WO2007051898A1 - Alternative oxidase and uses thereof - Google Patents

Alternative oxidase and uses thereof Download PDF

Info

Publication number
WO2007051898A1
WO2007051898A1 PCT/FI2006/000348 FI2006000348W WO2007051898A1 WO 2007051898 A1 WO2007051898 A1 WO 2007051898A1 FI 2006000348 W FI2006000348 W FI 2006000348W WO 2007051898 A1 WO2007051898 A1 WO 2007051898A1
Authority
WO
WIPO (PCT)
Prior art keywords
aox
cell
polypeptide
mitochondrial
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FI2006/000348
Other languages
English (en)
French (fr)
Inventor
Pierre Jean Frédéric RUSTIN
Howard T. Jacobs
Emmanuel Philippe Dassa
Gerrit A. J. Hakkaart
Daniel Jose Moreno Fernandez-Ayala
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Licentia Oy
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Licentia Oy
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Licentia Oy, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Licentia Oy
Priority to JP2008538372A priority Critical patent/JP2009513153A/ja
Priority to EP06807975.5A priority patent/EP1965829B1/en
Publication of WO2007051898A1 publication Critical patent/WO2007051898A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/60New or modified breeds of invertebrates
    • A01K67/61Genetically modified invertebrates, e.g. transgenic or polyploid
    • A01K67/65Genetically modified arthropods
    • A01K67/68Genetically modified insects
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/06Free radical scavengers or antioxidants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/03013Alcohol oxidase (1.1.3.13)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/20Animal model comprising regulated expression system
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/70Invertebrates
    • A01K2227/706Insects, e.g. Drosophila melanogaster, medfly
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the invention relates to a cDNA encoding a cyanide-insensitive alternative oxidase (AOX); constructs and compositions comprising the cDNA; and to a method for limiting the deleterious consequences of respiratory chain deficiency by means of allotopic expression of said AOX in mitochondria in mammalian or human cells or in a whole organism.
  • AOX cyanide-insensitive alternative oxidase
  • AOX is considered to act as an antioxidant protein by preventing overreduction of the mitochondrial quinone pool, which is known to favour superoxide production (Lam et al., Nature, 411:848-853, 2001; Maxwell et al., Proc. Natl. Acad. Sci. USA, 96:8271-8276, 1999).
  • any significant involvement of the AOX protein in electron flow is triggered only by very peculiar conditions. First, it requires a pronounced reduction of the quinone pool due to the low affinity of the AOX for its quinol substrate (Bahr and Bonner, J. Biol.
  • AOX expression should be tolerated by the whole organism without dramatic and harmful physiological effects.
  • the feasibility of said AOX expression was demonstrated in a whole organism animal model. The test was carried out using the fruit fly Drosophila melanogaster as a model system. In the present invention it was demonstrated that AOX expression was tolerated throughout Drosophila development, having no significant deleterious effects on phenotype, and afforded the same protection against respiratory chain dysfunction as in cultured human cells.
  • AOX expression In order to explore the potential of the AOX expression as a gene therapy tool in humans and other mammals, a versatile expression system, which allows AOX to be stably expressed at typical levels for a mammalian gene, over long periods, was developed. It was demonstrated that AOX expression is maintained for weeks following lentivector- based transduction of human HEK293 -derived cells, without any apparent deleterious effects on cell growth. Lentivector AOX-expressing cells were shown to exhibit cyanide- insensitive respiration, which is sensitive to propyl gallate. Lentivector transduced AOX is thus suitable as a tool for creating a by-pass of the respiratory chain in diverse mammalian models of metabolic disease.
  • the polynucleotide or cDNA sequence used in the present invention is preferably the DNA sequence shown in SEQ ID NO:1. It may also be a fragment, a homologue or an analogue of the DNA sequence shown in SEQ ID NO:1, allowing minor additions, substitutions and deletions of the nucleotide sequence in a way which is not detrimental for the functioning of the polypeptide encoded by the DNA sequence, i.e. for the folding or activity of the polypeptide.
  • the homologue is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second.
  • the comparison of the nucleotide sequence is performed by using the algorithms known in the art, for example the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof.
  • the cDNA sequences of the present invention are the DNA sequences exhibiting a degree of identity of at least 50%, at least 60%, at least 70%, at least 75 %, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, atjeast 94%, least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the coding region of the DNA sequence shown in SEQ ID NO: 1.
  • the present invention is accordingly related to a cDNA sequence, wherein the cDNA sequence encodes a cyanide-insensitive alternative oxidase (AOX) having the amino acid sequence SEQ ID NO:2 or an analogue or a homologue thereof having an amino acid sequence identity of at least 50%, at least 60%, at least 70%, at least 75 % at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the amino acid sequence SEQ ID NO:2 over blocks of at least 135 amino acids.
  • AOX cyanide-insensitive alternative oxidase
  • the region of the at least 135 amino acids in Ciona intestinalis AOX is within the region of amino acids from 140 to 365 in the amino acid sequence SEQ ID NO: 2, the amino acid sequence conserved in different plant, fungal or lower metazoan organisms.
  • the comparison of the amino acid sequences can be performed using standard BLAST algorithms, such as the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof.
  • the cDNA is not limited to SEQ ID NO:1, but may include minor variations, including minor amino acid substitutions, deletions and additions, which are not detrimental for the functioning of the cDNA sequence. Any sequence encoding the same polypeptide (because of genetic code redundancy), any sequence encoding a variant polypeptide with the same biochemical activities (e.g. one having amino acid replacements which do not affect the main function of the enzyme), and also any related AOX sequence from another organism that would encode a polypeptide with the same effects which are predictable on the basis of the present invention. Especially, the 5'- or 3'- terminal end of the sequence may be tagged with flag or myc encoding sequences, as disclosed in SEQ ID NO:3 and SEQ ID NO:5. Other possible sequences include a nucleotide sequence encoding Green fluorescent protein (GFP) fused to the DNA sequence of SEQ ID NO : 1.
  • GFP Green fluorescent protein
  • the substitution is conservative, i.e. an amino acid is replaced by one of similar size and with similar charge properties.
  • conservative substitution denotes the replacement of an amino acid residue by another, biologically similar residue.
  • conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine for another, or the substitution of one polar or charged residue for another residue with similary polarity or charge, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like.
  • Neutral hydrophilic amino acids that can be substituted for one another include asparagine, glutamine, serine and threonine.
  • the term "conservative substitution” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid.
  • conservative amino acids can be grouped as described in Lehninger, ⁇ Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY, pp. 71-77, 1975) as set out in the following:
  • the invention also relates to a cDNA sequence, which encodes a cyanide-insensitive alternative oxidase (AOX) having the amino acid sequence SEQ ID NO:2, a fragment or an analogue or a homologue thereof and hybridizes with SEQ ID NO: I 5 wherein the hybridization conditions are, for example those as described in Sambrook et al. 1989 (Analysis and cloning of eukaryotic genomic DNA. In: Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York, 2 nd ed. 5 pp 9.52-9.55, 1989; Synthetic oligonucleotide probes. In: Molecular cloning, a laboratory manual.
  • AOX cyanide-insensitive alternative oxidase
  • hybridization conditions for a short oligonucleotide probe are different from those for a DNA sequence comprising more than 100-200 nucleotides. Whereas hybrids formed between longer DNA molecules are essentially stable under the conditions used for posthybridization washings, hybrids involving short oligonucleotides are not. Posthybridization washing of such hybrids must therefore be carried out rapidly so that the probe does not dissociate from its target sequence.
  • Useful hybridization and washing conditions for oligonucleotide probes are presented on pages 11.45-11.46 and 11.55-11.57 of Sambrook et al. 1989 (Synthetic oligonucleotide probes. In: Molecular cloning, a laboratory manual. 2 n ed. Cold Spring Harbor Laboratory Press, New York, 1989).
  • the cDNA sequence of the present invention encodes an AOX, which when inserted into a human or metazoan cell is allotopically expressed and renders a mitochondrial substrate oxidation cyanide-insensitive, decreases metabolic acidosis, alleviates oxidative stress, provides by-passing of a cytochrome segment of the mitochondrial respiratory chain, and is capable of reducing susceptibility to cellular damage leading to apoptosis or cell death.
  • the cDNA sequence is obtainable from various organisms, including plants, fungi and invertebrates.
  • the cDNA sequence is obtained from an ascidian, more preferably from the urochordate Ciona intestinalis.
  • the present invention also provides recombinant DNA constructs, which comprise the cDNA described above.
  • the DNA constructs comprise the cDNA encoding the cyanide in-sensitive AOX, functionally coupled to suitable regulatory sequences, including signal sequences, enhancers, promoters and termination sequences.
  • the recombinant DNA construct is inserted into a suitable expression vector, such as plasmid or virus vectors inducing expression in human cell lines, e.g. the pcDNA5/FRT/TO or pWPI vectors, or in whole animals, e.g. expression vectors of the ⁇
  • said vector is a lentivirus vector.
  • the vector carrying the DNA construct comprising the cDNA encoding AOX is used to transform or transfect a suitable cell, which can be mammalian cell, e.g. a human cell or a cell from a rodent, e.g. rat , mice, hamster, etc, but also other animal cells can be used.
  • a suitable human cell is that obtained from a Flp-InTM T-RExTM-293 (Invitrogen) cell-line or from a HEK 293-derived cell-line.
  • the present invention is also related to a cyanide-insensitive alternative oxidase (AOX) polypeptide, which has the amino acid sequence SEQ ID NO:2, a fragment, an analogue or a homologue thereof.
  • the homologue should preferably have a sequence identity of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the amino acid sequence SEQ ID NO:2 over blocks of at least 135 amino acids.
  • the region of the at least 135 amino acids in Ciona intestinalis AOX is within the region of amino acids from 140 to 365 in the amino acid sequence SEQ ID NO: 2, the amino acid sequence conserved in different plant, fungal or lower metazoan organisms.
  • the comparison of the amino acid sequences can be performed using standard BLAST algorithms, such as the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof.
  • a polypeptide useful in the present invention comprises an amino acid sequence obtainable from different organisms, such as plants, fungi and lower metazoan phyla, including the Ciona intestinalis AOX sequence, any sequence encoding a variant polypeptide with the same biochemical activities (e.g. one having amino acid replacements which do not affect the main function of the enzyme), and also any related
  • the C-terminal or N-terminal end of the amino acid sequence may be tagged with flag or myc sequences, as disclosed in SEQ ID NO:4 and SEQ ID NO:6.
  • flag or myc sequences as disclosed in SEQ ID NO:4 and SEQ ID NO:6.
  • other tags g
  • Green fluorescent protein may also be fused to the amino acid sequence of SEQ ID NO:2.
  • the allotopically expressed AOX renders mitochondrial substrate oxidation cyanide-insensitive, decreases metabolic acidosis, alleviates oxidative stress, provides by-passing of a cytochrome segment of the mitochondrial respiratory chain and reduces susceptibility to cellular damage, including apoptosis or cell death.
  • the cyanide-insensitive AOX polypeptide of the present invention is obtainable from various organisms, including plants, fungi and lower metazoans.
  • the cDNA sequence is obtained from an ascidian, more preferably from the urochordate Ciona intestinalis,
  • the present invention also relates to a method, wherein by introducing the cDNA encoding AOX followed by allotopic expression of AOX in a human or metazoan cell it is possible to limit a lot of deleterious consequences of respiratory chain deficiencies, such as rendering a mitochondrial substrate oxidation cyanide-insensitive, decreasing metabolic acidosis, alleviating oxidative stress, blocking or by-passing, preferably facultatively by-passing a cytochrome segment of the mitochondrial respiratory chain, reducing susceptibility to apoptosis or cell death.
  • respiratory chain deficiencies such as rendering a mitochondrial substrate oxidation cyanide-insensitive, decreasing metabolic acidosis, alleviating oxidative stress, blocking or by-passing, preferably facultatively by-passing a cytochrome segment of the mitochondrial respiratory chain, reducing susceptibility to apoptosis or cell death.
