairs are well known in the art; and any known fluorescence donor/acceptor pairs can be used. Non-limiting examples of suitable fluorescence donor/acceptor pairs are shown in Table 2.

Table 2

In Table 2, HEX is (carboxy-2¹, 4, 4', 5', 7, 7', hexachlorofluorescein); and Eclipse™ and ElleQuencher™ are dark quenchers.

The present invention provides compositions comprising a subject FET- labeled substrate set, where the compositions comprise a subject FET-labeled set and a second component. Suitable second components include one or more of a buffer, a nuclease inhibitor, a salt, etc. In some embodiments, a FET-labeled substrate set is provided as a liquid solution. In other embodiments, a FET-labeled substrate set is lyophilized. The present invention further provides sets of nucleozyme tags (e.g., nucleic acids that include both a nucleozyme template (i.e., zymogene) and a linker), which are used in conjunction with a set of substrates, e.g., FET-labeled substrates, with corresponding recognition nucleotide sequences. A subject set of tags includes two or more tags, such that for each target being detected, there exists at least one tag which encodes, but which itself is the anti-sense sequence of, a catalytic nucleic acid sequence having distinctly measurable activity, where each tag comprises a different linker, as described above.

A subject representative set of tags includes at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten different tags, each with a different recognition nucleotide sequence that is substantially identical to a recognition nucleotide sequence in a corresponding FET-labeled substrate.

Thus, e.g., a subject set of tags includes: (a) a first nucleic acid comprising a first recognition sequence that is the same as a recognition sequence in a first FET-labeled substrate (e.g., a recognition domain R1 and a recognition domain R2, which are substantially identical to recognition domains R1 and R2, respectively, of a first FET-labeled substrate); and further comprising a linker; and (b) a second nucleic acid comprising a second recognition sequence that is the same as a recognition sequence in a second FET-labeled substrate (e.g., a recognition domain R3 and a recognition domain R4, which are substantially identical to recognition domains R3 and R4, respectively, of a second FET-labeled substrate); and further comprising a linker.

In some embodiments, a subject set of tags includes: (a) a first nucleic acid comprising a first recognition sequence that is the same as a recognition sequence in a first FET-labeled substrate (e.g., a recognition domain R1 and a recognition domain R2, which are substantially identical to recognition domains R1 and R2, respectively, of a first FET-labeled substrate); and further comprising a first linker; (b) a second nucleic acid comprising a second recognition sequence that is the same as a recognition sequence in a second FET-labeled substrate (e.g., a recognition domain R3 and a recognition domain R4, which are substantially identical to recognition domains R3 and R4, respectively, of a second FET-labeled substrate); and further comprising a second linker; and (c) a third nucleic acid comprising a third recognition sequence that is the same as a recognition sequence in a third FET-labeled substrate (e.g., a recognition domain R5 and a recognition domain R6, which are substantially identical to recognition domains R5 and R6, respectively, of a third FET-labeled substrate); and further comprising a third linker.

KITS Additional aspects of the invention include kits, e.g., for use in practicing methods of the invention, such as determining the presence of one or more target nucleic acids in a sample. In representative embodiments, the kits include one or more nucleozyme detection agents, such as nucleozyme tags, nucleozyme substrates, forward and reverse primers, as well as other components (as desired) where in certain embodiments the kits include one or more different sets of detection agents, as described above.

Also present may be additional components or reagents that find use in practicing the subject methods. Reagents permitting primer-initiated nucleic acid amplification and catalytic nucleic acid activity include one or more of the following: a) a set of dNTPs; b) magnesium ions, e.g., MgCI₂; c) a DNA polymerase, as described above; etc.

In one embodiment, the instant kit further comprises reagents useful for isolating a sample of nucleic acid molecules from a subject or sample. The components in the instant kit can either be obtained commercially or made, as desired. In addition, the components of the instant kit can be in solution or lyophilized as appropriate. In one embodiment, the components are in the same compartment, and in another embodiment, the components are in separate compartments. In many embodiments, the kit further comprises instructions for use.

In the instant methods and kits, the nucleic acid amplification can be performed according to any suitable method known in the art, and preferably according to one selected from the group consisting of PCR, SDA and TMA. The various reagent components of the kits may be present in separate containers, or may all be precombined into a reagent mixture for combination with template (e.g., target) DNA. For example, the kit may include a set of substrates and a corresponding set of tags, where these two components may be present separately or combined into a single composition for use.

In addition to the above components, the subject kits further include (in certain embodiments) instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another form of these instructions is a computer readable medium, e.g., diskette, compact disk (CD), etc., on which the information has been recorded. Yet another form of these instructions that may be present is a website address which may be used via the internet to access the information at a removed site.

