WO2010040901A1 - Alternative oxidase and uses thereof - Google Patents

Abstract

The invention relates to a method for combating disorders affecting the mitochondrial oxidative phosphorylation system by allotopic expression of the cyanide- insensitive alternative oxidase (AOX) in human cells. The successful expression of AOX in human cells and in Drosophila has been shown to confer spectacular cyanide-resistance to mitochondrial substrate oxidation, alleviate oxidative stress, apoptosis susceptibility and metabolic acidosis. AOX is well tolerated when expressed ubiquitously in the whole organism. AOX expression is a valuable tool to limit the deleterious consequences of respiratory chain deficiency.

Description

ALTERNATIVE OXIDASE AND USES THEREOF

Cross-Reference to Related Applications

[0001] This applications claims the benefit of priority of U.S. Provisional Application Nos. 61/103,441 and 61/141,613, filed October 7, 2008 and December 30, 2008, respectively. The disclosure of each priority docuent is hereby incorporated herein by reference in its entirety.

Field of the invention

[0002] The invention relates to a cDNA encoding a cyanide-insensitive alternative oxidase (AOX); constructs and compositions comprising the cDNA; and to a method for limiting the deleterious consequences of respiratory chain deficiency by means of allotopic expression of the AOX in mitochondria in mammalian or human cells or in a whole organism. By using the method deleterious consequences of blockage of the oxidative phosphorylation system is overcome and a route to gene therapy of mitochondrial disease and ageing is provided.

Background of the invention

[0003] Since the pioneering work of Otto Warburg in 1919 (Warburg, 1919), it has been known that cyanide-resistant respiration differentiates most plants and micro-organisms from mammals and other higher animals. Cyanogenic compounds are thus among the most frequently encountered poisons in nature to resist animal predators (Tattersall et al., 2001). Plants and microorganisms are endowed with various components conferring cyanide-resistance, including an unusual, cyanide -resistant mode of respiration. This alternative respiration generally relies on the presence of a unique protein, the so-called alternative oxidase (AOX), which conveys electrons directly from the quinone pool of the mitochondrial respiratory chain (RC) to oxygen, hence by-passing entirely the cytochrome segment of the chain (Figure IA) (Affourtit et al., 2002), thereby strongly diminishing proton extrusion linked to substrate oxidation, concomitantly decreasing ATP production. In plants, it therefore prevents the repression of mitochondrial substrate oxidation by high ATP levels resulting from the phosphorylating activity of chloroplasts (Rustin, 1985).

[0004] In addition, AOX is considered to act as an antioxidant protein by preventing over-reduction of the mitochondrial quinone pool, which is known to favour superoxide production (Lam et al., 2001; Maxwell et al., 1999). In plants, any significant involvement of the AOX protein in electron flow is triggered only by very peculiar conditions. First, it requires a pronounced reduction of the quinone pool due to the low affinity of the AOX for its quinol substrate (Bahr and Bonner, 1973), and second, the presence of a subset of organic acids, chiefly pyruvate, which regulate the enzyme allosterically (Umbach et al., 2002). Reduced redox status of the RC and a high pyruvate level are the exact conditions resulting from inherited human metabolic disorders localized to the cytochrome segment of the mitochondrial RC (Munnich, 2001). Based on this observation, it has been a longstanding goal of the inventors to express AOX in human cells, with the aim of achieving a potential rescue of electron flow and mitigating the deleterious consequences of pathological RC deficiency. The first attempts to express plant AOX genes in human cells led to apparently uncontrolled lethality (P.Rustin., unpublished data). Even if a genome database search by Vanlerberghe and colleagues suggested the occurrence of AOX in several animal phyla (McDonald and Vanlerberghe, 2004), the goal was not achieved and thus, the solution to the problem of expressing the AOX genes in human cells remained unsolved. More generally, a need exists for new materials and methods for treating or mitigating the effects of a variety of disorders and conditions related to RC deficiency. A need also exists for methods of prophylaxis therapy (prophylaxis; preventative therapy) to prevent or delay the onset of such disorders and conditions and their symptoms and pathological features.

[0005] The OXPHOS system (Smeitmk, et al., Nat. Rev. Genet. 2, 342-352, 2001 is usually considered to comprise the five multisubunit complexes involved in respiratory electron flow and ATP synthesis, four of which (complexes I, III, IV and V) include subunits encoded by mitochondrial DNA. Electron transfer through complexes I (NADH ubiquinone oxidoreductase), III (ubiquinol: cytochrome c oxidoreductase) and IV (cytochrome c oxidase, COX) is accompanied by proton-pumping across the inner mitochondrial membrane in which the complexes are embedded, and which creates the electrochemical gradient used to drive ATP synthesis by complex V (ATP synthase). Several non proton-pumping dehydrogenases, such as complex II (succinate ubiquinone oxidoreductase, or succinate dehydrogenase, SDH), feed electrons directly into the downstream portion of the respiratory chain, the cytochrome-containing complexes III and IV. [0006] Mitochondrial OXPHOS dysfunction and various diseases can result from deficiency or dysfunction of any of these components, including both structural subunits of the OXPHOS complexes, proteins involved in OXPHOS biosynthetic machinery; the entire apparatus of mitochondrial DNA maintenance and expression; and the enzymes and chaperones needed for co factor biosynthesis and assembly (Smeitink, et al., Nat. Rev. Genet. 2, 342-352, 2001). Collectively, these comprise over 200 different gene products. OXPHOS inhibition can also result from the action of toxins which target specific enzymatic steps, such as complex I (rotenone), III (antimycin), IV (cyanide, KCN) or V (oligomycin). OXPHOS dysfunction can, in principle, entrain a range of metabolic disturbances in addition to the bioenergy deficit implied by decreased ATP production, and these may underlie many of the pathological manifestations of OXPHOS disease (Smeitink et al., Cell Metab. 3, 9-13, 2006). Inhibition of electron flow can result in the excess production of reactive oxygen species (ROS) at complexes I and/or III, if the quinone pool becomes over-reduced. When normal electron flow is interrupted, electrons are instead donated in an inappropriate side-reaction to molecular oxygen, creating the superoxide anion which is then further processed to other forms of ROS. Excessive ROS production can lead to damage of lipids, proteins, carbohydrates and nucleic acids. If such damage is not repaired, the functional loss or death of vital cells may result. A second side-effect of respiratory chain inhibition is the need to recruit cytosolic shunts for the reoxidation of NADH, notably lactate dehydrogenase, which converts pyruvate to lactate. The resulting production of lactic acid leads to cellular and systemic acidosis, which is believed to underlie many of the damaging pathological manifestations of OXPHOS disease.

[0007] Limitations on NADH reoxidation, as well as on the biochemical reaction of complex II, one of the steps of the TCA cycle, may lead to a severe disturbance of metabolism. Potential secondary effects include additional depletion of ATP, impaired supply of carbon skeletons for biosynthesis, and deranged calcium homeostasis.

Summary of the Invention

[0008] The present application provides improvements, new materials, and new uses relating to the invention described in U.S. Patent Application No. 11/591,847 (published as US 2008/0103088) and International Application No. PCT/FI2006/00348 (published as WO 2007/051898), all of which are incorporated herein y reference in their entirety. [0009] In the present invention it is demonstrated that allotopic expression in cells of alternative oxidase (AOX) from the marine invertebrate Ciona intestinalis protects cells against the major deleterious consequences of mitochondrial oxidative phosphorylation (OXPHOS) dysfunction. These include inhibition of substrate oxidation, metabolic acidosis (via the need to reoxidize NADH through lactate dehydrogenase instead of through the respiratory chain) and the overproduction of oxygen radicals leading to cellular damage or cell death (apoptosis). Since excessive accumulation of mitochondrial DNA (mtDNA) mutations has been shown to induce the features of premature aging, it is expected that AOX expression should limit or prevent or slow the above consequences, thereby possibly delaying (slowing the deterious effects of) aging, increasing lifespan or improving the quality of life.

[0010] To be of use as a therapeutic strategy, AOX expression should be tolerated by the whole organism without dramatic and harmful physiological effects. In the present invention, the feasibility of AOX expression was demonstrated in a whole organism animal model. The test was carried out using the fruit fly Drosophila melanogaster as a model system. In the present invention it was demonstrated that AOX expression was tolerated throughout Drosophila development, having no significant deleterious effects on phenotype, and afforded the same protection against respiratory chain dysfunction as in cultured human cells.

[0011] In order to explore the potential of the AOX expression as a gene therapy tool in humans and other mammals, a versatile expression system, which allows AOX to be stably expressed at typical levels for a mammalian gene, over long periods, was developed. It was demonstrated that AOX expression is maintained for weeks following lentivector-based transduction of human HEK293 -derived cells, without any apparent deleterious effects on cell growth. Lentivector AOX-expressing cells were shown to exhibit cyanide-insensitive respiration, which is sensitive to propyl gallate. Lentivector- transduced AOX is thus suitable as a tool for creating a by-pass of the respiratory chain in diverse mammalian models of metabolic disease.

[0012] Described herein as a new embodiment of the invention, with many variations, are materials and methods for prophylaxis of many diseases or conditions having impaired mitochondrial function (especially impaired OXPHOS function). [0013] In one aspect, the invention provides a method for prophylaxis therapy (prophylaxis) for a subject at risk for developing a disease associated with mitochondrial OXPHOS dysfunction. In some variations, the method involves administering the therapeutic (prophylactic) agent to a subject that has been identified as a candidate for therapy (e.g., from examination, medical testing, genetic testing, laboratory tests, and the like). For example, the invention includes a method for prophylaxis therapy (prophylaxis) for a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction comprising: administering to a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, who has not been diagnosed with such a disorder, an effective amount of a therapeutic selected from the group consisting of: (i) a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein; and (ii) a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein.

[0014] Other variations of the invention include one or more steps relating to diagnosis/prognosis or selection of subjects that are candidates expected to benefit from the prophylaxis of the invention. For example, in another variation, the invention includes a method that comprises identifying a subject as a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction; and administering to the subject an effective amount of a therapeutic selected from the group consisting of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein; and a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein. In some embodiments, the subject has not been diagnosed as having a disorder associated with mitochondrial OXPHOS dysfunction.

[0015] In some embodiments, the disorder associated with mitochondrial OXPHOS dysfunction is selected form the gorup consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease; mitochondrial encephalomyopathies; progressive external ophthalmoplegia, Kearns-Sayre syndrome; MELAS syndrome; amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia; other ataxias and neurological conditions resulting from genetics defects in POLG, clOorf2 (Twinkle) or other components of the system of mitochondrial DNA maintenance; syndromic mitochondrial hearing impairment; nonsyndromic mitochondrial hearing impairment; intractable obesity; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; and Lactic acidemia. (Although the disorders are set forth in a list, prophylaxis or therapy of each disorder is individually contemplated as an aspect of the invention.)

[0016] The subject can be identified as a subject at risk in various ways. For example, in some embodiments, the subject is identified as being at risk because the subject has a relative that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction. In some embodiments, the subject has a genetic parent, a genetic sibling (sibling with a common genetic parent), genetic grandparent or genetic cousin (common genetic grandparent) that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

[0017] In some embodiments, the identifying step of the methods described herein comprises screening for the presence of a mutation in the genome of the subject that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction. The screening may comprise obtaining a biological sample from the subject and analyzing nucleic acid (e.g., mitochondrial DNA) from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction. In some embodiments, the gene is associated with proper assembly of cytochrome c oxidase (OXPHOS complex IV). In some embodiments, the gene is associated with proper assembly of OXPHOS complex III.

[0018] For the purposes of the invention, reduced function of a candidate gene can refer to aberrant transcription/translation; and can also refer to aberrant function of the gene product (e.g., protein) encoded by the gene. For example, some mutant genes will be properly transcribed and translated, but will encode mutant forms of the protein (due to missense or nonsense genetic mutations, for example) with reduced (or lost) function relative to wildtype protein.

[0019] Various genes, including but not limited to, DJl, Cox 10, Scol, Sco2, MTCOXl, MTC0X2, MTC0X3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL have been found to be associated with OXPHOS dysfunction. Specifically contemplated as aspects of the invention include prophylaxis methods comprising identifying subjects for treatment with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein (or cells tranformed or transfected with the polynucleotide) by first identifying mutations in a gene(s) associated mitochondrial OXPHOS function (wherein the mutation in the gene causes or is correlated with mitochondrial OXPHOS dysfunction).

[0020] In some embodiments, the identifying step of the methods described herein comprises screening for the presence of a mutation in a gene selected from the group consisting of DJl, Cox 10, Scol, Sco2, MTCOXl, MTC0X2, MTC0X3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL.

[0021] In one embodiment, the gene is DJl and the method comprises screening for a missense mutation causing a DJl amino acid mutation (e.g., substitution) selected from the group consisting of C106E, C106D, L166P, M25I, A104T, and D149A. In another embodiment, the gene is Cox 10 and the method comprises screening for a missense mutation causing a Cox 10 gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A121 IT and A121 IG. In another embodiment, the gene is Cox 10 and the method comprises screening for a missense mutation causing a Cox 10 amino acid mutation (e.g., substitution) selected from the group consisting of T196K, P225L, D336V and D336G In another embodiment, the gene is SCOl and the method comprises screening for a missense mutation causing a SCOl gene C520T mutation. In another embodiment, the gene is SCOl and the method comprises screening for a missense mutation causing a SCOl P174L amino acid mutation (e.g., substitution). In yet another embodiment, the method comprises screening for a missense mutation causing a SCO2 amino acid mutation (e.g., substitution) selected from the group consisting of E140K, R90X, and R171W.

[0022] In yet another embodiment, the gene is Cox 15 and the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C. In another embodiment, the gene is Cox 15 and the method comprises screening for a missense mutation causing a Cox 15 amino acid mutation (e.g., substitution) selected from the group consisting of R217W and F374L. In yet another embodiment, the gene is Surfl and the method comprises screening for a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T. In another embodiment, the gene is Surfl and the method comprises screening for a missense mutation causing a Surfl Q82X amino acid mutation (e.g., substitution).

[0023] In some embodiments, the identifying comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction in the subject. In some embodiments, the identifying step of the methods described herein comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of OXPHOS dysfunction in the subject. In some embodiments, the identifying step of the methods described herein comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of OXPHOS dysfunction in the subject. In some embodiments, the identifying step of the methods described herein comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of OXPHOS dysfunction in the subject. In some embodiments, the identifying step of the methods described herein comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction in the subject. [0024] The various techniques for identifying/selecting subjects as candidates for prophylaxis are not mutually exclusive. Thus, variations of the invention include analysis of two, three, four, or more of the aforementioned parameters, e.g., existence of an affected genetic relative; genetic testing for mutations in candidate genes; biochemical testing of gene product activity; biochemical testing of ATP/ ADP or other physiological indictors of OXPHOS function, etc. The existence of two or more diagnostic indicators, e.g., the presence of a mutation combined with existence of an affected relative or biochemical abnormality, increases the stringency of selection (avoidance of false positives).

[0025] Another aspect of the invention provides a method for prophylaxis therapy for a disorder associated with cytochrome c oxidase deficiency. Disorders associated with cytochrome c oxidase deficiency include, but are not limted to, Leigh syndrome, fatal hypertrophic cardiomyopathy (HCMP) with encephalopathy, hepatic failure, tubulopathy with encephalomyopathy and leukodystrophy. Such method comprises identifying a subject having a mutation that is correlated with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Coxl5, and administering to the subject a therapeutic selected from the group consisting of a polynucleotide that encodes an alternative oxidase protein; and a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein. In some embodiments, the subject is identified as being at risk because the subject has a relative that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency. In some embodiments, the subject has a genetic parent, a genetic sibling (sibling with a common genetic parent), genetic grandparent or genetic cousin (common genetic grandparent) that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

[0026] In some embodiments, the identifying step comprises screening for the presence of a mutation in a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15 of the subject, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency. The screening may comprise obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid (e.g., mitochondrial DNA) that correlates with or causes reduced function of at least one gene selected from the group consisting of Surf 1, SCOl, SCO2, Cox 10, and Cox 15, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency.

[0027] In another aspect, the invention provides a method of treating a disorder associated with mitochondrial OXPHOS dysfunction comprising screening a biological sample from a subject suspected of having a disorder associated with mitochondrial OXPHOS dysfunction subject for a mutation that correlated with or causes reduced function of a gene selected from the group consisting of Surf 1, SCOl, SC02, Cox 10, and Cox 15; and administering to the subject a therapeutic selected from the group consisting of a polynucleotide that encodes an alternative oxidase protein; and a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein.

[0028] Another aspect of the invention provides a therapeutic or prophylactic method for treating a disorder associated with mitochondrial OXPHOS dysfunction in a subject comprising identifying a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction; transforming or transfecting cells from the subject ex vivo with a polynucleotide that encodes an alternative oxidase; and administering the transformed or transfected cells to the subject.

[0029] The invention also includes the use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein (or cells transformed or transfected with the polynucleotide) in the manufacture of a medicament for prophylaxis therapy for a subject identified as beng at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction. In a preferred variation, the subject has been identified as being at risk by genetic analysis and identification of a mutation as described elsewhere herein. In another variation, the risk is identified by biocheical analysis (e.g., ATP, ADP or other markers described herein).

[0030] Another aspect of the invention includes the use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein (or cells transformed or transfected with the polynucleotide) in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, wherein the subject has a missense mutation that correlates with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10 and Coxl5.

[0031 ] The invention also includes the use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein (or cells transformed or transfected with the polynucleotide) in the manufacture of a medicament for treatment of a subject identified as having a disorder associated with mitochondrial OXPHOS dysfunction, wherein the subject has a missense mutation that results in reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10 and Cox 15.

[0032] Still another variation of the invention is the use of a genetic and/or biochemical test (as summarized above and described herein in detail) to identify a subject as a candidate for prophylaxis therapy for a disorder associated with mithochondrial OXPHOS dysfunction. In preferred variations, the prophylaxis therapy comprises AOX gene therapy or cell based therapies described herein.

[0033] A polynucleotide that comprises a nucleotide sequence that encodes an alternative oxidase protein is used to practice some aspects of the invention. Alternative oxidases have been identified in the genomes of many species, especially plants, fungi, and microorganisms, and evidence exists for AOX in at least a few animals. The encoded alternative oxidase protein for practice of the invention can be any wildtype AOX that, when transfected into mammalian cells, exhibits AOX activity. As described herein in greater detail, it may be advantageous to use all or a wildtype AOX or only a fragment necessary for conferring AOX activity. In some variations, a sequence coding for a heterologous mitochondrial transit peptide is attached to the sequence coding for a mature AOX protein to facilitate proper transport of the allotopically expressed AOX to the mitochondria. For example, an animal or mammalian mitochondrial transit peptide coding sequence is attached to an AOX coding sequence (minus any native transit peptide sequence) from plant, fungi, microorganism, or non-mammalian animal source. In still other vaiations, the encoded AOX (or AOX fragment) may differ from a wildtype AOX due to addition, deletion, or substitution of amino acids. Asny polypeptide that exhibits alternative oxidase activity in a eukaryotic cell that expresses the polypeptide can be an alternative oxidase protein for purposes of the invention. The ability to do multi-species alignments of AOX sequences provides guidance as to which residues are highly conserved and less susceptible to alteration (especially non-conservative alteration); which residues are variable between species and susceptible to alteration without destroying activity; and which residues are suitable for substitution (e.g., by swapping residues between aligned sequences of different species). All such variations are contemplated for practice of the invention.

[0034] In some embodiments, the polynucleotide comprising the nucleotide sequence that encodes an alternative oxidase protein comprises the DNA sequence shown in SEQ ID NO: 1. The polynucleotide may also be an homologue or an analogue of the nucleotide sequence sequence shown in SEQ ID NO:1, allowing minor additions, substitutions and deletions of the nucleotide sequence in a way which is not detrimental for the functioning of the polypeptide encoded by the DNA sequence, i.e. for the folding or activity of the polypeptide. The homologue is determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The comparison of the nucleotide sequence is performed by using the algorithms known in the art, for example the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof. The cDNA sequences of the present invention are the DNA sequences exhibiting a degree of identity preferably of at least 50%, at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the coding region of the DNA sequence shown in SEQ ID NO: 1.

[0035] In some embodiments, the polynucleotide for use in the methods described herein comprises a nucleotide sequence that encodes a cyanide-insensitive alternative oxidase (AOX) having the amino acid sequence SEQ ID NO:2 or an analogue or a homologue thereof having an amino acid sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the amino acid sequence SEQ ID NO:2 over blocks of at least 135 amino acids. The region of the at least 135 amino acids in dona intestinalis AOX is within the region of amino acids from 140 to 365 in the amino acid sequence SEQ ID NO: 2, the amino acid sequence conserved in different plant, fungal or lower metazoan organisms. The comparison of the amino acid sequences can be performed using standard BLAST algorithms, such as the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof.

[0036] The polynucleotide is not limited to SEQ ID NO: 1 , but may include minor variations, including minor amino acid substitutions, deletions and additions, which are not detrimental for the functioning of the cDNA sequence. Any sequence encoding the same polypeptide (because of genetic code redundancy), any sequence encoding a variant polypeptide with the same biochemical activities (e.g. one having amino acid replacements which do not affect the main function of the enzyme), and also any related AOX sequence from another organism that would encode a polypeptide with the same effects which are predictable on the basis of the present invention. Especially, the 5'- or 3'- terminal end of the sequence may be tagged with flag or myc encoding sequences, as disclosed in SEQ ID NO: 3 and SEQ ID NO:5. Other possible sequences include a nucleotide sequence encoding Green fluorescent protein (GFP) fused to the DNA sequence of SEQ ID NO: 1.

[0037] Preferably, where amino acid substitution is used, the substitution is conservative, i.e. an amino acid is replaced by one of similar size and with similar charge properties.

[0038] As used herein, the term "conservative substitution" denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine for another, or the substitution of one polar or charged residue for another residue with similary polarity or charge, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids that can be substituted for one another include asparagine, glutamine, serine and threonine. The term "conservative substitution" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid.

[0039] Alternatively, conservative amino acids can be grouped as described in Lehninger, (Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY, pp. 71-77 (1975)) as set out in the following: Non-polar (hydrophobic) A. Aliphatic: A, L, I, V, P,

B. Aromatic: F, W,

C. Sulfur-containing: M,

D. Borderline: G. Uncharged-polar

A. Hydroxyl: S, T, Y,

B. Amides: N, Q,

C. Sulfhydryl: C,

D. Borderline: G.

Positively Charged (Basic): K, R, H. Negatively Charged (Acidic): D, E.

[0040] In some embodiments, the polynucleotide for use in the methods described herein comprises a nucleotide sequence that encodes a cyanide-insensitive alternative oxidase (AOX) having the amino acid sequence SEQ ID NO:2 or an analogue or a homologue thereof and hybridizes with SEQ ID NO:1, wherein the hybridization conditions are, for example those as described in Sambrook et al. 1989 or other laboratory manuals. Hybridization with a DNA probe, consisting more than 100-200 nucleotides of SEQ ID NO: 1 or more preferably the entire coding region of SEQ ID NO: 1 is usually performed at high stringency conditions, i.e. hybridization at a temperature, which is 20-25⁰C below the calculated melting temperature Tm of a perfect hybrid. Washes are performed in low salt concentration (e.g. 0. IxSSC) and at a temperature, which is 12-20⁰C below the Tm. Typical conditions for DNA probes greater than 100-200 nucleotides are presented on pages 9.52-9.55 of Sambrook et al. 1989. The hybridization conditions for a a short oligonucleotide probe (or a mix of oligonucleotide probes) are different from those for a DNA sequence comprising more than 100-200 nucleotides. Whereas hybrids formed between longer DNA molecules are essentially stable under the conditions used for posthybridization washings, hybrids involving short oligonucleotides are not. Posthybridization washing of such hybrids must therefore be carried out rapidly so that the probe does not dissociate from its target sequence. Useful hybridization and washing conditions for oligonucleotide probes are presented on pages 11.45-11.46 and 11.55-11.57 of Sambrook et al. 1989. [0041] The polynucleotide described herein encodes an AOX, which when inserted into a human or metazoan cell is allotopically expressed and renders a mitochondrial substrate oxidation cyanide-insensitive, decreases metabolic acidosis, alleviating oxidative stress, provides by-passing of a cytochrome segment of the mitochondrial respiratory chain, and is capable of reducing susceptibility to apoptosis or cell death. The polynucleotide is obtainable from various organisms, including plants, fungi and invertebrates. Preferably the polynucleotide is obtained from an ascidian, more preferably from the urochordate Ciona intestinalis .

[0042] The use of recombinant DNA constructs, which comprise the polynucleotide described above, are also contemplated. Preferably the DNA constructs comprise the cDNA encoding the cyanide in-sensitive AOX, functionally coupled to suitable regulatory sequences, including signal sequences, enhancers, promoters and termination sequences. Preferably, the recombinant DNA construct is inserted into a suitable expression vector, such as plasmid or virus vectors inducing expression in human cell lines, e.g. the pcDNA5/FRT/TO or pWPI vectors, or in whole animals, e.g. expression vectors of the Pelican series (Barolo et al., 2000) for expression in Drosophila. In a preferred embodiment of the invention the vector is a lentivirus vector.

[0043] The vector carrying the DNA construct comprising the cDNA encoding AOX is used to transform or transfect a suitable cell, which can be mammalian cell, e.g. a human cell or a cell from a rodent, e.g. rat , mice, hamster, etc, but also other animal cells can be used. A preferable human cell is that obtained from a Flp-In™ T-REx™-293 (Invitrogen) cell-line or from a HEK 293-derived cell-line.

[0044] The present invention is also related to a cyanide-insensitive alternative oxidase (AOX) polypeptide, which has the amino acid sequence SEQ ID NO: 2 or an analogue or a homologue thereof. The homologue should preferably have a sequence identity of at least 55%, preferably 60%, preferably 70%, more preferably 80%, more preferably 90%, even more preferably 95%, and most preferably 99% with the amino acid sequence SEQ ID NO:2 over blocks of at least 135 amino acids. The region of the at least 135 amino acids in Ciona intestinalis AOX is within the region of amino acids from 140 to 365 in the amino acid sequence SEQ ID NO: 2, the amino acid sequence conserved in different plant, fungal or lower metazoan organisms. The comparison of the amino acid sequences can be performed using standard BLAST algorithms, such as the SIB BLAST Network Service at http://us.expasy.org and default parameters thereof.

[0045] A polypeptide useful in the present invention comprises an amino acid sequence obtainable from different organisms, such as plants, fungi and lower metazoan phyla, including the Ciona intestinalis AOX sequence, any sequence encoding a variant polypeptide with the same biochemical activities (e.g. one having amino acid replacements which do not affect the main function of the enzyme), and also any related AOX amino acid sequence from another organism that would have the same effects which are predictable on the basis of the present invention.

[0046] The C-terminal or N-terminal end of the amino acid sequence may be tagged with flag or myc sequences, as disclosed in SEQ ID NO:4 and SEQ ID NO:6. Sequences encoding other tags, e.g. the Green fluorescent protein GFP may also be fused to the amino acid sequence of SEQ ID NO:2.

[0047] As discussed above in connection with cDNA encoding the AOX, the allotopically expressed AOX renders mitochondrial substrate oxidation cyanide- insensitive, decreases metabolic acidosis, alleviates oxidative stress, provides by-passing of a cytochrome segment of the mitochondrial respiratory chain and reduces susceptibility to cell death apoptosis or cell death.

[0048] The cyanide-insensitive AOX polypeptide of the present invention is obtainable from various organisms, including plants, fungi and lower metazoans. Preferably the cDNA sequence is obtained from an ascidian, more preferably from the urochordate Ciona intestinalis.

[0049] The present invention also relates to a method, wherein by introducing the cDNA encoding AOX followed by allotopic expression of AOX in a human or metazoan cell it is possible to limit a lot of deleterious consequences of respiratory chain deficiencies, such as rendering a mitochondrial substrate oxidation cyanide-insensitive, decreasing metabolic acidosis, alleviating oxidative stress, blocking or by-passing, preferably facultatively by-passing a cytochrome segment of the mitochondrial respiratory chain,reducing susceptibility to apoptosis or cell death. [0050] Some aspects of the present invention relate to the effects of allotopic expression of an alternative oxidase (AOX) (such as AOX from the marine invertebrate Ciona intestinalis) in vertebrate (especially human) cells or organisms to help protect against the major deleterious consequences of mitochondrial OXPHOS dysfunction. Polypeptide and polynucleotide materials and methods for the amelioration of disorders associated with mitochondrial OXPHOS dysfuction are among the preferred embodiments of the invention.

[0051] One aspect of the invention includes isolated and/or purified polypeptides that have alternative oxidase activity. In some embodiments, the isolated and/or purified polypeptide having alternative oxidase activity comprises an amino acid sequence at least 75% identical to the amino acid sequence set forth in SEQ ID NO: 2 or fragments thereof that have alternative oxidase activity. An exemplary fragment is a fragment lacking an amino-terminal mitochondrial transit peptide and optionally lacking other sequences not involved in AOX activity. In other embodiments, the isolated and/or purified polypeptide comprises an amino acid sequence with still greater similarity, e.g., at least 75%, at least 80%, at least 85% or at least 95%, at least 96%, at least 97%, at least 98% or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 fragments thereof that have alternative oxidase activity. The term "alternative oxidase activity" refers to the catalysis of the oxidation of ubiquinol which occurs under some conditions in mitochondria by diverting electrons from the standard electron transfer chain, transferring them from ubiquinol to oxygen and generating water and heat as products (along with oxidized ubiquinol).

[0052] In some variations, the polypeptide is derived from an organism from a phylum selected from the groups consisting of Mollusca, Annelida and Echinodermata, and Chordata for all of which there is evidence of the existence of AOX genes. It is expected that AOX also exists in numerous other animal phyla. In some embodiments the polypeptide is derived from an organism from subphylum Urochordata; or from an organism from order Enterogona; or from an organism from family Cionidae. Wild type sequences from organisms are highly preferred and are isolated using known techniques. In one aspect, the polypeptide is derived from dona intestinalis and comprises the amino acid sequence set forth in SEQ ID NO: 2. [0053] Polynucleotides that comprise nucleotide sequences that encode all (or a portion of) a polypeptide of the invention are an additional aspect of the invention. In some embodiments wild type sequences are used. In other embodiments, sequence variation is contemplated, as indicated above for amino acid sequences. Vectors including expression vectors for in vitro production and gene therapy vectors for in vivo production/expression of polypeptides, are also an aspect of the invention.

[0054] For example, the invention includes isolated or purified polynucleotides comprising a nucleotide sequence that encodes a polypeptide that has alternative oxidase activity as discussed above and described in further detail in the description below. In one aspect, the isolated or purified polynucleotide comprises a nucleotide sequence at least 55%, 65%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 1.

[0055] In another aspect, the invention provides a polynucleotide that comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal or protist origin. The use of an animal transit peptide is contemplated as a tool for improving targeting of non-animal AOX proteins to animal mitochondria. In some variations, the mitochondrial transit peptide is of vertebrate, mammalian or human origin and the polypeptide with alternative oxidase activity is a mature alternative oxidase of plant or fungal origin. In other variations, the mitochondrial transit peptide is of vertebrate origin and the polypeptide with alternative oxidase activity is of invertebrate origin. In a particular embodiment, the polypeptide with alternative oxidase activity is from a chordate species of invertebrate and the mitochondrial transit peptide is of mammalian origin.

[0056] In some embodiments, a polynucleotide of the invention further comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell. In some aspects the promoter sequence is of mammalian origin. In other aspect, the promoter sequence is a promoter of a nuclear gene that encodes a mitochondrial protein.

[0057] The invention also includes an expression vector comprising a polynucleotide of the invention. In one aspect, the polynucleotide is operably linked to an expression control sequence. The expression vector may be any vector used for the expression of a nucleic acid and may for example, be selected from the group consisting of adenoviral vectors, adeno-associated viral vectors, and lentivirus vectors. For many applications, replication-deficient forms of such vectors are preferred. The polynucleotides and vectors of the invention may be formulated as compositions in which the polynucleotides or the vector is presented in a pharmaceutically acceptable carrier, excipient or diluent. Such compositions are useful for both ex vivo and in vivo gene therapy to introduce AOX activity to cells that otherwise lack it.

[0058] Another aspect of the invention are host cells that have been transformed or transfected with a polynucleotide or vector of the invention. In some variations, the cells are any prokaryotic or eukaryotic cell that can be manipulated (e.g., through transformation or transfection) to express polypeptide constructs of the invention. In some variations, the cells are suitable for ex vivo transfection/transformation and reinplantation into a host organism.

[0059] In one aspect, the invention provides a vertebrate cell transformed or transfected with a polynucleotide that encodes a polypeptide with alternative oxidase activity, wherein the cell expresses the polypeptide and exhibits one or more of increased resistance to antimycin A, cyanide (CN-) or oligomycin compared to a wild type cell. These resistances are three examples of evidence for AOX activity in cells. Other examples are described in detail below.