  • the present invention is also related to a method for treating pathogenesis or defects in the mitochondrial respiratory chain or the oxidative phosphorylation system wherein the method comprises introducing the cDNA encoding the AOX of the present invention and allowing allotopic expression of AOX in a human or metazoan cell.
  • the present invention also provides a method for retarding ageing processes in humans, by introducing the cDNA of the present invention and allowing allotopic expression of AOX in a human or metazoan cell.
  • the present invention provides a method for treating ageing-associated diseases by introducing the cDNA of the present invention and allowing allotopic expression of AOX in a human or metazoan cell.
  • the present invention is related to the medical use of the cDNA sequence of the present invention for rendering mitochondrial substrate oxidation cyanide-insensitive, decreasing metabolic acidosis, for alleviating oxidative stress, retarding ageing processes in a human cell, reducing susceptibility to apoptosis in a human cell.
  • cDNA sequence of present invention for manufacturing a medicine for treating a disease affecting the mitochondrial respiratory chain or oxidative phosphorylation system. This is achieved by introducing the cDNA into a cell and allowing allotopic expression of said cDNA in a human or metazoan cell.
  • Some aspects of the present invention relate to the effects of allotopic expression of an alternative oxidase (AOX) (such as AOX from the marine invertebrate Ciona intestinalis) in vertebrate (especially human) cells or organisms to help protect against the major deleterious consequences of mitochondrial OXPHOS dysfunction.
  • AOX alternative oxidase
  • Polypeptide and polynucleotide materials and methods for the amelioration of disorders associated with mitochondrial OXPHOS dysfuction are among the preferred embodiments of the invention.
  • One aspect of the invention includes isolated and/or purified polypeptides that have alternative oxidase activity.
  • the isolated and/or purified polypeptide having alternative oxidase activity comprises an amino acid sequence at least 75% identical to the amino acid sequence set forth in SEQ ID NO: 2 or fragments thereof that have alternative oxidase activity.
  • An exemplary fragment is a fragment lacking an amino-terminal mitochondrial transit peptide and optionally lacking other sequences not involved in AOX activity.
  • the isolated and/or purified polypeptide comprises an amino acid sequence with still greater similarity, e.g., at least 75%, at least 80%, at least 85% or at least 95%, at least 96%, at least 97%, at least 98% or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 fragments thereof that have alternative oxidase activity.
  • alternative oxidase activity refers to the catalysis of the oxidation of ubiquinol which occurs under some conditions in mitochondria by diverting electrons from the standard electron transfer chain, transferring them from ubiquinol to oxygen and generating water and heat as products (along with oxidized ubiquinol).
  • the polypeptide is derived from an organism from a phylum selected from the groups consisting of Mollusca, Nematoda and Chordata for all of which there is evidence of the existence of AOX genes. It is expected that AOX also exists in numerous other animal phyla.
  • the polypeptide is derived from an organism from subphylum Urochordata; or from an organism from order Enterogona; or from an organism from family Cionidae. Wild type sequences from organisms are highly preferred and are isolated using known techniques.
  • the polypeptide is derived from Ciona intestinalis and comprises the amino acid sequence set forth in SEQ ID NO: 2.
  • Polynucleotides that comprise nucleotide sequences that encode all or a portion of a polypeptide of the invention are an additional aspect of the invention. In some embodiments wild type sequences are used. In other embodiments, sequence variation is contemplated, as indicated above for amino acid sequences.
  • Vectors including expression vectors for in vitro production and gene therapy vectors for in vivo production/expression of polypeptides are also an aspect of the invention.
  • the invention includes isolated or purified polynucleotides comprising a nucleotide sequence that encodes a polypeptide that has alternative oxidase activity as discussed above and described in further detail in the description below.
  • the isolated or purified polynucleotide comprises a nucleotide sequence at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 1.
  • the invention provides a polynucleotide that comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal or protist origin.
  • the use of an animal transit peptide is contemplated as a tool for improving targeting of non-animal AOX proteins to animal mitochondria.
  • the mitochondrial transit peptide is of vertebrate, mammalian or human origin and the polypeptide with alternative oxidase activity is a mature alternative oxidase of plant or fungal origin.
  • the mitochondrial transit peptide is of vertebrate origin and the polypeptide with alternative oxidase activity is of invertebrate origin.
  • polypeptide with alternative oxidase activity is from a chordate species of invertebrate and the mitochondrial transit peptide is of mammalian origin.
  • a polynucleotide of the invention further comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell.
  • the promoter sequence is of mammalian origin.
  • the promoter sequence is a promoter of a nuclear gene that encodes a mitochondrial protein.
  • the invention also includes an expression vector comprising a polynucleotide of the invention.
  • the polynucleotide is operably linked to an expression control sequence.
  • the expression vector may be any vector used for the expression of a nucleic acid and may for example, be selected from the group consisting of adenoviral vectors, adeno-associated viral vectors, and lentivirus vectors. For many applications, replication- deficient forms of such vectors are preferred.
  • polynucleotides and vectors of the invention may be formulated as compositions in which the polynucleotides or the vector is presented in a pharmaceutically acceptable carrier, excipient or diluent and are therefore useful for manufacturing medical compositions, which are applicable for both ex vivo and in vivo gene therapy by introducing AOX activity to cells that otherwise lack it.
  • Another aspect of the invention includes host cells that have been transformed or transfected with a polynucleotide or vector of the invention.
  • the cells are any prokaryotic or eukaryotic cell that can be modified, e.g., through transformation or transfection, to express the polypeptide of the invention.
  • the cells are suitable for ex vivo transfection or transformation and thereby provide a method for manufacturing a medical composition, which subsequently may be reinplantated into a host organism.
  • the invention provides a vertebrate cell transformed or transfected with a polynucleotide that encodes a polypeptide with alternative oxidase activity, wherein the cell expresses the polypeptide and exhibits one or more of increased resistance to antiniycin A, cyanide (CN " ) or oligomycin compared to a wild type cell.
  • CN cyanide
  • the invention provides a vertebrate cell transformed or transfected with a polynucleotide that encodes a polypeptide with alternative oxidase activity, wherein the transformed or transfected cell expresses a polypeptide that exhibits oxidative phosphorylation to produce ATP through the cytochrome metabolic pathway and wherein, in the presence of an inhibitor of said oxidative phosphorylation, the cell oxidizes ubiquinol through the alternative oxidase pathway.
  • the alternative oxidase activity is allosterically regulated by pyruvate to inhibit metabolic acidosis under conditions favoring metabolic acidosis.
  • isolated or purified cells transformed or transfected with a polynucleotide or vector of the invention.
  • the isolated cell is a stem cell including an embryonic stem cell, an adult stem cell or a neural stem cell. Cells with totipotency or pluripotency or even multipotency are among the preferred cell types for ex vivo gene therapy aspects of the invention.
  • aspects of the invention are directed to methods for manufacturing medicines for the treatment of disorders associated with mitochondrial OXPHOS dysfuction using polypeptides, polynucleotides or vectors of the invention or a cell transformed or transfected with such a polynucleotide or such a vector
  • a method is provided for decreasing metabolic acidosis or palliating oxidative stress in a mammalian cell by contacting the cell with a composition comprising a polypeptide of the invention.
  • the methods comprise transforming or transfecting the cell with a polynucleotide or vector of the invention.
  • compositions which comprises a polypeptide of the invention in an amount effective to reduce metabolic acidosis in cells, and which composition when administered to a mammalian subject in need of treatment decreases metabolic acidosis in said mammalian subject.
  • the method comprises manufacturing a medical composition comprising a polynucleotide, vector or a cell transformed or transfected with such a polynucleotide or such a vector, wherein the medical composition, when administered is capable of expressing an effective amount of the polypeptide which reduces metabolic acidosis in cells of the mammalian subject.
  • compositions which comprises an effective amount of the polypeptide of the invention and which composition when administered to to a mammalian subject in need of treatment is capable of palliating oxidative stress in mammalian subjects.
  • Also contemplated as an aspect of the invention is a method of manufacturing a medical composition comprising a polynucleotide, vector or a transformed or transfected cell, which composition when administered to a mammalian subject in need is capable of expressing an effective amount of the polypeptide of the invention, thereby decreasing oxidative stress in said mammalian subject.
  • compositions comprising an effective amount of the polypeptide of the invention or a polynucleotide, vector or a transformed or transfected cell, which when administered to a mammalian subject in need of treatment for obesity expresses an effective amount of the peptide of the present invention, thereby providing a treatment of an otherwise intractable obesity is contemplated in some variations.
  • the mammalian subject is human.
  • compositions are locally administrable to a tissue or an organ comprising cells affected by metabolic acidosis of oxidative stress. In other aspects, the composition is systemically administrable.
  • the disorders associated with mitochondrial OXPHOS dysfunctions are impaired mitochondrial respiratory function such as Leigh syndrome; MERRF syndrome; Parkinson's Disease and related conditions; Mitochondrial encephalomyopathies, including progressive external ophthalmoplegia, Kearns-Sayre syndrome and MELAS syndrome; diverse, multisystem pediatric disorders affecting organs such as liver, kidney, the CNS, heart, skeletal muscle, or the endocrine and sensorineural systems; diseases the pathogenesisof which are known or believed to involve excessive production of reactive oxygen species in mitochondria, such as amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia or forms of cardiovascular disease attributable to defects in antioxidant defenses; other ataxias or neurological conditions resulting from genetics defects in POLG, clOorG (Twinkle) or other components of the system of mitochondrial DNA maintenance; mitochondrial hearing impairment, both syndromic and nonsyndromic; forms of diabetes mellitus attributable to defects of
  • the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations specifically mentioned above.
  • aspects of the invention may have been described by reference to a genus or a range of values for brevity, it should be understood that each member of the genus and each value or sub-range within the range is intended as an aspect of the invention.
  • various aspects and features of the invention can be combined, creating additional aspects which are intended to be within the scope of the invention.
  • Figure 1 demonstrates that AOX is expressible in human cells and targeted to mitochondria. Immunocytochemistry was carried out as described by Garrido et al. (Garrido et al., MoI. Biol. Cell, 14:1583-1596, 2003).
  • Figure IA is a simplified biochemical scheme of mitochondrial respiration and by-pass of the cytochrome segment provided by AOX.
  • the five complexes of the RC are denoted by Roman numerals.
  • Figure IB is an immunoblot of 20 ⁇ g total cell lysate from Flp-InTM T-RExTM-293 (Invitrogen) cell clones transfected either with AOX-flag or AOX-myc constructs or empty vector, and probed with primary antibodies shown. Lanes denoted (+) were lysates from cells treated with 1 ⁇ g/ml doxycyclin to induce transgene expression. Primary antibodies used were: mouse anti-Myc monoclonal 9E10 and anti-flag M2 antibody.
  • Figure 1C is a panel of a fluorescence micrograph of cells transfected with the AOX-flag construct with immunocytochemistry using a-flag primary antibody.
  • Figure ID is a fluorescence micrograph of cells transfected with the AOX-flag construct applying staining with Mitotracker® Red (Molecular Probes).
  • Figure IE is a panel of a fluorescence micrograph of cells transfected with the AOX-flag construct with superposition of the images from panels shown in Figures 1C and ID.