SYSTEMS

Also provided are systems for use in practicing the subject methods. The subject systems at least one full set of nucleozyme detection agents (i.e., tag, substrate, forward primer and reverse primer), as well as any other requisite components for practicing the subject methods, as described above. In addition, the subject systems may include any required devices for practicing the subject methods, e.g., thermal cyclers, fluorimeters, etc. EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); nt, nucleotide(s) and the like.

I. Materials and Methods.

A. Primer design.

To ensure specificity of the designed PCR assays, the primers were selected in the unique sequence region of the target mRNA that was identified by BLAST search of the target mRNA sequence against the human RefSeq collection, NCBI, release 11, May 2005(Fig.3A). Both forward (3') and reverse (5') primers were initially designed to have a Tm of 55 - 6O⁰C calculated according to (Wetmur, Critical Rev. Biochem. MoI. Biol. 1991 , 26:227-259) using Na⁺ concentration of 0.1 M. The sequences of the gene-specific parts of the forward primers, reverse primers, the mRNA target gene names and accession numbers, primer IDs and Tm values are summarized in Table 3. Each pair of primers was selected from several designs based on the performance in the 1-plex and 3-plex assay. The primer design was performed using the proprietary software tools developed in Clontech Bioinformatics group. Table 3. Primers and target mRNAs.

All the primer sequences satisfying specificity requirements were checked for the presence of all four nucleotides and absence of low complexity sequences, i.e., long stretches of the same nucleotide or alternating pairs of nucleotides. In order to avoid primer-dimers, which presents the most challenging problem in design of multiplex assays, the primer pairs were screened for the occurrence of a sequence match that may potentially lead to formation of a duplex between forward and reverse primers (Fig.3B). Presence of the linker sequence in the forward primer requires an additional screening of the reverse primer sequences in order to avoid primer-dimers between the linker and the R-primer. Therefore, in the 3-plex design all 3 primer pairs were checked against all 10 available linkers and the linkers with the less probability of primer-dimers were selected.

In addition, self-dimers and hairpins were also eliminated at this stage. Due to the experimental design of the QZyme PCR, the only dimers that have to be considered are the ones formed by the F and R primers. The F-F dimers and R- R dinners can not be amplified in PCR because the resulting amplicon will have a homologous sequence at the ends and form a hairpin preventing further amplification.

According to the three-primer design, the connection between the universal Q-tag primer and the amplicon is established by the linker sequence which is included in the 5'-end part of the forward primer and at the 3'-end of the universal Q-tag primer. The linker sequences were thoroughly selected and tested in multiple experiments. The candidate sequences were selected from the collection of computer-generated random 20-mer sequences by applying a set of conditional filters, which included low complexity filter, overall and 3'-end homology to the human genome and to the human RNA, balanced GC content, and finally absence of any homology with the other linkers. Sequences that passed the filters were tested in 1-plex and then in 3-plex assays to ensure the best performance and absence of any unfavorable interactions with the other components of the reaction mix. Sequences of ten selected linkers along with the recommended partners for multiplex PCR design are summarized in the Table 1. Depending on the particular choice of primer sequences and QZyme tags for a multiplex assay, other combinations of linkers not presented in the Table 2 also can be considered.

Table 1. Linkers.

B. PCR buffer and reaction mix.

The QZyme PCR reporter system (Clontech) is based on the ribonuclease activity of deoxyribozyme molecules described earlier (Santoro SW₁. Joyce GF: A general purpose RNA-cleaving DNA enzyme. Proc. Natl. Acad. Sci. USA 1997, 94:4262-4266) and optimized for using in PCR detection (Impey HL, Applegate TL, Haughton MA, Fuery CJ, King JE, Todd AV: Factors That Influence Deoxyribozyme Cleavage during Polymerase Chain Reaction. Anal. Biochem. 2000, 286:300-303). Details of QZyme technology and its implementation for multiplex real-time PCR can be found at the website having a URL produced by place "http://www." before

"clontech. com/clontech/archive/JAN05UPD/tech_notes_qzyme.shtml." Three QZyme fluorescent probes and three corresponding Q-tags were used here for PCR assays: B-FAM with B-tag, D-JOE with D-tag and K-ROX with K-tag. Thus, in combination with ten linkers each primer pair has 30 options for signal detection to choose from. All the assays here were optimized for the best performing combination of probes and primers by computational analysis of sequences with further experimental optimization.

The oligonucleotide synthesis was ordered from Integrated DNA Technologies Inc. All the primers including 40-mers forward-linker and 55-mers Q- tag-linker were synthesized in 100 nm scale followed by standard desalting.

