WO2007043638A1

WO2007043638A1 - Condensed heterocyclic compound

Info

Publication number: WO2007043638A1
Application number: PCT/JP2006/320434
Authority: WO
Inventors: Masahiko Hayakawa; Takahiro Nigawara; Kazuyuki Tsuchiya; Akira Nagayoshi; Takeshi Hondo
Original assignee: Astellas Pharma Inc.
Priority date: 2005-10-14
Filing date: 2006-10-13
Publication date: 2007-04-19
Also published as: JP2009013065A

Abstract

It is intended to provide a compound useful as a GK activator. The inventors made intensive studies of a condensed heterocycle and as a result, they found that a compound characterized in that it has a group represented by -X-B and a carbamoyl group on the benzene ring of a condensed heterocycle, and to the nitrogen atom of the carbamoyl group, a pyridyl, pyrazinyl or thiazolyl group which may be substituted with a specific substituent is attached has a favorable GK activating action, and thus the invention has been completed. Because the compound of the invention has a favorable GK activating action, it is useful as a therapeutic agent for diabetes, particularly type II diabetes.

Description

Specification

Condensed heterocyclic compounds

Technical field

[0001] The present invention relates to a novel condensed heterocyclic compound useful as a pharmaceutical, particularly as a therapeutic agent for diabetes.

Background art

[0002] GK (Dalcokinase (ATP: D-hexose 6-phosphotransferase, EC2.7.1.1)) is an enzyme that phosphorylates 6-carbon sugars expressed in the spleen and liver. It has been. This enzyme belongs to the hexokinase family and is also known as hexokinase IV. Compared to other hexokinases, GK has 1) low affinity for glucose as a substrate and a Km value close to blood glucose concentration, 2) no inhibition by enzymatic reaction product glucose 6-phosphate, 3 ) It has characteristics such as 50 kDa, which is about half the molecular weight.

The human dalcokinase gene is located on chromosome 7 pl3 as a single gene, and is controlled by different tissue-specific promoters separated by 30 kb or more in spleen | 8 cells and hepatocytes, and uses different first exons. Power The remaining Eksons 2-10 are common. Therefore, the spleen-type and liver-type GK proteins differ only in the N-terminal 15 residues.

[0003] As blood glucose level rises, the glucose concentration in spleen j8 cells quickly reaches equilibrium via GLUT2, a sugar transporter, and GK senses changes in intracellular glucose concentration and activates glycolysis. Turn into. As a result, the ATP / ADP ratio in the spleen β-cells increased and the Κ channel closed,

ΑΤΡ

This is detected by voltage-dependent Ca channels, and the intracellular calcium concentration increases and insulin is released. That is, GK acts as a glucose sensor in spleen j8 cells and plays an important role in the control of insulin secretion. Even in the liver, GK acts as a glucose sensor, reacting to an increase in blood glucose level and converting glucose to glucose 6-phosphate. As a result, production of glycogen increases, glycolysis is activated, and gluconeogenesis in the liver is suppressed.

Hyperglycemia occurs frequently in patients with impaired glucose phosphate due to GK gene mutations, and juvenile diabetes develops (MODY2). On the other hand, Km value of GK activity by gene mutation In patients with low values, hypoglycemia is observed after meals and on an empty stomach. That is, even in humans, GK acts as a glucose sensor and plays an important role in maintaining normal glucose levels in the blood. Based on these facts, drugs that activate GK enhance glucose-dependent insulin secretion from spleen j8 cells, correct postprandial hyperglycemia, and suppress the release of sugar from the liver. Expected to be a treatment for diabetes. Furthermore, glucose uptake into the liver is promoted in the hyperglycemic state after meals, and excess insulin secretion does not occur, and there is a possibility that knee fatigue, which has been a problem with conventional sulfo-lurea (SU) agents, can be avoided. Recently, it has been reported that culturing mouse spleen cells (MIN6N8) under high glucose induces apoptosis. Furthermore, when dalcokinase was overexpressed in these cells, apoptosis of MIN6N8 cells was suppressed (Diabetes 54: 2 2602 -2611 (2005). GK activator is expected to show a spleen protective action.