  • Figure 2 demonstrates that AOX expression modifies mitochondrial biochemistry in human cells.
  • Figure 2A demonstrates oxygen electrode traces after 48 h doxycyclin induction for ⁇
  • Figure 2B shows cell growth curves, wherein AOX means cells transfected with an untagged AOX construct; Ctrl, means cells transfected with empty vector, grown in standard DMEM medium supplemented with uridine and pyruvate and doxycyclin (Spelbrink et al., J. Biol. Chem., 275:24818-24828, 2000).
  • Figure 2C shows SOD activity of an empty vector-transfected and untagged AOX- transfected cells grown either with (+) or without (-) doxycyclin induction.
  • Figure 3 demonstrates cloning of AOX and AOX-myc into a customized Drosophila transgenic expression vector.
  • p ⁇ UAS ⁇ AOX H-Pelican (left) is a modified version of the Pelican series of vectors (Barolo et al., Biotechniques, 29:726-732, 2000), in which the eGFP coding sequence of pGreen H Pelican is replaced by that of C. intestinalis AOX, and the Gal4p-responsive 5xUAS sequence is inserted in the original multi-cloning site of the vector upstream of the minimal promoter element (Hsp70 TATA box).
  • the other elements of the transgenic vector are denoted as follows: P element 5' and 3' - the terminal sequences of the P-element transposon which allow its mobilization in Drosophila embryos in the presence of a co-injected plasmid encoding P-element transposase; w — white* marker gene, conferring red eye colour after integration in recipient white ' embryos; insulator - insulator elements from the gypsy transposon which block transcription into or from the AOX transgene at the chromosomal integration site; pUC8 plasmid DNA and white linker sequences - elements of the plasmid required for propagation in E. coli or portions of the white + marker gene not integrated in the resulting transgenic lines.
  • the transgenically inserted DNA is indicated more clearly (right).
  • the insulator elements (I) are shown in light grey, the Gal4p-responsive promoter element (PUAS) followed by the AOX encoding gene in dark grey, the P-elements ends in black, and the DNA of the chromosomal integration site with a bold line.
  • PUAS Gal4p-responsive promoter element
  • Figure 4 demonstrates microinjection and selection of transgenic flies resulting in independent transgenic lines from individual flies.
  • Figure 4A demonstrates microinjection and the first selection of transgenic flies.
  • Coinjection of the transgenic vector p (UAS)AOX H-Pelican (see Figure 3) and a P- element transposase-encoding plasmid into white ' recipient Drosophila embryos (egg) results in rare, random integration of the transgenic cassette in both somatic and germ cells of the progeny. Since the progeny are mainly chimeras, eye colour is not a reliable indicator of genotype. All survivors are bred to white ' flies to select transgenic progeny in the next generation, which show yellow (marked with horizontal lines) or pale orange
  • Figure 4B demonstrates creation of transgenic Drosophila lines.
  • the transgenic progeny selected as described in Figure 4A, showing yellow or pale orange eyes are in turn bred to white ' flies to establish lines containing single autosomal insertions (i.e. segregating 50/50 regardless of sex) or X-chromosomal insertions if desired.
  • the lines are tested for their viability as homozygotes, then maintained as hemizygotes for further studies.
  • Eight such lines of AOX transgenic flies were established in this study, containing single insertions at different autosomal sites. Pale orange eyes are marked with a grid, red eyes in black.
  • Figure 5 depicts the genomic insertion site of the transgene in one of the established lines (AOX line F6-1), which was used for the subsequent studies.
  • The shows a schematic map of a region of Drosophila melanogaster chromosome 2R into which the AOX transgenic cassette (denoted as in Figure 3) has inserted in transgenic line F6-1 (output from genome browser at www.flybase.net). All eight AOX transgenic lines showed different insertion sites, but AOX transgene expression levels and hemizygous phenotypes were the same for all lines tested in each experiment.
  • Figure 6 illustrates the cross between a hemizygous AOX fly and a hemizygous da-GAL4 driver fly with Tm3Sb balancer chromosome.
  • the daughterless-GAL4 driver was used to express the AOX or (AOX-myc) transgene ubiquitously in the progeny of the appropriate genetic constitution.
  • Figure 6A is a scheme for generating and selecting AOX-expressing flies on the basis of 1 O
  • the Sb marker provides an additional check to distinguish AOX-expressing (red eyes) from non-expressing AOX transgenic flies (pale orange eyes). Yellow eyes are marked with horizontal lines, pale orange eyes with a grid and red eyes in black.
  • Figure 6B illustrates how the AOX-expressing flies were identified phenotypically by the colour of their eyes and bristle morphology. Photographs are of examples of each of the four classes of actual progeny, which eclosed in similar numbers. White-eyed flies carry no white*- containing transgenes. Those with yellow eyes (and normal bristles) have inherited only the da-GAL4 transgene. Those with pale orange eyes (and short bristles) have inherited only the AOX transgene. Those with red eyes have inherited two copies of the white* marker gene, i.e. both transgenes.
  • GAL4 from the ubiquitous da promoter supports ubiquitous and high-level transcription of the AOX transgene, which was verified in the red-eyed progeny by semi-quantitative, fluorescent RT-PCR, using AOX-specific primers, and an internal standard for rp49 mRNA. Yellow eyes are marked with horizontal lines, pale orange eyes with a grid and red eyes in black.
  • Figure 7 shows verification by in situ hybridization of AOX mRNA expression in embryos.
  • Expression of Gal4p from the da promoter supports ubiquitous and high-level transcription of the AOX transgene, whereas transgenic 'non- expressor' (AOX/-) embryos show no expression.
  • Expression was verified using a specific probe for AOX (sense probe, being the complementary strand to its mRNA), with an antisense probe (AOX coding sequence) as negative control. Probes were generated by in vitro transcription (Roche kit) of & 316 bp fragment of the AOX coding sequence, inserted into the multi-cloning site of pGEM®-T Easy vector (Promega).
  • the insert is flanked by two bacteriophage promoters that allow transcription in both orientations, depending on the polymerase used. Embryos were collected after 16 hours of the commencement of egg-laying. Vitelline membrane and chorion were removed, and embryos were fixed in methanol. In situ hybridization was carried out in re-hydrated embryos using standard procedures (Tomancak et al, Genome Biol, 3:researchOO88.1- 0088.14, 2003).
  • Figure 8 illustrates confirmation of expression of AOX-myc (SEQ ID NO:6), using Western blotting to an anti-myc antibody, in whole flies where AOX-myc expression is induced by the da-GAL4 driver.
  • the total protein extracts from male and female AOX- myc expressing and non-expressing flies, selected under a similar scheme as shown in Figure 6 were run on SDS-PAGE and transferred on Western blot filters.
  • AOX-myc protein was detected with a myc-epitope-specific monoclonal antibody.
  • Figure 9 illustrates changes in weight of AOX-expressing and non-expressing flies during adult life. Flies were collected and kept alive in standard supplemented-food vials, at a maximum of 15 flies per vial and changing vials three times per week. Flies were anaesthetized on ice and their weight was measured at eclosion subsequently every two weeks.
  • Figure 10 illustrates a phenotypic analysis of AOX expressing flies, indicating partial cyanide resistance.
  • Figure 11 illustrates AOX activity in mitochondria from AOX-expressing flies.
  • FIG 12 shows oxygen consumption traces for isolated mitochondrial suspensions from AOX-expressing and non-expressing Drosophila as selected under the scheme of Figure 6.
  • Drosophila mitochondria were prepared as described by Toivonen et al. (Toivonen et al., Genetics 159:241-254, 2001) and oxygen consumption in the presence of various substrates and inhibitors was determined as previously (Hakkaart et al., EMBO Rep., 7:341-345, 2006). Additions were of pyruvate + malate (5 mM each), ADP (1.5 ⁇ mol), KCN (100 ⁇ M) and SHAM (1 mM).
  • the respiratory control ratio (RCR) is the ratio of state 4 to state 3 respiration, i.e. respiration driven by ADP and the resting state of 2Q
  • the RCR is a measure of the degree of coupling of the mitochondria, i.e. how far respiration is limited by the flux through ATP synthase.
  • Figure 13 illustrates the effect of cyanide on viability of AOX-expressing, non-expressing
  • AOX-transgenic and non-transgenic flies as selected under the scheme of Figure 6.
  • KCN was added in a fume hood at various concentrations to the agarose plugs cast in the vials. Flies in groups of 10 were placed inside the vials, which were closed by non-airtight bungs and left in the fume hood. Flies were scored as non- viable when they ceased all movement, at times measured from the start of the experiment.
  • Figure 13 A shows that after 30 min of incubation in vials containing agarose plugs impregnated with 100 ⁇ M KCN all AOX-expressing flies remained viable and able to crawl up the side of the vial, whereas non-expressor flies had all succumbed and lay dead on the surface of the agarose.
  • Figure 13B shows the mean survival times (+ SD) in vials containing 1 mM KCN- impregnated agarose plugs, of groups of male and female flies of different genotypes, as indicated. Whereas non-transgenic (wt) and non-expressor flies died after approximately 5 min, AOX-expressing flies remained viable for approximately 30 min, and were also able to recover from the paralysis overnight without lethal effects.
  • Figure 14 illustrates the development of AOX-expressing and non-transgenic (wt) Drosophila on media containing 10 or 30 ⁇ g/ml antimycin. Flies are shown approximately 7 d (left) or 10 d (right) after egg-laying. At 30 ⁇ g/ml antimycin wild-type flies either do not hatch or the larvae are non- viable. At 10 ⁇ g/ml antimycin wild-type flies reach early larval stage but no further. AOX-containing flies reach 3 rd instar larval stage and begin climbing tube in preparation for pupariation, after which they eclose as healthy adults.
  • Figure 15 illustrates the construction of p WPI- AOX.
  • the map of p WPI (left) is redrawn from that shown on www.adgene.com.
  • the 1110 bp AOX coding sequence (shaded box, right), including start and stop codons and flanked by Smal half-sites as shown, was blunt end-cloned into the unique Pmel site of the vector, between the EFl ⁇ -promoter/cPPT and EMCV IRES segments.
  • Figure 16 are live-cell images of pWPI-AOX-transduced cells showing unsorted cells, 3 weeks post-transduction (left) or cells replated following FACS enrichment (right). GFP fluorescing cells appear as bright cells in the monochrome images. Separate control images (not shown), created by successive imaging using Krypton lamp excitation (excitation filter 492/18 nm, emission filter 535/30) and white light (halogen lamp) confirmed this interpretation.
  • Krypton lamp excitation excitation filter 492/18 nm, emission filter 535/30
  • white light halogen lamp
  • Figure 17 depicts a Northern blot analysis of AOX expression.
  • RNA from FACS-enriched pWPI-AOX-transduced cells and from doxycyclin-induced pcDNA5-AOX-transfected plus empty vector-transfected cells was hybridized with an AOX-specif ⁇ c probe.
  • Lanes marked a and b represent duplicate RNA preparations.
  • Lanes marked Ia, 2a etc. represent two batches of pWPI-AOX-transduced cells. Transcript sizes were inferred from RNA size markers and correspond with those predicted from the vector maps.
  • Figure 18 demonstrates the respiration of pWPI-AOX-transduced cells.
  • Oxygen consumption traces from permeabilized, FACS-enriched, pWPI-AOX-transduced cells and from doxycyclin-induced pcDNA5-AOX-transfected and empty vector-transfected cells is indicated.
  • the arrows indicate times of addition of potassium cyanide (KCN) to 100 ⁇ M and n-propyl gallate (PG) to 10 ⁇ M.
  • KCN potassium cyanide
  • PG n-propyl gallate
  • allotopic expression means expression in a different place.
  • the term is used to mean expression, in one organism (or cells from an organism), of a gene derived from another organism, where no homologous gene is found in the genome of the first organism.
  • the AOX expression in organisms that do not posses the AOX gene in their genomes brought about a dramatic transformation of mitochondrial biochemistry as shown in the experimental part of the present invention.
  • the results demonstrate that allotopic AOX expression would be a feasible strategy for gene therapy of pathological conditions affecting the mitochondrial respiratory chain and OXPHOS system.
  • mitochondrial substrate oxidation means the oxidation of substrate molecules (e.g. sugars, organic acids) inside mitochondria, or in mitochondrial suspensions in vitro, or inside permeabilized cells studied in vitro, involving the consumption of molecular oxygen.
  • substrate molecules e.g. sugars, organic acids
  • reoxidizing of NADH means the regeneration of NAD , a crucial electron acceptor in most steps in catabolism, via enzymatic oxidation of the reduced form NADH, involving a downstream electron acceptor such as ubiquinone.
  • metabolic acidosis in the present invention means “lactic acidosis".