[0060] In another aspect, the invention provides a vertebrate cell transformed or transfected with a polynucleotide that encodes a polypeptide with alternative oxidase activity, wherein the cell expresses the polypeptide, exhibits oxidative phosphorylation to produce ATP through the cytochrome metabolic pathway and wherein, in the presence of an inhibitor of the oxidative phosphorylation, the cell oxidizes ubiquinol through the alternative oxidase pathway. In one variation, the alternative oxidase activity is allosterically regulated by pyruvate to inhibit metabolic acidosis under conditions favoring metabolic acidosis.

[0061] Also provided are isolated or purified cells transformed or transfected with a polynucleotide or vector of the invention. In some variations, the isolated cell is a stem cell including an embryonic stem cell, an adult stem cell or a neural stem cell. Cells with totipotency or pluripotency or even multipotency are among the preferred cell types for ex vivo gene therapy aspects of the invention.

[0062] In particular embodiments, the mammalian subject is human.

[0063] In some aspects, the compositions are administered locally to a tissue or an organ comprising cells affected by metabolic acidosis of oxidative stress. In other aspects, the composition is administered systemically.

[0064] Still other variations of the invention include: the use of apolynucleotide, vector, or transformed cell as described herein for prophylaxis therapy (prophylaxis) of a disorder associated with mitochondrial OXPHOS function; and/or the use of a polynucleotide, vector, or transformed cell as described herein in the manufacture of a medicament for prophylaxis therapy (prophylaxis) of a disorder associated with mitochondrial OXPHOS function. In some preferred variations, the subject to be treated has not been diagnosed with the disorder, but through indicia described herein, is identified as at risk for the disorder.

[0065] In other particular embodiments, the prophylaxis therapy of the human subject is to delay or prevent a disease or condition selected from the group consisting of impaired mitochondrial respiratory function selected from the group consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease and related conditions; Mitochondrial encephalomyopathies, including progressive external ophthalmoplegia, Kearns-Sayre syndrome and MELAS syndrome; diverse, multisystem pediatric disorders affecting organs such as liver, kidney, the CNS, heart, skeletal muscle, and the endocrine and sensorineural systems; diseases whose pathogenesis is known or believed to involve excessive production of reactive oxygen species in mitochondria, including amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia and forms of cardiovascular disease attributable to defects in antioxidant defenses; other ataxias and neurological conditions resulting from genetics defects in POLG, cl0orf2 (Twinkle) or other components of the system of mitochondrial DNA maintenance; mitochondrial hearing impairment, both syndromic and nonsyndromic; forms of diabetes mellitus attributable to defects of the mitochondrial OXPHOS system; side-effects of antiretroviral therapies that impact the mitochondrial OXPHOS system; obesity and other metabolic disorders resulting from disturbances in the mobilization of food resources; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; Diabetes mellitus and Lactic acidemia.

[0066] For the purposes of the present invention, a treatment agent or regimen is "prophylactic" when it contributes to a measurable delay in the onset of a disease or any one or more symptoms used to diagnose a disease, e.g., provides a measure of protection, prevention, or delay of onset of disease, or delay of onset of symptoms used to diagnose a disease in a subject. While it often will be apparent to a subject and/or the subject's caregiver(s) that a measure of protection, prevention, or delay of onset of disease, or delay of onset of symptoms used to diagnose a disease has been achieved (e.g., based on experience with the disease in other subjects), prophylaxis also is demonstrated and quantifiable in the context of a controlled study, where a measure of protection, prevention, or delay of onset of disease, or delay of onset of disease symptoms is achieved in a group of treated subjects, compared to a group of untreated controls, for example. If a standard of care regimen for prophylaxis exists for a particular disease or condition, then the materials or method of the invention can be compared against the standard of care in a controlled study.

[0067] In the context of mitochondrial OXPHOS dysfunction, which has been characterized herein and in the scientific literature, prophylaxis can be demonstrated by delayed onset of excess production of reactive oxygen species (ROS) at complexes I and/or III; delayed damage of lipids, proteins, carbohydrates and nucleic acids from ROS observed at the cellular level; or delayed development of cellular or systemic acidosis, for example.

[0068] Although the invention is frequently characterized herein as prophylaxis, the term "prophylaxis" is not critical to defining the invention per se. Aspects, embodiments, or variations of the invention characterized herein as prophylaxis can be characterized alternatively as methods for delay of onset of disease, or delay of onset of disease symptoms, for example. "Disease" can refer to any disease specifically named herein, for example. [0069] Additional aspects of the invention are summarized in the following numbered paragraphs:

[0070] 1. A method for prophylaxis therapy for a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction comprising:

administering to a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, who has not been diagnosed with such a disorder, an effective amount of a therapeutic selected from the group consisting of:

(i) a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein.

[0071] 2. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

[0072] 3. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

[0073] 4. A method for prophylaxis therapy for a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction comprising

(a) identifying a subject as a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction; and

(b) administering to the subject an effective amount of a therapeutic selected from the group consisting of

(i) a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein; and (ii) a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein,

wherein the subject has not been diagnosed as having a disorder associated with mitochondrial OXPHOS dysfunction.

[0074] 5. The method or use of any one of paragraphs 1-4, wherein the subject is identified as a subject at risk because the subject has a relative that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

[0075] 6. The method or use of paragraph 5, wherein the subject is identified as a subject at risk because the subject has a sibling that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction, wherein the sibling and the subject share a common genetic parent.

[0076] 7. The method or use of paragraph 5, wherein the subject is identified as a subject at risk because the subject has a genetic parent that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

[0077] 8. The method or use of any one of paragraphs 1-7, wherein the disorder associated with mitochondrial OXPHOS dysfunction is selected from the group consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease; mitochondrial encephalomyopathies; progressive external ophthalmoplegia, Kearns-Sayre syndrome; MELAS syndrome; amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia; other ataxias and neurological conditions resulting from genetics defects in POLG, clOorf2 (Twinkle) or other components of the system of mitochondrial DNA maintenance; syndromic mitochondrial hearing impairment; nonsyndromic mitochondrial hearing impairment; intractable obesity; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; and Lactic acidemia.

[0078] 9. The method or use of any one of paragraphs 1-8, wherein the subject is identified as a subject at risk from the presence of a mutation in the genome of the subject that correlates with or causes reduced function of at least one gene or gene product associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

[0079] 10. The method of paragraph 4, wherein the identifying step comprises screening for the presence of a mutation in the genome of the subject that correlates with or causes reduced function of at least one gene or gene product associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

[0080] 11. The method of paragraph 10, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene or gene product associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction

[0081] 12. The method of paragraph 11, wherein the nucleic acid is mitochondrial DNA (mtDNA).

[0082] 13. The method or use of paragraph 9, wherein the mutation is in a gene found in mitochondrial DNA of the subject.

[0083] 14. The method or use of paragraph 9 or 10, wherein the gene is associated with proper assembly of cytochrome c oxidase.

[0084] 15. The method or use of paragraph 9 or 10, wherein the gene is associated with proper assembly of OXPHOS complex III.

[0085] 16. The method or use of paragraph 9, wherein the subject is identified as a subject at risk from the presence of a mutation in a gene selected from the group consisting of DJl, Cox 10, Scol, Sco2, MTCOXl, MTC0X2, MTC0X3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL. [0086] 17. The method of paragraph 10, wherein the identifying comprises screening for the presence of a mutation in a gene selected from the group consisting of DJl, Cox 10, Scol, Sco2, MTCOXl, MTCOX2, MTCOX3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL.

[0087] 18. The method or use of paragraph 16 or 17, wherein the gene is DJ 1.

[0088] 19. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a DJl amino acid substitution selected from the group consisting of C106E, C106D, L166P, M25I, A104T, and D 149 A.

[0089] 20. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a DJl amino acid substitution selected from the group consisting of C106E, C106D, L166P, M25I, A104T, and D149A.

[0090] 21. The method or use of paragraph 16 or 17, wherein the gene is CoxlO.

[0091] 22. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a CoxlO gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A121 IT and A1211G.

[0092] 23. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a CoxlO gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A121 IT and A121 IG.

[0093] 24. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a CoxlO amino acid substitution selected from the group consisting of T196K, P225L, D336V and D336G.

[0094] 25. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a CoxlO amino acid substitution selected from the group consisting of T196K, P225L, D336V and D336G. [0095] 26. The method or use of paragraph 16 or 17, wherein the gene is SCOl .

[0096] 27. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a SCOl gene C520T mutation.

[0097] 28. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a SCOl gene C520T mutation.

[0098] 29. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a SCOl P174L amino acid substitution.

[0099] 30. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a SCOl P174L amino acid substitution.

[00100] 31. The method or use of paragraph 16 or 17, wherein the gene is SCO2.

[00101] 32. The method or use of paragraph 16 or 17, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a SCO2 amino acid substitution selected from the group consisting of E 140K, R90X, and Rl 7 IW.

[00102] 33. The method of paragraph 17, wherein the method comprises screening for a missense mutation causing a SCO2 amino acid substitution selected from the group consisting of E 140K, R90X, and Rl 7 IW.

[00103] 34. The method or use of paragraph 9, wherein the subject is identified as a subject at risk from the presence of a mutation in a gene selected from the group consisting of MTATP6, MTTLl, MTTK, MTNDl, MTND3, MTND4, MTND5, MTND6, MTCO3, MTTW, MTTV, NDUFSl, BSClL, Surfl, LRPPRC and Coxl5.

[00104] 35. The method of paragraph 10, wherein the identifying step comprises screening for the presence of a mutation in a gene selected from the group consisting of MTATP6, MTTLl, MTTK, MTNDl, MTND3, MTND4, MTND5, MTND6, MTCO3, MTTW, MTTV, NDUFSl, BSClL, Surfl, LRPPRC and Coxl5.

[00105] 36. The method or use of paragraph 34 or 35, wherein the gene is Coxl5. [00106] 37. The method or use of paragraph 34 or 35, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C.

[00107] 38. The method of paragraph 35, wherein the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and T1171C.

[00108] 39. The method or use of paragraph 34 or 35, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a Cox 15 amino acid substitution selected from the group consisting of R217W and F374L.

[00109] 40. The method of paragraph 35, wherein the method comprises screening for a missense mutation causing a Cox 15 amino acid substitution selected from the group consisting of R217W and F374L.

[00110] 41. The method or use of paragraph 34 or 35, wherein the gene is Surfl .

[00111] 42. The method or use of paragraph 34 or 35, wherein the subject is identified as a subject at risk from the presence of a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T.

[00112] 43. The method of paragraph 35, wherein the method comprises screening for a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T.

[00113] 44. The method or use of paragraph 34 or 35, wherein subject is identified as a subject at risk from the presence of a missense mutation causing a Surfl Q82X amino acid substitution.

[00114] 45. The method of paragraph 35, wherein method comprising screening for a missense mutation causing a Surfl Q82X amino acid substitution.

[00115] 46. A method for prophylaxis therapy for a disorder associated with cytochrome c oxidase deficiency comprising: administering a therapeutic to a subject identified as having a mutation that is correlated with or causes reduced function of a gene or product of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15;

wherein the therapeutic is selected from the group consisting of: (a) a polynucleotide that encodes an alternative oxidase protein; and (b) a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein.

[00116] 47. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with cytochrome C oxidase deficiency, wherein the subject has a missense mutation that correlates with or causes reduced function of a gene or product of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10 and Coxl5.

[00117] 48. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with cytochrome C oxidase deficiency, wherein the subject has a missense mutation that correlates with or causes reduced function of a gene or product of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10 and Coxl5.

[00118] 49. A method for prophylaxis therapy for a disorder associated with cytochrome c oxidase deficiency comprising

(a) identifying a subject having a mutation that is correlated with or causes reduced function of a gene or a product of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Coxl5;

(b) administering to the subject a therapeutic selected from the group consisting of

(i) a polynucleotide that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein. [00119] 50. The method of paragraph 49, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene or product of a gene selected from the group consisting of Surf 1 , SCOl, SCO2, Cox 10, and Coxl5, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency.

[00120] 51. The method or use of any one of paragraphs 46-50, wherein the subject is identified as a subject at risk because the subject has a relative that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

[00121] 52. The method or use of paragraph 51, wherein the subject is identified as a subject at risk because the subject has a sibling that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

[00122] 53. The method or use of any one of paragraphs 46-52, wherein the disorder associated with cytochrome c oxidase deficiency is selected from the group consisting of Leigh syndrome, fatal hypertrophic cardiomyopathy (HCMP) with encephalopathy, hepatic failure, tubulopathy with encephalomyopathy and leukodystrophy.

[00123] 54. The method or use of any one of paragraphs 1-8 and 46-53, wherein the subject is identified as a subject at risk from a reduced level (measurement) of activity of a protein selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00124] 55. The method of any one of paragraphs 4, 10, 17, 35 and 49, wherein the identifying step comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SCO2, CoxlO, and Coxl5 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00125] 56. The method or use of any one of paragraphs 1-55, wherein the subject is identified as a subject at risk from a decreased level (measurement) of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00126] 57. The method of any one of paragraphs 4, 10, 17, 35, 49 and 55, wherein the identifying step comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00127] 58. The method or use of any one of paragraphs 1-57, wherein the subject is identified as a subject at risk from an increased level (measurement) of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00128] 59. The method of any one of paragraphs 4, 10, 17, 35, 49, 55 and 57, wherein the identifying step comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00129] 60. The method or use of any one of paragraphs 1-59, wherein the subject is identified as a subject at risk from an increased level (measurement) of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00130] 61. The method of any one of paragraphs 4, 10, 17, 35, 55, 57, and 59, wherein the identifying step comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00131] 62. The method or use of any one of paragraphs 1-61, wherein the subj ect is identified as a subject at risk from a reduced level (measurement) of cytochrome c oxidase activity in a biological sample of the subject assessed by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00132] 63. The method of any one of paragraphs 4, 10, 17, 35, 49, 55, 57, 59, and 61, wherein the identifying step comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction (or cytochrome C oxidase deficiency) in the subject.

[00133] 64. A method of treating a disorder associated with mitochrondrial OXPHOS dysfunction comprising

(a) screening a biological sample from a subject suspected of having a disorder associated with mitochondrial OXPHOS dysfunction subject for a mutation that correlates with or causes reduced function of a gene or product of a gene selected from the group consisting of Surf 1, SCOl, SC02, Cox 10, and Cox 15;

(b) administering to the subject a therapeutic selected from the group consisting of

(i) a polynucleotide that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein.

[00134] 65. The method of paragraph 64, wherein the disorder associated with mitochondrial OXPHOS dysfunction is selected from the group consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease; mitochondrial encephalomyopathies; progressive external ophthalmoplegia, Kearns-Sayre syndrome; MELAS syndrome; amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia; syndromic mitochondrial hearing impairment; nonsyndromic mitochondrial hearing impairment; intractable obesity; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; and Lactic acidemia.

[00135] 66. The method of paragraph 64 or 65, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene or product of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Coxl5, wherein the presence of the mutation in the gene indicates that the subject should be administered the therapeutic.

[00136] 67. The method of paragraph 66, wherein the nucleic acid is mitochondrial DNA (mtDNA).

[00137] 68. The method of paragraph 66, wherein the gene is Cox 10.

[00138] 69. The method of paragraph 68, wherein the method comprises screening for a missense mutation causing a Cox 10 gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A121 IT and A121 IG; or screening for a missense mutation causing a Cox 10 amino acid substitution selected from the group consisting of T196K, P225L, D336V and D336G.

[00139] 70. The method of paragraph 66, wherein the gene is SCOl .

[00140] 71. The method of paragraph 70, wherein the method comprises screening for a missense mutation causing a SCOl gene C520T mutation; or screening for a missense mutation causing a SCOl P174L amino acid substitution.

[00141] 72. The method of paragraph 66, wherein the gene is SCO2.

[00142] 73. The method of paragraph 72, wherein the method comprises screening for a missense mutation causing a SCO2 amino acid mutation selected from the group consisting of E 140K, R90X, and Rl 7 IW.

[00143] 74. The method of paragraph 66, wherein the gene is Coxl5.

[00144] 75. The method of paragraph 74, wherein the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C; or screening for a missense mutation causing a Cox 15 amino acid mutation selected from the group consisting of R217W and F374L.

[00145] 76. The method of paragraph 66, wherein the gene is Surfl .

[00146] 77. The method of paragraph 76, wherein the method comprises screening for a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T; or screening for a missense mutation causing a Surfl Q82X amino acid mutation.

[00147] 78. The method of any one of paragraphs 64-77, wherein the identifying step further comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SCO2, CoxlO, and Coxl5 in a biological sample of the subject, wherein the presence of the mutation and a reduced level of activity of the protein is indicative of mitochondrial OXPHOS dysfunction in the subject.

[00148] 79. The method of any one of paragraphs 64-77, wherein the identifying step further comprises measuring a level of cellular ATP in a biological sample of the subject, wherein the presence of the mutation and a decreased level of ATP in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

[00149] 80. The method of any one of paragraphs 64-77, wherein the identifying step further comprises measuring a level of cellular ADP in a biological sample of the subject, wherein the presence of the mutation and an increased level of ADP in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

[00150] 81. The method of any one of paragraphs 64-77, wherein the identifying step further comprises measuring a level of serum lactate in a biological sample of the subject, wherein the presence of the mutation and an increased level of lactate in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

[00151] 82. The method of any one of paragraphs 64-77, wherein the identifying step further comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein the presence of the mutation and a reduced level of cytochrome c oxidase activity in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

[00152] 83. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for treatment of a subject identified as having a disorder associated with mitochondrial OSPHOS dysfunction, wherein the subject has a missense mutation that results in reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, CoxlO and Cox 15. [00153] 84. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for treatment of a subject identified as having a disorder associated with mitochondrial OSPHOS dysfunction, wherein the subject has a missense mutation that results in reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Coxl0 and Coxl5.

[00154] 85. The method or use of any one of paragraphs 1-84, wherein the alternative oxidase protein is derived from an organism from the domain Eukarya.

[00155] 86. The method or use of paragraph 85, wherein the alternative oxidase protein is derived from an organism from a phylum selected from the group consisting of Mollusca, Annelida and Echinodermata, and Chordata.

[00156] 87. The method or use of paragraph 85, wherein the alternative oxidase protein is derived from an organism from family Cionidae.

[00157] 88. The method or use of paragraph 87, wherein the alternative oxidase protein is derived from Ciona intestinalis .

[00158] 89. The method or use of any one of paragraphs 1-84, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 75% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity;

wherein the polypeptide has alternative oxidase activity.

[00159] 90. The method or use of any one of paragraphs 1-84, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 95% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and (b) fragments of (a) that have alternative oxidase activity;

wherein the polypeptide has alternative oxidase activity.

[00160] 91. The method or use of any one of paragraphs 1-84, wherein the isolated nucleic acid encodes a polypeptide comprising the amino acid sequence SEQ ID NO: 2.

[00161] 92. The method or use of any one of paragraphs 85-91, wherein the protein or encoded polypeptide further comprises an epitope tag.

[00162] 93. The method or use of any one of paragraphs 1-84, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal, or protist origin.

[00163] 94. The method or use of any one of paragraphs 1-84, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of vertebrate origin and an amino acid of a polypeptide with alternative oxidase activity of invertebrate origin.

[00164] 95. The method or use of paragraph 94, wherein the polypeptide with alternative oxidase activity is from a chordate species of invertebrate.

[00165] 96. The method or use of paragraph 93 or 94, wherein the mitochondrial transit peptide is of mammalian origin.

[00166] 97. The method or use of any one of paragraphs 1-96, wherein the polynucleotide is operably linked to an expression control sequence.

[00167] 98. The method or use of any one of paragraphs 1 -96, wherein the polynucleotide comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell.

[00168] 99. The method or use of paragraph 98, wherein the promoter is of mammalian origin. [00169] 100. The method or use of paragraph 98, wherein the promoter is a promoter of a nuclear gene that encodes a mitochondrial protein.

[00170] 101. The method or use of any one of paragraphs 1-100, wherein the polynucleotide is administered by administering a vector that comprises the polynucleotide.

[00171] 102. The method or use of paragraph 101, wherein the vector is selected from the group consisting of replication deficient adenoviral vectors, adeno-associated viral vectors, and lentivirus vectors.

[00172] 103. The method or use of any one of paragraphs 1 - 102, wherein the polynucleotide or cell is administered locally to a tissue or an organ comprising cells affected by metabolic acidosis or oxidative stress.

[00173] 104. The method or use of any one of paragraphs 1-102, wherein the polynucleotide or cell is administered systemically.

[00174] 105. The method or use of any one of paragraphs 1 - 104, wherein the cells transformed or transfected with the polynucleotide are autologous cells of the subject trnasformed or transfected ex vivo.

[00175] 106. A therapeutic or prophylactic method for treating a disorder associated with mitochondrial OXPHOS dysfunction in a subject comprising

(a) identifying a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction;

(b) transforming or trans fecting cells from the subject ex vivo with a polynucleotide that encodes an alternative oxidase; and

(c) administering the transformed or transfected cells to the subject.

[00176] Additional features and variations of the invention will be apparent to those skilled in the art from the entirety of this application, including the drawing and detailed description, and all such features are intended as aspects of the invention. Likewise, features of the invention described herein can be re-combined into additional embodiments that also are intended as aspects of the invention, irrespective of whether the combination of features is specifically mentioned above as an aspect or embodiment of the invention. Also, only such limitations which are described herein as critical to the invention should be viewed as such; variations of the invention lacking limitations which have not been described herein as critical are intended as aspects of the invention.

[00177] In addition to the foregoing, the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations specifically mentioned above. For example, although aspects of the invention may have been described by reference to a genus (e.g., a group of treatable diseases or a list of genes or proteins) or a range of values for brevity, it should be understood that each individual member of the genus and each value or sub-range within the range is intended as an aspect of the invention. Likewise, various aspects and features of the invention can be combined, creating additional aspects which are intended to be within the scope of the invention. Although the applicant(s) invented the full scope of the claims appended hereto, the claims appended hereto are not intended to encompass within their scope the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the right to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.

Brief Description of the Drawings

[00178] Figure 1 demonstrates that AOX is expressible in human cells and targeted to mitochondria. Immunocytochemistry was carried out as described by Garrido et al. (2003).

[00179] Figure IA is a simplified biochemical scheme of mitochondrial respiration and by-pass of the cytochrome segment provided by AOX. The five complexes of the RC are denoted by Roman numerals.

[00180] Figure 1 B is an immunoblot of 20 μg total cell lysate from Flp-In™ T-REx™- 293 (Invitrogen) cell clones transfected either with AOX-flag or AOX-myc constructs or empty vector, and probed with primary antibodies shown. Lanes denoted (+) were lysates from cells treated with 1 μg/ml doxycyclin to induce transgene expression. Primary antibodies used were: mouse anti-Myc monoclonal 9E10 and anti-flag M2 antibody.

[00181] Figure 1 C is a panel of a fluorescence micrograph of cells transfected with the AOX-flag construct with immunocytochemistry using a- flag primary antibody.

[00182] Figure ID is a fluorescence micrograph of cells transfected with the AOX-flag construct applying staining with Mitotracker® Red (Molecular Probes).

[00183] Figure IE is a panel of a fluorescence micrograph of cells transfected with the AOX-flag construct with superposition of the images from panels shown in Figures 1C and ID.

[00184] Figure 2 demonstrates that AOX expression modifies mitochondrial biochemistry in human cells.

[00185] Figure 2A demonstrates oxygen electrode traces after 48 h doxycyclin induction for whole cells (traces a, b) and for digitonin permeabilized (Ctrl-d, AOX-d) cells (traces c-g) upon addition of various organic acids and inhibitors as described in the text, wherein Ctrl, means cells transfected with the empty vector; AOX means cells transfected with an untagged AOX construct. Cell respiration and succinate oxidation were measured using a Clark oxygen electrode. KCN, 100 μM potassium cyanide; PG, 10 μM n-propyl gallate; Pyr, 10 mM pyruvate; Succ, 10 mM succinate,

[00186] Figure 2B shows cell growth curves, wherein AOX means cells transfected with an untagged AOX construct; Ctrl, means cells transfected with empty vector, grown in standard DMEM medium supplemented with uridine and pyruvate and doxycyclin (Spelbrmk et al, 2000).

[00187] Figure 2C shows SOD activity of an empty vector-transfected and untagged AOX-transfected cells grown either with (+) or without (-) doxycyclin induction.

[00188] Figure 3 demonstrates cloning of AOX and AOX-myc into a customized Drosophila transgenic expression vector, p (UAS)AOX H-Pelican (left) is a modified version of the Pelican series of vectors (Barolo et al., 2000), in which the eGFP coding sequence of pGreen H Pelican is replaced by that of C. intestinalis AOX, and the GaWp- responsive 5xUAS sequence is inserted in the original multi-cloning site of the vector upstream of the minimal promoter element (Hsp70 TATA box). The other elements of the transgenic vector are denoted as follows: P element 5' and 3' - the terminal sequences of the P-element transposon which allow its mobilization in Drosophila embryos in the presence of a co-injected plasmid encoding P-element transposase; w - white⁺ marker gene, conferring red eye colour after integration in recipient white embryos; insulator - insulator elements from the gypsy transposon which block transcription into or from the AOX trans gene at the chromosomal integration site; pUC8 plasmid DNA and white linker sequences - elements of the plasmid required for propagation in E. coli or portions of the white" marker gene not integrated in the resulting transgenic lines. The transgenically inserted DNA is indicated more clearly (right). The insulator elements (I) are shown in light grey, the Gal4p-responsive promoter element (P_UAS) followed by the AOX encoding gene in dark grey, the P-elements ends in black, and the DNA of the chromosomal integration site with a bold line.

[00189] Figure 4 demonstrates microinjection and selection of transgenic flies resulting in independent transgenic lines from individual flies.

[00190] Figure 4A demonstrates microinjection and the first selection of transgenic flies. Coinjection of the transgenic vector p (UAS)AOX H-Pelican (see Figure 3) and a P- element transposase-encoding plasmid into white recipient Drosophila embryos (egg) results in rare, random integration of the transgenic cassette in both somatic and germ cells of the progeny. Since the progeny are mainly chimeras, eye colour is not a reliable indicator of genotype. All survivors are bred to white flies to select transgenic progeny in the next generation, which show yellow (marked with horizontal lines) or pale orange (marked with a grid) eyes.

[00191] Figure 4B demonstrates creation of transgenic Drosophila lines. The transgenic progeny selected as described in Figure 4A, showing yellow or pale orange eyes are in turn bred to white flies to establish lines containing single autosomal insertions (i.e. segregating 50/50 regardless of sex) or X-chromosomal insertions if desired. The lines are tested for their viability as homozygotes, then maintained as hemizygotes for further studies. Eight such lines of AOX transgenic flies were established in this study, containing single insertions at different autosomal sites. Pale orange eyes are marked with a grid, red eyes in black.

[00192] Figure 5 depicts the genomic insertion site of the transgene in one of the established lines (AOX line F6-1), which was used for the subsequent studies. The shows a schematic map of a region of Drosophila melanogaster chromosome 2R into which the AOX transgenic cassette (denoted as in Figure 3) has inserted in transgenic line F6-1 (output from genome browser at www.flybase.net). All eight AOX transgenic lines showed different insertion sites, but AOX transgene expression levels and hemizygous phenotypes were the same for all lines tested in each experiment.

[00193] Figure 6 illustrates the cross between a hemizygous AOX fly and a hemizygous da-GAL4 driver fly with Tm3Sb balancer chromosome. In this set up the daughterless- GAL4 driver was used to express the AOX or (AOX-myc) transgene ubiquitously in the progeny of the appropriate genetic constitution.

[00194] Figure 6A is a scheme for generating and selecting AOX-expressing flies on the basis of white⁺ eye colour. Hemizygous AOX transgenic flies in the white background, with pale orange eyes as a result of a single copy of the of white⁺ marker in the transgenic cassette, are mated with balanced hemizygotes for the daughterless (da)-GAL4 transgene, having even paler, yellow eyes, as a result of very low expression of the white" marker also carried in the da-GAL4 transgene cassette. The balancer chromosome of the latter carries the separate (dominant) marker Sb, which confers short (stubbly) bristles. The progeny from the cross have different eye colours depending on which transgenes, if any, they have inherited. These segregate independently, since they are on separate autosomes. The Sb marker provides an additional check to distinguish AOX-expressing (red eyes) from non-expressing AOX transgenic flies (pale orange eyes). Yellow eyes are marked with horizontal lines, pale orange eyes with a grid and red eyes in black.

[00195] Figure 6B illustrates how the AOX-expressing flies were identified phenotypically by the colour of their eyes and bristle morphology. Photographs are of examples of each of the four classes of actual progeny, which eclosed in similar numbers. White-eyed flies carry no white⁺- containing transgenes. Those with yellow eyes (and normal bristles) have inherited only the da-GAL4 transgene. Those with pale orange eyes (and short bristles) have inherited only the AOX transgene. Those with red eyes have inherited two copies of the white⁺ marker gene, i.e. both transgenes. Expression of GAL4 from the ubiquitous da promoter supports ubiquitous and high-level transcription of the AOX transgene, which was verified in the red-eyed progeny by semi-quantitative, fluorescent RT-PCR, using AOX-specific primers, and an internal standard for rp49 mRNA. Yellow eyes are marked with horizontal lines, pale orange eyes with a grid and red eyes in black.

[00196] Figure 7 shows verification by in situ hybridization of AOX mRNA expression in embryos. Expression of Gal4p from the da promoter (AOX/da-Gal4 embryos) supports ubiquitous and high.level transcription of the AOX transgene, whereas transgenic 'non- expressor' (AOX/-) embryos show no expression. Expression was verified using a specific probe for AOX (sense probe, being the complementary strand to its mRNA), with an antisense probe (AOX coding sequence) as negative control. Probes were generated by in vitro transcription (Roche kit) of a 376 bp fragment of the AOX coding sequence, inserted into the multi-cloning site of pGEM®-T Easy vector (Promega). In this vector, the insert is flanked by two bacteriophage promoters that allow transcription in both orientations, depending on the polymerase used. Embryos were collected after 16 hours of the commencement of egg-laying. Vitelline membrane and chorion were removed, and embryos were fixed in methanol. In situ hybridization was carried out in re-hydrated embryos using standard procedures (Tomancak et al., 2003).

[00197] Figure 8 illustrates confirmation of expression of AOX-myc (SEQ ID NO: 6), using Western blotting to an anti-myc antibody, in whole flies where AOX-myc expression is induced by the da-GAL4 driver. The total protein extracts from male and female AOX-myc expressing and non-expressing flies, selected under a similar scheme as shown in Figure 6 were run on SDS-PAGE and transferred on Western blot filters. AOX- myc protein was detected with a myc-epitope-specific monoclonal antibody. An equivalent amount of protein extract from human cells induced to express the same epitope-tagged AOX-myc protein alongside, as a positive control. Pale orange eyes are marked with a grid and red eyes in black.

[00198] Figure 9 illustrates changes in weight of AOX-expressing and non-expressing flies during adult life. Flies were collected and kept alive in standard supplemented-food vials, at a maximum of 15 flies per vial and changing vials three times per week. Flies were anaesthetized on ice and their weight was measured at eclosion subsequently every two weeks.

[00199] Figure 10 illustrates a phenotypic analysis of AOX expressing flies, indicating partial cyanide resistance.

[00200] Figure 11 illustrates AOX activity in mitochondria from AOX-expressing flies

[00201] Figure 12 shows oxygen consumption traces for isolated mitochondrial suspensions from AOX-expressing and non-expressing Drosophila as selected under the scheme of Figure 6. Drosophila mitochondria were prepared as described by Toivonen et al. (2001) and oxygen consumption in the presence of various substrates and inhibitors was determined as previously (Hakkaart et al., 2006). Additions were of pyruvate + malate (5 mM each), ADP (1.5 μmol), KCN (100 μM) and SHAM (1 mM). The respiratory control ratio (RCR) is the ratio of state 4 to state 3 respiration, i.e. respiration driven by ADP and the resting state of respiration after the ADP is consumed, indicated by the discontinuity in the traces at the point where no external substrate or inhibitor was added. The RCR is a measure of the degree of coupling of the mitochondria, i.e. how far respiration is limited by the flux through ATP synthase.

[00202] Figure 13 illustrates the effect of cyanide on viability of AOX-expressing, non- expressing AOX-transgenic and non-transgenic flies, as selected under the scheme of Figure 6. KCN was added in a fume hood at various concentrations to the agarose plugs cast in the vials. Flies in groups of 10 were placed inside the vials, which were closed by non-airtight bungs and left in the fume hood. Flies were scored as non- viable when they ceased all movement, at times measured from the start of the experiment.

[00203] Figure 13A shows that after 30 min of incubation in vials containing agarose plugs impregnated with 100 μM KCN all AOX-expressing flies remained viable and able to crawl up the side of the vial, whereas non-expressor flies had all succumbed and lay dead on the surface of the agarose.

[00204] Figure 13B shows the mean survival times (+ SD) in vials containing 1 mM KCN-impregnated agarose plugs, of groups of male and female flies of different genotypes, as indicated. Whereas non-transgenic (wt) and non-expressor flies died after approximately 5 min, AOX-expressing flies remained viable for approximately 30 min, and were also able to recover from the paralysis overnight without lethal effects.