The PCR template was a product of reverse transcription of the 250 ng of human liver total mRNA (Clontech) using 10 μmol of random 9-mer oligonucleotide mix as a primer. The standard PCR reaction mix is a volume of 25 μl contained 200 nmol of QZyme substrate and QTaq DNA polymerase with Hot Start antibodies in QTaq PCR ROX-free buffer (Clontech). The standard amount of primers for the two-primer PCR was 40 nmol of forward and 200 nmol of reverse and for the three-primer reactions the amount of forward primer and Q-tag-Linker varied from 10 nmol to 80 nmol while the reverse primer was always at 200 nmol. In each experiment a set of six serial 5-fold dilutions of the template and two no- template controls was prepared. Thus, the serial dilutions start at approximately 250 ng of total RNA and end at the 250/5⁵ = 80 pg. C. PCR data acquisition and processing.

The quantitative real-time PCR was performed using Stratagene Mx3000P with the initial incubation at 95°C for 3 minutes, followed by 45 bi-phasic cycles of 15 seconds at 95°C and 1 minute at 56 °C. The fluorescence detection was performed using dyes FAM, JOE and ROX. The results were confirmed on the ABI 7700 and ABI 7900 at the same experimental conditions with the fluorescent dyes FAM, JOE and FAM-TAM (ABI 7700) or FAM, JOE and TET (ABI 7900). Fluorescent intensities measured in each cycle of PCR amplification were corrected for the background and plotted using standard Stratagene Mx3000P software. The Ct values (PCR cycle at the manually selected threshold level) were estimated from the logarithmic amplification plots after baseline correction at the threshold of 1000 fluorescent units. Overall PCR efficiencies were calculated from the slopes of the standard curves Ct/Logio(conc.) according to the equation E = 10^"

1 /slope Λ

II. Results

The main challenge in designing the multiplex PCR assay is to ensure that the individual reactions running in the same test tube are not interfering with each other. Among the factors responsible for the interference between the multiplexed reactions, the most common is the interaction of primer sequences with each other and with the amplicons produced in the parallel reactions. These interactions result in the loss of PCR efficiency and high variability of Ct values.

Fig.4 shows the typical magnitude of distortions of the PCR amplification plot for the 3-plex assay. In this particular case, the 3-plex shows average Ct shift of 0.3 cycle at the threshold level, where the amplification is thought to be exponential. The difference is not significant comparing to the QZyme PCR reproducibility of ±0.5 cycles between repetitive runs. However, in the multiple experiments with the different targets the Ct values of the 3-plex are always slightly higher then the corresponding 1-plex. That observation becomes even more pronounced in the case of multiplexing of a highly abundant target with a low abundant one. As expected, the amplification plot of the abundant target does not change much, but the low abundant reaction often changes significantly when multiplexed. The 3-plex PCR assay represented in Fig.4 has been made by combining three 1-plex assays without any further optimization, yet each 1-plex assay has been optimized for PCR performance. All three target mRNAs in the 3-plex are of an average abundance with the Ct values around 23 - 24 cycles. The primer pair EH63-F1 B/R9 showed the PCR efficiency in 1-plex assay lower then 90%, while the other two had efficiencies over 95%. In the 3-plex assay the primer pair with the lowest PCR efficiency seems to become the most affected by the other components: the amplification plots show distortions especially in the upper part, where the most differences with the 1-plex had been observed. However, the Ct values of the 1-plex and 3-plex assays are pretty close for all three reactions.

The same assay designed using the universal tag QZyme system (Fig.5) demonstrates the enhanced PCR efficiency of the all three 1-plex reactions. As a result, all negative NTC in 1-plex and 3-plex were achieved using lower concentration of primers in the reactions. Besides, the overlay of amplification plots shows a close match for EH64 and EH60 indicating that there is no interference between the multiplexed reactions.

The optimal ratio of the Q-tag/F/R primers has been found experimentally by comparing the PCR efficiencies and Ct values of the 1-plex assays at different concentrations of the primers. For all tested linkers the ratio of 40/60/200 nmol produced the best results.