  • "Lactic acidosis” is a poisonous side-effect of the blockage of the respiratory chain, wherein the mitochondria cannot use the normal pathway for reoxidation of NADH, and the only alternative pathway which the cell can use to reoxidize NADH is the one that converts pyruvate to lactate via the enzyme misleadingly called lactate dehydrogenase. Lactate is then exported from the cell as lactic acid, and leads to acidification of the extracellular mileu, which manifests pathologically as lactic acidosis. AOX prevents all of this by providing an alternative, but still mitochondrial, respiratory route to reoxidize NADH, thus making the use of the lactate dehydrogenase pathway unnecessary for the cell.
  • oxidative stress refers to decreasing or eliminating damage to animal or plant cells, and thereby the organs and tissues composed of those cells, caused by reactive oxygen species, which include but are not limited to superoxide, singlet oxygen, peroxynitrite or hydrogen peroxide. Oxidative stress is ⁇
  • Oxidative stress can be measured in a number of ways including the measurement of lipid oxidation products such as malonaldehyde or thiobarbituric acid reactive substances (TBARS) in blood on urine (Gutteridge et al, Anal. Biochem., 91: 250-257, 1978; Yagi et al., Chem. Phys. Lipids, 45: 337-351, 1987; Ekstrom et al., Chem.-Biol. Interact, 66: Mini, 1988; Ekstrom, et al., Chem.-Biol. Interact., 67: 25- 31, 1988; .
  • lipid oxidation products such as malonaldehyde or thiobarbituric acid reactive substances (TBARS) in blood on urine
  • TBARS thiobarbituric acid reactive substances
  • Glazer eds., Methods in Enzymology, Vol. 186, pp. 521-529. New York: Academic Press, 1990; Gomes et al., Chem. Res. Toxicol., 3 :307-310, 1990; Cundy et al., In: M. G. Simic, K. A. Taylor, J. F. Ward, and C. von Stanford (eds.), Oxygen Radicals in Biology and Medicine, pp. 479- 482. New York: Plenum Press, 1988); vitamin E or vitamin C levels in blood fractions (including LDL) (Clausen et al., Biol. Trace Elem. Res., 20:135-151, 1989; Van Rensburg et al., Mutat.
  • Mitochondria from all plants, many fungi and some protozoa contain a cyanide-resistant, alternative oxidase that functions as an alternative to cytochrome c oxidase as the terminal oxidase on the electron transfer chain, reducing oxygen to two molecules of water. Electron flow to this "alternative" pathway branches from the conventional respiratory electron transfer pathway (often referred to as the cytochrome pathway) at the level of the ubiquinone pool. Catalytically, the alternative pathway therefore consists of a single enzyme (alternative oxidase) that functions as an ubiquinol oxidase.
  • Electron transfer through the alternative oxidase is not coupled to proton translocation, so two of the three sites of energy conservation are bypassed and the free energy released is lost as heat.
  • AOX accepts electrons from the ubiquinol pool, with the concomitant reduction of molecular oxygen to water.
  • the alternative pathway is non-phosphorylating and, therefore, does not contribute directly to oxidative phosphorylation.
  • this alternative pathway has the potential to decrease the efficiency of respiration, AOX is tightly regulated by two mechanisms.
  • ROS reactive oxygen species
  • Alternative oxidase is resistant to inhibitors that act at electron transfer complexes III (including myxothiazol and antimycin) and IV (including cyanide), but it can be inhibited specifically by several compounds, including salicylhydroxamic acid (SHAM) and n- propyl gallate (Moore et al., Biochim. Biophys. Acts 1059:121-140, 1991).
  • SHAM salicylhydroxamic acid
  • n- propyl gallate n- propyl gallate
  • the AOX was predicted to contain two transmembrane helices that are connected by a helix located in the intermembrane space (Moore et al., J. Bioenerg. Biomembr., 27:367-377, 1995). Since this model was proposed, further AOX sequences were identified, resulting in the proposal by Andersson and Nordlund (FEBS Lett., 449:17-22, 1999) of an alternative structural model. Although this second model also classifies the AOX as a di-iron protein, it differs in the precise ligation sphere of the di-iron center (Andersson and Nordlund, FEBS Lett., 449:17-22, 1999).
  • IMMUTANS (Im) gene from Arabidopsis thaliana has been sequenced and, interestingly, was found to encode a plastid terminal oxidase (PTOX) that appears to be distantly related to the AOX (Wu et al., Plant Cell, 11 :43-55, 1999; Carol et al., Plant Cell 11:57-68, 1999).
  • the limited but significant homology of the Im gene to the AOX includes several glutamate and histidine residues located in positions that could contribute to iron binding. All but one (Glu-269) of the amino acid residues, which were proposed by Andersson and Nordlund (1999) to coordinate the di-iron centers, were also present in the Im sequence.
  • the model was subtly adapted in so much that Glu-269 was replaced by Glu-268, a residue that indeed is fully conserved throughout all AOX and PTOX sequences.
  • Table 1 AOX genes from a wide range of taxonomic groups
  • alternative oxidase comprises a mitochondrial transit peptide (ranging from 50-80 residues in length) at the N-teminus of the peptide.
  • AOX from Sauromatum guttatum (Swiss Prot Accession No. P22185) has a mitochondrial transit peptide located at the N- terminus (residues 1-62) followed by the mature AOX sequence (residues 63-354);
  • a route for expressing a cyanide-insensitive AOX in human cells was developed and its feasibility demonstrated in a whole organism model.
  • AOX cyanide-insensitive alternative oxidase
  • AOX conferred a spectacular cyanide-resistance to mitochondrial substrate oxidation, alleviated oxidative stress, apoptosis, i.e. cell death susceptibility, and metabolic acidosis. Furthermore, AOX was shown to be well tolerated when expressed ubiquitously in a whole organism model. Therefore, allotropic AOX expression was shown to be a valuable tool to limit the deleterious consequences of respiratory chain deficiency in human cells and a whole animal model. The expressed AOX appeared to be confined to mitochondria. AOX involvement in electron flow is triggered by a highly reduced redox status of the respiratory chain and enhanced by pyruvate, otherwise the enzyme remains essentially inert.
  • Ciona intestinalis alternative oxidase when expressed in human cells, was correctly targeted to mitochondria and rendered mitochondrial substrate oxidation insensitive to the respiratory chain inhibitor, potassium cyanide.
  • AOX Ciona intestinalis alternative oxidase
  • propyl gallate it is furthermore demonstrated that AOX is enzymatically inert under conditions when the respiratory chain is functioning normally.
  • AOX was shown by an indirect assay to inhibit the generation of reactive oxygen species (ROS) when cells were treated with antimycin
  • A a drug which blocks the respiratory chain at the level of respiratory complex III.
  • This treatment normally leads to a large induction of the mRNA for S0D2, the mitochondrial superoxide dismutase, as a result of the over-production of reactive oxygen species (ROS) when the quinine pool becomes highly reduced.
  • ROS reactive oxygen species
  • One embodiment of the present invention is related to protection of apoptosis or cell death.
  • experimental work is disclosed, which demonstrate that AOX expression in cells completely protects them from apoptosis or cell death induced by ⁇
  • AOX expression in human cells can be an effective way to restore respiration when the cytochrome segment of the respiratory chain is inhibited, whether by ingestion of toxins, or as a result of disease-causing or ageing-associated mutations of mitochondrial DNA or of nuclear genes encoding components of the mitochondrial oxidative phosphorylation (OXPHOS) system.
  • OXPHOS mitochondrial oxidative phosphorylation
  • AOX expression could limit or prevent the consequences of excessive accumulation of mtDNA mutations, which elsewhere has been shown to induce the features of premature ageing.
  • physiological effects of ageing such as weight loss, reduced subcutaneous fat, alopecia (hair loss), kyphosis (curvature of the spine), osteoporosis, anaemia, reduced fertility and heart enlargement should be delayed and lifespan increased.
  • An additional embodiment of the invention is to provide a tool for studying the consequences of RC dysfunctions.
  • the successful expression of C. intestinalis AOX in human cells constitutes a promising tool to study further the consequences of RC dysfunction because it offers a unique possibility to disconnect electron flow through most of the RC from the phosphorylation process.
  • allotopic expression of AOX is contemplated as an effective therapy for currently intractable RC diseases.
  • the first step in this endeavour is the expression of AOX in whole organism models, e.g. mouse or Drosophila, exhibiting RC deficiency.
  • AOX expression had no significant effect on respiratory chain activities, but blocked the induction of superoxide dismutase activity in the presence of respiratory poisons such as antimycin, indicating that it alleviates enhanced ROS production when the respiratory chain becomes inappropriately reduced. Furthermore, it greatly diminished the acidification of the medium caused by culturing cells overnight in the presence of cyanide, which results from reliance on lactate production to reoxidize NADH if the respiratory chain is unavailable. Finally, AOX expression provided significant protection against oligomycin-induced cell death during 6 hours of culture.
  • AOX expression can have a beneficial effect in combating the deleterious effects of inhibition of the cytochrome segment of the respiratory chain or ATP synthase, whether by toxins or by mutations.
  • OXPHOS oxidative phosphorylation
  • AU of these ameliorations indicate that AOX expression can have a beneficial effect in combating the deleterious effects of inhibition of the cytochrome segment of the respiratory chain or ATP synthase, whether by toxins or by mutations.
  • OXPHOS oxidative phosphorylation
  • a highly preferred embodiment of the invention is the provision of a gene therapy tool by using allotopic expression of AOX.
  • AOX a gene therapy tool
  • a more versatile expression system which allows AOX to be stably expressed at typical levels for a mammalian gene over long periods was developed by using the current lentiviral vectors (Wiznerowicz and Trono, Trends Biotechnol., 23:42-47, 2005).
  • the expression system allows transformation of a variety of target cell- types and species.
  • the Lentivector-AOX can be injected as at the sites of specific lesions in affected tissues and organs. Successful transduction and survival of transduced cells at the injection site can be conveniently monitored using the GFP reporter of pWPI. 3 ⁇
  • C. intestinalis AOX was expressed in human cells using lentivector transduction under the control of a ubiquitously acting, physiologically relevant promoter. Even though expression at the mRNA level achieved by this route was approximately two orders of magnitude less than using the Flp-InTM T-RExTM-293 system under maximal induction, the profound effect on mitochondrial respiratory metabolism was essentially the same. Lentivector-delivered AOX can thus be used to provide a facultative by-pass of the cytochrome segment of the respiratory chain, under conditions where the latter is inhibited, e.g. by toxins, mutations or other insults, such as transient hypoxia.
  • transduced cells can be maintained for at least three weeks with no detectable growth advantage or disadvantage. Unlike many foreign proteins, AOX expressed at this level in human cells would therefore appear to have no toxic effects. Moreover, in contrast to observations that various disturbances in mitochondrial catabolism, notably involving mutations in the TCA cycle enzymes fumarate hydratase and succinate dehydrogenase, can stimulate cell proliferation or even tumorigenic potential (Warburg, Science, 123:309-314, 1956; Pollard et al, Ann. Med., 35:632-639, 2003), lentivector- delivered AOX appears to be essentially inert in this regard. This strengthens the argument that it can be safely adopted as a gene therapy tool, if animal testing confirms its utility.
  • the results of the Drosophila experiments showed that whole-organism expression of AOX is well tolerated, supporting normal development with no deleterious consequences.
  • the AOX-expressing flies appeared morphologically normal and were fertile, and produced normal numbers of progeny when mated to non-transgenic flies.
  • AOX transgenic flies appeared to be as long-lived as the most long-lived wild-type.
  • the enzyme was active in mitochondria of the adult fly under similar biochemical conditions to those in which it is active in cultured human cells. Expression of AOX in Drosophila rendered mitochondrial substrate oxidation cyanide-insensitive and even partially protected the flies against cyanide toxicity.
  • AOX-expressing flies which were completely paralysed within 30 min, survived the treatment and were active again after 16 hours. AOX-expressing flies were also resistant to the complex III inhibitor antimycin, which was toxic to wild-type flies when added to fly food. Respiratory chain activities were not significantly altered in mitochondria from AOX- expressing flies compared with control flies, indicating that, as in human cultured cells, AOX is enzymatically inert in the entire organism, except under conditions where it is needed.
  • expression constructs comprising viral vectors containing the genes of interest may be adenoviral (see, for example, U.S. Patent No. 5,824,544; U.S. Patent No. 5,707,618; U.S. Patent No. 5,693,509; U.S. Patent No. 5,670,488; U.S. Patent No. 5,585,362; each incorporated herein by reference), retroviral (see, for example, U.S. Patent No. 5,888,502; U.S. Patent No. 5,830,725; U.S. Patent No. 5,770,414; U.S. Patent No.