[00205] Figure 14 illustrates the development of AOX-expressing and non-transgenic (wt) Drosophila on media containing 10 or 30 μg/ml antimycin. Flies are shown approximately 7 d (left) or 10 d (right) after egg-laying. At 30 μg/ml antimycin wild-type flies either do not hatch or the larvae are non- viable. At 10 μg/ml antimycin wild-type flies reach early larval stage but no further. AOX-containing flies reach 3rd instar larval stage and begin climbing tube in preparation for pupariation, after which they eclose as healthy adults.

[00206] Figure 15 illustrates the construction of pWPI-AOX. The map of pWPI (left) is redrawn from that shown on www.adgene.com. The 1110 bp AOX coding sequence (shaded box, right), including start and stop codons and flanked by Smal half-sites as shown, was blunt end-cloned into the unique Pmel site of the vector, between the EFlalpha-promoter/cPPT and EMCV IRES segments.

[00207] Figure 16 are live-cell images of pWPI-AOX-transduced cells showing unsorted cells, 3 weeks post-transduction (left) or cells replated following FACS enrichment (right). GFP fluorescing cells appear as bright cells in the monochrome images. Separate control images (not shown), created by successive imaging using Krypton lamp excitation (excitation filter 492/18 nm, emission filter 535/30) and white light (halogen lamp) confirmed this interpretation.

[00208] Figure 17 depicts a Northern blot analysis of AOX expression. RNA from FACS-enriched pWPI-AOX-transduced cells and from doxycyclin-induced pcDNA5- AOX-transfected plus empty vector-transfected cells was hybridized with an AOX- specific probe. Lanes marked a and b represent duplicate RNA preparations. Lanes marked Ia, 2a etc., represent two batches of pWPI-AOX-transduced cells. Transcript sizes were inferred from RNA size markers and correspond with those predicted from the vector maps.

[00209] Figure 18 demonstrates the respiration of pWPI-AOX-transduced cells. Oxygen consumption traces from permeabilized, FACS-enriched, pWPI-AOX-transduced cells and from doxycyclin-induced pcDNA5-AOX-transfected and empty vector-transfected cells is indicated. The arrows indicate times of addition of potassium cyanide (KCN) to 100 μM and n -propyl gallate (PG) to 10 μM.

[00210] Figure 19A shows a schematic map of the transgenic construct pUAS-AOX-H- Pelican.

[00211] Figure 19B shows the crossing scheme to obtain AOX-expressing progeny from AOX transgenic hemizygotes (with AOX transgene on chromosome 2), crossed to hemizygotes for the ubiquitous da-GAL4 driver, and balanced against the Sb marker.

[00212] Figure 19C shows a whole-mount in situ hybridization to AOX-expressing and non-expressing embryos, probed for AOX sense and antisense transcripts.

[00213] Figure 19D shows the results of Q-RT-PCR of AOX RNA relative to RpL32 mRNA, from hemizygous AOX transgenic flies combined with different GAL4 drivers and growth temperatures.

[00214] Figure 19E shows the results of Q-RT-PCR of AOX RNA relative to RpL32 mRNA, from hemizygous AOX transgenic flies combined with the tub-GS driver in presence of different concentrations of the inducing drug RU486 throughout development, (h) Weight loss (% of wet weight at eclosion) in young adult flies of the sex and genotype shown.

[00215] Figure 20 demonstrates that mitochondria from AOX expressing flies exhibit cyanide-resistant substrate oxidation. Figures 2OA and 2OB are representative polarographic traces showing rates of oxygen consumption. Figure 2OC provides compiled polarographic data and Figure 2OD demonstrates respiratory chain complex activities from flies of the sex, age, growth and assay temperature, genotype and transgenic line (F6 or F 17) as indicated: wild-type (non-transgenic), AOX- (hemizygous for AOX transgene but with no driver), AOX+ (hemizygous for AOX transgene and for da-GAL4 driver).

[00216] Figures 21 A and B are representative polargraphic trees for mitochondria from AOX-expressing (Figure 21A) and non-expressing (Figure 21B) non-adult females of transgenic line F6, cultured and assayed at 25°C. [00217] Figure 22 demonstrates that AOX-expressing flies are resistant to cyanide.

[00218] Figure 23 provides further data on AOX rescue of dj-lβ and shows results of a combined bang-sensitivity/locomotor activity assay. At least 5 independent samples of 20 female flies of each genotype indicated were used in each experiment. Data are presented as means ± SEM, analyzed using one-way ANOVA for post-test comparisons (Newman- Keuls test). Single, double and 9 treble asterisks indicate significant differences between the groups, p < 0.001.

Detailed Description of the Invention Definitions:

[00219] The terms used in the present invention have the meaning they usually in the fields of recombinant DNA techniques, genetics, developmental biology, cell biology and biochemistry. Some terms however, may be used in a somewhat different manner and some terms benefit from additional explanation to be correctly interpreted for patent purposes. Therefore, some of the terms are explained in more detail below.

[00220] The term "allotopic expression" means expression in a different place. In the present invention the term is used to mean expression, in one organism (or cells from an organism), of a gene derived from another organism, where no homologous gene is found in the genome of the first organism. The AOX expression in organisms that do not posses the AOX gene in their genomes brought about a dramatic transformation of mitochondrial biochemistry as shown in the experimental part of the present invention. The results demonstrate that allotopic AOX expression would be a feasible strategy for gene therapy of pathological conditions affecting the mitochondrial respiratory chain and OXPHOS system.

[00221] The term "mitochondrial substrate oxidation" means the oxidation of substrate molecules (e.g. sugars, organic acids) inside mitochondria, or in mitochondrial suspensions in vitro, or inside permeabilized cells studied in vitro, involving the consumption of molecular oxygen. [00222] The term "reoxidizing of NADH" means the regeneration OfNAD⁺, a crucial electron acceptor in most steps in catabolism, via enzymatic oxidation of the reduced form NADH, involving a downstream electron acceptor such as ubiquinone.

[00223] The term "metabolic acidosis" in the present invention means "lactic acidosis". "Lactic acidosis" is a poisonous side-effect of the blockage of the respiratory chain, wherein the mitochondria cannot use the normal pathway for reoxidation of NADH, and the only alternative pathway which the cell can use to reoxidize NADH is the one that converts pyruvate to lactate (via the enzyme misleadingly called lactate dehydrogenase). Lactate is then exported from the cell as lactic acid, and leads to acidification of the extracellular mileu, which manifests pathologically as lactic acidosis. AOX prevents all of this by providing an alternative, but still mitochondrial, respiratory route to reoxidize NADH, thus making the use of the lactate dehydrogenase pathway unnecessary for the cell.

[00224] The term "alleviating or palliating oxidative stress" as used herein refers to decreasing or eliminating damage to animal or plant cells (and thereby the organs and tissues composed of those cells) caused by reactive oxygen species, which include (but are not limited to) superoxide, singlet oxygen, peroxynitrite, hydrogen peroxide and hydroxy radical. Oxidative stress is defined as an imbalance between pro-oxidants and antioxidants, with the former prevailing.

[00225] Oxidative stress can be measured in a number of ways including the measurement of lipid oxidation products such as malonaldehyde or thiobarbituric acid reactive substances (TBARS) in blood on urine (Gutteridge et al., Anal. Biochem., 91 : 250-257, 1978; Yagi et al., Chem. Phys. Lipids, 45: 337-351, 1987; Ekstrom et al., Chem.- Biol. Interact., 66: 177-187, 1988; Ekstrom, et al., Chem.-Biol. Interact., 67: 25- 31, 1988; Boyd, et al., Cancer Lett., 50:31-37, 1990; Dhanakoti, et al., Lipids, 22:643-646, 1987); the ex vivo oxidizability of blood fractions (such as LDL) (Harats et al., Atherosclerosis, 79: 245- 252, 1989); modified DNA bases and/or DNA adducts in peripheral blood cells (Liou et al., Cancer Res., 49: 4929-4935, 1989; Leanderson et al., Agents Actions, 36: 50- 57, 1992.) or urine (Shigenaga et al., In: L. Packer and A. N. Glazer (eds.), Methods in Enzymology, Vol. 186, pp. 521-529. New York: Academic Press, 1990; Gomes et al., Chem. Res. Toxicol, 3: 307-310, 1990; Cundy et al., In: M. G. Simic, K. A. Taylor, J. F. Ward, and C. von Sonntag (eds.), Oxygen Radicals in Biology and Medicine, pp. 479- 482. New York: Plenum Press, 1988); vitamin E or vitamin C levels in blood fractions (including LDL) (Clausen et al, Biol. Trace Elem. Res., 20: 135-151, 1989; Van Rensburg et al., Mutat. Res., 215: 167-172, 1989; Jessup et al., Biochem. L, 265: 399-405, 1990; Nierenberg et al., In: T. E. Moon and M. S. Micozzi (eds.), Nutrition and Cancer Prevention, pp. 181-212. New York: Marcel Dekker, Inc., 1989); catalase or superoxide dismutase levels in blood fractions (Hageman et al., in,Larramendy et al., Mutat. Res., 214: 129-136, 1989); lipid peroxides in blood (Pryor, et al., Free Radical Biol. Med., 7: 177-178, 1989; Frei et al., Anal. Biochem., 175: 120-130, 1988; Yamamoto et al., In: L. Packer and A. N. Glazer (eds.), Methods in Enzymology, Vol. 186, pp. 371 -379. New York: Academic Press, 1990); volatile compounds such as ethane and pentane in expired breath (Refat et al., Pediatr. Res., 10: 396-403, 1991; Kazui et al., Free Radical Biol. Med., 13: 509-515, 1992; Kneepkens et al., Clin. Invest. Med., 15: 163-186, 1992); glutathione/glutathione disulfide in blood factions (Buhl et al., Lancet, 2: 1294-1298, 1989; Hughes et al., In: L. Packer and A. N. Glazer (eds. J, Methods in Enzymology, Vol. 186, pp. 681-685. New York: Academic Press, 1990; Lang et al., Gerontologist, 29: 187A, 1989; Sies et al., In: L. Packer (ed), Methods in Enzymology, vol. 105, pp. 445-451. Orlando: Academic Press, Inc., 1984); eicosanoids in urine (Judd et al., J. Am. Coll. Nutr., 5: 386-399, 1989); autoxidative, non-cyclooxygenase-denived eicosanoids in plasma (Morrow et al., Free Radical Biol. Med., 10: 195-200, 199); and the "TRAP" assay that measures the total peroxyl radical-trapping antioxidant power of blood serum (Wayner et al., Biochim. Biophys. Acta, 924: 408-419, 1987).

General Description of the Invention

[00226] Mitochondria from all plants, many fungi and some protozoa contain a cyanide- resistant, alternative oxidase that functions as an alternative to cytochrome c oxidase as the terminal oxidase on the electron transfer chain, reducing oxygen to two molecules of water. Electron flow to this "alternative" pathway branches from the conventional respiratory electron transfer pathway (often referred to as the cytochrome pathway) at the level of the ubiquinone pool. Catalytically, the alternative pathway therefore consists of a single enzyme (alternative oxidase) that functions as an ubiquinol oxidase. Electron transfer through the alternative oxidase is not coupled to proton translocation, so two of the three sites of energy conservation are bypassed and the free energy released is lost as heat. AOX accepts electrons from the ubiquinol pool, with the concomitant reduction of molecular oxygen to water. Unlike the cytochrome pathway, the alternative pathway is non-phosphorylating and, therefore, does not contribute directly to oxidative phosphorylation. As this alternative pathway has the potential to decrease the efficiency of respiration, AOX is tightly regulated by two mechanisms. It is active as a non- covalently linked dimer, and inactive when covalently linked via disulphide bonds (Umbach et al, Plant Physiol, 103:845-854, 1993), but requires 2-oxo-acids such as pyruvate to be fully active (Millar et al., FEBS Lett., 329:259-262, 1993). It is generally assumed that the AOX pathway can serve to protect an organism that expresses AOX, such as a plant, during periods of stress (Wagner et al., FEBS Lett., 368:339-342, 1995; Robson et al., Plant Physiol, 129:1908-1920, 2002). A number of studies have shown an induction of AOX synthesis following various stress treatments of plants or cell cultures (for example, Vanlerberghe et al, Plant Physiol, 111 :589-595, 1996; Amora et al, FEBS Lett., 477:175-180, 2000; Sweetlove et al, Plant J., 32:891-904, 2002), and studies utilizing AOX antisense tobacco cell cultures have shown higher levels of reactive oxygen species (ROS) present in the mitochondria while AOX over-expression resulted in lower levels of ROS (Maxwell et al, Proc. Natl Acad. Sci. U.S.A. 96:8271-8276, 1999).

[00227] Alternative oxidase is resistant to inhibitors that act at electron transfer complexes III (including myxothiazol and antimycin) and IV (including cyanide), but it can be inhibited specifically by several compounds, including salicylhydroxamic acid (SHAM) and n-propyl gallate (Moore et al, Biochim. Biophys. Acts 1059:121-140, 1991).

[00228] Two structural models of the AOX currently exist. The first model proposed by Siedow et al (Siedow et al, FEBS Lett. 362, 10-14, 1995; Moore et al, J. Bioenerg. Biomembr. 27, 367-377, 1995) was based on relatively few AOX sequences and classified the AOX as a member of the di-iron family of proteins that also includes the R2 subunit of ribonucleotide reductase and the hydroxylase component of methane monooxygenase. Based on hydropathy analysis, the AOX was predicted to contain two transmembrane helices that are connected by a helix located in the intermembrane space (Moore 1995, supra). Since this model was proposed, further AOX sequences were identified, resulting in the proposal by Andersson and Nordlund (FEBS Lett. 449, 17-22, 1999) of an alternative structural model. Although this second model also classifies the AOX as a di- iron protein, it differs in the precise ligation sphere of the di-iron center (Andersson 1999, supra). For instance, one of the C-terminal GIu-X -X-His motifs identified by Siedow et al. (Siedow 1995, supra; Moore 1995, supra), containing Glu-270, appeared not to be fully conserved in the newly identified sequences and consequently seemed unlikely to play a role in ligating iron. Instead, Andersson and Nordlund used a third Glu-X-X-His motif (that contains Glu-217, which is located in the intermembrane space according to the Siedow et al. model) to coordinate the iron atoms. Since such a choice implies that the transmembrane helices can no longer be retained, Andersson and Nordlund (Andersson 1999, supra) proposed that the AOX is an interfacial rather than a transmembrane protein.

[00229] Recently, the IMMUTANS (Im) gene from Arabidopsis thaliana has been sequenced and, interestingly, was found to encode a plastid terminal oxidase (PTOX) that appears to be distantly related to the AOX (Wu et al., Plant Cell 11, 43-55, 1999; Carol et al., Plant Cell 11, 57-68, 1999). The limited but significant homology of the Im gene to the AOX includes several glutamate and histidine residues located in positions that could contribute to iron binding. In the Im sequence, all but one (Glu-269) of the amino acid residues that were proposed by Andersson and Nordlund to coordinate the di-iron centers are also present. Importantly, however, the model was subtly adapted in so much that Glu-269 was replaced by Glu-268, a residue that indeed is fully conserved throughout all AOX and PTOX sequences.

[00230] It has been reported that AOX proteins from diverse taxonomic groups (see Table 1) all share key conserved amino acid residues in the central regions of the protein, which can be seen in the multi-sequence alignment provided in McDonald et al., Plant. MoI. Biol, 53:865-876, 2003, the disclosure of which is incorporated herein by reference. The conserved amino acid residues include the six iron-binding residues distinctive of di- iron carboxylate proteins (Berthold et al., Annu. Rev. Plant Biol, 54:497-517, 2003), other residues within the four iron-binding motifs, and several other amino acids. Importantly, all of these residues are also completely conserved in the animal proteins (McDonald et al., supra).

Table 1

Blumeria graminis AF327336

Basidiomycota Cryptococcus neoforms AF502293

Plantae Anthophyta Arabidopsis haliana NM_113135

NM_113134

NM 125817

Populus tremula CAB64356

Catharanthus roseus AB055060

Zea mays AAL27795

Triticum aestivum BAB88646

Oryza sativa AB004813

Cucumis sativus AAP35170

Glycine max U87906

Protista Chlorophyta Chlamydomonas reinhardtii AF047832

AF314255

Rhodophyta Cyanidioschyson merolae AP006491

Baαllariophyta Thalassiosira pseudonana

Acrasionycota Dictyostelium discoideum BAB82989

Apicomplexa Cryptosporidium parvum AY312954

Euglenozoa Trypanosoma brucei brucei AB070617

Oomycota Pythium aphanidermatum CAE11918

Eubacteria Proteobacteria Novosphigobium ZP 00095227 aromatiαvorans

[00231] Similarly, review of alternative oxidase sequences from various species demonstrates that alternative oxidase comprises a mitochondrial transit peptide (ranging from 50-80 residues in length) at the N-terminus of the peptide. For example, AOX from Sauromatum guttatum (Swiss Prot Accession No. P22185) has a mitochondrial transit peptide located at the N-terminus (residues 1-62) followed by the mature AOX sequence (residues 63-354).

[00232] Various reports have been published regarding the structure-function relationship of AOX. For example, Moore et al. (Biochem. Soc. Trans., 36:1022-1026, 2008), the disclosure of which is incorporated herein by reference in its entirety) provides experimental studies that constribute to the current understanding of the structure of AOX with particular reference to its catalytic site. Site directed mutagenesis studies have also identified key residues with respect to AOX activity other than those involved in ligating the di-iron center (Albury et al., J. Biol. Chem., 273:30301-30306, 1998; Chaudhuri et al., MoI. Biochem. ParasitoL, 95:53-68, 1998; J. Biol. Chem., 277:1190-1194, 2002; Ajayi et al, J. Biol. Chem., 277:8187-8193, 2002; the disclosures of which are incorporated herein by reference in their entireties). Of particular interest is the finding that most of the AOX sequences possess only four highly conserved tyrosine residues, namely Tyr²⁵³, Tyr²⁶⁶, Tyr²⁷⁵ and Tyr²⁹⁹ (residues are numbered according to the Andersson and Nordlund model (FEBS Lett. 449, 17-22, 1999)). Both Albury et al. (J. Biol. Chem., 277:1190-1194, 2002) and Nakamura et al., (Biochem. Biophys. Res. Commun., 334:593-600, 2005) found that Tyr²⁷⁵ was essential for catalytic activity. Moore et al. (supra) further reports that Tyr²⁶⁶ and Tyr²⁹⁹ are both highly conserved across all organisms and that mutation of either of these residues to alanine results in a highly inhibited enzyme (Nakamura et al., Biochem. Biophys. Res. Commun., 334:593-600, 2005). Moore et al proposes a ubiquinol-binding site in AOX which is a hydrophobic pocket between helices I and II and has confirmed that the His /Arg dyad, part of a potential hydroquinone binding motif (Fisher et al., J. MoI. Biol, 296:1153-1162, 2000), is almost totally conserved among plant AOX and other organisms. Each of the above-referenced reports provides quidance as to which residues of AOX should be maintained in order to preserve activity.

[00233] In the present invention a route for expressing a cyanide-insensitive AOX in human cells was developed and its feasibility demonstrated in a whole organism model. The successful results indicated that said route is adaptable to the metabolic conditions pertaining inside mammalian mitochondria.

[00234] Human mitochondrial respiration is distinct from that of most plants, microorganisms and even some metazoans by reducing molecular oxygen only through the highly cyanide-sensitive enzyme cytochrome c oxidase. The present inventors observed that expression of the cyanide-insensitive alternative oxidase (AOX) was well tolerated by cultured human cells. The cyanide-insensitive AOX was identified in an ascidian of marine origin, i.e. Ciona intestinalis . However, Ciona intestinalis is not the only source of AOX. It may be found in other organisms as well.

[00235] In one specific embodiment of the invention, the expression of AOX conferred a spectacular cyanide-resistance to mitochondrial substrate oxidation, alleviated oxidative stress, apoptosis, i.e. cell death susceptibility, and metabolic acidosis. Furthermore, AOX was shown to be well tolerated when expressed ubiquitously in a whole organism model. Therefore, allotropic AOX expression was shown to be a valuable tool to limit the deleterious consequences of respiratory chain deficiency in human cells and a whole animal model. The expressed AOX appeared to be confined to mitochondria. AOX involvement in electron flow is triggered by a highly reduced redox status of the respiratory chain and enhanced by pyruvate, otherwise the enzyme remains essentially inert.

[00236] In another embodiment of the present invention it was shown that Ciona intestinalis alternative oxidase (AOX), when expressed in human cells, was correctly targeted to mitochondria and rendered mitochondrial substrate oxidation insensitive to the respiratory chain inhibitor, potassium cyanide. Using the AOX inhibitor propyl gallate it is furthermore demonstrated that AOX is enzymatically inert under conditions when the respiratory chain is functioning normally.

[00237] In a further embodiment of the invention, AOX was shown by an indirect assay to inhibit the generation of reactive oxygen species (ROS) when cells were treated with antimycin A, a drug which blocks the respiratory chain at the level of respiratory complex III. This treatment normally leads to a large induction of the mRNA for SOD2, the mitochondrial superoxide dismutase, as a result of the over-production of reactive oxygen species (ROS) when the quinine pool becomes highly reduced. This is relieved in cells expressing AOX, consistent with the prediction that by providing a route to overcome the block on substrate oxidation AOX also prevents the damaging side-effects of increased ROS production.

[00238] In an additional embodiment of the invention, it was demonstrated that AOX expression did not affect the growth rate of human cells in culture.

[00239] One embodiment of the present invention is related to protection of apoptosis or cell death. In the present invention, experimental work is disclosed, which demonstrate that AOX expression in cells completely protects them from apoptosis or cell death induced by the drug oligomycin, an inhibitor of ATP synthase, which results in blockage of the respiratory chain and a massive overproduction of ROS.

[00240] These observations indicated that AOX expression in human cells can be an effective way to restore respiration when the cytochrome segment of the respiratory chain is inhibited, whether by ingestion of toxins, or as a result of disease-causing or ageing- associated mutations of mitochondrial DNA or of nuclear genes encoding components of the mitochondrial oxidative phosphorylation (OXPHOS) system.

[00241] In a further embodiment of the invention it was demonstrated that AOX expression could limit or prevent the consequences of excessive accumulation of mtDNA mutations, which elsewhere has been shown to induce the features of premature ageing. Thus, in said embodiment of the invention, the physiological effects of aging, such as weight loss, reduced subcutaneous fat, alopecia (hair loss), kyphosis (curvature of the spine), osteoporosis, anaemia, reduced fertility and heart enlargement, should be delayed and lifespan increased.

[00242] An additional embodiment of the invention is to provide a tool for studying the consequences of RC dysfunctions. The successful expression of C. intestinalis AOX in human cells constitutes a promising tool to study further the consequences of RC dysfunction because it offers a unique possibility to disconnect electron flow through most of the RC from the phosphorylation process. In another embodiment, allotopic expression of AOX is contemplated as an effective therapy for currently intractable RC disorders. The first step in this endeavor is the expression of AOX in whole organism models, e.g. mouse or Drosophila, exhibiting RC deficiency.

[00243] Accordingly, in the experimental part of the present invention, the effects of expressing the alternative oxidase (AOX) from the ascidian, Ciona intestinalis, in cultured human cells were demonstrated by using the Flp-In™ T-REx expression system, which supports high-level transgene expression in response to induction by doxycyclin. By said system it was demonstrated that AOX is targeted to mitochondria, and leads to metabolic changes as predicted by its known property as a by-pass of the cytochrome segment of the respiratory chain. Accordingly, AOX expression enabled human cells to respire in the presence of concentrations of cyanide which completely block respiration in control cells. The cyanide -insensitive respiration was inhibited by propyl gallate, a specific inhibitor of AOX. Conversely, oxygen consumption in the absence of respiratory chain poisons was insensitive to propyl gallate, indicating that the enzyme does not contribute to electron flow when the respiratory chain is normally functional. AOX expression had no significant effect on respiratory chain activities, but blocked the induction of superoxide dismutase activity in the presence of respiratory poisons such as antimycin, indicating that it alleviates enhanced ROS production when the respiratory chain becomes inappropriately reduced. Furthermore, it greatly diminished the acidification of the medium caused by culturing cells overnight in the presence of cyanide, which results from reliance on lactate production to reoxidize NADH if the respiratory chain is unavailable. Finally, AOX expression provided significant protection against oligomycin-induced cell death during 6 hours of culture.

[00244] All of these ameliorations indicate that AOX expression can have a beneficial effect in combating the deleterious effects of inhibition of the cytochrome segment of the respiratory chain or ATP synthase, whether by toxins or by mutations. As such, it suggests the potential utility of AOX as a wide-spectrum gene therapy agent directed against disorders of oxidative phosphorylation (OXPHOS), including multifarious conditions characterized by pathological inhibition of the OXPHOS system, such as cardiac or cerebral ischemia, and neurodegenerative disorders, e.g. Parkinson's Disease.

[00245] A highly preferred embodiment of the invention is the provision of a gene therapy tool by using allotopic expression of AOX. In order to explore the potential and feasibility of AOX as a gene therapy tool, a more versatile expression system, which allows AOX to be stably expressed at typical levels for a mammalian gene over long periods was developed by using the current lentiviral vectors (Wiznerowicz and Trono, 2005). The expression system allows transformation of a variety of target cell-types and species. This opens the way for testing the efficacy of AOX as a strategy for the alleviation of deleterious phenotypes in a great variety of animal models of human disease, where interference with the mitochondrial OXPHOS system is proposed as a pathological mechanism. The Lentivector-AOX can be injected as at the sites of specific lesions in affected tissues and organs. Successful transduction and survival of transduced cells at the injection site can be conveniently monitored using the GFP reporter of p WPI.

[00246] In the present invention C. intestinalis AOX was expressed in human cells using lentivector transduction under the control of a ubiquitously acting, physiologically relevant promoter. Even though expression at the mRNA level achieved by this route was approximately two orders of magnitude less than using the Flp-In™ T-REx™-293 system under maximal induction, the profound effect on mitochondrial respiratory metabolism was essentially the same. Lentivector-delivered AOX can thus be used to provide a facultative by-pass of the cytochrome segment of the respiratory chain, under conditions where the latter is inhibited, e.g. by toxins, mutations or other insults, such as transient hypoxia.

[00247] In a highly preferred embodiment of the invention, which is a Lentivector- delivered AOX expression, transduced cells can be maintained for at least three weeks with no detectable growth advantage or disadvantage. Unlike many foreign proteins, AOX expressed at this level in human cells would therefore appear to have no toxic effects. Moreover, in contrast to observations that various disturbances in mitochondrial catabolism, notably involving mutations in the TCA cycle enzymes fumarate hydratase and succinate dehydrogenase, can stimulate cell proliferation or even tumorigenic potential (Warburg, 1956; Pollard et al., 2003), lentivector-delivered AOX appears to be essentially inert in this regard. This strengthens the argument that it can be safely adopted as a gene therapy tool, if animal testing confirms its utility.

[00248] Accordingly, in the experimental part of the present invention the effects of AOX expression in the fruit fly Drosophila were demonstrated. Ubiquitous expression in Drosophila is a good first test of whether the whole human organism is able to tolerate the expression of the given foreign gene product. Drosophila cells work on the same genetic and bioenergetic principles as human cells and all of the same major cell-types, tissues and even organs exist in the fly. Using the available fly genetic systems the effect in many different genetic backgrounds can be checked in a short time. The findings can be used to design experiments in mammals, for example in mouse, which is even more similar in its overall physiology to humans and finally in clinical trials with humans.

[00249] The results of the Drosophila experiments showed that whole-organism expression of AOX is well tolerated, supporting normal development with no deleterious consequences. The AOX-expressing flies appeared morphologically normal and were fertile, and produced normal numbers of progeny when mated to non-transgenic flies. AOX transgenic flies appeared to be as long-lived as the most long-lived wild-type. Moreover, the enzyme was active in mitochondria of the adult fly under similar biochemical conditions to those in which it is active in cultured human cells. Expression of AOX in Drosophila rendered mitochondrial substrate oxidation cyanide-insensitive and even partially protected the flies against cyanide toxicity. Even at 1 mM KCN, AOX- expressing flies, which were completely paralysed within 30 min, survived the treatment and were active again after 16 hours. AOX-expressing flies were also resistant to the complex III inhibitor antimycin, which was toxic to wild-type flies when added to fly food. Respiratory chain activities were not significantly altered in mitochondria from AOX-expressing flies compared with control flies, indicating that, as in human cultured cells, AOX is enzymatically inert in the entire organism, except under conditions where it is needed.

Gene Therapy

[00250] It is now widely recognized that DNA may be introduced into a cell using a variety of viral vectors. In such embodiments, expression constructs comprising viral vectors containing the genes of interest may be adenoviral (see, for example, U.S. Patent No. 5,824,544; U.S. Patent No. 5,707,618; U.S. Patent No. 5,693,509; U.S. Patent No. 5,670,488; U.S. Patent No. 5,585,362; each incorporated herein by reference), retroviral (see, for example, U.S. Patent No. 5,888,502; U.S. Patent No. 5,830,725; U.S. Patent No. 5,770,414; U.S. Patent No. 5,686,278; U.S. Patent No. 4,861,719 each incorporated herein by reference), adeno-associated viral (see, for example, U.S. Patent No. 5,474,935; U.S. Patent No. 5,139,941; U.S. Patent No. 5,622,856; U.S. Patent No. 5,658,776; U.S. Patent No. 5,773,289; U.S. Patent No. 5,789,390; U.S. Patent No. 5,834,441; U.S. Patent No. 5,863,541; U.S. Patent No. 5,851,521; U.S. Patent No. 5,252,479 each incorporated herein by reference), an adenoviral-adenoassociated viral hybrid (see, for example, U.S. Patent No. 5,856,152 incorporated herein by reference) a vaccinia viral or a herpesviral (see, for example, U.S. Patent No. 5,879,934; U.S. Patent No. 5,849,571; U.S. Patent No. 5,830,727; U.S. Patent No. 5,661,033; U.S. Patent No. 5,328,688 each incorporated herein by reference) or a lentiviral vector (see, for example, U.S. Patent Nos. 6,207,455 and 6,235,522, each of which are incorporated herein by reference). For many applications, replication-deficient strains of viruses are preferred.

[00251] Those of skill in the art are well aware of how to apply gene delivery to in vivo and ex vivo situations. For viral vectors, one generally will prepare a viral vector stock. Depending on the kind of virus and the titer attainable, one will deliver 1 X 10⁴, 1 X 10⁵, 1 X 10⁶, 1 X 10⁷, 1 X 10⁸, 1 X 10⁹, 1 X 10¹⁰, 1 X 10¹¹ or 1 X 10¹² infectious particles to the patient. Similar figures may be extrapolated for liposomal or other non- viral formulations by comparing relative uptake efficiencies. Formulation as a pharmaceutically acceptable composition is discussed below.

[00252] Various routes are contemplated for various cell types. For practically any cell, tissue or organ type, systemic delivery is contemplated. In other embodiments, a variety of direct, local and regional approaches may be taken. For example, the cell, tissue or organ may be directly injected with the expression vector or protein.

[00253] Preferred promoters for gene therapy for use in this invention include EF-α promoter; cytomegalovirus (CMV) promoter/enhancer, long terminal repeat (LTR) of retroviruses, keratin 14 promoter, and α myosin heavy chain promoter. Tissue specific promoters may be advantageous for disorder or conditions where localized AOX expression is desirable.

[00254] Host cells, including prokaryotic and eukaryotic cells, that are transformed or transfected (stably or transiently) with polynucleotides or vectors discussed herein are considered as an aspect of the invention. Polynucleotides of the invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector. Methods for introducing DNA into the host cell, which are well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts. As stated above, such host cells are useful for amplifying the polynucleotides and also for expressing the polypeptides of the invention encoded by the polynucleotide. The host cell may be isolated and/or purified. The host cell also may be a cell transformed in vivo to cause transient or permanent expression of the polypeptide in vivo. The host cell may also be an isolated cell transformed ex vivo and introduced post-transformation, e.g., to produce the polypeptide in vivo for therapeutic purposes. The definition of host cell explicitly excludes a transgenic human being. In one aspect, ex vivo therapy is introduced into differentiated, undifferentiated or partially differentiated cells of a particular tissue/organ type. Exemplary differentiated cells include somatic cells, neuronal cells, skeletal muscle cells, smooth muscle cells, pancreatic cells, liver cells, and cardiac cells. Exemplary types of cells include but are not limited to undifferentiated or partially differentiated cells including stem cells, totipotent cells, pluripotent cells, embryonic stem cells, inner mass cells, adult stem cells, bone marrow cells, cells from umbilical cord blood, and cells derived from ectoderm, mesoderm, or endoderm.

[00255] Such host cells are useful in assays as described herein. For expression of polypeptides of the invention, any host cell is acceptable, including but not limited to bacterial, yeast, plant, invertebrate (e.g., insect), vertebrate, and mammalian host cells. For developing therapeutic preparations, expression in mammalian cell lines, especially human cell lines, is preferred. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be desirable to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated forms of polypeptides are embraced by the present invention. Similarly, the invention further embraces polypeptides described above that have been covalently modified to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.

[00256] Similarly, the invention provides for the use of polypeptides or polynucleotides or host cells of the invention in the manufacture of a medicament for the treatment of disorders described herein, including but not limited to disorders characterized by defects in the mitochondrial respiratory chain and disorders characterized by oxidative damage in cells.