Fig.6 demonstrates a direct comparison of the two-primer QZyme assay versus the universal tag QZyme assay. In the case of the EH63 target, the universal QZyme tag design gives better PCR efficiency, while for the EH64 the opposite had been observed. In conclusion, with the method described here, the QZyme tag can be used as a universal PCR reporter, which performs well in multiplex reactions and requires little change in the primer design process. For the purpose of optimizing the multiplex PCR assay, the assignment of the fluorescent dyes to the target reactions can be easily changed without synthesis of new gene-specific primer. The universal QZyme tag PCR design provides a way to multiplex more reactions then the number of fluorescent dyes available for detection. For example, multiplex assays of six primer pairs can be quantified in two wells by using three dyes and six different linkers: the dye1-linker1 , dye2-linker2 and dye3-linker3 in the first well and the dye1-linker4, dye2-linker5 and dye3-linker6 in the second well. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method for determining whether a target nucleic acid is present in a sample, the method comprising:

(a) contacting the sample with:

(i) a forward primer comprising a primer domain complementary to a region of said target nucleic acid and a linker domain; (ii) a reverse primer; (iii) a nucleozyme tag comprising a nucleozyme template domain and said linker domain; and

(iv) a nucleozyme substrate that produces a detectable signal upon cleavage by a nucleozyme having a sequence complementary to said nucleozyme template domain; to produce a reaction mixture; and

(b) detecting said signal from said reaction mixture to determine whether said target nucleic acid is present in the sample.

2. The method according to Claim 1 , wherein said nucleozyme substrate is labeled with a FET label.

3. The method according to Claim 1 , wherein said linker domain of said forward primer and said nucleozyme tag ranges in length from about 5 to about 25 nt.

4. The method according to Claim 1 , wherein said linker domain is 5¹ of said primer domain in said forward primer.

5. The method according to Claim 1 , wherein said nucleozyme template domain is 5¹ of said linker domain in said nucleozyme tag.

6. The method according to Claim 1 , wherein said method comprises temperature cycling said reaction mixture while signal is being detected from said reaction mixture.

7. The method according to Claim 6, wherein said method is a method of monitoring the production of said target nucleic acid over time.

8. The method according to Claim 1 , wherein said method is a method of quantitatively determining the amount of said target nucleic acid in said sample.

9. A method for determining whether a sample contains a plurality of distinct target nucleic acids, the method comprising: (a) contacting the sample with a set of nucleozyme detection agents for each of said distinct target nucleic acids, wherein each of set of said nucleozyme detection agents comprises:

(i) a forward primer comprising a primer domain complementary to a region of said target nucleic acid and a linker domain; (ii) a reverse primer;

(iii) a nucleozyme tag comprising a nucleozyme template domain and said linker domain; and

(iv) a FET labeled nucleozyme substrate that produces a unique detectable signal upon cleavage by a nucleozyme having a sequence complementary to said nucleozyme template domain; to produce a reaction mixture; and

(b) detecting signals produced by said nucleozyme substrates from said reaction mixture to determine whether said sample contains said plurality of distinct target nucleic acids.

10. The method according to claim 9, wherein said plurality, comprises at least two different target nucleic acids.

11. The method according to claim 10, wherein said plurality comprises at least 3 different target nucleic acids.

12. The method according to claim 9, wherein at least one of said FET labeled substrates comprises a dark quencher.

13. The method according to claim 9, wherein all of said FET labeled substrates comprise a dark quencher.

14. The method according to Claim 9, wherein said linker domain of said forward primers and said nucleozyme tag ranges in length from about 5 to about 25 nt.

15. The method according to Claim 9, wherein said linker domain is 5' of said primer domain in said forward primers.

16. The method according to Claim 9, wherein said nucleozyme template domain is 5' of said linker domain in said nucleozyme tags.

17. The method according to Claim 9, wherein said method comprises temperature cycling said reaction mixture while signal is being detected from said reaction mixture.

18. The method according to Claim 17, wherein said method is a method of monitoring the production of said target nucleic acids over time.

19. The method according to Claim 9, wherein said method is a method of quantitatively determining the amount of said target nucleic acids in said sample.

20. The method of claim 9, wherein the target nucleic acids are DNA molecules.

21. A composition comprising a set of nucleozyme detection agents, wherein said set includes:

(i) a nucleozyme tag comprising a nucleozyme template domain and a linker domain;

(ii) a nucleozyme substrate that produces a detectable signal upon cleavage by a nucleozyme having a sequence complementary to said nucleozyme template domain; (iii) a forward primer comprising a primer domain complementary to a region of said target nucleic acid and said linker domain; and (iv) a reverse primer.

22. The composition according to Claim 21 , wherein said composition further comprises a sample.

23. The composition according to Claim 21 , wherein said composition comprises a plurality of said sets, wherein each set of said plurality is specific for a different target nucleic acid.

24. A kit for use in determining the presence of a target nucleic acid in a sample, said kit comprising: a set of nucleozyme detection agents comprising: (i) a nucleozyme tag comprising a nucleozyme template domain and a linker domain; and

(ii) a nucleozyme substrate that produces a detectable signal upon cleavage by a nucleozyme having a sequence complementary to said nucleozyme template domain.

25. The kit according to Claim 24, wherein said kit comprises a plurality of said sets, wherein each set of said plurality is specific for a different target nucleic acid.