  • an adenoviral-adenoassociated viral hybrid see, for example, U.S. Patent No. 5,856,152 incorporated herein by reference
  • a vaccinia viral or a herpesviral see, for example, U.S. Patent No. 5,879,934; U.S. Patent No. 5,849,571; U.S. Patent No. 5,830,727; U.S. Patent No. 5,661,033; U.S. Patent No. 5,328,688 each incorporated herein by reference
  • a lentiviral vector see, for example, U.S. Patent Nos. 6,207,455 and ⁇
  • Various routes are contemplated for various cell types.
  • any cell, tissue or organ type systemic delivery is contemplated.
  • a variety of direct, local and regional approaches may be taken.
  • the cell, tissue or organ may be directly inj ected with the expression vector or protein.
  • Preferred promoters for gene therapy for use in this invention include EF- ⁇ promoter; cytomegalovirus (CMV) promoter/enhancer, long terminal repeat (LTR) of retroviruses, keratin 14 promoter, and ⁇ myosin heavy chain promoter.
  • CMV cytomegalovirus
  • LTR long terminal repeat
  • Tissue specific promoters may be advantageous for disease or conditions where localized AOX expression is desirable.
  • Host cells including prokaryotic and eukaryotic cells, that are transformed or transfected (stably or transiently) with polynucleotides or vectors discussed herein are considered as an aspect of the invention.
  • Polynucleotides of the invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector.
  • Methods for introducing DNA into the host cell which are well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts.
  • host cells are useful for amplifying the polynucleotides and also for expressing the polypeptides of the invention encoded by the polynucleotide.
  • the host cell may be isolated and/or purified.
  • the host cell also may be a cell transformed in vivo to cause transient or permanent expression of the polypeptide in vivo.
  • the host cell may also be an isolated cell transformed ex vivo and introduced post- transformation, e.g., to produce the polypeptide in vivo for therapeutic purposes.
  • ex vivo therapy is introduced into differentiated, undifferentiated or partially differentiated cells of a particular tissue/organ type.
  • exemplary differentiated cells include somatic cells, neuronal cells, skeletal muscle cells, smooth muscle cells, pancreatic cells, liver cells, and cardiac cells.
  • exemplary types of cells include but are not limited to undifferentiated or partially differentiated cells including stem cells, totipotent cells, pluripotent cells, embryonic stem cells, inner mass cells, adult stem cells, bone marrow cells, cells from umbilical cord blood, and cells derived from ectoderm, mesoderm, or endoderm.
  • any host cell is acceptable, including but not limited to bacterial, yeast, plant, invertebrate (e.g., insect), vertebrate, and mammalian host cells.
  • expression in mammalian cell lines, especially human cell lines is preferred.
  • Use of mammalian host cells is expected to provide for such post- translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be desirable to confer optimal biological activity on recombinant expression products of the invention.
  • Glycosylated and non-glycosylated forms of polypeptides are embraced by the present invention.
  • the invention further embraces polypeptides described above that have been covalently modified to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.
  • the invention provides for the use of polypeptides or polynucleotides or host cells of the invention in the manufacture of a medicament for the treatment of disorders described herein, including but not limited to disorders characterized by defects in the mitochondrial respiratory chain and disorders characterized by oxidative damage in cells.
  • the invention provides a kit comprising a polynucleotide, polypeptide, or composition of the invention packaged in a container, such as a vial or bottle, and further comprising a label attached to or packaged with the container, the label describing the contents of the container and providing indications and/or instructions regarding use of the contents of the container to treat one or more disease states as described herein.
  • non-viral delivery is contemplated.
  • these include calcium phosphate precipitation (Graham and Van Der Eb 5 Virology, 52:456-467, 1973; Chen and Okayama, MoI. Cell Biol., 7:2745-2752, 1987; Rippe, et al., MoI. Cell Biol, 10:689-695, 1990), DEAE-dextran (Gopal, MoI. Cell Biol., 5:1188-1190, 1985), electroporation (Tur- Kaspa, et al., MoI. Cell Biol., 6:716-718, 1986; Potter, et al., Proc. Nat. Acad. Sci.
  • the expression construct (or the proteins) may be entrapped in a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, In: Liver Diseases, Targeted Diagnosis And Therapy Using Specific Receptors And Ligands, Wu, G, Wu, C, ed.
  • the liposome may be complexed with a hemagglutinating virus (HVJ).
  • HVJ hemagglutinating virus
  • the liposome may be complexed or employed in conjunction with nuclear nonhistone chromosomal proteins (HMG-I) (Kato, et al, J. Biol. Chem, 266:3361-3364, 1991).
  • HMG-I nuclear nonhistone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG-I.
  • expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention.
  • receptor-mediated delivery vehicles that can be employed to deliver a nucleic acid encoding a therapeutic gene into cells. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu 5 Adv. Drug Delivery Rev., 12:159-167, 1993).
  • Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent.
  • ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu (1987), supra) and transferrin (Wagner, et al., Proc. Natl. Acad Sci. USA, 87(9):3410-3414, 1990).
  • ASOR asialoorosomucoid
  • transferrin Wang and Wang (1987), supra
  • Recently, a synthetic neoglycoprotein, which recognizes the same receptor as ASOR has been used as a gene delivery vehicle (Ferkol, et al., FASEB.
  • EGF epidermal growth factor
  • the delivery vehicle may comprise a ligand and a liposome.
  • a ligand and a liposome For example, Nicolau, et al., Methods Enzymol., 149:157-176 (1987) employed lactosyl- ceramide, a galactose-terminal asialganglioside, incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes.
  • a nucleic acid encoding a therapeutic gene also may be specifically delivered into a particular cell type by any number of receptor-ligand systems with or without liposomes.
  • the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above that physically or chemically permeabilize the cell membrane. This is applicable particularly for transfer in vitro, however, it may be applied for in vivo use as well. Dubensky, et al., Proc. Natl. Acad. Sci. USA, 81:7529-7533 3?
  • Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein, et al., Nature, 327:70-73, 1987).
  • Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang, et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.
  • Non-viral delivery mechanisms contemplated include calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52:456-467, 1973; Chen and Okayama, MoI. Cell Biol, 7:2745-2752, 1987; Rippe et al., MoI. Cell Biol., 10:689-695, 1990) DEAE-dextran (Gopal, MoI. Cell Biol, 5:1188-1190, 1985), electroporation (Tur-Kaspa et al., MoI. Cell Biol., 6:716-718, 1986; Potter et al., Proc. Nat. Acad. Sci. USA, 81:7161- 7165, 1984), direct microinjection (Harland and Weintraub, J.
  • the delivery vehicle may specifically deliver polynucleotides . .
  • Targeting of specific polypeptides to organelles can be accomplished by modifying polynucleotides that encodes them to express specific organelle targeting signals. These signals target specific organelles, but in some embodiments the interaction of the targeting signal with the organelle does not occur through a traditional receptor:ligand interaction.
  • the eukaryotic cell comprises a number of discrete membrane bound compartments, or organelles. The structure and function of each organelle is largely determined by its unique complement of constituent polypeptides. However, the vast majority of these polypeptides begin their synthesis in the cytoplasm. Thus organelle biogenesis and upkeep require that newly synthesized proteins can be accurately targeted to their appropriate compartment. This is often accomplished by amino-terminal signaling sequences, as well as post-translational modifications and secondary structure.
  • mitochondrial targeting signals include those listed as Genbank Accession Nos. NP633590, Q9DCW4, NP000099, NP067274, NP080720, AA031763, NP032641, AAH49802, NP000273, NP031647, XP331748, NP000008, WPOOOl 17, NP002147, XP326125, NP002216, NP898871, NP002387, NP004101, NP001599, NP005720, P22572, AAP88794, AAH55030, AAH53661, NP036216, NP032329, NP001600, P42126, NP031408, NM201263, NP060297, AAH27412, AAC25560, NP006558, NP001688, AAP35327, NP061820, CAA29050, NP056155, AAG316
  • the organelle targeting signal can contain at least two, at least 5-15, or about 11 charged groups, causing the targeting signal to be drawn to organelles having a net opposite charge.
  • the targeting signal can contain a series of charged groups that cause the targeting signal to be transported into an organelle either against or down an electromagnetic potential gradient. Suitable charged groups are groups that are charged under intracellular conditions such as amino acids with charged functional groups, amino groups, nucleic acids, and the like.
  • Mitochondrial localization/targeting signals generally consist of a leader sequence of highly positively charged amino acids, which allows the protein to be targeted to the highly negatively charged mitochondria. Unlike recepto ⁇ ligand approaches that rely upon stochastic Brownian motion for the ligand to approach the receptor, the mitochondrial localization signal of some embodiments is drawn to mitochondria because of charge.
  • a protein In order to enter the mitochondria, a protein generally must interact with the mitochondrial import machinery, consisting of the Tim and Tom complexes (Translocase of the Inner/Outer Mitochondrial Membrane). With regard to the mitochondrial targeting signal, the positive charge draws the linked protein to the complexes and continues to draw the protein into the mitochondria. The Tim and Tom complexes allow the proteins to cross the membranes. Accordingly, some embodiments of the present invention deliver compositions to the inner mitochondrial space utilizing a positively charged targeting signal and the mitochondrial import machinery.
  • the invention in another embodiment, includes a polynucleotide that encodes a mature AOX polypeptide operatively connected in frame to a polynucleotide that encodes an organelle localization signal.
  • a chimeric construct can be introduced into organelles of cells.
  • the cells can be a transformed cell line that can be maintained indefinitely in cell culture, or the cells can be from a primary cell culture. Exemplary cell lines include those available from American Type Culture Collection.
  • the nucleic acid can be replicated and 4Q
  • the targeting signal can be enzymatically cleaved if necessary such that the polynucleotide that encodes a mature AOX polypeptide is free to remain in the target organelle.
  • Any eukaryotic cell can be transfected to produce organelles that express a specific nucleic acid, for example a metabolic gene, including primary cells as well as established cell lines.
  • exemplary types of cells include but are not limited to undifferentiated or partially differentiated cells including stem cells, totipotent cells, pluripotent cells, embryonic stem cells, inner mass cells, adult stem cells, bone marrow cells, cells from umbilical cord blood, and cells derived from ectoderm, mesoderm, or endoderm.
  • Exemplary differentiated cells include somatic cells, neuronal cells, skeletal muscle cells, smooth muscle cells, pancreatic cells, liver cells, and cardiac cells.
  • embodiments of the present invention also encompasses the manipulation of the mitochondrial genome to supply the means by which known mitochondrial diseases (including LHON, MELAS.) and putative mitochondrial diseases (including aging, Alzheimer's Disease, Parkinson's Disease, Diabetes, Heart Disease) are treated.
  • known mitochondrial diseases including LHON, MELAS.
  • putative mitochondrial diseases including aging, Alzheimer's Disease, Parkinson's Disease, Diabetes, Heart Disease
  • AOX is used as a gene therapy tool to correct bioenergetic defects arising from mutations affecting the mitochondrial OXPHOS system, whether inherited or generated somatically during ageing.
  • AOX permits electron flow to resume under conditions where the mitochondrial respiratory chain is partially blocked within the cytochrome segment or ATP synthase.
  • AOX-supported electron flow is non proton-pumping, hence does not contribute directly to ATP generation.
  • AOX can allow electron and proton flow through complex I to resume, which should at least partially restore ATP generation.
  • the prediction from our findings is that AOX should have utility under conditions of partial respiratory chain blockage at or beyond complex III, e.g. resulting from mis-sense mutations in structural subunits, or loss of assembly factors and chaperones (e.g. Surfl), which leave some residual activity in the cytochrome chain, and hence do not diminish ATP production below a critical threshold.
  • AOX expression is thus shown to be both benign and beneficial in the whole organism, it can be inferred that it will be a useful tool for the treatment of a wide spectrum of human disorders affecting the mitochondrial respiratory chain, via gene therapy.
  • a mitochondrial respiratory chain disease can present itself in many areas of the body, including neurological, muscle, ophthalmological, heart, renal, liver, blood, gastrointestinal, the endocrine system and metabolic decompensation.