[00257] In a related embodiment, the invention provides a kit comprising a polynucleotide, polypeptide, or composition of the invention packaged in a container, such as a vial or bottle, and further comprising a label attached to or packaged with the container, the label describing the contents of the container and providing indications and/or instructions regarding use of the contents of the container to treat one or more disease states as described herein.

[00258] In other embodiments, non- viral delivery is contemplated. These include calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52:456-467 (1973); Chen and Okayama, MoI. Cell Biol, 7:2745-2752, (1987); Rippe, et al, MoI. Cell Biol, 10:689-695 (1990)), DEAE-dextran (Gopal, MoI. Cell Biol, 5:1188-1190 (1985)), electroporation (Tur-Kaspa, et al., MoI. Cell Biol, 6:716-718, (1986); Potter, et al., Proc. Nat. Acad. Sci. USA, 81 :7161-7165, (1984)), direct microinjection (Harland and Weintraub, J. Cell Biol, 101 :1094-1099 (1985)), DNA-loaded liposomes (Nicolau and Sene, Biochim. Biophys. Acta, 721 :185-190 (1982); Fraley, et al, Proc. Natl. Acad. Sci. USA, 76:3348-3352 (1979); Feigner, Sci. Am., 276(6): 102-6 (1997); Feigner, Hum. Gene Ther., 7(15): 1791-3, (1996)), cell sonication (Fechheimer, et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467 (1987)), gene bombardment using high velocity microprojectiles (Yang, et al., Proc. Natl. Acad. Sci. USA, 87:9568-9572 (1990)), and receptor-mediated transfection (Wu and Wu, J. Biol. Chem., 262:4429-4432 (1987); Wu and Wu, Biochemistry, 27:887-892 (1988); Wu and Wu, Adv. Drug Delivery Rev., 12:159-167 (1993)).

[00259] In a particular embodiment of the invention, the expression construct (or the proteins) may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, "In Liver Diseases, Targeted Diagnosis And Therapy Using Specific Receptors And Ligands," Wu, G., Wu, C, ed., New York: Marcel Dekker, pp. 87-104 (1991)). The addition of DNA to cationic liposomes causes a topological transition from liposomes to optically birefringent liquid-crystalline condensed globules (Radler, et al., Science, 275(5301):810-4, (1997)). These DNA-lipid complexes are potential non-viral vectors for use in gene therapy and delivery.

[00260] Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Also contemplated in the present invention are various commercial approaches involving "lipofection" technology. In certain embodiments of the invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda, et al., Science, 243:375-378 (1989)). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear nonhistone chromosomal proteins (HMG-I) (Kato, et al., J. Biol. Chem., 266:3361-3364 (1991)). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-I . In that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention.

[00261] Other vector delivery systems that can be employed to deliver a nucleic acid encoding a therapeutic gene into cells include receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu (1993), supra).

[00262] Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent. Several ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu (1987), supra) and transferrin (Wagner, et al, Proc. Nat'l. Acad Sci. USA, 87(9):3410-3414 (1990)). Recently, a synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle (Ferkol, et al., FASEB. J., 7:1081-1091 (1993); Perales, et al., Proc. Natl. Acad. Sci., USA 91 :4086-4090 (1994)) and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells (Myers, EPO 0273085).

[00263] In other embodiments, the delivery vehicle may comprise a ligand and a liposome. For example, Nicolau, et al., Methods EnzymoL, 149:157-176 (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes. Thus, it is feasible that a nucleic acid encoding a therapeutic gene also may be specifically delivered into a particular cell type by any number of receptor-ligand systems with or without liposomes.

[00264] In another embodiment of the invention, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above that physically or chemically permeabilize the cell membrane. This is applicable particularly for transfer in vitro, however, it may be applied for in vivo use as well. Dubensky, et al., Proc. Nat. Acad. Sci. USA, 81 :7529-7533 (1984) successfully injected polyomavirus DNA in the form of CaPO4 precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif, Proc. Nat. Acad. Sci. USA, 83:9551-9555 (1986) also demonstrated that direct intraperitoneal injection of CaPO4 precipitated plasmids results in expression of the transfected genes.

[00265] Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein, et al., Nature, 327:70- 73 (1987)). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang, et al., Proc. Natl. Acad. Sci USA, 87:9568-9572 (1990)). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

[00266] Other non-viral delivery mechanisms contemplated include calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52:456-467, 1973; Chen and Okayama, MoI. Cell Biol, 7:2745-2752, 1987; Rippe et al., MoI. Cell Biol, 10:689-695, 1990) DEAE-dextran (Gopal, MoI. Cell Biol, 5:1188-1190, 1985), electroporation (Tur-Kaspa et al., MoI. Cell Biol, 6:716-718, 1986; Potter et al., Proc. Nat. Acad. Sci. USA, 81 :7161- 7165, 1984), direct microinjection (Harland and Weintraub, J. Cell Biol, 101 :1094-1099, 1985.), DNA-loaded liposomes (Nicolau and Sene, Biochim. Biophys. Acta, 721 :185-190, 1982; Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979; Feigner, Sci Am. 276(6): 102 6, 1997; Feigner, Hum Gene Ther. 7(15): 1791 3, 1996), cell sonication (Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987), gene bombardment using high velocity microprojectiles (Yang et al., Proc. Natl. Acad. Sci USA, 87:9568- 9572, 1990), and receptor-mediated transfection (Wu and Wu, J. Biol. Chem., 262:4429- 4432, 1987; Wu and Wu, Biochemistry, 27:887-892, 1988; Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993).

Mitochondrial Targeting

[00267] In still other embodiments, the delivery vehicle may specifically deliver polynucleotides to mitochondria (U.S. Patent Application Publication Nos. 2006/0211647, 2006/0183227 and 2004/0154046, the disclosures of which are incorporated herein by reference in their entireties). [00268] Targeting of specific polypeptides to organelles can be accomplished by modifying polynucleotides that encodes them to express specific organelle targeting signals. These signals target specific organelles, but in some embodiments the interaction of the targeting signal with the organelle does not occur through a traditional receptor:ligand interaction. The eukaryotic cell comprises a number of discrete membrane bound compartments, or organelles. The structure and function of each organelle is largely determined by its unique complement of constituent polypeptides. However, the vast majority of these polypeptides begin their synthesis in the cytoplasm. Thus organelle biogenesis and upkeep require that newly synthesized proteins can be accurately targeted to their appropriate compartment. This is often accomplished by amino-terminal signaling sequences, as well as post-translational modifications and secondary structure. For mitochondria, several amino-terminal targeting signals have been deduced. Exemplary mitochondrial targeting signals include those listed as Genbank Accession Nos. NP633590, Q9DCW4, NP000099, NP067274, NP080720, AA031763, NP032641, AAH49802, NP000273, NP031647, XP331748, NP000008, WPOOO 117, NP002147, XP326125, NP002216, NP898871, NP002387, NP004101, NP001599, NP005720, P22572, AAP88794, AAH55030, AAH53661, NP036216, NP032329, NP001600, P42126, NP031408, NM201263, NP060297, AAH27412, AAC25560, NP006558, NP001688, AAP35327, NP061820, CAA29050, NP056155, AAG31658, NP0323289, NP497429, NP000681, NP005262, NP000099, NP000275, AAH00439, NP005381, NP000700, P08249, NP004083, JC4022, AAP35352, NP032123, NP499075, NP509584, NP034607, AAB27965, AAC52130, AAH05476, NP000007, AAH39158, DSHUN, AAC42010, NP005382, AAA56664, NP000174, AAHl 1617, NP005318, AAH16180, AAF21941, AAH01917, AAC52130, NP495693, NP000522, CAA30121, NP000021, NP733844, NP009320, NP055975, NP002603, CAA42060, NP034455, NP032676, CAA39695, PI9974, AAH57347, NP032836, CAA32052, P33540, NP001976, P42125, NP000246, CAE35137, NP499264, NP002148, NP006671, NP032023, NP034152, NP031559, NP000427, NP492290, NP510764, NP000679, NP056155, XP323115, tl5761, NP033463, NP005923, NP003468, NP002071, NP000265, NP000021, AAH08119, P39726, NP009531, NP009515, NP009473, NP009463, NP009678, CAA55624, NP009704, NP009780, NP009786, NP009810, NP009827, NP009841, NP009929, NP009953, NP009958, NP009975, NP010079, NP010432, NP010480, NP010750, NPl 16635, NPOl 1760, NPOl 1872, NP012194, CAA89390, NP012647, NP012884, NP013073, NP013160, NP013597, NP013778, NP013788, NP014546, NP014683, NP014785, NP015207, NP015190, NPO 15071, NP015061 CAA89167 and NP015392.

[00269] In one embodiment, the organelle targeting signal can contain at least two, at least 5-15, or about 11 charged groups, causing the targeting signal to be drawn to organelles having a net opposite charge. In another embodiment, the targeting signal can contain a series of charged groups that cause the targeting signal to be transported into an organelle either against or down an electromagnetic potential gradient. Suitable charged groups are groups that are charged under intracellular conditions such as amino acids with charged functional groups, amino groups, nucleic acids, and the like. Mitochondrial localization/targeting signals generally consist of a leader sequence of highly positively charged amino acids, which allows the protein to be targeted to the highly negatively charged mitochondria. Unlike receptor :ligand approaches that rely upon stochastic Brownian motion for the ligand to approach the receptor, the mitochondrial localization signal of some embodiments is drawn to mitochondria because of charge.

[00270] In order to enter the mitochondria, a protein generally must interact with the mitochondrial import machinery, consisting of the Tim and Tom complexes (Translocase of the Inner/Outer Mitochondrial Membrane). With regard to the mitochondrial targeting signal, the positive charge draws the linked protein to the complexes and continues to draw the protein into the mitochondria. The Tim and Tom complexes allow the proteins to cross the membranes. Accordingly, some embodiments of the present invention deliver compositions to the inner mitochondrial space utilizing a positively charged targeting signal and the mitochondrial import machinery.

[00271] In another embodiment, the invention includes a polynucleotide that encodes a mature AOX polypeptide operatively connected in frame to a polynucleotide that encodes an organelle localization signal. Such a chimeric construct can be introduced into organelles of cells. The cells can be a transformed cell line that can be maintained indefinitely in cell culture, or the cells can be from a primary cell culture. Exemplary cell lines include those available from American Type Culture Collection. The nucleic acid can be replicated and transcribed within the nucleus of a cell of the transfected cell line. The targeting signal can be enzymatically cleaved if necessary such that the polynucleotide that encodes a mature AOX polypeptide is free to remain in the target organelle.

[00272] Any eukaryotic cell can be transfected to produce organelles that express a specific nucleic acid, for example a metabolic gene, including primary cells as well as established cell lines. Exemplary types of cells include but are not limited to undifferentiated or partially differentiated cells including stem cells, totipotent cells, pluripotent cells, embryonic stem cells, inner mass cells, adult stem cells, bone marrow cells, cells from umbilical cord blood, and cells derived from ectoderm, mesoderm, or endoderm. Exemplary differentiated cells include somatic cells, neuronal cells, skeletal muscle cells, smooth muscle cells, pancreatic cells, liver cells, and cardiac cells.

[00273] Given the importance of mitochondria in human disease, cell proliferation, cell death, and aging, embodiments of the present invention also encompasses the manipulation of the mitochondrial genome to supply the means by which known mitochondrial disorders (including LHON, MELAS.) and putative mitochondrial disorders (including aging, Alzheimer's Disease, Parkinson's Disease, Diabetes, Heart Disease) are treated, or the disease or symptoms onset if delayed or prevented.

Therapeutic (including Prophylactic) Uses of the AOX Polynucleotides and Polypeptides of the Invention

[00274] The invention provides numerous in vitro and in vivo methods of using the AOX polypeptides and polynucleotides of the invention. In one aspect, AOX is used as a gene therapy tool to correct, prevent, or delay the onset of bioenergetic defects arising from mutations affecting the mitochondrial OXPHOS system, whether inherited or generated somatically during aging. AOX permits electron flow to resume under conditions where the mitochondrial respiratory chain is partially blocked within the cytochrome segment or ATP synthase. However, AOX-supported electron flow is non- proton-pumping, hence does not contribute directly to ATP generation. On the other hand, if the cytochrome chain is blocked at complex III or IV, AOX can allow electron and proton flow through complex I to resume, which should at least partially restore ATP generation. The prediction from our findings is that AOX should have utility under conditions of partial respiratory chain blockage at or beyond complex III, e.g. resulting from mis-sense mutations in structural subunits, or loss of assembly factors and chaperones (e.g. Surfl), which leave some residual activity in the cytochrome chain, and hence do not diminish ATP production below a critical threshold. Under these circumstances, the protective effects of AOX in blocking reverse electron flow and supporting the reoxidation of NADH, thus minimizing harmful ROS production, metabolic acidosis and the generation of pro-apoptotic signals, should assist in alleviating the consequences of physiological dysfunction of the respiratory chain.

[00275] Since AOX expression is thus shown to be both benign and beneficial in the whole organism, it can be inferred that it will be a useful tool for the treatment, prevention, or delay of a wide spectrum of human disorders affecting the mitochondrial respiratory chain, via gene therapy. A mitochondrial respiratory chain disorder can present itself in many areas of the body, including neurological, muscle, op hthalmo logical, heart, renal, liver, blood, gastrointestinal, the endocrine system and metabolic decompensation. A review of mitochondrial respiratory chain disorders can be found in Morris et al., (J. Royal Soc, Med, 88:217P-222P, 1995), the disclosure of which is incorporated herein by reference in its entirety. Exemplary mitochondrial respiratory chain disorders include Leigh syndrome (caused by mutations in mitochondrial genes for subunits of ATP synthase or other OXPHOS complexes, or nuclear genes for the complex IV assembly factor SURFl or other proteins involved in the biogenesis of the OXPHOS system); MERRF syndrome (caused by mutations in mitochondrial tRNA-Lys or other components of the mitochondrial translational apparatus); Parkinson's Disease and related conditions (caused by mutations in genes for mitochondrial functions, including the mtDNA polymerase POLG, mitochondrial protein kinase signaling, protein metabolism or resistance against oxidative stress); Mitochondrial encephalomyopathies, including progressive external ophthalmoplegia, Kearns-Sayre syndrome and MELAS syndrome (caused by deletions or point mutations of mitochondrial DNA, nuclear genes involved in mtDNA maintenance or biogenesis of the respiratory chain); Diverse, multisystem pediatric disorders affecting organs such as liver, kidney, the CNS, heart, skeletal muscle, and the endocrine and sensorineural systems (resulting from mutations in genes for OXPHOS subunits, assembly factors, mitochondrial protein synthesis components, mitochondrial protein import, processing and turnover, metabolite transport or synthesis of prosthetic groups and electron carriers for OXPHOS); diseases whose pathogenesis is known or believed to involve excessive production of reactive oxygen species in mitochondria, including amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia and forms of cardiovascular disease attributable to defects in antioxidant defenses; other ataxias and neurological conditions resulting from genetics defects in POLG, cl0orf2 (Twinkle) or other components of the system of mitochondrial DNA maintenance; mitochondrial hearing impairment, both syndromic and nonsyndromic (caused by mutations in the mitochondrial genes for 12S rRNA, tRNASer(UCN) or other components of the mitochondrial translational apparatus); forms of diabetes mellitus attributable to defects of the mitochondrial OXPHOS system (resulting from mtDNA deletions, point mutations or sequence polymorphisms); side-effects of antiretroviral therapies that impact the mitochondrial OXPHOS system; intractable obesity and other metabolic disorders resulting from disturbances in the mobilization of food resources; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; Diabetes mellitus and Lactic acidemia.

[00276] Diseases of the mitochondria appear to cause the most damage to cells of the brain, heart, liver, skeletal muscles, kidney and the endocrine and respiratory systems. Thus, transfection of mitochondria in these cells and tissues (or progenitor cells that can differentiate into these types of tissues) with AOX is within the scope of the present invention. It will be appreciated that the mitochondria can be transfected to express any protein whether naturally present in the mitochondrion or not or naturally encoded by mtDNA or nuclear DNA. Depending on which cells are affected, symptoms of the disease to be treated may include loss of motor control, muscle weakness and pain, gastrointestinal disorders and swallowing difficulties, poor growth, cardiac disease, liver disease, diabetes, respiratory complications, seizures, visual/hearing problems, lactic acidosis, developmental delays and susceptibility to infection.

Prophylactic methods and genetic testing

[00277] In another aspect, the invention provides a method for prophylaxis therapy for a subject (not previously diagnosed with the disorder associated with OXPHOS dysfunction) at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction described herein. For example, the method comprises identifying a subject as being at risk for developing a disorder associated with OXPHOS dysfunction and administering to the subject an effective amount of a therapeutic selected from the group consisting of (a) a polynucleotide described herein comprising a nucleotide seuqnece that encodes an alternative oxidase protein and (b) a cell transformed or transfected with the polynucleotide.

[00278] In another aspect, methods are provided for prophylaxis therapy for a disorder associated with cytochrome c oxidase activity. Disorders associated with cytochrome c deficiency include, but are not ilimited to, Leigh syndrome, fatal hypertrophic cardiomyopathy (HCMP) with encephalopathy, hepatic failure, tubulopathy with encephalomyopathy and leukodystrophy. Such methods comprise identifying a subject having a mutation that is correlated with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10 and Cox 15 and administering to the subject a therapeutic selected from the group consisting of a polynucleotide described herein comprising a nucleotide sequence that encodes an alternative oxidase protein and a cell transformed or transfected with the polynucleotide.

[00279] In another aspect, methods of treating a disorder associated with mitochondrial OSPHOS dysfunction are provided. Such methods comprise screening a biological sample from a subject suspected of having a disorder associated with mitochondrial OXPHOS dysfunction for a mutation that is correlated with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10 and Cox 15 and administering to the subject a therapeutic selected from the group consisting of a polynucleotide described herein comprising a nucleotide sequence that encodes an alternative oxidase protein and a cell transformed or transfected with the polynucleotide.

[00280] In yet another aspect, therapeutic or prophylactic methods for treating a disorder associated with miotochondrial OXPHOS dysfunction are provided. Such methods comprse identifying a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, transforming or transfecting cells from the subject ex vivo with a polynucleotide described herein comprising a nucleotide sequence that encodes an alternative oxidase, and administering the transformed or transfected cells to the subject.

[00281] The subject can be identified as being at risk for developing a disorder associated with OXPHOS dysfunction in various ways. For example, in one embodiment, the subject is identified as being as risk because the subject has relative (e.g., sibling, common genetic parent) that has been diagnosed with a disorder associated with a mitochondrial OXPHOS dysfunction (or cytochrome c oxidase activity).

[00282] In another embodiment, the methods described herein comprise identifying the subject as being at risk be screening for the presence of a mutation in the genome of the subject that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction. The screening may comprise obtaining a biological sample from the subject and analyzing nucleic acid (e.g., mitochondrial DNA) from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with OXPHOS dysfunction.

[00283] A plethora of genes are associated with mitochondrial OXPHOS function (Capkova et al, Cas. Les. Cesk., 141 :636-641, 2002; Howell, N., Am. J. Hum. Genet., 55:219-224, 1994; Lin et al., Nature, 443:787-795, 2006; Moslemi et al., Neurology, 61 :991-993, 2003; Zeviani, M., Cell. Dev. Biol, 12:407-416, 2001; Moore et al., Hum. Molec. Genet., 14:71-84, 2005; Bonifati et al., Science, 299:256-259, 2003; Olzmann et al., J. Biol. Chem., 279:8506-8515, 2004; Agostino et al., Hum. Molec. Genet., 12:399- 413, 2003; Antonicka et al., Hum. Molec. Genet., 12:2693-2702, 2003; Antonicka et al., Am. J. Hum. Genet., 72:101-114, 2003; Valnot et al., Am. J. Hum. Genet., 67:1104-1109, 2000; Jaksch et al., Hum. Molec. Genet., 10:3025-3035, 2001; Rossi et al., Am. J. Neuroradiol., 24:1188-1191, 2003; DeMauro et al., Annu. Rev. Neurosci., 31 :91-123, 2008; and Santoro et al., Neuromusc. Disorders, 10:450-453, 2000, the disclosure of which are incorporated herein by reference in their entireties). These genes include, but are not limited to, DJl, Cox 10, Scol, Sco2, MTCOXl, MTCOX2, MTCOX3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxόAl, Cox6A2, CoxόBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L BCSlL, MTATP6, MTTLl, MTTK, MTNDl, MTND3, MTND4, MTND5, MTND6, MTCO3, MTTW, MTTV, NDUFSl, BSClL, Surfl, LRPPRC and Coxl5. In one embodiment, the gene is associated with the proper assembly of cytochrome c oxidase (OXPHOS complex IV) (including, but not limited to, CoxlO, Coxl5, Cox4Il, Cos4I2, Cos5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, CoxβC, CoxβC, Cox7Al, Cox7A2, Cox7A3, Cox7B, Cox7B2, Cox7C, Cox8, Coxl 1, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L). In another embodiment, the gene is associated with proper assembly of OXPHOS complex III (e.g., BCSlL). Table 2 below lists the various human genes identified above as well as their respective Genbank Accession Nos and sequence identifiers.

[00284] Table 2

[00285] Genetic diagnosis of a mutation in a gene associated mitochondrial OXPHOS dysfunction (or cytochrome c oxidase deficiency) can be performed using any technologies for assaying DNA for a mutation. The nucleic acid sequence data can be obtained by any means known in the art. For example, the nucleic acid sequence data may be obtained through direct analysis of the sequence of one or both alleles of gene or a polymorphic site within a gene. The assaying step may involve any techniques available for analyzing nucleic acid to determine its characteristics, including but not limited to well-known techniques such as single-strand conformation polymorphism analysis (SSCP) (Orita et al, Proc Natl. Acad. Sci. USA, 86: 2766-2770, 1989); non-radioactive PCR- single strand conformation polymorphism analysis; DNA and/or RNA hybridization; heteroduplex analysis (White et al., Genomics, 12: 301-306, 1992); denaturing gradient gel electrophoresis analysis (Fischer et al., Proc. Natl. Acad. Sci. USA, 80: 1579-1583, 1983); and Riesner et al., Electrophoresis, 10: 377-389 ,1989); DNA sequencing (manual or automated) Sanger et al., Proc. Natl. Acad. Sci. USA, 74:5463-5467 (1977); RNase cleavage (Myers et al., Science, 230: 1242-1246, 1985); chemical cleavage of mismatch techniques (Rowley et al., Genomics, 30: 574-582, 1995; and Roberts et al., Nucl. Acids Res., 25: 3377-3378, 1997); restriction fragment length polymorphism (RFLP) analysis; single nucleotide primer extension analysis (Shumaker et al., Hum. Mutat., 7: 346-354, 1996); and Pastinen et al., Genome Res., 7: 606-614, 1997); 5' nuclease assays (Pease et al., Proc. Natl. Acad. Sci. USA, 91 :5022-5026, 1994); DNA Microchip analysis (Ramsay, G., Nature Biotechnology, 16: 40-48, 1999; and Chee et al., U.S. Patent No. 5,837,832); analysis using a single nucleotide polymorphism (SNP) chip containing SNP 's from throughout the genome (e.g., Infmium HD BeadChip) or from a portion of the genome, such as the mitochondrial genome; ligase chain reaction (Whiteley et al., U.S. Patent No. 5,521,065); cloning for polymorphisms; denaturing high pressure liquid chromatography (DHPLC); clamped denaturing gel electrophoresis (CDGE); denaturing gradient gel electrophoresis (DGGE); mobility shift analysis; restriction enzyme analysis; chemical mismatch cleavage (CMC); RNase protection assays; and use of polypeptides that recognize nucleotide mismatches, such as E. coli mutS protein; and allele-specific PCR. See generally, Schafer and Hawkins, Nature Biotechnology, 16: 33-39, 1998; Li et al., Nucleic Acids Research, 28(2): el (i-v) (2000); Liu et al., Biochem Cell Bio 80:17-22 (2000); and Burczak et al., Polymorphism Detection and Analysis, Eaton Publishing, 2000; Sheffield et al., Proc. Natl. Acad. Sci. USA, 86:232-236 (1989); Flavell et al., Cell, 15:25-41 (1978); Geever et al, Proc. Natl. Acad. Sci. USA, 78:5081-5085 (1981); Cotton et al., Proc. Natl. Acad. Sci. USA, 85:4397-4401 (1985); Myers et al., Science 230:1242- 1246 (1985); Church and Gilbert, Proc. Natl. Acad. Sci. USA, 81 :1991-1995 (1988);; and Beavis et al., U.S. Patent No. 5,288,644). All of the foregoing documents are hereby incorporated by reference in their entirety.

[00286] In another variation of the invention, the necessary sequence information is obtained from a database or other record that contains nucleic acid sequence information pertaining to the genome of a subject.

[00287] In one preferred embodiment, the assaying involves sequencing of nucleic acid to determine nucleotide sequence thereof, using any available sequencing technique. (See, e.g., Sanger et al., Proc. Natl. Acad. Sci. (USA), 74: 5463-5467, 1977 (dideoxy chain termination method); Mirzabekov, TIBTECH, 12: 27-32, 1994 (sequencing by hybridization); Drmanac et al., Nature Biotechnology, 16: 54-58, 1998; U.S. Patent No. 5,202,231; and Science, 260: 1649-1652,1993 (sequencing by hybridization); Kieleczawa et al., Science, 258:1787-1791, 1992 (sequencing by primer walking); (Douglas et al., Biotechniques, 14:824-828, 1993 (Direct sequencing of PCR products); and Akane et al., Biotechniques 16: 238-241, 1994; Maxam and Gilbert, Meth. EnzymoL, 65: 499-560, 1977 (chemical termination sequencing), all incorporated herein by reference in their entireties). The analysis may entail sequencing of the entire gene genomic DNA sequence, or portions thereof; or sequencing of the entire gene coding sequence or portions thereof. In some circumstances, the analysis may involve a determination of whether an individual possesses a particular gene allelic variant, in which case sequencing of only a small portion of nucleic acid — enough to determine the sequence of a particular codon or codons characterizing the allelic variant — is sufficient. This approach is appropriate, for example, when assaying to determine whether one family member inherited the same allelic variant that has been previously characterized for another family member, or, more generally, whether a person's genome contains an allelic variant that has been previously characterized and correlated with a disorder associated with mitochondrial OXPHOS dysfunction (or cytochrome c oxidase deficiency).

[00288] In another embodiment, the assaying comprises performing a hybridization assay to determine whether nucleic acid from the subject has a nucleotide sequence identical to or different from one or more reference sequences. In a preferred embodiment, the hybridization involves a determination of whether nucleic acid derived from the human subject will hybridize with one or more oligonucleotides, wherein the oligonucleotides have nucleotide sequences that correspond identically to a portion of the gene sequence, or that correspond identically except for one mismatch, insertion, or deletion. The hybridization conditions are selected to differentiate between perfect sequence complementarity and imperfect matches differing by one or more bases. Such hybridization experiments thereby can provide single nucleotide polymorphism sequence information about the nucleic acid from the human subject, by virtue of knowing the sequences of the oligonucleotides used in the experiments.

[00289] Several of the techniques outlined above involve an analysis wherein one performs a polynucleotide migration assay, e.g., on a polyacrylamide electrophoresis gel, under denaturing or non-denaturing conditions. Nucleic acid derived from the subject is subjected to gel electrophoresis, usually adjacent to one or more reference nucleic acids, such as reference gene sequences having a coding sequence identical to all or a portion of the gene sequences provided in Table 2 or another reported gene sequence associated with mitochondrial OXPHOS function (or cytochrome c oxidase assembly) , or identical except for one known polymorphism. The nucleic acid from the subject and the reference sequence(s) are subjected to similar chemical or enzymatic treatments and then electrophoresed under conditions whereby the polynucleotides will show a differential migration pattern, unless they contain identical sequences. (See generally Ausubel et al. (eds.), Current Protocols in Molecular Biology, New York: John Wiley & Sons, Inc. (1987-1999); and Sambrook et al., (eds.), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press (1989), both incorporated herein by reference in their entirety.)

[00290] In the context of assaying, the term "nucleic acid of a human subject" is intended to include nucleic acid obtained directly from the human subject (e.g., DNA (including mitochondrial DNA) or RNA obtained from a biological sample such as a blood, tissue, or other cell or fluid sample); and also nucleic acid derived from nucleic acid obtained directly from the human subject. By way of non- limiting examples, well known procedures exist for creating cDNA that is complementary to RNA derived from a biological sample from a human subject, and for amplifying (e.g., via polymerase chain reaction (PCR)) DNA or RNA derived from a biological sample obtained from a human subject. Any such derived polynucleotide which retains relevant nucleotide sequence information of the human subject's own DNA/RNA is intended to fall within the definition of "nucleic acid of a human subject" for the purposes of the present invention.

[00291] In the context of assaying, the term "mutation" includes addition, deletion, and/or substitution of one or more nucleotides in a gene sequence that is associated with mitochondrial OXPHOS function (or cytochrome c oxidase assembly). As reported herein, several gene mutations have been reported that play apparent causative roles in mitochondrial OXPHOS dysfunction (or cytochrome c oxidase deficiency). Even mutations that have no apparent causative role may serve as useful markers for mitochondrial OXPHOS dysfunction, provided that the appearance of the mutation correlates reliably with the appearance of mitochondrial OXPHOS dysfunction.

[00292] In such diagnostic methods, the polynucleotide sequences encoding the gene protein product may be used in hybridization or PCR assays of fluids or tissues from biopsies to detect expression of the appropriate protein. Such methods may be qualitative or quantitative in nature and may include Southern or northern analysis, dot blot or other membrane-based technologies; PCR technologies; dip stick, pin, chip and ELISA technologies. All of these techniques are well known in the art and are the basis of many commercially available diagnostic kits.

[00293] In order to conduct genetic analyses, biological samples are obtained from the subject of interest. Any tissue or fluid sample that contains DNA (including mitochondrial DNA) is suitable, such as a tissue biopsy or blood sample. For some types of analysis, DNA from these samples is isolated using techniques well known to those of skill in the art. For example, DNA may be isolated from the EDTA-anticoagulated whole blood by the method of Miller et al., Nucleic Acids Res., 16: 1215, 1998, and from cytobrush specimens using the Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN).

[00294] PCR as described in U.S. Patent Nos. 4,683,195 and 4,965,188 provides additional uses for oligonucleotides based upon the gene sequence(s) being tested. Such oligomers are generally chemically synthesized, but they may be generated enzymatically or produced from a recombinant source as described herein above. Oligomers generally comprise two nucleotide sequences, one with sense orientation and one with antisense, employed under optimized conditions for identification of a specific gene or condition. The same two oligomers, nested sets of oligomers, or even a degenerate pool of oligomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.

[00295] Using such oligomers, the sequence of the gene being tested for a mutation is screened for variation by direct sequencing of portions of gene. The sequencing strategy uses amplification primers generated based upon the cDNA sequence of the gene of interest. Preferably, the primers are designed to amplify a region of interest known to have a mutation. Amplification and sequencing primers may be readily synthesized using techniques well known to those of skill in the art. Amplification primers also may be tagged at the 5' end with the forward or reverse M 13 universal sequence to facilitate direct sequencing. Amplimers were subjected to cycle sequencing using the dRhodamine terminator ready reaction kit or the Dye Primer ready reaction kit for -M 13 and M 13 Rev primers (Perkin Elmer) and analyzed on the Prism ABI 377 fluorescent sequencer. Sequences can then be aligned for further analysis using a program such as, e.g., SEQUENCHER 3.0 (Gene Codes).

[00296] In some embodiments, the identifying step of the methods decribed herein comprise screening for the presence of a mutation in a gene selected from the group consisting of Surfl, SCOl, SCO2, CoxlO, and Coxl5 of the subject, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency. Such screening may include obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene selected from the group consisting of Surfl, SCOl, SCO2, CoxlO, and Coxl5, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency.

[00297] In some embodiments, the identifying comprises screening for the presence of a mutation in a gene selected from DJl, CoxlO, Scol, Sco2, MTCOXl, MTCOX2, MTCOX3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, Cox6Al, Cox6A2, Cox6Bl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL.

[00298] In one embodiment, the gene is DJl and the method comprises screening for a missense mutation causing a DJl amino acid mutation selected from the group consisting of C106E, C106D, L166P, M25I, A104T, and D149A of SEQ ID NO: 19. In another embodiment, the gene is Cox 10 and the method comprises screening for a missense mutation causing a Cox 10 gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A121 IT and A121 IG of SEQ ID NO: 20. In another embodiment, the gene is Cox 10 and the method comprises screening for a missense mutation causing a Cox 10 amino acid mutation selected from the group consisting of T196K, P225L, D336V and D336G of SEQ ID NO: 21. In another embodiment, the gene is SCOl and the method comprises screening for a missense mutation causing a SCOl gene C520T mutation of SEQ ID NO: 24. In another embodiment, the gene is SCOl and the method comprises screening for a missense mutation causing a SCOl P174L amino acid mutation of SEQ ID NO: 25. In yet another embodiment, the method comprises screening for a missense mutation causing a SC02 amino acid mutation selected from the group consisting of E140K, R90X, and R171W of SEQ ID NO: 27.

[00299] In yet another embodiment, the gene is Cox 15 and the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C. In another embodiment, the gene is Cox 15 and the method comprises screening for a missense mutation causing a Cox 15 amino acid mutation selected from the group consisting of R217W and F374L of SEQ ID NO: 23. In yet another embodiment, the gene is Surfl and the method comprises screening for a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T. In another embodiment, the gene is Surfl and the method comprises screening for a missense mutation causing a Surfl Q82X amino acid mutation of SEQ ID NO: 29.

[00300] Alternatively, the nucleic acid sequence data may be obtained through indirect analysis of the nucleic acid sequence of an allele of the polymorphic marker. For example, if an allelic variation causes an altered amino acid sequence of an encoded protein, as compared to the non-variant (e.g., wild-type) protein, e.g., due to substitutions, deletions, insertions, or truncation (due to, e.g., splice variation), then evidence of the nucleic acid change may be obtained from the protein sequene. Methods of detecting variant proteins include direct amino acid sequencing of the variant protein (or a fragment of the protein); SDS-PAGE followed by gel staining (to detect variant proteins of different molecular weights) and immunoassays (e.g., immunofluorescent immunoassays, immunoprecipitations, radioimmunoasays, ELISA, and Western blotting), in which an antibody specific for an epitope comprising the variant position which differentially recognizes one form of the protein can be used.

[00301] In another aspect, the subject is identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction through the use of biochemical assays. For example, in one embodiment, the identifying step comprises measuring a level of activity of a protein selected from the group consisting of Surf 1 , SCOl, SCO2, CoxlO, and Coxl5 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. The measuring may include comparing a level of activity of a protein selected from the group consisting of Surfl, SCOl, SC02, CoxlO, and Cox 15 in a biological sample of the subject suspected of having a disorder associated with OXPHOS dysfunction (or cytochrome c oxidase deficiency) to the with a sample from a healthy subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. The presence, absence or reduced level of the protein can be determined, for example, by Western blot. The level of activity of the protein can be determined, for example, by Blue-Native (BNE) gels or by two-dimensional BNE-SDS-PAGE (Wittig et al, Nat. Protocol, 1 :416-428, 2006; Rais et al., Proteomics, 2567-2571, 2004; Zerbetto et al., Electrophoresis, 18:2059- 2064, 1997; )

[00302] In another embodiment, the identifying step comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. In another embodiment, the identifying step comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. Methods of measuring levels of ATP and ADP in a sample are known in the art. See, for example, ATPlite Luminescence ATP Detection Assay System (Perkin Elmer) and ADPQuest™ (DiscoveRx).

[00303] In yet another embodiment, the identifying step comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. Methods of measuring levels of lactate in a sample are known in the art. See, for example, SIGMA Lactate Assay.

[00304] In yet another embodiment, the identifying step comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by standard enzymatic assays known in the art, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. Exemplary methods of determining the level of cytochrome c oxidase activty include those assays described in Chrzanowska-Lightowlers et al., Anal. Biochem., 214:45-49, 1993; Miro et al., J. Neurosci. Methods, 80:107-111, 1998; .MS441 MitoProfile® Rapid Microplate Assay Kit for Human Complex IV Activity (Sumanasekera et al., A. J. Physiol. Cell Physiol, 293:C566-573, 2007); CYTOCOXl Cytochrome c Oxidase kit (Singma- Aldrich), the disclosure of which are incorporated herein by reference in their entireties.

[00305] In yet another embodiment, the identifying step comprises measuring the level (quantity) of cytochrome c oxidase in a biological sample of the subject by standard enzymatic assays known in the art, wherein a reduced level of cytochrome c oxidase in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. An exemplary method of determining the level of cytochrome c oxidase in a sample uses MS442 MitoProfile® Rapid Microplate Assay Kit for Human Complex IV Quantity (Mitociences, see product sheet.)

[00306] In yet another embodiment, the identifying step comprises measuring both the level (quantity)of cytochrome c oxidase and the level of cytochome oxidase activity in a biological sample of the subject by standard enzymatic assays known in the art, wherein a reduced level of cytochrome c oxidase and cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction (or cytochrome c oxidase deficiency) in the subject. An exemplary method of determining the level of cytochrome c oxidase and the level of its actitvity uses MS442 MitoProfile® Rapid Microplate Assay Kit for Human Complex IV Activity and Quantity (Mitociences; Murray et al., Biotechnol., Appl. Biochem., 48:167-178, 2007, the disclosure of which is incorporated herein by reference in its entirety.).

[00307] In some variations of the invention, multiple screening procedures are employed. For example, nucleic acid is screened to identify a mutation; and then a cellular or biochemical assay is performed to determine if the mutation correlates with a statistically significant change in the levels of ATP, ADP, pyruvate, or any of the other species involved in mitochondrial respiration.

Animal Models

[00308] Animal models (including drosophila and mice) can be used to demonstrate therapeutic efficacy for AOX therapy of the invention in the treatment of various disorders of the mitochondrial respiratory chain. Exemplary drosophila models include oxen (Frolov et al., Genetics, 156:1727-1736, 2000), Surβ-KD (Zordan et al., Genetics, 172:229:241, 2006), park (Green et al., Hum. MoI. Genet. 14: 799-811, 2005; Park et al., Nature 441 : 1157-1161, 2006), dj-lβ (Muelener et al., Proc Natl Acad Sci USA. 103: 12517-12522, 2006), cyclope (Szublewski et al., Genetics 158:1 629-1643, 2001), Httexlp Q93 (Marse et al., Bioessays 26: 485-496, 2004), and dfh (Anderson et al., Drosophila. Hum. MoI. Genet. 14: 3397-3405, 2005), which demonstrate one of the following disorders: complex III deficiency, Cytochrome c oxidase-deficient Leigh syndrome, Parkinson's disease, Infantile cytochrome c oxidase deficiency, Huntington's Disease and Friedreich ataxia.

[00309] Exemplary mouse models include Cox6a2 (Radford et al., Am. J. Physiol. Heart Circ. Physiol, 282: H726-H733, 2002), CoxlO (Diaz et al., Hum. MoI. Genet. 14: 2737- 2748, 2005), Mecp2 (Kriaucionis et al., MoI. Cell. Biol. 26: 5033-5042, 2006), Harlequin (Vahsen et al., EMBO J. 23: 4679-4689, 2004; Simon et al., J. Neurosci. 24: 1987-1995, 2004) and others (Maddedu et al., Vascul Pharmacol. 2006 Aug 22; [Epub ahead of print]; Traystman et al., ILAR J. 44: 85-95, 2003; Szentirmai et al., Neurosurgery 55: 283-286, 2004) that demonstrate one of the following disorders: diastolic heart failure, anemia, deafness, cardiomyopathy, Leigh syndrome, Rett syndrome, Complex I deficiency with neuronal and retinal degeneration, coronary artery disease and stroke. [00310] In one aspect, an AOX cDNA is administered (either systemically or locally to an organ through a catheter or other suitable medical device) via gene therapy to an animal model for a human disorder of the mitochondrial respiratory chain. Contemplated therapeutic effects include decreased metabolic acidosis, reduced or eliminated oxidative stress, a reduced susceptibility to apoptosis or a reduced rate of apoptosis.

Methods of Making Transgenic Animals

[00311] A transgenic animal can be prepared in a number of ways. A transgenic organism is one that has an extra or exogenous fragment of DNA incorporated into its genome, sometimes replacing an endogenous piece of DNA. At least for the purposes of this invention, any animal whose genome does not naturally include AOX and which has been modified to introduce an AOX gene (or AOX variant with AOX activity), as well as its transformed/transfected progeny, are considered transgenic animals. In order to achieve stable inheritance of the extra or exogenous DNA, the integration event must occur in a cell type that can give rise to functional germ cells. The two animal cell types that are used for generating transgenic animals are fertilized egg cells and embryonic stem cells. Embryonic stem (ES) cells can be returned from in vitro culture to a "host" embryo where they become incorporated into the developing animal and can give rise to transgenic cells in all tissues, including germ cells. The ES cells are transfected in culture and then the mutation is transmitted into the germ line by injecting the cells into an embryo. The animals carrying mutated germ cells are then bred to produce transgenic offspring. The use of ES cells to make genetic changes in the mouse germ line is well recognized. For a reviews of this technology, those of skill in the art are referred to Bronson & Smithies, J. Biol. Chem., 269(44), 27155-27158, 1994; Torres, Curr. Top. Dev. Biol., 36, 99-114; 1998 and the references contained therein.

[00312] Generally, blastocysts are isolated from pregnant mice at a given stage in development, for example, the blastocyst from mice may be isolated at day 4 of development (where day 1 is defined as the day of plug), into an appropriate buffer that will sustain the ES cells in an undifferentiated, pluripotent state. ES cell lines may be isolated by a number of methods well known to those of skill in the art. For example, the blastocysts may be allowed to attach to the culture dish and approximately 7 days later, the outgrowing inner cell mass picked, trypsinized and transferred to another culture dish in the same culture media. ES cell colonies appear 2-3 weeks later with between 5-7 individual colonies arising from each explanted inner cell mass. The ES cell lines can then be expanded for further analysis. Alternatively, ES cell lines can be isolated using the immunosurgery technique (described in Martin, Proc. Natl. Acad. Sci. USA 78:7634- 7638, 1981) where the trophectoderm cells are destroyed using anti-mouse antibodies prior to explanting the inner cell mass.

[00313] In generating transgenic animals, the ES cell lines that have been manipulated by homologous recombination are reintroduced into the embryonic environment by blastocyst injection (as described in Williams et al, Cell 52:121-131, 1988). Briefly, blastocysts are isolated from a pregnant mouse and expanded. The expanded blastocysts are maintained in oil-drop cultures at 4°C for 10 minutes prior to culture. The ES cells are prepared by picking individual colonies, which are then incubated in phosphate-buffered saline, 0.5 mM EGTA for 5 minutes; a single cell suspension is prepared by incubation in a trypsin-EDTA solution containing 1% (v/v) chick serum for a further 5 minutes at 4°C. Five to twenty ES cells (in Dulbecco's modified Eagle's Medium with 10% (v/v) fetal calf serum and 3,000 units/ml DNAase 1 buffered in 20 mM HEPES [pH 8]) are injected into each blastocyst. The blastocysts are then transferred into pseudo-pregnant recipients and allowed to develop normally. The transgenic mice are identified by coat markers (Hogan et al., Manipulating the Mouse Embryo, Cold Spring Harbor, N. Y. (1986) ). Additional methods of isolating and propagating ES cells may be found in, for example, U.S. Patent No. 5,166,065; U.S. Patent No. 5,449,620; U.S. Patent No. 5,453,357; U.S. Patent No. 5,670,372; U.S. Patent No. 5,753,506; U.S. Patent No. 5,985,659, each incorporated herein by reference.

[00314] An alternative method involving zygote injection method for making transgenic animals is described in, for example, U.S. Patent No. 4,736,866, incorporated herein by reference. Additional methods for producing transgenic animals are generally described by Wagner and Hoppe (U.S. Patent No. 4,873,191; which is incorporated herein by reference), Brinster et al. Proc. Nat'l Acad. Sci. USA, 82(13) 4438-4442, 1985; which is incorporated herein by reference in its entirety) and in Manipulating the Mouse Embryo; A Laboratory Manual, 2nd edition (eds., Hogan, Beddington, Costantimi and Long, Cold Spring Harbor Laboratory Press, 1994; which is incorporated herein by reference in its entirety). [00315] Briefly, this method involves injecting DNA into a fertilized egg, or zygote, and then allowing the egg to develop in a pseudo-pregnant mother. The zygote can be obtained using male and female animals of the same strain or from male and female animals of different strains. The transgenic animal that is born, the founder, is bred to produce more animals with the same DNA insertion. In this method of making transgenic animals, the new DNA typically randomly integrates into the genome by a non-homologous recombination event. One to many thousands of copies of the DNA may integrate at a site in the genome

[00316] Generally, the DNA is injected into one of the pronuclei, usually the larger male pronucleus. The zygotes are then either transferred the same day, or cultured overnight to form 2-cell embryos and then transferred into the oviducts of pseudo-pregnant females. The animals born are screened for the presence of the desired integrated DNA.

[00317] DNA clones for microinjection can be prepared by any means known in the art. For example, DNA clones for microinjection can be cleaved with enzymes appropriate for removing the bacterial plasmid sequences, and the DNA fragments electrophoresed on 1% agarose gels in TBE buffer, using standard techniques. The DNA bands are visualized by staining with ethidium bromide, and the band containing the expression sequences is excised. The excised band is then placed in dialysis bags containing 0.3 M sodium acetate, pH 7.0. DNA is electroeluted into the dialysis bags, extracted with a 1 : 1 phenol: chloroform solution and precipitated by two volumes of ethanol. The DNA is redissolved in 1 ml of low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) and purified on an Elutip-D™ column. The column is first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 ml of low salt buffer. The DNA solutions are passed through the column three times to bind DNA to the column matrix. After one wash with 3 ml of low salt buffer, the DNA is eluted with 0.4 ml high salt buffer and precipitated by two volumes of ethanol. DNA concentrations are measured by absorption at 260 nm in a UV spectrophotometer. For microinjection, DNA concentrations are adjusted to 3 mg/ml in 5 mM Tris, pH 7.4 and 0.1 mM EDTA.

[00318] Additional methods for purification of DNA for microinj ection are described in Hogan et al. Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1986), in Palmiter et al. Nature 300:611 (1982); in The Qiagenologist, Application Protocols, 3rd edition, published by Qiagen, Inc., Chatsworth, CA.; and in Sambrook et al. Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).

[00319] In an exemplary microinjection procedure, female mice six weeks of age are induced to superovulate. The superovulating females are placed with males and allowed to mate. After approximately 21 hours, the mated females are sacrificed and embryos are recovered from excised oviducts and placed in an appropriate buffer, e.g., Dulbecco's phosphate buffered saline with 0.5% bovine serum albumin (BSA; Sigma). Surrounding cumulus cells are removed with hyaluronidase (1 mg/ml). Pronuclear embryos are then washed and placed in Earle's balanced salt solution containing 0.5 % BSA in a 37.5°C incubator with a humidified atmosphere at 5% CO2, 95% air until the time of injection. Embryos can be implanted at the two-cell stage.

[00320] Randomly cycling adult female mice are paired with vasectomized males. C57BL/6 or Swiss mice or other comparable strains can be used for this purpose. Recipient females are mated at the same time as donor females. At the time of embryo transfer, the recipient females are anesthetized with an intraperitoneal injection of 0.015 ml of 2.5 % avertin per gram of body weight. The oviducts are exposed by a single midline dorsal incision. An incision is then made through the body wall directly over the oviduct. The ovarian bursa is then torn with watchmakers forceps. Embryos to be transferred are placed in DPBS (Dulbecco's phosphate buffered saline) and in the tip of a transfer pipette (about 10 to 12 embryos). The pipette tip is inserted into the infundibulum and the embryos transferred. After the transfer, the incision is closed by two sutures. The pregnant animals then give birth to the founder animals which are used to establish the transgenic line.

Pharmaceutical Formulations and Routes of Administration

[00321] Polypeptides and/or polynucleotides of the invention may be administered in any suitable manner using an appropriate pharmaceutically acceptable vehicle, e.g., a pharmaceutically acceptable diluent, adjuvant, excipient or carrier. Liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media are preferred. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, water, saline solutions, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol, calcium phosphate, mineral oil, and cocoa butter. Such formulations are useful, e.g., for administration of polypeptides or polynucleotides of the invention to mammalian (including human) subjects in therapeutic regimens.

[00322] The composition to be administered according to methods of the invention preferably comprises (in addition to the polynucleotide or vector) a pharmaceutically acceptable carrier solution such as water, saline, phosphate buffered saline, glucose, or other carriers conventionally used to deliver therapeutics intravascularly. Multi gene therapy is also contemplated, in which case the composition optionally comprises both the polynucleotide of the invention/vector and another polynucleotide/vector selected to treat mitochondrial disorders or their symptoms.

[00323] The "administering" that is performed according to the present method may be performed using any medically-accepted means for introducing a therapeutic directly or indirectly into the vasculature of a mammalian subject, including but not limited to injections (e.g., intravenous, intramuscular, subcutaneous, or catheter); oral ingestion; intranasal or topical administration; and the like. In a preferred embodiment, administration of the composition comprising a polynucleotide of the invention is performed intravascularly, such as by intravenous, intra-arterial, or intracoronary arterial injection. The therapeutic composition may be delivered to the patient at multiple sites. The multiple administrations may be rendered simultaneously or may be administered over a period of several hours. In certain cases it may be beneficial to provide a continuous flow of the therapeutic composition. Additional therapy may be administered on a period basis, for example, daily, weekly or monthly. To minimize side effects in non- target tissues, preferred methods of administration are methods of local administration, such as administration by intramuscular injection.

[00324] In gene therapy embodiments employing viral delivery, the unit dose may be calculated in terms of the dose of viral particles being administered. Viral doses include a particular number of virus particles or plaque forming units (pfu). For embodiments involving adenovirus, particular unit doses include 10³, 10⁴, 10⁵, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³ or 10¹⁴ pfii. Particle doses may be somewhat higher (10 to 100 fold) due to the presence of infection-defective particles.

[00325] In embodiments employing a viral vector, preferred polynucleotides still include a suitable promoter and polyadenylation sequence as described above. Moreover, it will be readily apparent that, in these embodiments, the polynucleotide further includes vector polynucleotide sequences (e.g., adenoviral polynucleotide sequences) operably connected to the sequence encoding a polypeptide of the invention.

[00326] Similarly, the invention includes kits which comprise compounds or compositions of the invention packaged in a manner which facilitates their use to practice methods of the invention. In a simplest embodiment, such a kit includes a compound or composition described herein as useful for practice of the invention (e.g., polynucleotides or polypeptides of the invention), packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes use of the compound or composition to practice the method of the invention. Preferably, the compound or composition is packaged in a unit dosage form. In another embodiment, a kit of the invention includes a composition of both a polynucleotide or polypeptide packaged together with a physical device useful for implementing methods of the invention, such as a stent, a catheter, an extravascular collar, a polymer film, a bandage, a suture or the like. In another embodiment, a kit of the invention includes compositions of both a polynucleotide or polypeptide of the invention packaged together with a hydrogel polymer, or microparticle polymers, or other carriers described herein as useful for delivery of the polynucleotides or polypeptides to the patient,

[00327] The invention will be further described with reference to the following non- limiting examples.

Example 1 — Construction of AOX expressing vector

[00328] AOX cDNA (SEQ ID NO: 1) obtained from the ascidian Ciona intestinalis was ligated directly into the doxycyclin-inducible mammalian vector pCDNA5/FRT/TO vector, either with or without an epitope tag.

[00329] For the construction of epitope-tag expression vectors, annealed oligonucleotide pairs GJ247 (SEQ ID NO:7): 5'GGCCGC GGAACAAAAACTCATCTCAGAAGAGGATCTGTGATGAS' plus GJ248 (SEQ ID NO:8): 5TCGATCATCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGCS' (myc) and GJ249 (SEQ ID NO:9):

5'GGCCGCGGATTACAAGGATGACGACGATAAGTGAS' (SEQ ID NO:9) plus GJ250 (SEQ ID NO: 10): 5'TCGATCACTTATCGTCGTCATCCTTGTAATCCGCS' (flag) were ligated into pCDNA5/FRT/TO (Invitrogen) digested with Notl and Xho\. pBluescript II clones carrying overlapping stretches of the C. intestinalis AOX cDNA (ciegO32gl4 and ciclO22cO3, http://ghost.zool.kyoto-u.ac.jp/indexrl.html) were used to assemble the full- length cDNA by PCR, using primer pairs: GJ241 (SEQ ID NO: 11): 5'GGGAAGCTTCCACCATGTTGTCTACCGGAAGTAAAACS' plus GJ242 (SEQ ID NO: 12): 5'GGGGTACCGAGAGTATAACCAGAAAAAACS' on ciegO32gl4, and GJ243 (SEQ ID NO: 13): 5' GGTACCTACACTGGACGGCTAGATGAG3' plus GJ244 (SEQ ID NO: 14): 5'GGGGCGGCCGCTTGTCCAGGTGGATAAGGATTCS' or GJ 245 (SEQ ID NO: 15): 5'GGGGCGGCCGCTATTGTCCAGGTGGATAAGGATTCS' on ciclO22cO3.

[00330] After sequence verification the subcloned N- and C-terminal fragments were ligated into pCDNA5/FRT/TO, or the modified, epitope tag-containing vectors, as Hindlϊl-Kpnl and Kpnl-Notl fragments, respectively.

Example 2 — Trasfection of a Human Cell Culture

[00331] Flp-In™ T-REx™-293 cells (Invitrogen), which are commercially available human embryonic kidney derived cells, were cultured in standard DMEM medium supplemented with 200 μM uridine and 2 mM pyruvate and 5% TET free foetal bovine serum (Ozyme) (Spelbrink et al., 2000) plus appropriate antibiotics for transgene selection, and transfected with the pcDNA5/FRT/TO-AOX expression constructs of Example 1 or with the empty vector using LipofectamineTM (Invitrogen) according to the manufacturer's instructions.

[00332] Cells surviving treatment with antibiotics (150 μg/ml hygromycin and 15 μg/ml blasticidin), containing a single copy of the AOX transgene (or empty vector) inserted in a precise chromosomal location (see www.invitrogen.com for full explanation of the FIp- InTM T-REx expression system), were induced to express AOX by adding 1 μg/ml doxycyclin to the medium. [00333] After 24 h of induction, AOX expression was confirmed by SDS-PAGE and immunob lotting (Figure IB). Both of the epitope-tagged versions of C. intestinalis AOX AOX-myc (SEQ ID NO:6) and AOX-fiag (SEQ ID NO:4)) were detected, migrating at the size predicted by the cDNA sequence (42 kDa) after mitochondrial import. As a prerequisite for function, the AOX protein has to be targeted to mitochondria. This was verified by immunocytochemistry (Garrido et al., 2003), in which the signal generated by flag-tagged AOX overlapped that of Mitotracker®Red, a mitochondrial) marker (Figures IC-E). A similar overlap was observed with the myc-tagged version of the protein (not shown).

Example 3 — Biochemical analyses of the pcDNA/FRT/TO-AOX trans fected human cells

[00334] Cell lysates were prepared and analyzed for AOX expression by immunoblotting after SDS polyacrylamide gel electrophoresis. Primary antibodies used were: mouse anti-Myc monoclonal 9E10 (Roche Molecular Biochemicals) and anti-flag M2 antibody (Stratagene). Peroxidase conjugated goat anti-mouse IgG (Vector Laboratories, Inc.) was used as secondary antibody (Spelbrink et al., 2000).

[00335] Cell respiration and succinate oxidation by digitonin permeabilized cells were measured after 48 h doxycyclin induction, using a Clark oxygen electrode (Hansatech, UK) fitted to a magnetically stirred 250 μl chamber maintained at 37°C in 250 μl of a medium consisting of 0.3 M mannitol, 5 mM KCI, 5 mM MgC12, 10 mM phosphate buffer (pH 7.2) and 1 mg/ml bovine serum albumin. KCN, 100 μM potassium cyanide; PG, 100 μM n-propyl gallate; Pyr, 10 mM pyruvate; Succ, 10 mM succinate. Total SOD activity (EC 1.15.1.1; Mn- and CuZn-dependent enzymes) was determined by the pyrogallol autoxidation assay, 50% decrease of the autoxidation rate by SOD being defined as 1 U (Roth and Gilbert, 1984). Results were expressed as U/mg protein.

[00336] The respiratory properties at 37 ⁰C of cells harbouring either the tagged or untagged version of AOX or the empty vector, after 48 h of induction were compared. Similar to the non-transfected parental cell-line, respiration of cells harbouring the empty vector was fully sensitive to 100 μM potassium cyanide (Figure 2A, trace a). In contrast, the respiration of cells induced to express AOX, whether tagged or untagged, consistently showed from 20 to 40% resistance to cyanide (Figure 2A, trace b). A three-fold increased concentration of potassium cyanide did not result in any further inhibition (not shown). [00337] Next the oxidation of a mitochondrial substrate, succinate, by digitonin- permeabilized cells was studied. The oxidation of succinate by control cells (in the presence of rotenone to avoid production of any inhibitory oxaloacetate) was fully sensitive to cyanide (Figure 2 A, trace c). In contrast, succinate oxidation by cells induced to express AOX was significantly resistant to cyanide, up to 60% (Figure 2A, trace d). This cyanide-resistant oxidation was fully inhibited by a subsequent addition of 100 μM propyl gallate, a specific inhibitor of the AOX in plant mitochondria (Siedow and Bickett, 1981). Importantly, propyl gallate addition in the absence of cyanide only caused a 5% inhibition of oxygen uptake (Figure 2A, trace f), indicating that AOX was largely inert under such conditions, but activated by the presence of cyanide. The residual succinate oxidation was fully inhibited by 100 μM cyanide. Surprisingly, although the AOX supposedly works at much lower temperature in C. intestinalis, a cold seawater organism, the protein expressed in human cells was readily active and stable at 37°C.

[00338] Because it could significantly decrease the ATP produced by mitochondria, it was important to verify that a constitutively active, non-phosphorylating AOX was not detrimental to cell survival. The effect of a long-term expression of the AOX on cell growth (Figure 2B) and acidification of the medium (not shown) was tested. No difference could be observed between growth of cells expressing AOX and control cells (up to four cell passages, 18 days). The lack of any change in medium acidification provoked by lactate excretion indicates that there was no detectable shift in the relative use of glycolysis versus mitochondrial respiration in AOX expressing cells (cells dependent upon glycolysis for ATP production. This is consistent with the interpretation that, under normal conditions, electron flow uses the phosphorylating cytochrome segment, whilst AOX is essentially inert.

[00339] Accordingly, it was also observed that the presence of the AOX protein did not significantly change the activity of succinate-cytochrome c reductase, measured in vitro (not shown), a decrease that would be predicted if electrons were readily conveyed directly to oxygen by a functional AOX. In addition, in plants, AOX has been shown to act as an anti-oxidant enzyme by preventing the superoxide production resulting from a highly reduced quinone pool (Maxwell et al., 1999). Therefore, a persistently active AOX should decrease superoxide production, and lead to a decreased level of the inducible superoxide dismutase activity (SOD) (Geromel et al., 2001). To investigate this, the SOD activity in both the induced and the non-induced AOX cells was compared, finding no significant difference (Figure 2C). Taken together, these data, replicated on both the epitope-tagged (myc or flag) and untagged AOX versions, support the view that the enzyme remains inert as long as the mitochondrial quinone pool is not highly reduced, i.e. as long as the cytochrome segment of the RC remains functional.

[00340] Pyruvate is known as an allosteric effector of the plant mitochondria AOX, and is of great importance in mitochondrial diseases (Stacpoole et al., 1978). Experiments were conducted to determine if this organic acid, , also affected the expressed C. intestinalis AOX. The cyanide-sensitivity of succinate oxidation under state 4 conditions was therefore compared in permeabilized AOX-induced cells in the absence or presence of pyruvate, plus rotenone (Figure 2A, traces d, g). This latter inhibitor, specific to complex I, was added in order to block the NADH reoxidation required for sustained oxidation of the added pyruvate. In the presence of pyruvate, a significant increase in the cyanide- resistant succinate oxidation (from 60% to about 80%) was noted. This strongly suggests that the expressed C. intestinalis AOX was subjected to a similar allosteric regulation by organic acid as is the plant enzyme, despite the absence of the supposedly critical cysteine residue in the predicted amino acid sequence (McDonald and Vanlerberghe, 2004).

[00341] Finally, after overnight culture in the presence of cyanide (as above), non-AOX expressing cells showed acidification of the medium by approximately 1.0 pH unit, whereas AOX-expressing cells gave medium acidification of only 0.2-0-3 pH units. This indicate that, under conditions where the cytochrome segment of the mitochondrial respiratory chain is blocked, AOX expression relieves the metabolic acidosis resulting from enhanced pyruvate reduction to lactic acid, which is the cell's only available means of reoxidizing NADH, when the cytochrome chain is not functional.

Example 4 — Expressing AOX in a whole metazoan

[00342] It was next tested whether AOX can be expressed ubiquitously in a whole metazoan, i.e. Drosophila, without adverse effects.

[00343] The AOX cDNA (SEQ ID NO: 1) from Ciona intestinalis was recloned in a customized Drosophila P-element vector (based on the Pelican series of vectors (Barolo et al. 2000)) with the transgene flanked by insulator elements to prevent readthrough transcription into or from insertion site genes, and placed under the control of a minimal promoter dependent upon transactivation by the yeast transcriptional activator GaWp (Figure 3). To verify expression in transgenic lines created in parallel, we also created a version of this construct, in which AOX was C-terminally Myc epitope-tagged (SEQ ID NO:5).

[00344] Eight transgenic founder lines for AOX, as well as several tens of such lines for AOX-myc, were established by microinjection and selection for the white⁺ (red) eye- colour marker carried by the vector, using standard methods (Figures 4 A and 4B).

[00345] The genomic insertion sites of the AOX transgenes were identified using standard inverse PCR, with results as illustrated in Figure 5 for one of the lines (AOX line F6-1). This line was viable and fertile as a homozygote and had a single AOX transgene insertion in the 2nd chromosome. Line F6-1 was used for the subsequent studies, in each case alongside one or more other AOX transgenic lines, to verify that the phenotypes observed were attributable to AOX and not to an insertional or other mutagenic effect in a single transgenic line.

[00346] Transgenic founders were bred to Gal4-driver flies carrying GAL4 under the control of the ubiquitously acting promoter of the daughterless gene. AOX- or AOX myc- expressing flies developed, enclosed in the predicted numbers and appeared healthy. Figure 6A illustrates the cross, which was set up using the daughterless-GAL4 driver to express AOX ubiquitously. Figure 6B illustrates how the expressing flies were identified phenotypically, and that they are viable and phenotypically normal. Figure 7 illustrates how expression of the AOX transgene at the RNA level was verified, i.e. using in situ hybridization. Figure 8 illustrates the confirmation of expression of AOX-myc, using Western blotting to an anti-myc antibody, in whole flies where AOX-myc expression is induced by the da-GAL4 driver.

[00347] AOX-expressing flies of both sexes appeared morphologically normal and were fertile, producing normal numbers of progeny when mated to non-transgenic flies. AOX- expressors showed a very slight developmental delay compared with control flies (Table 1).

Table 1 : Development time [00348] AOX-expressing (AOX+) males eclosed half a day later at 25 °C than non- expressing (AOX-) control males; there was a less pronounced differences in eclosion time of females, although the difference is still significant (/?>0.001 by Student's t test), due to the high number of replicate measurements.

[00349] In preliminary measurements of lifespan, AOX transgenic flies appeared to be as long-lived as the most long-lived wild-type strains (maximum lifespan -105 days). In actual crosses, AOX-expressor and AOX transgenic 'non-expressor' males both lived significantly longer than control, wild-type males. However, the 'non-expressor' males were consistently more long-lived than expressor males, suggesting that a low level of AOX expression might be beneficial for promoting long and healthy lifespan. Different AOX transgenic lines showed male lifespan extension to different extents. Transgene insertion sites may therefore be influencing the outcome. AOX-transgenic virgin females also showed a minimal lifespan extension in this assay.

[00350] Figure 9 shows that AOX-expressor flies underwent a more rapid and more pronounced weight loss than control flies during the first weeks of adult life: this is a further indication that the efficiency of mitochondrial energy generation is slightly decreased, for a given food intake. If this observation is shown to apply also in mammals, it indicates a utility of AOX in the treatment of otherwise intractable obesity. Unlike conventional and discredited treatments with uncoupling agents, which have highly deleterious side-effects, AOX represents a completely natural and self-regulating by-pass of the OXPHOS system. Moreover, since restricted food intake is known to prolong lifespan in flies (Bross et al., 2005, Piper et al., 2005), as in many other experimental organisms (Weindruch et al., 2006), a subtle modulation of the efficiency of mitochondrial catabolism may underlie beneficial effects of AOX expression on ageing and lifespan. [00351] Overall, these studies provide a proof of principle that AOX can be expressed in a whole metazoan without compromising development, and with subtly beneficial, rather than detrimental, physiological effects.

Example 5 — AOX activity in mitochondria from AOX-expressing flies.

[00352] In this experiment it was confirmed that dona intestinalis AOX expressed in Drosophila is enzymatically active, and exhibits similar properties as in human cells. Figure 10 shows that the AOX-expressing flies showed a pronounced resistance to potassium cyanide, remaining viable for up to several hours on medium containing the toxin at concentrations which kill wild-type flies within minutes. Figures 11 and 12 show a set of representative oxygen electrode traces, using mitochondrial suspensions from whole flies.