  • a review mitochondrial respiratory chain disorders can be found in Morris et al., (Morris et al. J. Royal Soc, Med, 88:217P-222P, 1995), the disclosure of which is incorporated herein by reference in its entirety.
  • Exemplary mitochondrial respiratory chain disorders include Leigh syndrome (caused by mutations in mitochondrial genes for subunits of ATP synthase or other OXPHOS complexes, or nuclear genes for the complex IV assembly factor SURFl or other proteins involved in the biogenesis of the OXPHOS system); MERRF syndrome (caused by mutations in mitochondrial tRNA-Lys or other components of the mitochondrial translational apparatus); Parkinson's Disease and related conditions (caused by mutations in genes for mitochondrial functions, including the mtDNA polymerase POLG, mitochondrial protein kinase signaling, protein metabolism or resistance against oxidative stress); Mitochondrial encephalomyopathies, including progressive external ophthalmoplegia, Kearns-Sayre syndrome and MELAS syndrome (caused by deletions or point mutations of mitochondrial DNA, nuclear genes involved in mtDNA maintenance or biogenesis of the respiratory chain); Diverse, multisystem pediatric disorders affecting organs such as liver, kidney, the CNS, heart, skeletal muscle,
  • mitochondria can be transfected to express any protein whether naturally present in the mitochondrion or not or naturally encoded by mtDNA or nuclear DNA.
  • symptoms of the disease to be treated may include loss of motor control, muscle weakness and pain, gastro-intestinal disorders and swallowing difficulties, poor growth, cardiac disease, liver disease, diabetes, respiratory complications, seizures, visual/hearing problems, lactic acidosis, developmental delays and susceptibility to infection.
  • drosophila models Animal models (including drosophila and mice) can be used to demonstrate therapeutic efficacy for AOX therapy of the invention in the treatment of various disorders of the mitochondrial respiratory chain.
  • exemplary drosophila models include oxen (Frolov et al., Genetics, 156:1727-1736, 2000), Surfl-KD (Zordan et al., Genetics, 172:229:241, 2006), park (Green et al., Hum. MoI. Genet. 14:799-811, 2005; Park et al., Nature 441:1157- ⁇
  • Exemplary mouse models include Cox6a2 (Radford et al., Am. J. Physiol. Heart Circ. Physiol, 282:H726-H733, 2002), CoxlO (t>iaz et al., Hum. MoI. Genet. 14:2737-2748, 2005), Mecp2 (Kriaucionis et al., MoI. Cell. Biol., 26:5033-5042, 2006), Harlequin (Vahsen et al., EMBO J., 23:4679-4689, 2004; Simon et al., J.
  • an AOX cDNA is administered (either systemically or locally to an organ through a catheter or other suitable medical device) via gene therapy to an animal model for a human disorder of the mitochondrial respiratory chain.
  • Contemplated therapeutic effects include decreased metabolic acidosis, reduced or eliminated oxidative stress, a reduced susceptibility to apoptosis or a reduced rate of apoptosis.
  • a transgenic animal can be prepared in a number of ways.
  • a transgenic organism is one that has an extra or exogenous fragment of DNA incorporated into its genome, sometimes replacing an endogenous piece of DNA.
  • any animal whose genome does not naturally include AOX and which has been modified to introduce an AOX gene (or AOX variant with AOX activity), as well as its transformed/transfected progeny, are considered transgenic animals.
  • the integration event In order to achieve stable inheritance of the extra or exogenous DNA, the integration event must occur in a cell type that can give rise to functional germ cells.
  • the two animal cell types that are used for generating transgenic animals are fertilized egg cells and embryonic stem cells. ⁇
  • Embryonic stem (ES) cells can be returned from in vitro culture to a "host" embryo where they become incorporated into the developing animal and can give rise to transgenic cells in all tissues, including germ cells.
  • the ES cells are transfected in culture and then the mutation is transmitted into the germ line by injecting the cells into an embryo.
  • the animals carrying mutated germ cells are then bred to produce transgenic offspring.
  • the use of ES cells to make genetic changes in the mouse germ line is well recognized. For a reviews of this technology, those of skill in the art are referred to Bronson & Smithies, J. Biol. Chem., 269(44):27155-27158, 1994; Torres, Curr. Top. Dev. Biol, 36:99-114; 1998 and the references contained therein.
  • blastocysts are isolated from pregnant mice at a given stage in development, for example, the blastocyst from mice may be isolated at day 4 of development (where day 1 is defined as the day of plug), into an appropriate buffer that will sustain the ES cells in an undifferentiated, pluripotent state.
  • ES cell lines may be isolated by a number of methods well known to those of skill in the art. For example, the blastocysts may be allowed to attach to the culture dish and approximately 7 days later, the outgrowing inner cell mass picked, trypsinized and transferred to another culture dish in the same culture media. ES cell colonies appear 2-3 weeks later with between 5-7 individual colonies arising from each explanted inner cell mass. The ES cell lines can then be expanded for further analysis.
  • ES cell lines can be isolated using the immunosurgery technique (described in Martin, Proc. Natl. Acad. Sci. USA, 78:7634-7638, 1981) where the trophectoderm cells are destroyed using anti-mouse antibodies prior to explanting the inner cell mass.
  • blastocyst injection as described in Williams et al., Cell, 52:121-131, 1988. Briefly, blastocysts are isolated from a pregnant mouse and expanded. The expanded blastocysts are maintained in oil-drop cultures at 4 0 C for 10 minutes prior to culture.
  • the ES cells are prepared by picking individual colonies, which are then incubated in phosphate-buffered saline, 0.5 mM EGTA for 5 minutes; a single cell suspension is prepared by incubation in a trypsin- EDTA solution containing 1% (v/v) chick serum for a further 5 minutes at 4oC.
  • Five to twenty ES cells in Dulbecco's modified Eagle's Medium with 10% (v/v) fetal calf serum and 3,000 units/ml DNAase 1 buffered in 20 mM HEPES [pH 8]) are injected into each blastocyst. The blastocysts are then transferred into pseudo-pregnant recipients and allowed to develop normally.
  • transgenic mice are identified by coat markers (Hogan et al., Manipulating the Mouse Embryo, Cold Spring Harbor, N. Y., 1986). Additional methods of isolating and propagating ES cells may be found in, for example, U.S. Patent No. 5,166,065; U.S. Patent No. 5,449,620; U.S. Patent No. 5,453,357; U.S. Patent No. 5,670,372; U.S. Patent No. 5,753,506; U.S. Patent No. 5,985,659, each incorporated herein by reference.
  • this method involves injecting DNA into a fertilized egg, or zygote, and then allowing the egg to develop in a pseudo-pregnant mother.
  • the zygote can be obtained using male and female animals of the same strain or from male and female animals of different strains.
  • the transgenic animal that is born, the founder, is bred to produce more animals with the same DNA insertion.
  • the new DNA typically randomly integrates into the genome by a non-homologous recombination event.
  • One to many thousands of copies of the DNA may integrate at a site in the genome
  • the DNA is injected into one of the pronuclei, usually the larger male pronucleus.
  • the zygotes are then either transferred the same day, or cultured overnight to form 2-cell embryos and then transferred into the oviducts of pseudo-pregnant females. The animals born are screened for the presence of the desired integrated DNA.
  • DNA clones for microinjection can be prepared by any means known in the art.
  • DNA clones for microinjection can be cleaved with enzymes appropriate for removing the bacterial plasmid sequences, and the DNA fragments electrophoresed on 1% ⁇ £
  • the column is first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 ml of low salt buffer.
  • the DNA solutions are passed through the column three times to bind DNA to the column matrix.
  • the DNA is eluted with 0.4 ml high salt buffer and precipitated by two volumes of ethanol.
  • DNA concentrations are measured by absorption at 260 nm in a UV spectrophotometer. For microinjection, DNA concentrations are adjusted to 3 mg/ml in 5 mM Tris, pH 7.4 and 0. I mM EDTA.
  • mice six weeks of age are induced to superovulate.
  • the superovulating females are placed with males and allowed to mate.
  • the mated females are sacrificed and embryos are recovered from excised oviducts and placed in an appropriate buffer, e.g., Dulbecco's phosphate buffered saline with 0.5% bovine serum albumin (BSA; Sigma).
  • BSA bovine serum albumin
  • Pronuclear embryos are then washed and placed in Earle's balanced salt solution containing 0.5 % BSA in a 37.5oC incubator with a humidified atmosphere at 5% CO2, 95% air until the time of injection. Embryos can be implanted at the two-cell stage.
  • Embryos to be transferred are placed in DPBS (Dulbecco's phosphate buffered saline) and in the tip of a transfer pipette (about 10 to 12 embryos). The pipette tip is inserted into the infundibulum and the embryos transferred. After the transfer, the incision is closed by two sutures. The pregnant animals then give birth to the founder animals which are used to establish the transgenic line.
  • Polypeptides and/or polynucleotides of the invention may be administered in any suitable manner using an appropriate pharmaceutically acceptable vehicle, e.g., a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.
  • a pharmaceutically acceptable diluent e.g., a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.
  • Liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media are preferred. Any diluent known in the art may be used.
  • Exemplary diluents include, but are not limited to, water, saline solutions, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol, calcium phosphate, mineral oil, and cocoa butter.
  • Such formulations are useful, e.g., for administration of polypeptides or polynucleotides of the invention to mammalian (including human) subjects in therapeutic regimens.
  • composition to be administered according to methods of the invention preferably comprises (in addition to the polynucleotide or vector) a pharmaceutically acceptable carrier solution such as water, saline, phosphate buffered saline, glucose, or other carriers conventionally used to deliver therapeutics intravascularly.
  • a pharmaceutically acceptable carrier solution such as water, saline, phosphate buffered saline, glucose, or other carriers conventionally used to deliver therapeutics intravascularly.
  • Multi gene therapy is also contemplated, in which case the composition optionally comprises both the polynucleotide of the invention/vector and another polynucleotide/vector selected to treat mitochondrial disorders or their symptoms.
  • the "administering" that is performed according to the present method may be performed using any medically-accepted means for introducing a therapeutic directly or indirectly into the vasculature of a mammalian subject, including but not limited to injections (e.g., ⁇
  • administration of the composition comprising a polynucleotide of the invention is performed intravascularly, such as by intravenous, intra-arterial, or intracoronary arterial injection.
  • the therapeutic composition may be delivered to the patient at multiple sites.
  • the multiple administrations may be rendered simultaneously or may be administered over a period of several hours. In certain cases it may be beneficial to provide a continuous flow of the therapeutic composition. Additional therapy may be administered on a period basis, for example, daily, weekly or monthly.
  • preferred methods of administration are methods of local administration, such as administration by intramuscular injection.
  • the unit dose may be calculated in terms of the dose of viral particles being administered.
  • Viral doses include a particular number of virus particles or plaque forming units (pfu).
  • particular unit doses include 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 ' 10 10 , 10 11 , 10 12 , 10 13 or 10 14 pfu.
  • Particle doses may be somewhat higher (10 to 100 fold) due to the presence of infection-defective particles.
  • preferred polynucleotides still include a suitable promoter and polyadenylation sequence as described above.
  • the polynucleotide further includes vector polynucleotide sequences (e.g., adenoviral polynucleotide sequences) operably connected to the sequence encoding a polypeptide of the invention.
  • kits which comprise compounds or compositions of the invention packaged in a manner which facilitates their use to practice methods of the invention.
  • a kit includes a compound or composition described herein as useful for practice of the invention (e.g., polynucleotides or polypeptides of the invention), packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes use of the compound or composition to practice the method of the invention.
  • the compound or composition is packaged in a unit dosage form.
  • a kit of the invention includes a composition of both a polynucleotide or polypeptide packaged together with a physical device useful for implementing methods of the invention, such as a stent, a catheter, an extravascular collar, a polymer film, a bandage, a suture or the like.
  • a kit of the invention includes compositions of both a polynucleotide or polypeptide of the invention packaged together with a hydrogel polymer, or microparticle polymers, or other carriers described herein as useful for delivery of the polynucleotides or polypeptides to the patient,