[00353] Mitochondrial preparations from AOX-expressing and non-expressing flies were compared for sensitivity to respiratory chain inhibitors in the presence of various substrates. The oxidation of pyruvate + malate by mitochondria from AOX non- expressing flies was sensitive to potassium cyanide, whereas that from AOX-expressing flies was mainly (>70%) resistant to cyanide (Figure 12). The residual, cyanide- insensitive respiratory activity was sensitive to inhibitors of AOX such as n-propyl gallate or salicylhydroxamic acid (SHAM, Schonbaum et al., 1971), whereas these inhibitors had only a small effect when cyanide was absent. As with human cells, the presence of pyruvate did slightly modify the bioenergetics of mitochondria from AOX-expressing cells, decreasing the respiratory control ratio (RCR, a measure of the dependence of respiration on ATP production) by approximately 20%, thus indicating that AOX does contribute in a small measure to respiratory electron flow under phosphorylating conditions, when organic acids such as pyruvate are the main substrate. RCR shows a progressive decline during ageing (Ferguson et al., 2005) but, at all ages tested, the AOX- expressing flies exhibited a lower RCR than control or non-expressor flies of the same age. In AOX-expressing flies the enzyme was still active at 1 and 2 months of age, based on cyanide-resistance of respiration of mitochondrial suspensions.

Example 6 — AOX protects flies from respiratory chain poisoning

[00354] AOX-expressing flies showed a pronounced resistance to the toxic effects of potassium cyanide, remaining viable for several hours on medium containing the toxin at concentrations which kill wild-type flies within minutes (Figure 13). Even at 1 rnM KCN, AOX-expressing flies, which were completely paralysed within 30 min, survived the treatment and were active again after 16 hours. AOX-expressing flies were also resistant to the complex III inhibitor antimycin, which was toxic to wild-type flies when added to fly food (Figure 14). At a dose of 10 μg/ml, wild-type embryos hatched to form larvae, but never reached pupal stage, whereas AOX-expressing larvae developed normally to adult flies. At 30 μg/ml, antimycin completely blocked the development of wild-type flies even to larval stage, but AOX-expressing flies were able to complete development and form viable fertile adults, even though the completion of development was delayed by several days. AOX expression also afforded a protection against moderate doses of oligomycin, an inhibitor of complex V (ATP synthase).

[00355] These findings confirm the potential utility of AOX as a gene therapy tool to correct bioenergetic defects arising from mutations affecting the mitochondrial OXPHOS system, whether inherited or generated somatically during ageing. AOX permits electron flow to resume under conditions where the mitochondrial respiratory chain is partially blocked within the cytochrome segment or ATP synthase. However, AOX-supported electron flow is non proton-pumping, hence does not contribute directly to ATP generation. On the other hand, if the cytochrome chain is blocked at complex III or IV, AOX can allow electron and proton flow through complex I to resume, which should at least partially restore ATP generation. The prediction from our findings is that AOX should have utility under conditions of partial respiratory chain blockage at or beyond complex III, e.g. resulting from mis-sense mutations in structural subunits, or loss of assembly factors and chaperones (e.g. Surfl), which leave some residual activity in the cytochrome chain, and hence do not diminish ATP production below a critical threshold. Under these circumstances, the protective effects of AOX in blocking reverse electron flow and supporting the reoxidation of NADH, thus minimizing harmful ROS production, metabolic acidosis and the generation of pro-apoptotic signals, should assist in alleviating the consequences of physiological dysfunction of the respiratory chain.

[00356] This can be tested directly and conveniently in Drosophila, by combining AOX expression with mutations that either block the cytochrome chain completely (such as cyclope) with others that have a milder effect, e.g. oxen (Frolov et al., 2000) or a knockdown of Surf 1 (Zordan et al., 2006). Example 7 — Construction of lentivirus-AOX expression constructs

[00357] The Ciona intestinalis AOX cDNA cloned into the vector pcDNA5/FRT/TO (Invitrogen) as described in Example 1 above was recloned in two steps as a Smal fragment via blunt-end cloning in the Pmel site of lentivector pWPI (Addgene, Cambridge, MA, USA; Kvell et al, 2005) to create a construct pWPI-AOX (Figure 15). pWPI not only affords an opportunity to establish stable, single-copy insertion and sustained expression of the transgene. It also allows easy and non-invasive detection of successfully transduced cells (Kvell et al., 2005) by virtue of the fact that the transgene is inserted upstream of the coding sequence of an inert reporter (GFP) in cis in the same mRNA, preceded by an internal ribosome entry site (IRES).

[00358] The sequence of the insert and surrounding vector was verified on both strands, and corresponded with the sequence previously reported for C. intestinalis AOX (Dehal et al., 2002; McDonald and Vanlerberghe, 2004; Hakkaart et al., 2006) and pWPI (www.addgene.org), except for one substitution within the cPPT region of the vector, which enhances nuclear localization of the transgene construct: AAAATTTTATCGATCACGAGAC (SEQ ID NO: 16) instead of AAAATTTTCCGATCACGAGAC (SEQ ID NO: 17), found also in the isolate of vector DNA as supplied.

Example 8 — Viral packaging, cell culture and transduction of a human cell culture

[00359] Virus production used standard procedures (Bovia et al., 2003; Zufferey et al., 1997), and the second-generation packaging system, which incorporates inbuilt safety features (www.lentiweb.com/protocols_lentivectors.php), as described previously (Pellinen et al., 2004). Flp-In™ T-REx™-293 cells (Invitrogen) were cultured in standard DMEM medium supplemented with 200 μM uridine, 2 mM pyruvate and 5% TET-free foetal bovine serum (Ozyme). Transductions used standard methods (Salmon et al., 2000; see lentiweb.com/protocols LVtitration.php). AOX expression was induced in transfected Flp-In™ T-REx™-293 cells (Hakkaart et al., 2006) by treating cells with 1 μg/ml doxycyclin.

[00360] Viral packaging of pWPI-AOX in vitro resulted in virus titres of up to 5.3 x 107 TU/ml. Transductions into Flp-In™ T-REx™-293 cells were performed at low multiplicity of infection (MOI 1). Use of this cell-line allowed a direct comparison with the previous inducible expression system. After 24 hours approximately 25% of cells were positive for GFP, which was still the case after growing cells for 3 weeks without any kind of selection (Figure 16).

Example 9 — Analysis of human cells transfected by lentivirus-AOX vector construct by fluorescence activated cell-sorting (FACS) and microscopy

[00361] GFP expressing Flp-In™ T-REx™-293 cells from Example 8 were sorted by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA, USA) according to manufacturer's instructions. Cells were analysed for GFP expression using an Olympus BX61 Live Imaging station, using simultaneous illumination with a Krypton lamp (excitation filter 492/18 nm) and white light (halogen lamp). Excitation fluorescence and transmitted light were detected simultaneously by a 4Ox LUMPlanFl water-immersion objective (numerical aperture 0.8), fitted with Hamamatsu Orca ER (high resolution Digital B/W CCD) camera, in order to distinguish GFP-expressing (bright) and non- expressing cells (less bright).

[00362] In order to assess the phenotype of the transduced cells in more detail, fluorescence-activated cell sorting (FACS), based on the GFP reporter, was employed to select for the transduced cell population. GFP-expressing cells were 80-90% of the enriched cell population (Fig. 2). The presence of the AOX-GFP mRNA was confirmed by Northern hybridization against an AOX-specific probe (Figure 17). Compared with Flp-In™ T-REx™-293 cells induced to express AOX from the original expression construct pcDNA5-AOX, the transcript was longer (4.1 kb as opposed to 1.8 kb, reflecting the additional presence of the IRES, GFP and additional 3' untranslated sequences), and present at much lower abundance, approximately two orders of magnitude, reflecting expression from a physiologically more relevant promoter (EF lα, as opposed to CMV immediate early) plus the fact that lentiviral transduction results in single genomic insertions rather than integrated tandem arrays of plasmid-derived sequences. Multiple batches of transduced cells sorted on the basis of GFP expression gave similar expression at the mRNA level. Flp-In™ T-REx™-293 cells transfected with the empty vector gave no signal.

Example 10 — Oxygen consumption in human cells transfected with lentivirus-AOX vector construct [00363] Respiration in digitonin-permeabilized cells was measured as previously (Hakkaart et al., 2006), using a Clark oxygen electrode (Hansatech, UK), and as inhibitors potassium cyanide (KCN) to 100 μM and /? -propyl gallate (PG) to 10 μM.

[00364] Mitochondrial biochemistry of the sorted, transduced cells was then analysed in comparison with the Flp-In™ T-REx™-293 cells induced to express AOX from the original expression construct pcDNA5-AOX, plus empty vector-trans fected cells as a negative control (Figure 18). Respiration of the empty vector-transfected cells was completely inhibited by 100 μM potassium cyanide, whereas induced AOX expression from the pcDNA5-AOX-transfected cells rendered respiration -70% insensitive to cyanide, similar to the previous study (Hakkaart et al., 2006). In the presence of cyanide, respiration was, however, almost completely inhibited by 10 μM n-propyl gallate. The cells transduced by pWPI-AOX behaved similarly. A slightly lower proportion (-60%) of respiratory activity was insensitive to cyanide, reflecting the proportion of cells expressing GFP after sorting. However, this residual respiration was, as expected, completely inhibited by further addition of 10 μM n-propyl gallate.

Example 11 — Construction of a transgenic mouse strain expressing C. intestinalis AOX

[00365] The AOX coding sequence is introduced into the mouse germ-line via a knock- in strategy, replacing the coding sequence of a gene whose product is targeted to mitochondria and which participates in the OXPHOS system, but which can be heterozygously deleted with only a mild phenotypic effect. This ensures that the AOX transgene will be expressed in a 'typical mitochondrial pattern', and overcomes many of the problems associated with random transgenic insertions. The mouse Tfam (mitochondrial transcription factor A) gene is a suitable such replacement target. (Larsson et al., Nature Genetics 18:231 :1998), since Tfam heterozygous mice show only reduced mitochondrial DNA copy number and a mild biochemical defect in heart, but no overt pathological signs). A typical gene targeting vector is used, such as the pDELBOY series or variants thereof. Because it is desired to study AOX expression in specific tissues and developmental stages, as well as to test rigorously if it can be tolerated in the whole organism, a STOP cassette (Lakso et al., PNAS 89:6232;1992), flanked by loxP recombination sites (and including the selectable marker) is introduced. This prevents expression of AOX, except when the AOX transgene-containing strain is mated to a strain expressing Cre recombinase in the desired tissue-specific pattern. Mating to a strain which ubiquitously expresses Cre recombinase activates the AOX transgene in all tissues, and thus is the formal test that AOX expression in all tissues is supported in the whole organism. Mating to a strain which expresses Cre recombinase only in a restricted tissue, e.g. in the substantia nigra, is a way to test not only whether AOX expression produces any deleterious effects in that tissue, but also whether AOX expression restricted to that tissue compensates for a pathological phenotype that manifests there, in a given disease model.

Example 12 — Materials and Methods for Examples 13-17

[00366] Drosophila stocks and maintenance: Wild type, ^wU18 mutant, and standard balancer and GAL4 driver (da-GAL4, Act5C-GAL4, elav-GAL4 6800) lines were obtained from stock centres. The tubulin-GeneS witch (tub-GS) driver was received as a gift. RNAi stock 13403 for cyclope was obtained from the Vienna Drosophila RNAi Centre. The derivation of the dj-1,6 null mutant dj-l/6^GE2mi (Park et al, Gene, 361 :133- 139, 2005) and Surfl-KD line 79.1 (Zordan et al., Genetics, 172:229-241, 2006) were described previously. Flies were maintained in standard oatmeal and molasses medium containing 1.5% (w/v) sucrose (Merck), 3% glucose (Sigma), 3.5% Instant Dry Baker's Yeast (European), 1.5% Maize flour (Oriola), 1% Wheat germ (Oriola), 1% Soya flour (Oriola), 1% agar (Oriola) and 3% Lyle's black treacle (T ate & LyIe, UK), to which was added 0.1% Nipagin M (Sigma) and 0.5% (v/v) propionic acid (JT Baker). For testing of resistance to antimycin, the drug (Sigma) was added to fly food at different concentrations. For testing of resistance to cyanide, 1-day old adult flies were placed inside plugged vials of 1% agarose containing 10 mM KCN, 50 mM Tris-HCl, pH 7.5, inside a fume hood at room temperature. After flies stopped moving they were transferred to empty vials to check for recovery overnight. For induction of expression using the tub-GS driver, flies hemizygous for both the driver and the GAL4-dependent transgene(s) of interest were cultured in the presence of appropriate doses of RU486 (Mifepristone, Sigma), as indicated in figure legends.

[00367] Construction of AOX transgenic Drosophila lines: The C. intestinalis AOX cDNA, originally cloned in mammalian expression vector pCDNA5/FRT/TO (Hakkaart et al., EMBO Rep, 7:341-345, 2006), was excised as an 1162 bp Pmel-Xbal fragment and recloned into Pmel plus Spel-digested pGREEN-H-Pelican DNA (Drosophila Genomics Resource Center, Bloomington, IN, USA; Barolo et al., Biotech., 29:726-732, 2000) in place of the eGFP coding sequence, creating pAOX-H-Pelican. A 419 bp fragment containing the 5xUAS (GAL4-binding) element plus Hsp70 minimal promoter was excised from pUAST (Brand et al, Development, 118:401-415, 1993) using BamHI and Xhol, and recloned into the intact multi-cloning site of pAOX-H-Pelican digested with BgHl plus Xhol, to create the final construct pUAS-AOX-H-Pelican (Fig. Ia, Supplementary Fig. Ia). All restriction digestions were carried out under manufacturer's recommended conditions (NEB, Fermentas). The myc-tagged AOX cDNA was similarly recloned from the original mammalian expression vector. Both constructs were sequenced to verify the construction and the absence of mutations. Following microinjection into ^wI118 recipient embryos (VANEDIS Drosophila Injection Service, Oslo, Norway), transgenic progeny were selected in the following generation based on eye pigmentation generated by the ^w+ marker, and established as independent lines in the J¹¹⁸ background. Insertion sites were determined by inverse PCR (Toivonen et al., Mitochondrion, 3:83-96, 2003)). Lines F6 (intergenic insertion on chromosome 2R, nt 9108854 of NCBI database entry NT 033778, between CG4646 and CG4630), F17 (insertion on chromosome 2R, nt 13364646 of NCBI database entry NT_033778, in the first (non-coding) exon of CG4827) and F24 (intergenic insertion on chromosome 3L, nt 11089598 of NCBI database entry NT 037436, between CG62729 and non-coding RNA pncrOl 1 :3L) were retained for further study, maintained as hemizygotes using the eye-colour marker and appropriate balancers, and used to generate homozygotes where needed for specific experiments.

[00368] Isolation of mitochondria: Mitochondria were prepared essentially as described by Miwa et al. (Free Radic. Biol. Med., 35:938-948, 2003) with modifications. Briefly, 150-200 flies were immobilized by chilling on ice and decanted into a chilled mortar. 0.5 ml of ice-cold isolation medium (250 mM sucrose, 5 mM Tris-HCl, 2 mM EGTA, 0.1% BSA (Sigma), pH 7.4) was added and the flies were crushed gently with a pestle. Homogenates were filtered and immediately centrifuged at 200 _gmax for 3 min at 4 ⁰C. Supernatants were re-centrifuged at 9,000 _gmax for 10 min at 4 ⁰C, and the mitochondrial pellets carefully re-suspended in 50 gl of isolation medium without BSA. Protein concentrations were determined using the Bradford assay (Bradford et al., Anal. Biochem., 72:248-254, 1976).

[00369] Polarography: Mitochondrial substrate oxidation rates were measured by polarography using a Clark-type oxygen electrode (Hansatech Instruments, Norfolk, UK) in a final volume of 0.5 ml at 25 ⁰C. Mitochondria (between 0.25-0.5 mg/ml) were incubated in incubation buffer (120 mM KCl, 5 mM KH2PO4, 3 mM Hepes, 1 mM EGTA, 1 mM MgCl₂, 0.2% BSA, pH 7.2) supplemented with either 20 mM sn-glycerol 3- phosphate (plus 5 mM rotenone, Sigma) or a mixture of 5 mM sodium pyruvate and 5 mM proline as substrate, followed by the addition of 1 mM ADP, with subsequent addition of 100 mM KCN or 10 mM SHAM (salicylhydroxamic acid, Sigma) to test the effect of AOX on substrate oxidation.

[00370] Enzymatic analysis: The activities of OXPHOS complexes I+III and II+III were measured as described previously (Fernandez -Ayala et al., Biochim. Biophys. Acta, 1706:174-183, 2005). Citrate synthase activity was determined by the reduction of dithio- bis-nitrobenzoic acid (DTNB) followed at 412 nm (extinction coefficient = 21000 M^"1. cm^{" l}) in a reaction containing 100 mM Tris-HCl, 2.5 mM EDTA, 37 μM acetyl-CoA, 75 μM DTNB and 300 μM oxaloacetate, pH 8.0. Cytochrome oxidase (COX) activity was measured in 40 mM Sodium phosphate buffer, pH 7.5, by following the disappearance of thiosulfite-reduced cytochrome c (initially 25 μM) at 550 nm (extinction coefficient = 27800 M^-1On^'1). Specific activity was determined by subtracting the rate in the presence of 2 mM KCN (almost zero) from the rate without the inhibitor.

[00371] Measurement of mitochondrial ROS production: Mitochondrial free radical production was determined by measuring the generation of hydrogen peroxide in solution in the presence of superoxide dismutase (SOD) as described previously (Sanz et al., in: Conn M., ed., Handbook of models for the study of human aging, Vol. 16 (New York, Academic Press), pp. 183-189, 2006), and as adapted to flies (Miwa et al., Free Radic. Biol. Med., 35:938-948, 2003). Mitochondria (about 0.1 mg/ml) were incubated for 15 min at 25 ⁰C in 1.5 ml incubation buffer (120 mM KCl, 5 mM KH2PO4, 3 mM Hepes, 1 mM EGTA, 1 mM MgCl₂, 0.2% BSA, pH 7.2) containing 0.1 mM homovanillic acid, 9 U/ml horseradish peroxidase, and 50 U/ml SOD (Sigma). 5mM pyruvate plus 5 mM proline was added to initiate the reaction. Reactions were stopped by adding 0.5 ml of stop solution (2.0 M glycine, 2.2. M NaOH, 50 mM EDTA), then placed at 4 ⁰C prior to fluorimetry (excitation at 312 nm, emission at 420 nm) using a PerkinElmer LS55 fluorimeter. Known amounts OfH₂O₂ generated in parallel by glucose oxidase with glucose as substrate were used as standards. All experiments were repeated in the absence of substrate and background fluorescence changes were subtracted. [00372] RNA extraction and quantitation: For expression analysis, homozygous AOX transgenic line F6 females were crossed either to males homozygous for the da-GAL4 or tub-GS driver, or to males heterozygous for the Act5C-GAL4 driver balanced against CyO. Total RNA was extracted from 100 mg of adult flies or L3 larvae anaesthetised on ice, and frozen at -80 ⁰C. Frozen flies were homogenised in 800 μl Trizol (Invitrogen), then incubated at room temperature for 5 min. After addition of 200 μl chloroform, thorough mixing and a further 3 min incubation, extractions were centrifuged for 15 min at 12,000 _gmax at 4°C. The (upper) aqueous phase was collected, and RNA was precipitated by addition of 500 μl of isopropanol and recovered after incubation at room temperature for 10 min by centrifugation for 10 min at 12,000 gmax at 4°C. The crude RNA pellet was washed with 1 ml of 75% ethanol, air-dried and dissolved in 180 μl of DEPC-treated water. DNase I treatment was performed at 37 ⁰C for 1 h in 200 μl reactions containing 20 mM Tris-HCl, 60 mM MgC12, pH 7.5, using 10 U DNaseI (Amersham Biosciences). RNA was recovered by phenol/chloroform extraction and ethanol precipitation, and resuspended in 50 μl of DEPC-treated water.

[00373] For cDNA synthesis, 11 μl reaction mixes containing 2 μg RNA, 1 μl 10 mM dNTP mix (Finnzymes) and 1 μl random hexamers (0.0125 U/μl, Amersham Biosciences) were incubated at 90 ⁰C for 3 min, then transferred to ice, after which 4 μl 5x M-MuLV reaction buffer (Fermentas), 0.5 μl 40 U/μl RNase inhibitor (Fermentas) and 2.5 μl of DEPC-treated water were added. The reactions were mixed and incubated at 25°C for 10 min. 2 μl of 20 U/μl M-MuLV reverse transcriptase (Fermentas) was added, and the reaction was incubated for 10 min at 25°C and 1 h at 37°C in a thermal cycler, after which the reverse transcriptase was inactivated at 70⁰C for 10 min.

[00374] The transcript levels of AOX, RpL32 and GAPDH were measured by Q-RT- PCR using custom-designed hybridisation probes (Tib-MolBiol, Berlin, Germany) analysed on a Roche Diagnostics LightCycler 1.5. All RNA extractions were performed in triplicate, with each used as a template for three separate cDNA synthesis reactions which were then pooled. Each cDNA pool was itself analysed in triplicate, producing a total of nine data points for flies of a given genotype, age or sex. Expression of AOX was measured relative to that oϊRpL32 (Rp49), in order to normalise for sample and run to run variations. Parallel reactions using GAPDH as a normalization standard gave indistinguishable results. A series of five-fold dilutions of an external standard was used in each run to produce a standard curve. Analytical reactions were performed using 50-fold diluted cDNA samples, in 20 μl reaction volume consisting of 2 μl of the cDNA template, 2 μl of 20 μM forward and reverse primers, 1.5 μl of 3 μM hybridisation probes (Fluorescein- and LightCycler Red 640-labelled) and 2 μl of 1OX LightCycler FastStart DNA Master HybProbe mix (Roche). MgC12 was added to a final concentration of 4 mM. The PCR programme consisted of a 10 min pre-incubation at 95 ⁰C, 45 cycles of 10 s denaturation at 95 ⁰C, 10 s annealing at 50 ⁰C and 6 s extension at 72 ⁰C. Melting curve analysis, consisting of 30 s probe annealing at 45 ⁰C and a 0.1°C/s denaturation ramp to 95 ⁰C, was performed after the amplification step to verify that only a single, specific extension product had been amplified. Fluorescence data were extracted and analysed using LightCycler data collection software version 3.5 (Roche) and manufacturer's instructions (LightCycler Software 3.5.3 Operators Manual, Roche) for baseline adjustment, noise reduction and data analysis.

[00375] Insertion site analysis by inverse PCR: DNA was extracted from 100 mg of flies (30 females or 40 males by homogenization in 500 μl of lysis buffer (100 mM Tris-HCl, 100 mM EDTA, 100 mM NaCl, 1 % SDS, pH 7.5) and incubated at 65 ⁰C for 30 min. After phenol: chloroform extraction and isopropanol precipitation, DNA was recovered by centrifugation at 12,000 _gmax for 15 min at room temperature, washed with 70% ethanol, air-dried and resuspended in 150 μl of 10 mM Tris-Cl, pH 8.0. The remaining steps of inverse PCR were essentially as described previously (Toivonen et al., Mitochondrion, 3:83-96, 2003), except that various 4-hitter restriction enzymes were used, all cutting near to the P3 ' end within the transgenic construct, and primers foot-A (5 '- GTTGTCACTGAAGCGGGA-S ', SEQ ID NO: 119) and 34S (5 - GCAGTTCATTCAGGGCACC-3', SEQ ID NO: 120) were used. Amplification conditions were: 4 min initial denaturation at 95°C, 30 cycles of 1 min annealing at 55°C, 2 min elongation at 72°C, 1 min denaturation at 95°C, followed by final annealing of 1 min at 55°C and 15 min extension at 72°C. PCR products were analyzed on a 1% agarose gel containing 0.5 μg/ml EtBr, extracted from the gel using Qiaquick Gel Extraction Kit (Qiagen), and sequenced using the foot-A and 34S primers. The sequences were compared to the Drosophila genome by BLAST searching.

[00376] Primers and probes used in AOX expression analysis:

[00377] Q-RT-PCR analysis of Surf 1 mRNA: cDNA synthesis was performed using High Capacity cDNA Reverse Transcription kit (Applied Biosystems), under manufacturer's recommended conditions. All RNA extractions were performed in triplicate, with each RNA used as a template for two separate cDNA synthesis reactions, which were then pooled. Each cDNA pool was analysed in triplicate, producing a total of nine data points for each sample. Surfl mRNA levels of were measured relative to the that RpL32 (Rp49), using the StepOnePlus™ instrument (Applied Biosystems) and the manufacturer's SYBR_® Green PCR reagents and recommended conditions, with primers Surfl F: 5 ^'-TATGATACGTTTGGGGAACC-S ^' (SEQ ID NO: 133) and Surfl R: 5 - ACCATCCCAAAGGAGCT ATC-3 ' (SEQ ID NO: 134) (Zordan et al, Genetics, 172:229-241, 2006). Fluorescence data was extracted and analyzed using StepOne Software version 2.0 (Applied Biosystems). mRNA levels were calculated by comparing cycle threshold values (comparative ΔΔC_tmethod). The cycle threshold of each sample was first normalized to that of the internal control (RpL32), and subsequently to the target/reference ratio of a chosen calibrator sample, to enable calculation of fold-changes between samples.

[00378] In situ hybridization: Whole-mount in situ hybridization was performed essentially as described by Fernandez -Moreno et al. (Methods MoI. Biol., 372:33-49, 2007), with minor modifications. Drosophila embryos were collected after over-night egg laying, washed with water and dechorionized with household bleach for 2-3 min. After washing with water followed by heptane, embryos were immersed in 5 ml heptane. 5 ml fixing solution (DEPC-treated PBS buffer plus 10% formaldehyde) was added and the mixture was shaken vigorously for 20 min. After removal of fixing solution, embryos were washed and shaken twice for 20 min with 5 ml of methanol. Finally, embryos were collected and stored in methanol at 4 ⁰C. An AOX cDNA fragment of 376 bp was amplified using primers 41S (5'-GTCAACTCAGCCACATTC-S' -SEQ ID NO: 135) and 41A (5'-AACATCAAAGCCAGTCC-S'- SEQ ID NO: 136), with pUAS -AOX-H-P elican DNA as template, under standard conditions (annealing step at 50⁰C), using Pfu Polymerase (Fermentas), with a final step to add 3 ' terminal adenines using Taq polymerase (Fermentas) at 70 ⁰C for 30 min, in 0.2 mM dATP. The fragment was cloned into pGEM-T Easy (Promega) in both orientations. These riboprobe constructs were then linearized with Ncol and transcribed in vitro by SP6 RNA Polymerase (Roche) using the Digoxigenin-Labelling Kit (Roche) under manufacturer's recommended conditions (0.6 μg of template DNA in a 20 μl reaction), to create sense and antisense strand-specific probes of 478 nt. Probe solutions were treated with 2 μl RNasefree DNAse (Roche) for 15 min at 37 ⁰C followed by addition of 2 μl 0.2 M EDTA. Embryos were re-hydrated in PBT buffer (DEPC-treated PBS buffer plus 0.1% Tween 20) through a methanol series (90%, 75%, 50% and finally in PBT), incubated in PBT plus 4% formaldehyde for 20 min, washed 5 times for 5 min with PBT and finally with PBT: HB (1 : 1), HB being 50% deionized formamide, 5 x SSC, 50 μg/ml heparin (Sigma), 100 μg/ml yeast tRNA (Sigma), 100 μg/ml sonicated salmon sperm DNA (Sigma) and 0.1% Tween 20. All these steps were performed on a roller at room temperature. Embryos were then incubated for 1 h at 55 ⁰C in HB and finally overnight at 60 ⁰C in 50 μl of HB containing 100-200 ng of the sense or antisense strand-specific riboprobes (denatured at 80 ⁰C for 10 min in the hybridization solution). After removal of probe, embryos were washed twice with HB for 20 min at 55 ⁰C, once in PBT:HB (1 : 1) at room temperature and another 5 times in PBT. Next, embryos were incubated with pre-adsorbed alkaline phosphatase-conjugated antibody (Antidigoxigenin- AP-Fab fragments, Roche, 1/2000) for 1 h at room temperature on a roller. The antibody was pre-adsorbed as follows, in order to minimize cross-reaction with proteins in the embryo: rehydrated embryos were incubated directly with the antibody (1/50) in 500 μl PBT overnight at 4 ⁰C to get an antibody stock solution (40 x) ready to use. After treatment with the antibody, the hybridized embryos were washed 5 times with PBT for 5 min, and 3 times with washing solution (100 mM Tris- HCl, 100 mM NaCl, 50 mM MgC12, 0.1% Tween 20, pH 9.5) at room temperature. Finally, to 1 ml of washing solution were added 9 μl of 100 mg/ml nitroblue tetrazolium (Roche) and 7 μl of 50 mg/ml 5-bromo-4-chloro-3-indolyl phosphate (Roche). Embryos were kept in this solution until they acquired a visible blue color and the developing reaction was stopped by several washes with PBT. Embryos were finally de-hydrated through an ethanol series (30%, 50%, 70% and 100%) at room temperature for 10 min each, stored for several hours to overnight in ethanol at 4 ⁰C, washed once with xylene for 5 min, slide-mounted using Neomount (Merck), and visualized by light microscopy.

[00379] Protein extraction and Western blotting: Whole fly protein extracts were prepared by grinding 10-20 flies in 0.5 ml PBS, containing 1.5% (v/v) Triton X-100 and Complete, Mini, EDTA-free Protease Inhibitor Cocktail (Roche) at manufacturer's recommended dilution. The suspension was cleared by centrifugation at 13,000 _gmax for 15 min at 4 ⁰C and protein concentrations of the supernatants were estimated by the Lowry- based DC Protein Assay (Bio-Rad). Aliquots of protein extracts (30 μg) were mixed with an equal volume of 2 x SDSPAGE sample buffer (50 mM Tris-HCl, 0.001% Bromophenol Blue, 4% SDS, 12% glycerol, 0.1M DTT, pH 6.8), denatured at 95 ⁰C for 5 min and resolved on 12.5% Criterion™ Precast Gels (Bio-Rad) at 120 V for 1.5 h. For Western blotting, PVDF membranes (Hybond-P, GE Healthcare) were wetted in methanol for 10 s, washed with water and equilibrated in 1 x SDS-PAGE buffer containing 15% methanol (transfer buffer) for 15 min. Gels were equilibrated in transfer buffer for 15 min, and proteins were transferred by electrob lotting (Bio-Rad system) at 100 V for 1 h. Membranes were blocked in TBS (0.15 M NaCl, 10 mM Tris-HCl, pH 7.5) containing 5% (w/v) dried non-fat milk (blocking solution) for 1.5 h at room temperature, then probed with anti-AOX antibody (polyclonal rabbit serum raised against two custom peptides, FKIETNDSTDEPNIEVENFPC (SEQ ID NO: 137) and

CVNHDLGSRKPDEQNPYPPGQ (SEQ ID NO: 138), 21st Century Biochemicals, Marlboro, MA, USA, 1 : 1000 dilution) for 1 h, washed three times in blocking solution, incubated with goat anti-rabbit HRP-conjugated secondary antibody (Bio-Rad, dilution 1 :5000) for 1 h followed by 3 washes in TBS. Finally, membranes were incubated in Luminol substrate detection system Immun-StarJM HRP(Bio-Rad), and chemiluminescence signal was detected on Fuji Medical X-ray film (Fujifilm). The AOX antibody was highly specific, producing no background on protein extracts from non- transgenic flies.

[00380] Behavioural analysis: Locomotor activity was determined separately in two ways. To assay climbing ability, using a modified version of the procedure of Cha et al. (047), flies were collected after eclosion and virgin females and males were separated into groups of 10 flies. The flies were transferred into a climbing test vial (25 x 75 mm) with a line marked at 6 cm. The flies were tapped to the bottom of the vial and the number of flies reaching above the line after 10 s was recorded. Assays were done at 25 ⁰C with illumination from above. The climbing assay was repeated six times for each group of flies. Three sets of flies of each genotype tested were used in each experiment and all experiments were performed in triplicate. The second method used a combined bang- sensitivity/climbing assay. Aliquots of 20 adult females flies aged 20-22 days were vortexed at the maximum setting for 30 s, after which the percentage of flies climbing 7 cm in 15 seconds was recorded.

Example 13 — AOX expressing flies are viable and healthy

[00381] To test whether constitutive AOX expression is compatible with life in Drosophila, transgenic lines hemizygous for GAL4-dependent AOX were crossed with lines carrying the ubiquitously expressing da-GAL4 driver, using the scheme of Figure 19B. Flies of all four phenotypic classes eclosed in approximately equal numbers, using each of three different AOX transgenic lines (F6, Fl 7 and F24). AOX expression at the RNA level was confirmed by means of in situ hybridization (Figure 19C) and quantitative RT-PCR (Figures 19D- 19E), and at the protein level by Western blots. AOX transgene expression was generally higher in males than in females (Figures 19D and 19E) and the expressed protein was highly enriched in mitochondria. The GAL4-dependent AOX expression was 300-1000 times greater than without induction, and was comparable with that of the highly expressed reference gene RpL32 or GAPDH. Similar expression levels were obtained when driven by either of two ubiquitous GAL4 drivers (da-GAL4 or Act5C-GAL4), and graded expression at larval stage L3 was obtained using the drug- inducible tub-GS driver. AOX-expressing flies exhibited a very slight developmental delay of < 0.5 days. AOX-expressing adults of both sexes were fertile and, when mated to wild-type flies, produced offspring in normal numbers which were themselves healthy. Only when we tried to obtain flies carrying multiple copies of the AOX trans gene and da- GAL4 driver did we encounter evidence that very high level of expression of AOX may be deleterious: no such progeny eclosed at 25°C, but at 18⁰C, where the activity of GAL4 is decreased, viable progeny were obtained. AOX-expressing flies of both sexes showed a slightly exaggerated weight loss as young adults compared with non-expressors suggesting a slightly less efficient mobilization of food resources. Finally, upon induction by RU486, the observed unusual 'cleft thorax' phenotype exhibited by flies carrying the tub-GS driver was corrected by the presence of the expressed, GAL4-dependent AOX gene.