  • AOX cDNA (SEQ ID NO:1) obtained from the ascidian Ciona intestinalis was ligated directly into the doxycyclin-inducible mammalian vector pCDNA5/FRT/TO vector, either with or without an epitope tag.
  • GJ247 (SEQ ID NO:7):
  • GJ248 (SEQ ID NO:8):
  • GJ249 (SEQ ID NO:9): 5 1 GGCCGCGGATTACAAGGATGACGACGATAAGTGAS' (SEQ ID NO:9) plus
  • GJ250 (SEQ ID NO:10): 5 1 TCGATCACTTATCGTCGTCATCCTTGTAATCCGCS' (flag)
  • GJ241 (SEQ ID NO:11): 5'GGGAAGCTTCCACCATGTTGTCTACCGGAAGTAAAACS' plus
  • GJ242 (SEQ ID NO:12): 5'GGGGTACCGAGAGTATAACCAGAAAAAACS' on cieg032gl4, and
  • GJ243 (SEQ ID NO:13):
  • GJ244 (SEQ ID NO:14):
  • GJ 245 (SEQ ID NO: 15): 5'GGGGCGGCCGCTATTGTCCAGGTGGATAAGGATTC3 I on ciclO22cO3.
  • Flp-InTM T-RExTM-293 cells which are commercially available human embryonic kidney derived cells, were cultured in standard DMEM medium supplemented with 200 ⁇ M uridine and 2 rnM pyruvate and 5% TET free foetal bovine serum (Ozyme) (Spelbrink et al., J. Biol. Chem., 275:24818-24828, 2000) plus appropriate antibiotics for transgene selection, and transfected with the pcDNA5/FRT/TO-AOX expression constructs of Example 1 or with the empty vector using LipofectamineTM (Invitrogen) according to the manufacturer's instructions.
  • Ozyme TET free foetal bovine serum
  • Cell lysates were prepared and analyzed for AOX expression by immunoblotting after SDS polyacrylamide gel electrophoresis.
  • Primary antibodies used were: mouse anti-Myc monoclonal 9E10 (Roche Molecular Biochemicals) and anti-flag M2 antibody (Stratagene).
  • Peroxidase conjugated goat anti-mouse IgG (Vector Laboratories, Inc.) was used as secondary antibody (Spelbrink et al., J. Biol. Chem., 275:24818-24828, 2000).
  • Total SOD activity (EC 1.15.1.1; Mn- and CuZn-dependent enzymes) was determined by the pyrogallol autoxidation assay, 50% decrease of the autoxidation rate by SOD being defined as 1 U (Roth and Gilbert, Anal. Biochem., 137:50-53, 1984). Results were expressed as U/mg protein.
  • AOX has been shown to act as an anti-oxidant enzyme by preventing the superoxide production resulting from a highly reduced quinone pool (Maxwell et al., Proc. Natl. Acad. Sci. USA, 96:8271-8276, 1999).
  • Pyruvate is known as an allosteric effector of the plant mitochondria AOX, and is of great importance in mitochondrial diseases (Stacpoole et al., N. Engl. J. Med., 298:526-530, 1978). Experiments were conducted to determine if this organic acid, also affected the expressed C. intestinalis AOX. The cyanide-sensitivity of succinate oxidation under state 4 conditions was therefore compared in permeabilized AOX-induced cells in the absence or presence of pyruvate, plus rotenone ( Figure 2A, traces d, g). This latter inhibitor, specific to complex I, was added in order to block the NADH reoxidation required for sustained oxidation of the added pyruvate.
  • AOX expression relieves the metabolic acidosis resulting from enhanced pyruvate reduction to lactic acid, which is the cell's only available means of reoxidizing NADH, when the cytochrome chain is not functional.
  • the AOX cDNA (SEQ ID NO:1) from Ciona intestinalis was recloned in a customized Drosophila P-element vector (based on the Pelican series of vectors (Barolo et al., Biotechniques, 29:726-732, 2000) with the transgene flanked by insulator elements to prevent readthrough transcription into or from insertion site genes, and placed under the control of a minimal promoter dependent upon transactivation by the yeast transcriptional activator Gal4p (Figure 3).
  • AOX was C-terminally Myc epitope- tagged (SEQ ID NO:5).
  • AOX line F6-1 The genomic insertion sites of the AOX transgenes were identified using standard inverse PCR, with results as illustrated in Figure 5 for one of the lines (AOX line F6-1). This line was viable and fertile as a homozygote and had a single AOX transgene insertion in the 2nd chromosome. Line F6-1 was used for the subsequent studies, in each case alongside one or more other AOX transgenic lines, to verify that the phenotypes observed were attributable to AOX and not to an insertional or other mutagenic effect in a single transgenic line. Transgenic founders were bred to G ⁇ /4-driver flies carrying GAL4 under the control of the ubiquitously acting promoter of the daughterless gene.
  • AOX- or AOX myc-expressing flies developed, enclosed in the predicted numbers and appeared healthy.
  • Figure 6A illustrates the cross, which was set up using the daughterless-GAL4 driver to express AOX ubiquitously.
  • Figure 6B illustrates how the expressing flies were identified phenotypically, and that they are viable and phenotypically normal.
  • Figure 7 illustrates how expression of the AOX transgene at the RNA level was verified, i.e. using in situ hybridization.
  • Figure 8 illustrates the confirmation of expression of AOX-myc, using Western blotting to an anti-myc antibody, in whole flies where AOX-myc expression is induced by the da- GAL4 driver.
  • AOX-expressing flies of both sexes appeared morphologically normal and were fertile, producing normal numbers of progeny when mated to non-transgenic flies.
  • AOX- expressors showed a very slight developmental delay compared with control flies (Table 2).
  • AOX-expressing (A0X+) males eclosed half a day later at 25 °C than non-expressing (AOX-) control males; there was a less pronounced differences in eclosion time of females, although the difference is still significant (p>0.001 by Student's ttest), due to the high number of replicate measurements.
  • AOX transgenic flies appeared to be as long- lived as the most long-lived wild-type strains (maximum lifespan -105 days).
  • AOX-expressor and AOX transgenic 'non-expressor' males both lived significantly longer than control, wild-type males.
  • the 'non-expressor' males were consistently more long-lived than expressor males, suggesting that a low level of AOX expression might be beneficial for promoting long and healthy lifespan.
  • Different AOX transgenic lines showed male lifespan extension to different extents. Transgene insertion sites may therefore be influencing the outcome.
  • AOX-transgenic virgin females also showed a minimal lifespan extension in this assay.
  • Figure 9 shows that AOX-expressor flies underwent a more rapid and more pronounced weight loss than control flies during the first weeks of adult life: this is a further indication that the efficiency of mitochondrial energy generation is slightly decreased, for a given food intake. If this observation is shown to apply also in mammals, it indicates a utility of AOX in the treatment of otherwise intractable obesity. Unlike conventional and discredited treatments with uncoupling agents, which have highly deleterious side-effects, AOX represents a completely natural and self-regulating by-pass of the OXPHOS system. Moreover, since restricted food intake is known to prolong lifespan in flies (Bross et al., Aging Cell, 4:309-317, 2005; Piper et al., Exp.
  • AOX activity in mitochondria from AOX-expressing flies AOX activity in mitochondria from AOX-expressing flies.
  • Ciona intestinalis AOX expressed in Drosophila is enzymatically active, and exhibits similar properties as in human cells.
  • Figure 10 shows that the AOX-expressing flies showed a pronounced resistance to potassium cyanide, remaining viable for up to several hours on medium containing the toxin at concentrations which kill wild-type flies within minutes.
  • Figures 11 and 12 show a set of representative oxygen electrode traces, using mitochondrial suspensions from whole flies. Mitochondrial preparations from AOX-expressing and non-expressing flies were compared for sensitivity to respiratory chain inhibitors in the presence of various substrates.
  • AOX protects flies from respiratory chain poisoning
  • AOX-expressing flies showed a pronounced resistance to the toxic effects of potassium cyanide, remaining viable for several hours on medium containing the toxin at concentrations which kill wild-type flies within minutes ( Figure 13). Even at 1 mM KCN, AOX-expressing flies, which were completely paralysed within 30 min, survived the treatment and were active again after 16 hours. AOX-expressing flies were also resistant to the complex III inhibitor antimycin, which was toxic to wild-type flies when added to fly food ( Figure 14). At a dose of 10 ⁇ g/ml, wild-type embryos hatched to form larvae, but never reached pupal stage, whereas AOX-expressing larvae developed normally to adult flies.
  • antimycin completely blocked the development of wild-type flies even to larval stage, but AOX-expressing flies were able to complete development and form viable fertile adults, even though the completion of development was delayed by several days. AOX expression also afforded a protection against moderate doses of oligomycin, an inhibitor of complex V (ATP synthase).
  • Ciona intestinalis AOX cDNA cloned into the vector pcDNA5/FRT/TO (Invitrogen) as described in Example 1 above was recloned in two steps as a Smal fragment via blunt- end cloning in the Pmel site of lentivector pWPI (Addgene, Cambridge, MA, USA; Kvell et al., MoI. Ther., 12:892-899, 2005) to create a construct pWPI-AOX ( Figure 15).
  • pWPI not only affords an opportunity to establish stable, single-copy insertion and sustained expression of the transgene. It also allows easy and non-invasive detection of successfully transduced cells (Kvell et al., MoI.
  • transgene is inserted upstream of the coding sequence of an inert reporter (GFP) in cis in the same mRNA, preceded by an internal ribosome entry site (IRES).
  • GFP inert reporter
  • IRES internal ribosome entry site
  • Example 8 Viral packaging, cell culture and transduction of a human cell culture
  • Virus production used standard procedures (Bovia et al., Blood, 101:1727-1733, 2003; Zufferey et al., Nat. Biotechnol., 15:871-875, 1997), and the second-generation packaging system, which incorporates inbuilt safety features (www.lentiweb.com/protocols lentivectors.php). as described previously (Pellinen et al., Int. J. Oncol, 25:1753-1762, 2004).
  • Flp-InTM T-RExTM-293 cells (Invitrogen) were cultured in standard DMEM medium supplemented with 200 ⁇ M uridine, 2 mM pyruvate and 5% TET-free foetal bovine serum (Ozyme).
  • GFP expressing Flp-InTM T-RExTM-293 cells from Example 8 were sorted by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA, USA) according to manufacturer's instructions. Cells were analysed for GFP expression using an Olympus BX61 Live Imaging station, using simultaneous illumination with a Krypton lamp (excitation filter 492/18 nm) and white light (halogen lamp). Excitation fluorescence and transmitted light were detected simultaneously by a 4Ox LUMPlanFl water- immersion objective (numerical aperture 0.8), fitted with Hamamatsu Orca ER (high resolution Digital B/W CCD) camera, in order to distinguish GFP -expressing (bright) and non-expressing cells (less bright).
  • FACS fluorescence- activated cell sorting
  • the transcript was longer (4.1 kb as opposed to 1.8 kb, reflecting the additional presence of the IRES, GFP and additional 3' untranslated sequences), and present at much lower abundance, approximately two orders of magnitude, reflecting expression from a physiologically more relevant promoter (EF l ⁇ , as opposed to CMV immediate early) plus the fact that lentiviral transduction results in single genomic insertions rather than integrated tandem arrays of plasmid-derived sequences.
  • Multiple batches of transduced cells sorted on the basis of GFP expression gave similar expression at the mRNA level.
  • Flp-InTM T-RExTM-293 cells transfected with the empty vector gave no signal.
  • Respiration in digitonin-permeabilized cells was measured as previously (Hakkaart et al., EMBO Rep., 7:341-345, 2006), using a Clark oxygen electrode (Hansatech, UK), and as inhibitors potassium cyanide (KCN) to 100 ⁇ M and «-propyl gallate (PG) to 10 ⁇ M.
  • KCN potassium cyanide
  • PG propyl gallate
  • the AOX coding sequence is introduced into the mouse germ-line via a knock-in strategy, replacing the coding sequence of a gene whose product is targeted to mitochondria and which participates in the OXPHOS system, but which can be heterozygously deleted with only a mild phenotypic effect. This ensures that the AOX transgene will be expressed in a 'typical mitochondrial pattern', and overcomes many of the problems associated with random transgenic insertions.
  • the mouse Tfam (mitochondrial transcription factor A) gene is a suitable such replacement target (Larsson et al., Nature Genetics, 18:231-236, 1998), since Tfam heterozygous mice show only reduced mitochondrial DNA copy number and a mild biochemical defect in heart, but no overt pathological signs.
  • a typical gene targeting vector is used, such as the pDELBOY series or variants thereof. Because it is desired to study AOX expression in specific tissues and developmental stages, as well as to test rigorously if it can be tolerated in the whole organism, a STOP cassette (Lakso et al., Proc. Natl. Acad. Sci.
  • AOX expression in the substantia nigra is a way to test not only whether AOX expression produces any deleterious effects in that tissue, but also whether AOX expression restricted to that tissue compensates for a pathological phenotype that manifests there, in a given disease model.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Environmental Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/FI2006/000348 2005-11-01 2006-11-01 Alternative oxidase and uses thereof Ceased WO2007051898A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2008538372A JP2009513153A (ja) 2005-11-01 2006-11-01 末端酸化酵素及びその使用
EP06807975.5A EP1965829B1 (en) 2005-11-01 2006-11-01 Alternative oxidase and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US73233305P 2005-11-01 2005-11-01
US60/732,333 2005-11-01