[00382] Discussion: Ubiquitous expression of transgenic AOX in Drosophila throughout the life cycle, at the level of a typical abundant mRNA appears to be benign. The protein appears to be stable, correctly targeted and processed, and confers substantial and significant cyanide-resistance to mitochondrial oxidation of various substrate cocktails in vitro. As predicted, this substrate oxidation was completely abolished by AOX inhibitors, such as SHAM. However, as was the case for human cells expressing Ciona AOX, it appeared to be enzymatically inert in the absence of an OXPHOS inhibitor (Figure 21A). The implication is that, as in plants, the expressed AOX should not contribute significantly to electron flow under normal physiological conditions, when the quinone pool is mainly in the oxidized form. Were this not the case, constitutive by-pass of complexes III and IV would greatly decrease the net synthesis of ATP. Although Drosophila can tolerate a substantial drop in OXPHOS enzyme capacities, engendering a developmental delay of several days (Toivonen et al, Genetics, 159:241-254, 2001; Toivonen et al., Mitochondrion, 3:83-96, 2003), complete loss of complex IV or complex III is lethal. Consistent with this, ubiquitous AOX expression had only a small effect on developmental timing, plus a slight exaggeration of the weight loss experienced by adult flies in the weeks following eclosion. Putting these data together, it would appear that ubiquitous AOX expression results in only a small drop in the overall efficiency of catabolism, consistent with the enzyme being active only at low levels during normal physiological conditions.

[00383] Rescue by AOX of the cleft thorax phenotype caused by the tub-GS driver in the presence of RU486 was unexpected. The phenotype closely resembles that described in mutants in the gene ultraspiracle (usp), encoding a member of the nuclear hormone receptor superfamily that heterodimerizes with the ecdysone receptor (EcR), mediating ecdysteroid-induced gene expression (Henrich et al, Dev. Biol, 165:38-52, 1994). Recessive lethal _usp alleles combined with a putatively variegating _usp+ allele give a cleft thorax phenotype, suggesting a dosage insufficiency effect. Since RU486 is a steroid analogue it seems logical to account for its ability to phenocopy _usp mutants via binding to the _usp gene product or to EcR itself, impairing the interaction of the two proteins with each other or with DNA. Cleft thorax is also seen in weak mutants of pannier (Heitzler et al., Genetics, 143:1271-1286, 1996), encoding a GATA transcription factor highly expressed in the dorsal midline, pannier expression itself appears to be ecdysone- dependent, and a related gene has been shown to co-operate with the EcR/usp heterodimer in the activation of specific target genes (Brodu et al., MoI. Cell. Biol., 19:5732-5742, 1999). Why AOX should alleviate this phenotype is unclear. Other GAL4-dependent transgenes, e.g. UAS-GFP did not confer any such rescue.

Example 14— AOX expression supports cyanide-resistant substrate oxidation by Drosophila mitochondria

[00384] To test whether Ciona AOX expressed in Drosophila can contribute to electron flow and thus by-pass complexes III and IV we measured oxygen consumption of suspensions of Drosophila mitochondria in the presence of various combinations of substrates and inhibitors. In preliminary experiments, coupled mitochondria from AOX- expressing progeny of three separate AOX transgenic lines were found to support a substantial cyanide-resistant substrate oxidation (up to 50% of the levels prior to cyanide addition) when supplied with a substrate cocktail containing both pyruvate and succinate (data not shown). We backcrossed the AOX transgene from three transgenic lines, as well as the da-GAL4 driver, over >6 generations into a reference wild-type background (Dahomey w-) and analysed mitochondrial substrate oxidation using a standard pyruvate- plus-proline substrate cocktail. The respiratory control index (between 12-14 on these substrates) was unchanged by AOX expression. However, after cyanide addition, expressors typically maintained 10-20% of the uninhibited level of oxygen consumption in state 3, being usually greater in (the more highly expressing) males than females. Subsequent addition of propyl gallate (not shown) or SHAM (Figure 20A), two well characterized inhibitors of alternative oxidases, abolished the residual, cyanide-resistant oxidation. However, if SHAM was added first, it had no effect (Figure 21A), indicating that AOX did not contribute appreciably to electron flow under uninhibited conditions. In one transgenic line analyzed in greater detail (F6), the proportion of cyanide-resistant oxidation was increased when flies were grown and substrate oxidation was measured at 29 ⁰C (Figure 20C). In ageing flies (at 50% of their lifespan in either sex), state 3 substrate oxidation was diminished, regardless of AOX expression, but the cyanide -resistant proportion was maintained (Figure 21C). On sn-glycerol-3 -phosphate, a substrate that feeds electrons directly to complex III, AOX-expressing flies also manifested cyanide- resistant oxidation.

Example 15 — AOX expression confers cyanide and antimycin resistance to Drosophila in vivo

[00385] The following Example described the results of flies tested for resistance to cyanide and antimycin, inhibitors, respectively, of complexes IV and III. Because of the volatility of hydrogen cyanide (HCN), an assay was established to test the short-term toxicity of cyanide to adult flies, by placing them inside plugged vials containing agarose impregnated with 10 mM KCN. As shown in Figure 22, wild-type or AOX-nonexpressing flies were incapacitated within 5 min of such treatment, whereas AOX-expressing flies remained active during 20-30 min of cyanide exposure. The paralyzed flies were then left overnight in empty vials. All of the AOX-expressing flies exposed to KCN recovered overnight from the paralysis, whereas only one out of 50 non-expressing flies did so. Resistance to antimycin, which is non- volatile, was tested by addition of the drug at various concentrations to standard fly food. Wild-type eggs laid on 30 gg/ml antimycin failed to develop, and those laid on 10 gg/ml antimycin developed only to first instar. However, AOX-expressor eggs developed to adults on both concentrations of the drug, albeit with a considerable developmental delay (3-5 days at 25 ⁰C).

[00386] Discussion: The fact that AOX-expressing flies are partially resistant to antimycin and cyanide is consistent with the idea that AOX can support at least a portion of the electron flow to oxygen under conditions of partial inhibition of the cytochrome chain in vivo. Cyanide is a wide-spectrum reversible inhibitor of oxygen-binding hemoproteins, including hemoglobin as well as cytochrome oxidase, although the latter is generally considered its principal acute target. In insects, although a homologue of globin is present (Hankeln et al, J. Biol. Chem., 277:29012-29017, 2002), it is thought not to be involved in primary electron transport. Antimycin is a well characterized inhibitor of complex III, and the survival of AOX-expressing flies and their ability to complete development on medium containing doses of antimycin that are lethal to non-expressing or wild-type flies indicates that proton-pumping at complex I, plus residual activity of the cytochrome chain, is sufficient to maintain ATP production at a rate that supports life. Importantly, although AOX is non proton-pumping, it should nevertheless promote an increased rate of ATP production under conditions of OXPHOS inhibition. By facilitating electron flow it should restore redox homeostasis and enhance metabolic flux, including the substrate-level phosphorylation steps of glycolysis and the TCA cycle, proton pumping through complex I and flux through the beta-oxidation pathway, which can in turn supply additional NADH to complex I. We hypothesize that this amount of ATP production is sufficient to enable the completion of development even at 30 gg/ml antimycin.

[00387] AOX-expressing flies grown throughout development on antimycin-containing medium nevertheless showed a considerable developmental delay. This phenotype is shared with mutants affecting OXPHOS, such as in technical knockout (mitoribosomal protein S12, Toivonen et al., Genetics, 159:2410-254, 2001), stress-sensitive B (adenine nucleotide translocase, Zhang et al., Genetics, 153:891-903, 1999) and knockdown (citrate synthase, Fergestad et al., Genetics 173:1357-1364, 2006), as well as flies cultured on medium containing doxycycline (Toivonen et al., Genetics, 159:2410-254, 2001), an inhibitor of mitochondria protein synthesis. It may therefore be interpreted as a signature of a bioenergy limitation during development.

[00388] The complete elimination of COX activity (e.g. via null alleles of cyclope) is clearly lethal to Drosophila, even in the presence of AOX, which suggests that proton pumping through complex I alone is insufficient to maintain life. An alternate interpretation is that assembled complex IV is required for efficient assembly or stabilization of complexes I, II and III (the 'supercomplex hypothesis'). Partial knockdown of the complex IV subunit (COXVIc) encoded by cyclope, which diminished COX activity by more than 50% in adult flies, was, however, rescued by AOX. The available cyclope dsRNA line produced a sublethal phenotype with residual COX, indicating that the knockdown was not 100% efficient. AOX was also able to rescue partial knockdown of the complex IV assembly factor Surfl.

Example 16 — AOX-expression complements rescuess partial knockdown of cytochrome oxidase [00389] In Drosophila, complete functional loss of cytochrome oxidase, e.g. via homozygosity for a null mutation oϊ cyclope, encoding the COXVIa structural subunit of complex IV, is lethal. Moreover AOX expression was unable to complement this complete loss of function. However, AOX was able to rescue the lethality caused by partial knockdown of cytochrome oxidase, effected using RNAi technology against either cyclope or the complex IV assembly factor Surf I. GAL4-dependent dsRNA lines for each of these genes were combined with GAL4-dependent AOX, plus a suitable driver. Using the ubiquitous da-GAL4 driver the semilethality oϊcyclope knockdown was rescued At 25°C cyclope knockdown resulted in a large decrease in the number of eclosing progeny, which was restored to near wild-type levels by co-expression of AOX (p<0.01, chi-squared test). The decreased size of the eclosing adult flies was also rescued. AOX expression also compensated the lethality oϊcyclope knockdown induced by the da-GAL4 driver at 18°C, when combined with a 2 day heat-shock at 30⁰C during pupal stage. Mitochondrial COX activity from AOX-expressing flies knocked down for cyclope was less than half that from AOX-expressing control flies. At 18°C cyclope knockdown resulted in a reduced number of progeny that eclosed with a long delay (4-5 days) compared with controls. Co- expression of AOX restored the number of progeny to the expected level and reduced this developmental delay to approximately 1 day.

[00390] In some preliminary trials using the da-GAL4 driver, a small number of adult flies by co-expressing AOX in a Surfl knockdown line were obtained. However, a clearer and more consistent effect of AOX in rescue of Surfl knockdown, was not demonstrated using the inducible tub-GS driver in combination with different doses of RU486 (0.0 lμm, lμm or 2μm). At the highest doses of the drug, AOX was unable to rescue lethality, whereas at low doses knockdown was insufficient to produce complete lethality even in AOX non-expressing flies. However, at intermediate doses of the drug, at which Surfl knockdown alone was still lethal or semilethal (i.e. giving only a few eclosing pupae), concomitant AOX expression under the control of the same driver rescued the lethality. The extent of Surfl mRNA knockdown, as measured by Q-RT-PCR, was also similar in AOX-expressing and non-expressing flies cultured at the discriminating RU486 concentration of 2 μM.

[00391] Discussion: As observed previously using the ubiquitous Act5C-GAL4 driver (Zordan et al, Genetics, 172:229-241, 2006), complete knockdown of Surfl, i.e. by the use of the tub-GS driver and high doses of the inducing drug RU486, was lethal during early larval development. This lethality is not rescued by AOX expression and is presumably associated with loss of complex IV activity below a critical threshold. At levels of Surf 1 knockdown which produce pupal semilethality, co-expression of AOX under the same driver gave almost complete rescue (RU486 at 0.1 μM) or substantial rescue from almost complete lethality (RU486 at 0.2 μM). A Surfl-KD line (79.1) was selected for this experiment with the interfering transgene inserted into a long intron (of the gene PkβlC) in the inverse orientation, upstream of the major transcription start, thus minimizing any effects from constitutive background expression.

[00392] Surfl is a conserved gene involved in complex IV assembly, but its organismal null phenotype varies from lethal (Drosophila) through severe (yeast and human) to mild (mouse), and this is not understood. In yeast, disruption of the Surfl orthologue SHYl results in COX deficiency and respiratory defect, manifesting as inability to grow on nonfermentable substrates (Mashkevich et al, J. Biol. Chem., 272:14356-14364, 1997). Suppressor analysis (Barrientos et al., EMBO J., 21 :43-52, 2002) implicated Shy Ip in an early step of complex IV assembly, involving the COXI subunit. However, the interference with respiratory electron flow is greater than can be accounted for by complex IV deficiency alone (Mashkevich et al., J. Biol. Chem., 272:14356-14364, 1997), suggesting that Shylp might be involved also in the more global organization of the respiratory membrane and the transfer of electrons between complexes III and IV. Loss of SURFl functional activity in humans is a principal cause of COX-deficient Leigh Syndrome, a severe infantile encephalopathy (Zhu et al., Nat. Genet., 20:337-343, 1998; Tiranti et al., Am. J. Hum. Genet., 63:1601-1621, 1998; Yao et al., Hum. MoI. Genet., 8:2541-2549, 1999), but mis-sense mutations can cause a milder disease (Von Kleist- Retzow et al., J. Med. Genet., 38:109-113, 2001). In the mouse, functional ablation of Surfl provokes a decreased COX activity (Dell'agnello et al., Hum. MoI. Genet., 16:431- 444, 2007), but has virtually no physiological phenotype. Conversely, in Drosophila, only a partial knockdown of Surfl during development appears to be sufficient to produce lethality (Zordan et al., Genetics., 172:229-241, 2006). When knockdown was targeted specifically to the nervous system, impaired larval locomotion and adult optomotor responses were found, even though the decrease in cytochrome oxidase activity in the brain was only partial. Although Surfl/SHYl mutations in humans and yeast are recessive, the amount of Surf 1 knockdown required to produce lethality in flies is only 65% at the RNA level (Zordan et al, Genetics., 172:229-241, 2006)). In the present study, a knockdown of 40-50% at the RNA level was sufficient to provoke semilethality, although RNAi for Surfl in Drosophila (Zordan et al., Genetics., 172:229-241, 2006)) may be more efficient at the protein level. Until the phenotypes associated with Surfl deficiency are better understood, the meaning of its apparent rescue by AOX cannot be fully understood either.

Example 17— AOX expression compensates locomotor defect and excess ROS production in a Drosophila model of Parkinson's Disease

[00393] The Drosophila mutant dj-1, 6 carries a mutation in a gene homologous with one that causes a form of familial Parkinson's Disease in humans (DJl). The mutant exhibits progressive locomotor decline, as assayed by a behavioural assay for climbing ability, and the phenotype is proposed to be due mainly to neurodegeneration. The exact function of the DJl gene product and of its Drosophila homologues remains unclear, although the protein is known to be partially located in mitochondria and is believed in some way to confer protection from mitochondrial oxidative stress or damage. Since OXPHOS dysfunction is considered to be a common source of oxidative stress in Parkinson's Disease, we reasoned that the dj-1, 6 mutant phenotype might be alleviated by the provision of the AOX by-pass. AOX expression in human cells was previously shown to abolish the induction of superoxide dismutase under conditions of OXPHOS inhibition (Hakkaart et al., EMBO Rep., 7:341-345, 2006).

[00394] To test this, climbing activity was tested in wild-type and dj-1, 6 mutant flies of both sexes, over a period of 4 weeks post-eclosion, as well as in dj-1, 6 flies hemizygous for AOX plus or minus each of two GAL4 drivers, elav-GAL4 6800, which directs expression to the nervous system, and Act5CGAL4, which confers ubiquitous expression (Figure 23A). The previously reported locomotor defect of dj-1, 6 was confirmed and it was determined that the presence of the AOX transgene, even without a driver, conferred a partial rescue of the defect. This rescue was substantially enhanced by ubiquitous or nervous system-directed AOX expression. In AOX-expressing males the dj-1, 6 locomotor defect was almost completely abolished. Similar results were obtained when a combined bang-sensitivity and climbing assay on 20-22 day old flies was used. [00395] To determine whether rescue of the dj-1, 6 locomotor phenotype by AOX expression was related to alleviation of oxidative stress, mitochondrial ROS production was measured in mitochondrial suspensions from flies aged 20-22 days, a time-point at which AOX non-expressing dj-1, 6 flies manifest a substantial locomotor defect. Using the pyruvate-plus-proline substrate cocktail, we first confirmed that mitochondria from flies of the various genotypes studied gave state 3 substrate oxidation and respiratory control index similar to those of ageing AOX-expressing and wild-type flies studied earlier. Mitochondrial ROS production, measured as released hydrogen peroxide, was significantly higher in mitochondria from dj-1, 6 mutant flies than from wild-type flies of a given sex. The presence of the unexpressed AOX transgene alone did not significantly mitigate this excess ROS production. However, mitochondria from dj-1, 6 flies expressing AOX ubiquitously under the control of the Act5C-GAL4 driver gave ROS production decreased to a level no longer significantly different from that of mitochondria from wild- type flies.

[00396] Discussion: AOX expression was able to complement also the phenotype of a representative of a completely different class of Drosophila mutants, i.e. one carrying a mutation in a homologue of a human Parkinson's disease gene (DJl). Although the pathological mechanism of DJl mutations is poorly understood, there is a general consensus that DJl deficiency in some way entrains increased susceptibility to oxidative stress, particularly in the vulnerable dopaminergic neurons of the substantia nigra (Beal et al, Novartis Found. Symp., 287:183-192, 2007; Tan et al, Hum. Mutat., 28:641-653, 2007). DJl has been postulated as both a sensor and a direct scavenger of ROS (Taira et al., EMBO Rep., 5:213-218, 2004; Canet-Aviles et al., Proc. Natl. Acad. Sci. USA, 101 :9103-9108, 2004; Mitsumoto et al., Free Radic Res., 35:885-893, 2001), and DjI null mice are sensitive to oxidative stress (Kim et al., Proc. Natl. Acad. Sci. USA, 102:5215- 5220, 2005), as are Drosophila mutants in either of the homologues dj-1, 6 (Park et al., Gene, 361 :233-139, 2005; Lavara-Culebras et al., Gene, 400:10345-10350, 2005; Menzies et al., Curr. Biol, 15:1578-1582, 2005) and DJ-Ia (Yang et al., Proc. Natl. Acad. Sci USA, 102:13670-13675, 2005; Lavara-Culebras et al., Gene, 400: 10345-10350, 2005; Menzies et al., Curr. Biol., 15:1578-1582, 2005). It has been suggested to function as a peroxiredoxin (Andres-Mateos et al., Proc. Natl. Acad. Sci. USA, 104:14807-14812, 2007) or as a chaperone (Zhou et al., J. MoI. Biol, 356: 1036-1048, 2006). A primary target for its activity as a neuroprotectant appears to be alpha-synuclein (Batelli et al., PIoS ONE, 3:31884, 2008), whose aggregation it prevents. DJl is also protective against oxidative damage in cerebral ischemia (Aleyasin et al., Proc. Natl. Acad. Sci. USA, 104:18748-18753, 2007). Human DJl can substitute functionally for Drosophila dj-1,6 (Meulener et al., Proc. Natl. Acad. Sci. USA, 103:2517-2522, 2006). The current consensus is that mitochondrial dysfunction is a common underlying thread in Parkinson's disease etiology (Lin et al., Neuron, 13:507-523, 1994;,Taira et al., EMBO Rep., 5:213- 218, 2004; Tan et al., Hum. Mutat., 28:641-653, 2007), with increased oxidative stress or an inability to handle such stress proposed as a major mechanism. The ability of AOX to rescue the phenotype of dj-1, 6 mutant flies is consistent with this hypothesis. Mitochondria from dj-1, 6 mutant flies showed enhanced production of ROS in vitro, but this was suppressed by ubiquitous AOX expression, which also alleviated the locomotor defect. Interestingly, a much lower amount of ubiquitous AOX expression (> 2 order of magnitude less at the RNA level) nevertheless provoked a partial rescue of the locomotor defect (Figure 23), even though in isolated mitochondria its effects on ROS production were modest. AOX expression restricted to the nervous system also rescued the locomotor defect, the e/αv-GAL4 driver being highly specific for postmitotic neurons in the embryo and larval brain (Lin et al., Neuron, 13:507-523, 1994). One possibility might be that, even without driver, AOX expression is substantial in parts of the nervous system, but when assayed in the whole fly (for expression or ROS production) this effect is diluted out.

[00397] The foregoing results suggest two possible mechanisms to account for the alleviation of mitochondrial ROS production in the dj-1, 6 mutant phenotype, associated with the phenotypic rescue. Transient interruptions of electron flow in the microenvironment of the OXPHOS system, e.g. due to variations in the local availability of cytochrome c, may result in episodic bursts of excess ROS production at complexes I and/or III. The AOX by-pass of the cytochrome chain may act locally to prevent such disturbances, decreasing net ROS production to levels that are no longer pathological, despite the failure of the detoxification system provided by dj-1,6. A second possibility would be that AOX acts directly as to eliminate mitochondrial ROS, for example using semiquinone radicals as substrate. AOX is induced in Euglena by treatment with Cd (Castro-Guerrero et al., Bioenerg. Biomembr., 2007 Sep. 25 (Epub ahead of print)), which enhances ROS production (040) and leads to the induction of a wide portfolio of antioxidant enzymes (Castro-Guerrero et al., Bioenerg. Biomembr., 2007 Sep. 25 (Epub ahead of print)). Overexpression of AOX in plants also protects from the increased oxidative stress seen under cold conditions (Sugie et al., Genet Genet. Syst., 81 :349-354, 2006), and AOX is naturally induced by cold in many species (Vanderberghe et al., Plant Physiol, 100:115-119, 1992; Gonzalez-Meier et al., Plant Physiol., 120:765-772, 1999). The idea that AOX could be acting in dj-1, 6 directly as a ROS protectant is supported by the fact that even the tiny amount of expression seen without a driver is sufficient to produce a transient rescue of the locomotor defect. Such a low level of expression has no detectable effects on substrate oxidation, as measured polarographically (Figure 20).

Example 18 — Expression of the alternative oxidase (AOX) from Ciona intestinalis can compensate the growth defect and the pronounced oxidant-sensitivity of human cells with a pathological cytochrome oxidase defect.

[00398] The following Example investigated whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) can correct these metabolic abnormalities in human cells rendered COX-defϊcient by knockdown of COXlO or pathological mutation of COXl.

[00399] Construction of the AOX expressing vector. The C intestinalis AOX cDNA (Hakkaart et al., EMBO Rep., 7:341-345, 2005) was recloned as a Smal fragment in the Pmel site of lentivector pWPI (Addgene, Cambridge, MA, USA; Ref. 10), via blunt-end cloning, creating construct pWPI-AOX. Virus production used standard procedures (Bovia et al., Blood, 101 :1727-1733, 2003; Zufferey et al., Nat. BiotechnoL, 15:871-875, 1997), and the second-generation packaging system, which incorporates inbuilt safety features (Pellinen et al., Int. J. Oncol, 25:1753-1762, 2004; www.lentiweb . com/protocols lentivectors .php) .

[00400] Cell culture, transfection and infection: HEK293 -derived AOX-transgenic cells Hakkaart et al., EMBO Rep., 7:341-345, 2005) were grown in DMEM (Gibco Invitrogen, Cergy Pontoise, France) 4.5 g/1 glucose supplemented by 2 mM glutamine, 5% foetal bovine serum, 200 μM uridine, 1 mM pyruvate, 100 μg/ml hygromycin and 10 μg/ml blasticidin. Fibroblasts were grown in DMEM containing 4.5 g/1 glucose supplemented by 2 mM glutamine (as glutamax™), 10% foetal bovine serum, 200 μM uridine, 1 mM pyruvate and 10 mg/ml penicillin/streptomycin. HEK293 -derived AOX-transgenic cells were transfected with pSM2C plasmid from Open Biosystems (Huntsville, USA) expressing a shRNA directed against COXlO using lipofectamine from Invitrogen (Saint- Quentin en Yveline, France) according to manufacturer's instructions. The hairpin sequence was: 5 '-

TGCTGTTGACAGTGAGCGACCAGCCTATCTTTGTCCAGAATAGTGAAGCCACA GA TGTATTCTGGACAAAGATAGGCTGGGTGCCTACTGCCTCGGA-S ' (SEQ ID NO: 139). Sense and antisense sequences are underlined. Transductions of then lentivector construct used standard methods (Salmon et al, Blood, 96:3392-3398, 2000; lentiweb.com/protocols LVtitration.php). For determination of growth characteristics, HEK293-derived cells and fibroblasts were seeded at 10,000 and 15,000 cells/cm², respectively and medium was changed every two days.

[00401] Biochemical methods: Cell lysates were prepared according to the RIPA method. Western blots were carried out to control the effect of the shRNA on COXlO expression and to check for the expression of the AOX. Primary antibodies were rabbit polyclonal anti-COXIO from ProteinTech (Manchester, UK), mouse monoclonal anti-actin from Chemicon-Millipore (Saint Quentin en Yvelines, France) and mouse monoclonal anti-lily AOX kindly provided by Annie Sainsard. Peroxidase conjugated anti-mouse and anti-rabbit were from Amersham (Buckinghamshire, UK) and were used as secondary antibodies diluted 10,000 fold. Cytochrome c oxidase (COX) and succinate cytochrome c reductase (SCCR) activities were measured using the method described by Benit et al, 2006. Cell respiration was measured using a Clark oxygen electrode (Hansatech, UK) fitted to a magnetically stirred 250 μl chamber maintained at 37 ⁰C in a medium consisting of 0.3 M mannitol, 5 mM KCl, 5 mM MgC12, 10 mM phosphate buffer (pH 7.2) and 1 mg/ml bovine serum albumin, plus inhibitors as indicated.

[00402] Viability Assays: Cells were grown in DMEM containing 4.5 g/1 glucoase in 6-well plastes to near confluence and exposed either to 200 or to 800 μM hydrogen peroxide, made fresh daily, for 6 or 48 hours or else seeded at 15,000 cells/cm² and exposed to 5μM antimycin for 7 days with medium changed every 2 days. Cells were harvested by trypsin-EDTA treatment and resuspended in Hanks' Balanced Salt Solution (HBSS). At least three replicates of each treatment were used to calculate viability using the Trypan blue exclsuion assay. [00403] Statistical treatment: All data were first analyzed by a one way ANOVA and then using a pair wise comparison using a t-TEST using SigmaStat software (Sigma, St. Louis, USA). Data shown are means ± 1 SD. p < 0.001 was considered to indicate statistical significance.

[00404] Fluorescence microscopy: Cells were seeded at 15,000 cells/cm² and grown 3 days in standard conditions on glass labtek chambered cover glass (Nunc). Cells were washed three times with pre-warmed HBSS buffer and incubated 30 min in HBSS supplemented with 3μM DMSO dissolved Mitosox with or without 5 μM antimycin. Finally, cells were washed three times in HBSS and Mitosox fluorescence was visualized using a Nikon ECLIPSE TE300 microscope. Fibroblasts washed with phosphate buffered saline (PBS) were fixed with 4% paraformaldehyde for 20 minutes, permeabilized with 0.1% Triton X-100 (w/v) for 5 minutes and washed 3 times with PBS. After blocking with 5% goat serum in PBS/0.05% Tween (w/v) for 30 minutes, cells were treated for 2 hours with anti-AOX serum (5, 000-fold dilution, rabbit polyclonal against C. intestinalis AOX peptides CVNHDLGSRKPDEQNPYPPGQ (SEQ ID NO: 138) and FKIETNDSTDEPNIEVENFPC (SEQ ID NO: 137), 21^st Century Biochemicals, Marlboro, MA, USA). Cells were washed 3 times with PBS/Tween, treated for 11 hours with alexa- conjugated anti-rabbit secondary antibody (1, 000-fold dilution, Invitrogen, Cergy- Pontoise, France), washed again 3 times and mounted with Fluorescent mounting medium (Dako, Trappes, France). All procedures were performed at room temperature. Fluorescence was visualized using an eclipse TE300 microscope (Nikon Champigny sur Marne, France).

[00405] Superoxide dismutase assay: Total superoxide dismutase (SOD) activity was determined by pyrogallol auto-oxidation assay, 50% decrease of the auto-oxidation rate by SOD being defined as IU. Results were expressed as U/mg protein.

[00406] Results: Cytochrome c oxidase (COX) deficiency results in a wide spectrum of clinical presentations, ranging from early onset devastating encephalomyopathy and cardiomyopathy to neurological diseases in adulthood and in the elderly (McFarland et al., Curr. Top. Dev. Biol, 77:113-155, 2005). In patient-derived cultured cells, COX deficiency causes a requirement for several key metabolites: high levels of glucose, so as to compensate for decreased mitochondrial ATP synthesis; pyruvate, in order to ensure regeneration of the pyridine nucleotide pool; and uridine, to maintain the pyrimidine precursor pool for nucleic acid synthesis. Whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) can correct these metabolic abnormalities in human cells rendered COX-defϊcient by knockdown of COXlO or pathological mutation of COXl 5 was tested.

[00407] The alternative oxidase (AOX), absent from mammals, by-passes the cytochrome pathway to shuttle electrons directly from the quinone pool to molecular oxygen in numerous plants, microorganisms and, as recently reported, some metazoans, including the sea squirt dona intestinalis (Rasmussen et al., Anbu. Rev. Plant. Biol., 55:23-29, 2004; McDonald et al., IUBMB Life, 56:333-2341, 2004). It was recently reported that expressing C intestinalis AOX in human embryonic kidney (HEK)293- derived T-REx cells conferred cyanide -resistance without impairing the ability of these cells to grow and multiply (Hakkaart et al., EMBO Rep., 7:341-345, 2005). See also Example 9 above. Results of the present experiment indicated that while the respiration of HEK293 -derived cells expressing AOX was significantly resistant to antimycin and cyanide, i.e. specific inhibitors of complex III and IV, it was still sensitive to rotenone, malonate and oligomycin, specific inhibitors, respectively, of complex I, II and V of the mitochondrial OXPHOS system. This accords with the postulated function of AOX as a by-pass for the cytochrome chain, but not for complexes I, II or V.

[00408] HEK293 -derived cells harboring tetracycline-inducible AOX were then made COX-deficient using shRNA technology. COX deficiency was generated by targeting the COXlO gene, encoding the mitochondrial enzyme hemeA:farnesyltransferase involved in COX assembly (Antonicka et al., Am. J. Hum. Genet., 72:101-114, 2003). This resulted in a more than 90% decrease in the amount of the COXlO gene product assessed by Western blotting, leading to a 60% decrease in COX activity. In standard, high-glucose medium, containing also uridine and pyruvate, growth of these cells was indistinguishable from that of control cells, whereas they showed a significant growth defect in low glucose medium (1 g/1), in medium lacking added uridine and pyruvate, and in medium lacking all three supplements. Induction of AOX expression fully rescued the growth defect of COXIO-depleted cells. The mitochondrial localization and functionality of the AOX gene product having been previously established in these cells (Antonicka et al., Am. J. Hum. Genet., 72:101-114, 2003), we confirmed that AOX expression did not affect the enzymatic activities of the respiratory chain (RC) complexes in the COXIO-depleted cells.

[00409] The C. intestinalis AOX transgene was then expressed in immortalized COX- defective fibroblasts derived from a patient presenting an early-onset fatal hypertrophic cardiomyopathy due to a pathological COX 15 gene mutation (Antonicka et al., Am. J. Hum. Genet., 72: 101-114, 2003) . With 35-40% residual COX activity these cells exhibited a partial defect of respiration (about a 30% decrease as compared to control fibroblasts). The cells were transduced by a packaged lentiviral construct derived from lentivector pWPI (Addgene, Cambridge, MA, USA), containing the C. intestinalis AOX coding sequence under the control of the EFIa promoter, and in cis to IRES-GFP. Based on green fluorescence, about 80% of the COXl 5-mutant cells were successfully transduced. Using selection on antimycin, which rapidly triggers cell death in COX 15- defective cells, we isolated a clone of AOX-expressing, COX 15 -defective cells. The presence of the AOX was confirmed by Western blotting and further functional studies. The respiration of the COXl 5-mutant cells harbouring the AOX was 25-30% increased as compared to the parental COXl 5-mutant cells, and was largely cyanide-resistant (55% residual respiration in the presence of cyanide). When cultured under restrictive conditions (low glucose, or medium lacking uridine and pyruvate), the growth of the parental COXl 5-mutant cells was significantly impaired, but growth on the restrictive media was restored to control levels by the expression of AOX. Similar results were obtained with other COXl 5-mutant clones expressing AOX.

[00410] A pronounced oxidant-sensitivity of cytochrome oxidase-deficient cells, e.g. harboring the MELAS mutation in the mitochondrial DNA, has been previously reported, which was attributed to an increased susceptibility to oxidants of the calcium-dependent mitochondrial transition pore (Wong et al., Biochem. Biophys. Res. Commun., 239: 139- 145, 1997). Thus, the oxidant-sensitivity of cultured human fibroblasts rendered by mutations in SURFl (Von Kleist-Retzow et al., J. Med. Genet., 38:109-113, 2001), COXlO (Valnot et al., Hum. MoI. Genet., 9:1245-1249, 2000), and COXl 5 (Antonicka et al., Am. J. Hum. Genet., 72:101-114, 2003), and of HEK cells made COX-deficient by shRNA silencing of COXlO was tested. With this aim, we treated cells grown in nonselective medium plus antimycin (5μM; 7d), which causes endogenous oxidative insult (Hakkaart et al., EMBO Rep., 7:341-345, 2005), or with hydrogen peroxide (H₂O₂, 200μM and 800μM; 6h or 2d) resulting in an exogenous oxidative insult (Wong et al, Biochem. Biophys. Res. Commun., 239:139-145, 1997). Assessing cell viability by Trypan blue exclusion revealed that COX-deficient cells were significantly more sensitive to both types of oxidative insult. As compared to control cells, the viability of COX- deficient antimycin-treated cells were reduced to 70-80% for SURFl, COXlO or COX15 mutated fibroblasts and 85% for COX-deficient HEK cells, while antimycin did not affect the viability of control cells. See Table 3 below.

[00411] Table 3. Hypersensitivity of COX deficient cells to oxidative insult. Viability of cells exposed to 5μM antimycin, 200 or 800 μM H₂O₂ for various periods of time.

Viability of cells expressed as percentage of cells excluding the Trypan blue. Values are means ± SD of 3 independent experiments.

[00412] Similarly, the viability of control fibroblasts was not affected (<1%) by a day treatment with 200μM H₂O₂, while a similar treatment significantly affected the viability of all COX-deficient cells, from 97% to 72%. Treating HEK cells with 800μM H₂O₂ for 6 hours only mildle affected cell viability (94% of untreated cells), but decreased the viability COX-deficient HEK cells to 63% of untreated cells.

[00413] This presented a rationale to challenge the C(2¥75-mutant cells by mitochondrial superoxide overproduction triggered by antimycin (Robinson et al., Proc. Natl. Acad. Sci. USA, 103:15038-15043, 2006). Antimycin caused massive cell death under restrictive conditions (100% at 3 days) which was conteracted by the AOX expression (60% of growth observed in the absence of amtimycin). The rescue of cell growth by AOX expression was abolished if antimycin-treated cells were further treated with ImM nPG. AOX expression also abolished the excess superoxide production seen in C(2¥75-mutant cells in the presence of antimycin as measured by MitoSOX labeling. Cell death induced by antimycin was also partially prevented (about 35%) upon a 24 hour treatment with a spin trap, ImM TEMPOL (4-hydroxy-2,2,6,6-tetramethylpiperidinyloxy) (Soule et al, Free Radic. Biol. Med., 42:1632-1650, 2007). This indicated that cell death triggered by antimycin was in part due to superoxide overproduction which was overcome by AOX expression.

[00414] Thus far, mutations in up to 8 different genes, including nuclear genes SURFl, SCOl, SCO2, COXlO and COXl 5, plus the mitochondrial genes MTCOXI-III, have been shown specifically to cause COX deficiency in humans (MITOMAP: A Human Mitochondrial Genome Database.www.mitomap.org). However, the physiological consequences of COX deficiency, including the tissue-specificity of the resulting phenotypes and the underlying pathological processes, remain poorly understood. This is, furthermore, limiting the development of therapy (Smeitink et al., Cell Metab 3, 9-13, 2006). The foregoing results demonstrate that expressing AOX rescues the growth defect of COX-deficient cells as well as their susceptibility to oxidative stress. This provides a useful tool to delineate and possibly even to counteract the consequences of such deficiency, whatever its genetic origin.

[00415] All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety.

[00416] From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention.

References [00417] Affourtit, C, Albury, M.S., Crichton, P.G. and Moore, AX. (2002) Exploring the molecular nature of alternative oxidase regulation and catalysis. FEBS Lett, 510, 121- 126.

[00418] Bahr, J.T. and Bonner, W.D., Jr. (1973) Cyanide-insensitive respiration. II. Control of the alternate pathway. J Biol Chem, 248, 3446-3450.

[00419] Barolo, S., Carver, L.A. and Posakony, J.W. (2000) GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. Biotechniques, 29,

726-732.

[00420] Bovia, F., Salmon, P., Matthes, T., Kvell, K., Nguyen, T.H., Werner-Favre, C, Barnet, M., Nagy, M., Leuba, F., Arrighi, J.F., Piguet, V., Trono, D., Zubler, R.H. (2003) Efficient transduction of primary human B lymphocytes and nondividing myeloma B cells with HIV- 1 -derived lentiviral vectors. Blood, 101, 1727-1733.

[00421] Dehal, P., Satou, Y., Campbell, R.K., Chapman, J., Degnan, B., DeTomaso, A. et al. (2002) The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science, 298, 2157-2167.

[00422] Brass, T.G., Rogina, B. and Helfand, SX. (2005) Behavioral, physical, and demographic changes in Drosophila populations through dietary restriction. Aging Cell, 4, 309-317.

[00423] Ferguson, M., Mockett, R.J. Shen, Y., Orr, W.C. and Sohal, R.S. (2005) Age- associated decline in mitochondrial respiration and electron transport in Drosophila melanogaster. Biochem J, 390, 501-511.

[00424] Frolov, M.V., Benevolenskaya, E.V. and Birchler, J.A. (2000) The oxen gene of Drosophila encodes a homo log of subunit 9 of yeast ubiquinol-cytochrome c oxidoreductase complex: evidence for modulation of gene expression in response to mitochondrial activity. Genetics, 156, 1727-1736.

[00425] Garrido, N., Griparic, L., Jokitalo, E., Wartiovaara, J., van der Bliek, A.M. and Spelbrink, J.N. (2003) Composition and dynamics of human mitochondrial nucleoids. MoI Biol Cell, 14, 1583-1596. [00426] Geromel, V., Kadhom, N., Cebalos-Picot, L, Ouari, O., Polidori, A., Munnich, A., Rotig, A. and Rustin, P. (2001) Superoxide-induced massive apoptosis in cultured skin fibroblasts harboring the neurogenic ataxia retinitis pigmentosa (NARP) mutation in the ATPase-6 gene of the mitochondria) DNA. Hum MoI Genet, 10, 1221-1228.

[00427] Hakkaart, G.A.J., Dassa. E., Jacobs. H.T. and Rustin P (2006) Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration. EMBO Rep, 7, 341-345.

[00428] Kvell, K., Nguyen, T.H., Salmon, P., Glauser, F., Werner-Favre, C, Barnet, M., Schneider, P., Trono, D. and Zubler, R.H. (2005) Transduction of CpG DNA-stimulated primary human B cells with bicistronic lentivectors. MoI. Ther, 12, 892-899.

[00429] Lakso, M., Sauer, B., Mosinger, B. Jr., Lee, E.J., Manning, R.W., Yu, S.H., Mulder, K.L. and Westphal, H. (1992) Targeted oncogene activation by site-specific recombination in transgenic mice. Proc Natl Acad Sci USA, 89, 6232-6236.

[00430] Lam, E., Kato, N. and Lawton, M. (2001) Programmed cell death, mitochondria and the plant hypersensitive response. Nature, 411, 848-853.

[00431] Larsson, N.G., Wang, J., Wilhemsson, H., Oldfors, A. and Rustin, P. (1998) Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nature Genet, 18, 231-236.

[00432] Maxwell, D.P., Wang, Y. and Mclntosh, L. (1999) The alternative oxidase lowers mitochondria) reactive oxygen production in plant cells. Proc Natl Acad Sci U S A, 96, 8271- 8276.

[00433] McDonald, A. and Vanlerberghe, G. (2004) Branched mitochondrial electron transport in the Animalia: presence of alternative oxidase in several animal phyla. IUBMB Life, 56, 333-341

[00434] Munnich, A., Rotig, A., Cornier, V. and Rustin, P. (2001). 8th ed., eds., 2261- 2274. (2001) Clinical presentation of respiratory chain deficiency. In: The metabolic and molecular bases of inherited disease. McGraw-Hill Medical Publishing Division, New- York. [00435] Pellinen, R., Hakkarainen, T., Wahlfors, T., Tulimaki, K., Ketola, A., Tenhunen, A., Salonen, T. and Wahlfors, J. (2004) Cancer cells as targets for lentivirus- mediated gene transfer and gene therapy. Int J Oncol 25, 1753-1762.

[00436] Piper, M. D., Skorupa, D. and Partridge, L. (2005) Diet, metabolism and lifespan in Drosophila. Exp Gerontol, 40, 857-862.

[00437] Pollard, P.J., Wortham, N.C., Tomlinson, LP. (2003) The TCA cycle and tumorigenesis: the examples of fumarate hydratase and succinate dehydrogenase. Ann Med, 35, 632-639.

[00438] Roth, E.F., Jr. and Gilbert, H.S. (1984) The pyrogallol assay for superoxide dismutase: absence of a glutathione artifact. Anal Biochem, 137, 50-53.

[00439] Rustin, P. and Queiroz-Claret, C. (1985) Changes in oxidative properties of Kalanchoe blossfeldiana leaf mitochondria during development of Crassulacean acid metabolim. Mania, 164, 415-422.

[00440] Salmon, P., Kindler, V., Ducrey, O., Chapuis, B., Zubler, R.H. and Trono, D. (2000) High-level transgene expression in human hematopoietic progenitors and differentiated blood lineages after transduction with improved lentiviral vectors. Blood, 96, 3392-3398.

[00441] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) 2nd ed., (1989) Analysis and cloning of eukaryotic genomic DNA (pp 9.52-9.55), Synthetic oligonucleotide probes (pp 11.45-11.46, 11.55-11.57). In: Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York.

[00442] Schonbaum, G.R., Bonner, W.D. Jr., Storey, B.T. and Bahr, J.T. (1971) Specific inhibition of the cyanide-insensitive respiratory pathway in plant mitochondria by hydroxamic acids. Plant Physiol, 47, 124-128.

[00443] Siedow, J.N. and Bickett, D.M. (1981) Structural features required for inhibition of cyanideinsensitive electron transfer by propyl gallate. Arch Biochem Biophys, 207, 32- 39. [00444] Spelbrink, J.N., Toivonen, J.M., Hakkaart, G.A., Kurkela, J.M., Cooper, H.M., Lehtinen, S. K., Lecrenier, N., Back, J. W., Speijer, D., Foury, F. and Jacobs, H. T. (2000) In vivo functional analysis of the human mitochondrial DNA polymerase POLG expressed in cultured human cells. J Biol Chem, 275, 24818-24828.

[00445] Stacpoole, P.W., Moore, G.W. and Kornhauser, D.M. (1978) Metabolic effects of dichloroacetate in patients with diabetes mellitus and hyperlipoproteinemia. N Engl J Med, 298, 526-530.

[00446] Tattersall, D.B., Bak, S., Jones, P.R., Olsen, C.E., Nielsen, J.K., Hansen, MX., Hoj, P.B. and Moller, B. L. (2001) Resistance to an herbivore through engineered cyanogenic glucoside synthesis. Science, 293, 1826-1828.

[00447] Toivonen, J.M., O'Dell, K.M., Petit, N., Irvine, S.C., Knight, G.K., Lehtonen, M., Longmuir, M., Luoto, K., Touraille, S., Wang, Z., Alziari, S., Shah, Z. H. and Jacobs, H.T. (2001) Technical knockout, a Drosophila model of mitochondrial deafness. Genetics, 159, 241-254.

[00448] Tomancak, P., Beaton, A., Weiszmann, R., Kwan, E., Shu, S., Lewis, S. E., Richards, S. Ashburner, M., Hartenstein, V., Celniker, S.E. and Rubin G.M. (2003) Systematic determination of patterns of gene expression during Drosophila embryo genesis. Genome Biol, 3, research0088.1-0088.14.

[00449] Umbach, A.L., Gonzalez-Meier, M.A., Sweet, CR. and Siedow, J.N. (2002) Activation of the plant mitochondrial alternative oxidase: insights from site-directed mutagenesis. Biochim Biophys Acta, 1554, 118-128.

[00450] Warburg, O. (1919) Ober die Geschwindigkeit der photochemischen Kohiensaurezersetzung in lebenden Zellen. Biochem Z, 100, 230-270.

[00451] Warburg, O. (1956) On the origin of cancer cells. Science, 123, 309-314.

[00452] Weinruch, R. (2006) Will dietary restriction work in primates? Biogerontol, 7, 169-171.

[00453] Wiznerowicz, M. and Trono, D. (2005) Harnessing HIV for therapy, basic research and biotechnology. Trends Biotechnol, 23, 42-47. [00454] Zordan, M.A., Cisotto, P., Benna, C, Agostino, A., Rizzo, G., Piccin, A., et al. (2006) Post-transcriptional silencing and functional characterization of the Drosophila melanogaster homo log of human Surfl. Genetics, 172, 229-241.

[00455] Zufferey, R., Nagy, D., Mandel, R.J., Naldini, L., Trono, D. (1997) Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol.

15,871-875.

Claims

What is claimed is:

1. A method for prophylaxis therapy for a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction comprising

(a) identifying a subject as a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction; and

(b) administering to the subject an effective amount of a therapeutic selected from the group consisting of

(i) a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein, wherein the subject has not been diagnosed as having a disorder associated with mitochondrial OXPHOS dysfunction.

2. The method of claim 1, wherein the subject is identified as a subject at risk because the subject has a relative that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

3. The method of claim 1, wherein the subject is identified as a subject at risk because the subject has a sibling that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

4. The method of claim 1, wherein the subject is identified as a subject at risk because the subject has a common genetic parent that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

5. The method of any one of claims 1 -4, wherein the disorder associated with mitochondrial OXPHOS dysfunction is selected from the group consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease; mitochondrial encephalomyopathies; progressive external ophthalmoplegia, Kearns-Sayre syndrome; MELAS syndrome; amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia; other ataxias and neurological conditions resulting from genetics defects in POLG, cl0orf2 (Twinkle) or other components of the system of mitochondrial DNA maintenance; syndromic mitochondrial hearing impairment; nonsyndromic mitochondrial hearing impairment; intractable obesity; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; and Lactic acidemia.

6. The method of any one of claims 1-5, wherein the identifying step comprises screening for the presence of a mutation in the genome of the subject that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

7. The method of claim 6, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene associated with mitochondrial OXPHOS function, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction

8. The method of claim 7, wherein the nucleic acid is mitochondrial DNA (mtDNA).

9. The method of claim 6, wherein the gene is associated with proper assembly of cytochrome c oxidase.

10. The method of claim 6, wherein the gene is associated with proper assembly of OXPHOS complex III.

11. The method of claim 6, wherein the identifying comprises screening for the presence of a mutation in a gene selected from the group consisting of DJl, Cox 10, Scol, Sco2, MTCOXl, MTC0X2, MTC0X3 HTRA2, LRRK2, PARKIN, PINKl, SODl, α-Synuclein, Cox4Il, Cox4I2, Cox5A, Cox5B, CoxβAl, Cox6A2, CoxβBl, Cox 6C, Cox7Al, Cox7A2, Cox7A3, Cox7B2, Cox7C, Cox8, Coxl l, OXAlL, LRPPRC, Coxl8, Coxl9, PETl 12L and BCSlL.

12. The method of claim 11 , wherein the gene is DJl .

13. The method of claim 12, wherein the method comprises screening for a missense mutation causing a DJl amino acid mutation selected from the group consisting of C106E, C106D, L166P, M25I, A104T, and D149A.

14. The method of claim 11, wherein the gene is Cox 10.

15. The method of claim 14, wherein the method comprises screening for a missense mutation causing a Cox 10 gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A1211T and A1211G.

16. The method of claim 14, wherein the method comprises screening for a missense mutation causing a Cox 10 amino acid mutation selected from the group consisting of T196K, P225L, D336V and D336G.

17. The method of claim 11 , wherein the gene is SCO 1.

18. The method of claim 17, wherein the method comprises screening for a missense mutation causing a SCOl gene C520T mutation.

19. The method of claim 17, wherein the method comprises screening for a missense mutation causing a SCOl P174L amino acid mutation.

20. The method of claim 11 , wherein the gene is SCO2.

21. The method of claim 20, wherein the method comprises screening for a missense mutation causing a SCO2 amino acid mutation selected from the group consisting of E 140K, R90X, and Rl 7 IW.

22. The method of claim 6, wherein the identifying step comprises screening for the presence of a mutation in a gene selected from the group consisting of MTATP6, MTTLl, MTTK, MTNDl, MTND3, MTND4, MTND5, MTND6, MTCO3, MTTW, MTTV, NDUFSl, BSClL, Surfl, LRPPRC and Coxl5.

23. The method of claim 22, wherein the gene is Cox 15.

24. The method of claim 23, wherein the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C.

25. The method of claim 23, wherein the method comprises screening for a missense mutation causing a Cox 15 amino acid mutation selected from the group consisting of R217W and F374L.

26. The method of claim 22, wherein the gene is Surf 1.

27. The method of claim 26, wherein the method comprises screening for a missense mutation causing a Surf 1 gene mutation selected from the group consisting of T280C, C574T and C688T.

28. The method of claim 26, wherein method comprising screening for a missense mutation causing a Surfl Q82X amino acid mutation.

29. The method of any one of claims 1-5, wherein the identifying step comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SC02, Cox 10, and Cox 15 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of OXPHOS dysfunction in the subject.

30. The method of any one of claims 1-5, wherein the identifying step comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of OXPHOS dysfunction in the subject.

31. The method of any one of claims 1 -5 , wherein the identifying step comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of OXPHOS dysfunction in the subject.

32. The method of any one of claims 1-5, wherein the identifying step comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of OXPHOS dysfunction in the subject.

33. The method of any one of claims 1-5, wherein the identifying step comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of OXPHOS dysfunction in the subject.

34. The method of any one of claims 1-33, wherein the alternative oxidase protein is derived from an organism from the Eurkaya kingdom.

35. The method of claim 34, wherein the alternative oxidase protein is derived from an organism from a phylum selected from the group consisting of Mollusca, Annelida and Echinodermata, and Chordata.

36. The method of claim 34, wherein the alternative oxidase protein is derived from an organism from family Cionidae.

37. The method of claim 36, wherein the alternative oxidase protein is derived from Ciona intestinalis .

38. The method of claim 1, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 75% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

39. The method of claim 1, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 95% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

40. The method of claim 1, wherein the isolated nucleic acid encodes a polypeptide comprising the amino acid sequence SEQ ID NO: 2.

41. The method of any one of claims 38-40, wherein the polypeptide further comprises an epitope tag.

42. The method of claim 1, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal, or protist origin.

43. The method of claim 1, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of vertebrate origin and an amino acid of a polypeptide with alternative oxidase activity of invertebrate origin.

44. The method of claim 43, wherein the polypeptide with alternative oxidase activity is from a chordate species of invertebrate.

45. The method of claim 43 , wherein the mitochondrial transit peptide is of mammalian origin.

46. The method of any one of claims 1-45, wherein the polynucleotide comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell.

47. The method of claim 46, wherein the polynucleotide is operably linked to an expression control sequence.

48. The method of claim 46, wherein the promoter is of mammalian origin.

49. The method of claim 46, wherein the promoter is a promoter of a nuclear gene that encodes a mitochondrial protein.

50. The method of any one of claims 1 -48, wherein the polynucleotide is administered by administering a vector that comprises the polynucleotide.

51. The method of claim 50, wherein the vector is selected from the group consisting of replication deficient adenoviral vectors, adeno-associated viral vectors, and lenti virus vectors.

52. The method of claim 1 , wherein the polynucleotide is administered locally to a tissue or an organ comprising cells affected by metabolic acidosis or oxidative stress.

53. The method of claim 1 , wherein the polynucleotide is administered systemically.

54. A method for prophylaxis therapy for a disorder associated with cytochrome c oxidase deficiency comprising (a) identifying a subject having a mutation that is correlated with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15;

(b) administering to the subject a therapeutic selected from the group consisting of

(i) a polynucleotide that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein.

55. The method of claim 54, wherein the subject is identified as a subject at risk because the subject has a relative that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

56. The method of claim 54, wherein the subject is identified as a subject at risk because the subject has a sibling that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

57. The method of claim 54, wherein the subject is identified as a subject at risk because the subject has a common genetic parent that has been diagnosed with a disorder associated with cytochrome c oxidase deficiency.

58. The method of any one of claims 1 -4, wherein the disorder associated with cytochrome c oxidase deficiency is selected from the group consisting of Leigh syndrome, fatal hypertrophic cardiomyopathy (HCMP) with encephalopathy, hepatic failure, tubulopathy with encephalomyopathy and leukodystrophy.

59. The method of any one of claims 1-5, wherein the identifying step comprises screening for the presence of a mutation in a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15 of the subject, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency.

60. The method of claim 59, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with cytochrome c oxidase deficiency.

61. The method of claim 60, wherein the nucleic acid is mitochondrial DNA (mtDNA).

62. The method of claim 54, wherein the gene is CoxlO.

63. The method of claim 62, wherein the method comprises screening for a missense mutation causing a CoxlO gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A1211T and A1211G.

64. The method of claim 62, wherein the method comprises screening for a missense mutation causing a CoxlO amino acid mutation selected from the group consisting of T196K, P225L, D336V and D336G.

65. The method of claim 54, wherein the gene is SCO 1.

66. The method of claim 65, wherein the method comprises screening for a missense mutation causing a SCOl gene C520T mutation.

67. The method of claim 65, wherein the method comprises screening for a missense mutation causing a SCOl P174L amino acid mutation.

68. The method of claim 54, wherein the gene is SC02.

69. The method of claim 68, wherein the method comprises screening for a missense mutation causing a SC02 amino acid mutation selected from the group consisting of E 140K, R90X, and Rl 7 IW.

70. The method of claim 54, wherein the gene is Coxl5.

71. The method of claim 70, wherein the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C.

72. The method of claim 70, wherein the method comprises screening for a missense mutation causing a Cox 15 amino acid mutation selected from the group consisting of R217W and F374L.

73. The method of claim 54, wherein the gene is Surfl .

74. The method of claim 72, wherein the method comprises screening for a missense mutation causing a Surf 1 gene mutation selected from the group consisting of T280C, C574T and C688T.

75. The method of claim 72, wherein method comprising screening for a missense mutation causing a Surfl Q82X amino acid mutation.

76. The method of claim 54, wherein the identifying step further comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SC02, Cox 10, and Cox 15 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of cytochrome c oxidase deficiency in the subject.

77. The method of claim 54, wherein the identifying step further comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of cytochrome c oxidase deficiency in the subject.

78. The method of claim 54, wherein the identifying step further comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of cytochrome c oxidase deficiency in the subject.

79. The method of claim 54, wherein the identifying step further comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of cytochrome c oxidase deficiency in the subject.

80. The method of claim 54, wherein the identifying step further comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of cytochrome c oxidase deficiency in the subject.

81. The method of any one of claims 54-79, wherein the alternative oxidase protein is derived from an organism from the Eurkaya kingdom.

82. The method of claim 80, wherein the alternative oxidase protein is derived from an organism from a phylum selected from the group consisting of Mollusca, Nematoda and Chordata.

83. The method of claim 80, wherein the alternative oxidase protein is derived from an organism from family Cionidae.

84. The method of claim 82, wherein the alternative oxidase protein is derived from Ciona intestinalis .

85. The method of claim 54, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 75% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

86. The method of claim 54, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 95% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

87. The method of claim 54, wherein the isolated nucleic acid encodes a polypeptide comprising the amino acid sequence SEQ ID NO: 2.

88. The method of any one of claims 83-85, wherein the polypeptide further comprises an epitope tag.

89. The method of claim 54, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal, or protist origin.

90. The method of claim 54, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of vertebrate origin and an amino acid of a polypeptide with alternative oxidase activity of invertebrate origin.

91. The method of claim 88, wherein the polypeptide with alternative oxidase activity is from a chordate species of invertebrate.

92. The method of claim 88, wherein the mitochondrial transit peptide is of mammalian origin.

93. The method of any one of claims 54-90, wherein the polynucleotide comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell.

94. The method of claim 91 , wherein the polynucleotide is operably linked to an expression control sequence.

95. The method of claim 91 , wherein the promoter is of mammalian origin.

96. The method of claim 91 , wherein the promoter is a promoter of a nuclear gene that encodes a mitochondrial protein.

97. The method of any one of claims 54-93, wherein the polynucleotide is administered by administering a vector that comprises the polynucleotide.

98. The method of claim 95, wherein the vector is selected from the group consisting of replication deficient adenoviral vectors, adeno-associated viral vectors, and lenti virus vectors.

99. The method of claim 54, wherein the polynucleotide is administered locally to a tissue or an organ comprising cells affected by metabolic acidosis or oxidative stress.

100. The method of claim 54, wherein the polynucleotide is administered systemically.

101. A method of treating a disorder associated with mitochrondrial OXPHOS dysfunction comprising

(a) screening a biological sample from a subject suspected of having a disorder associated with mitochondrial OXPHOS dysfunction subject for a mutation that correlated with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10, and Coxl5; (b) administering to the subject a therapeutic selected from the group consisting of

(i) a polynucleotide that encodes an alternative oxidase protein; and

(ii) a cell transformed or transfected with a polynucleotide that encodes an alternative oxidase protein.

102. The method of claim 99, wherein the subject is identified as a subject at risk because the subject has a relative that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

103. The method of claim 99, wherein the subject is identified as a subject at risk because the subject has a sibling that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

104. The method of claim 99, wherein the subject is identified as a subject at risk because the subject has a common genetic parent that has been diagnosed with a disorder associated with mitochondrial OXPHOS dysfunction.

105. The method of any one of claims 99- 102, wherein the disorder associated with mitochondrial OXPHOS dysfunction is selected from the group consisting of Leigh syndrome; MERRF syndrome; Parkinson's Disease; mitochondrial encephalomyopathies; progressive external ophthalmoplegia, Kearns-Sayre syndrome; MELAS syndrome; amyotrophic lateral sclerosis, Alzheimer's disease, Friedreich ataxia; syndromic mitochondrial hearing impairment; nonsyndromic mitochondrial hearing impairment; intractable obesity; NARP syndrome; Alpers-Huttenlocher disease; sensorineural deafness; benign infantile myopathy; fatal infantile myopathy; pediatric myopathy; adult myopathy; Rhabdmyolysis; Leber Hereditary Optic Neuropathy; cardiomyopathy; Barth syndrome; Fanconi syndrome; mtDNA depletion syndrome; Pearson syndrome; and Lactic acidemia.

106. The method of any one of claims 99-103, wherein the identifying step comprises screening for the presence of a mutation in a gene selected form the group consisting of Surf 1, SCOl, SC02, Cox 10, and Cox 15 of the subject, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

107. The method of claim 104, wherein the screening comprises obtaining a biological sample from the subject and analyzing nucleic acid from the sample for the presence of a mutation in the nucleic acid that correlates with or causes reduced function of at least one gene selected from the group consisting of Surfl, SCOl, SCO2, CoxlO, and Coxl5, wherein the presence of the mutation in the gene indicates that the subject is at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

108. The method of claim 105, wherein the nucleic acid is mitochondrial DNA (mtDNA).

109. The method of claim 99, wherein the gene is CoxlO.

110. The method of claim 107, wherein the method comprises screening for a missense mutation causing a CoxlO gene mutation selected from the group consisting of C791A, C878T, G708A, A903G, A1211T and A1211G.

111. The method of claim 107, wherein the method comprises screening for a missense mutation causing a CoxlO amino acid mutation selected from the group consisting of T196K, P225L, D336V and D336G.

112. The method of claim 99, wherein the gene is SCOl.

113. The method of claim 110, wherein the method comprises screening for a missense mutation causing a SCOl gene C520T mutation.

114. The method of claim 110, wherein the method comprises screening for a missense mutation causing a SCOl P174L amino acid mutation.

115. The method of claim 99, wherein the gene is SCO2.

116. The method of claim 113, wherein the method comprises screening for a missense mutation causing a SCO2 amino acid mutation selected from the group consisting of E 140K, R90X, and Rl 7 IW.

117. The method of claim 99, wherein the gene is Coxl5.

118. The method of claim 115, wherein the method comprises screening for a missense mutation causing a Cox 15 gene mutation selected from the group consisting of C700T and Tl 171C.

119. The method of claim 115, wherein the method comprises screening for a missense mutation causing a Cox 15 amino acid mutation selected from the group consisting of R217W and F374L.

120. The method of claim 99, wherein the gene is Surfl .

121. The method of claim 118, wherein the method comprises screening for a missense mutation causing a Surfl gene mutation selected from the group consisting of T280C, C574T and C688T.

122. The method of claim 118, wherein method comprising screening for a missense mutation causing a Surfl Q82X amino acid mutation.

123. The method of claim 99, wherein the identifying step further comprises measuring a level of activity of a protein selected from the group consisting of Surfl, SCOl, SCO2, Cox 10, and Cox 15 in a biological sample of the subject, wherein a reduced level of activity of the protein is indicative of mitochondrial OXPHOS dysfunction in the subject.

124. The method of claim 99, wherein the identifying step further comprises measuring a level of cellular ATP in a biological sample of the subject, wherein a decreased level of ATP in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

125. The method of claim 99, wherein the identifying step further comprises measuring a level of cellular ADP in a biological sample of the subject, wherein an increased level of ADP in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

126. The method of claim 99, wherein the identifying step further comprises measuring a level of serum lactate in a biological sample of the subject, wherein an increased level of lactate in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

127. The method of claim 99, wherein the identifying step further comprises measuring activity of cytochrome c oxidase in a biological sample of the subject by enzymatic assay, wherein a reduced level of cytochrome c oxidase activity in the sample is indicative of mitochondrial OXPHOS dysfunction in the subject.

128. The method of any one of claims 99- 125 , wherein the alternative oxidase protein is derived from an organism from the Eurkaya kingdom.

129. The method of claim 126, wherein the alternative oxidase protein is derived from an organism from a phylum selected from the group consisting of Mollusca, Nematoda and Chordata.

130. The method of claim 127, wherein the alternative oxidase protein is derived from an organism from family Cionidae.

131. The method of claim 128, wherein the alternative oxidase protein is derived from dona intestinalis .

132. The method of claim 99, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 75% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

133. The method of claim 99, wherein the polynucleotide comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence at least 95% identical to an amino acid sequence selected from the group consisting of

(a) SEQ ID NO: 2; and

(b) fragments of (a) that have alternative oxidase activity; wherein the polypeptide has alternative oxidase activity.

134. The method of claim 99, wherein the isolated nucleic acid encodes a polypeptide comprising the amino acid sequence SEQ ID NO: 2.

135. The method of any one of claims 130-132, wherein the polypeptide further comprises an epitope tag.

136. The method of claim 99, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of animal origin fused to an amino acid sequence of a polypeptide with alternative oxidase activity of plant, fungal, or protist origin.

137. The method of claim 99, wherein the polynucleotide comprises a nucleotide sequence that encodes a chimeric polypeptide that comprises an amino acid sequence of a mitochondrial transit peptide of vertebrate origin and an amino acid of a polypeptide with alternative oxidase activity of invertebrate origin.

138. The method of claim 99, wherein the polypeptide with alternative oxidase activity is from a chordate species of invertebrate.

139. The method of claim 99, wherein the mitochondrial transit peptide is of mammalian origin.

140. The method of any one of claims 99-137, wherein the polynucleotide comprises a promoter sequence that promotes expression of the polynucleotide in a mammalian cell.

141. The method of claim 138, wherein the polynucleotide is operably linked to an expression control sequence.

142 The method of claim 138, wherein the promoter is of mammalian origin.

143. The method of claim 138, wherein the promoter is a promoter of a nuclear gene that encodes a mitochondrial protein.

144. The method of any one of claims 99-141, wherein the polynucleotide is administered by administering a vector that comprises the polynucleotide.

145. The method of claim 142, wherein the vector is selected from the group consisting of replication deficient adenoviral vectors, adeno-associated viral vectors, and lenti virus vectors.

146. The method of claim 99, wherein the polynucleotide is administered locally to a tissue or an organ comprising cells affected by metabolic acidosis or oxidative stress.

147. The method of claim 99, wherein the polynucleotide is administered systemically.

148. A therapeutic or prophylactic method for treating a disorder associated with mitochondrial OXPHOS dysfunction in a subject comprising

(a) identifying a subject at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction;

(b) transforming or trans fecting cells from the subject ex vivo with a polynucleotide that encodes an alternative oxidase; and

(c) administering the transformed or transfected cells to the subject.

149. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

150. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction.

151. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, wherein the subject has a missense mutation that correlates with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10 and Coxl5.

152. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for prophylaxis therapy for a subject identified as being at risk for developing a disorder associated with mitochondrial OXPHOS dysfunction, wherein the subject has a missense mutation that correlates with or causes reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10 and Coxl5.

153. Use of a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for treatment of a subject identified as having a disorder associated with mitochondrial OSPHOS dysfunction, wherein the subject has a missense mutation that results in reduced function of a gene selected from the group consisting of Surfl, SCOl, SCO2, Cox 10 and Cox 15

154. Use of a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes an alternative oxidase protein in the manufacture of a medicament for treatment of a subject identified as having a disorder associated with mitochondrial OSPHOS dysfunction, wherein the subject has a missense mutation that results in reduced function of a gene selected from the group consisting of Surfl, SCOl, SC02, Cox 10 and Coxl5.