Publications (1)

Publication Number Publication Date
WO2007051898A1 true WO2007051898A1 (en) 2007-05-10

Family

ID=38005473

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2006/000348 Ceased WO2007051898A1 (en) 2005-11-01 2006-11-01 Alternative oxidase and uses thereof

Country Status (3)

Country Link
EP (1) EP1965829B1 (cg-RX-API-DMAC7.html)
JP (1) JP2009513153A (cg-RX-API-DMAC7.html)
WO (1) WO2007051898A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010040901A1 (en) * 2008-10-07 2010-04-15 Pierre Rustin Alternative oxidase and uses thereof
WO2014096437A1 (en) * 2012-12-21 2014-06-26 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Alternative oxidase (aox) prevents smoking-associated lung damage

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103562379A (zh) * 2011-05-19 2014-02-05 国立大学法人德岛大学 细胞分化诱导剂以及分化诱导方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000044920A1 (en) * 1999-01-29 2000-08-03 Pioneer Hi-Bred International, Inc. Maize alternative oxidase genes and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000044920A1 (en) * 1999-01-29 2000-08-03 Pioneer Hi-Bred International, Inc. Maize alternative oxidase genes and uses thereof

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
CHEN; OKAYAMA, MOL. CELL BIOL., vol. 7, 1987, pages 2745 - 2752
FECHHEIMER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 8463 - 8467
FELGNER, HUM. GENE THER., vol. 7, no. 15, 1996, pages 1791 - 3
FELGNER, SCI. AM., vol. 276, no. 6, 1997, pages 102 - 6
FRALEY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 3348 - 3352
GOPAL, MOL. CELL BIOL., vol. 5, 1985, pages 1188 - 1190
HAKKAART G. ET AL.: "Allotropic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration", EMBO REPORTS, vol. 7, no. 3, March 2006 (2006-03-01), pages 341 - 345, XP003013235 *
HARLAND; WEINTRAUB, J. CELL BIOL., vol. 101, 1985, pages 1094 - 1099
LORIN S. ET AL.: "Overexpression of the alternative oxidase restores senescence and fertility in a long-lived respiration-deficient mutant of Podospora anserina", MOLECULAR MICROBIOLOGY, vol. 42, no. 5, December 2001 (2001-12-01), pages 1259 - 1267, XP003012718 *
MCDONALD A.E. ET AL.: "Branched mitochondrial electron transport in the animalia: presence of alternative oxidase in several animal phyla", IUBMB LIFE, vol. 56, no. 6, June 2004 (2004-06-01), pages 333 - 341, XP008080500 *
NICOLAU; SENE, BIOCHIM. BIOPHYS. ACTA, vol. 721, 1982, pages 185 - 190
POTTER ET AL., PROC. NAT. ACAD. SCI. USA, vol. 81, 1984, pages 7161 - 7165
RIPPE ET AL., MOL. CELL BIOL., vol. 10, 1990, pages 689 - 695
See also references of EP1965829A4
TANUDJI M. ET AL.: "Singnals required for the import and processing of the alternative oxidase into mitochondria", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 3, January 1999 (1999-01-01), pages 1286 - 1293, XP003012719 *
TUR-KASPA ET AL., MOL. CELL BIOL., vol. 6, 1986, pages 716 - 718
VAN DER EB, VIROLOGY, vol. 52, 1973, pages 456 - 467
WU; WU, ADV. DRUG DELIVERY REV., vol. 12, 1993, pages 159 - 167
WU; WU, BIOCHEMISTRY, vol. 27, 1988, pages 887 - 892
WU; WU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432
YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 9568 - 9572

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010040901A1 (en) * 2008-10-07 2010-04-15 Pierre Rustin Alternative oxidase and uses thereof
WO2014096437A1 (en) * 2012-12-21 2014-06-26 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Alternative oxidase (aox) prevents smoking-associated lung damage

Also Published As

Publication number Publication date
EP1965829A4 (en) 2009-05-13
EP1965829A1 (en) 2008-09-10
EP1965829B1 (en) 2014-10-01
JP2009513153A (ja) 2009-04-02

Similar Documents

Publication Publication Date Title
Cowling et al. Amphiphysin (BIN1) negatively regulates dynamin 2 for normal muscle maturation
Iacovelli et al. Generation of Cre transgenic mice with postnatal RPE-specific ocular expression
Bierkamp et al. Embryonic heart and skin defects in mice lacking plakoglobin
Semenova et al. An engineered 800 kilobase deletion of Uchl3 and Lmo7 on mouse chromosome 14 causes defects in viability, postnatal growth and degeneration of muscle and retina
CA2375106C (en) Compositions and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis, and abnormal cell proliferation
US20100022628A1 (en) Alternative oxidase and uses thereof
WO2010040901A1 (en) Alternative oxidase and uses thereof
Gothilf et al. Pineal‐specific expression of green fluorescent protein under the control of the serotonin‐N‐acetyltransferase gene regulatory regions in transgenic zebrafish
EP1965829B1 (en) Alternative oxidase and uses thereof
Bennett et al. RAX is required for fly neuronal development and mouse embryogenesis
US8852928B2 (en) LexA-based chemical-inducible gene expression system for use in transgenic animals
JP2009513153A5 (cg-RX-API-DMAC7.html)
EP1456375B1 (en) Screening methods employing fish model assessment of vision
CA2284833A1 (fr) Animal transgenique non humain dans lequel l'expression du gene codant pour l'insuline est supprimee
AU736492B2 (en) Vertebrate embryonic pattern-inducing hedgehog-like proteins
US20140033333A1 (en) Transgenic pig for mutant gucy2d as cone dystrophy model
Chen Using transgenic Drosophila model to study the mechanism of APOL1-associated cytotoxicity
ES2338971B1 (es) Modelo animal para el estudio de la angiogenesis y linfoangiogenesis in vivo.
O'Day Genetic Analysis of the Function of the Drosophila doublesex-Related Factor dmrt93B
US7556964B2 (en) Transgenic cell and gene recombinant animal having a mutant SDHC gene derived from mammals
Meng Role of an intronic enhancer in the regulation of myelin proteolipid protein gene expression
West Transgenic and Gene-Targeted Mouse Models for Pulmonary Hypertension
CA2304823A1 (en) Regulation of gene expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006807975

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008538372

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWP Wipo information: published in national office

Ref document number: 2006807975

Country of ref document: EP