GK, which exists in the brain, is a spleen type and is highly expressed in the nerve of VMH (Ventromedial hypothalamus), the feeding center. Glucose-sensitive nerves are classified into GE (Glucose Exited) -neurons that are excitable to dalcose and GI (Glucose Inhibited) -neurons that are inhibitory to glucose. GK mRNA and protein are present in about 70% of GE-neurons and in about 40% of GI-neurons.

In these glucose-sensitive neurons, GK senses an increase in intracellular glucose, activates the glycolysis, and increases the intracellular ATP / ADP ratio. As a result, GE-neuron

ATP

Yannel closes-Euron action potential frequency increases and neurotransmitters are released. On the other hand, GI-neuron is thought to involve the C1-channel. In rats with increased GK mRNA expression in VMH, the compensation for glucose deficiency is reduced.

Glucose-sensitive nerves also have receptors for levtin and insulin that are involved in feeding behavior. In GE-neurons under high glucose conditions, leptin and insulin open K channels and reduce action potential frequency. In addition to the ARC

ATP

NPY (Neuroeptide Y)-neuron, which acts to increase appetite, is inhibitory to glucose, and POMC (Proopiomelanocortin)-neuron, which works to suppress appetite, is excitatory to glucose (Diabetes 53: 2521-2528 (2004)) . From these facts, the central GK can be activated. And is expected to be effective in the treatment of obesity and metabolic syndrome.

[0005] Although a large number of compounds having GK activity have been reported, there has been no report of a compound that has been confirmed to be clinically effective so far. In addition, a novel GK activator having a good profile is eagerly desired for reducing various side effects (effects on hERG and CYP) and solubility.

The following benzofuran derivatives having GK activity have been reported (for example, Patent Document 1).

[Chemical 1]

Wherein A is substituted with a selected group of halogen, carboxy and C alkyl forces.

1-4

May represent pyridine-2-yl or thiazol-2-yl, wherein R ³ represents halogen,

C alkyl, C alkoxy, mono- or dialkylamino-containing hetero ring, hydrocarbon ring-0

1-4 1-4

Optionally substituted with heterocyclic-0 or carbocyclidur, C alkyl, C

1-4 1-4 Alkoxy, hydrocarbon ring, heterocycle, hydrocarbon ring-0 or heterocycle-0. For others, see the publication. )

[0006] Patent Document 1: International Publication WO2004 / 046139 Pamphlet

Disclosure of the invention

Problems to be solved by the invention

[0007] An object of the present invention is to provide a novel compound useful as a pharmaceutical having GK activity and particularly as a therapeutic agent for diabetes.

Means for solving the problem

[0008] As a result of intensive studies on the condensed heterocyclic compounds, the present inventors have a group represented by -XB and a force rubamoyl group on the benzene ring of the condensed heterocyclic ring, and the nitrogen atom of the carbamoyl group has Is pyridyl, birazinyl or thio which may be substituted with a specific substituent. It was confirmed that a compound characterized by binding an azolyl group has a good GK activity, and the present invention was completed.

That is, the present invention relates to a condensed heterocyclic compound represented by the general formula (I) or a salt thereof.

[Chemical 2]

(The symbols in the formula have the following meanings.

A: S, 0 or N (R ⁵ ),

X: 0, S ゝ SO or SO,

2

B: -R °, -Lower alkell, -R °° -CN, -R °° -C0N (R ^G ), -R °° -0- ^RG , -R °° -N (R ^G ) CO-R.

2

, -Y- (optionally substituted aryl), -Y- (optionally substituted heterocycle) or -Y- (substituted, optionally cycloalkyl),

Υ: a single bond, optionally substituted lower alkylene, -R. . -0- R. . -,-R. . -CON (R ^G )-,-R

^{°° - N (R G) CO-} , - ( substituted, even by lower alkylene) - CON (R ^G) - or - (substituted

V, may be lower alkylene) -N (R ^G ) CO-,

R °: the same or different from each other, lower alkyl,

R °°: the same or different from each other, lower alkylene,

R ^G : the same or different from each other, H or R °,

D: thiazole, pyridine or virazine,

R ¹ and R ² : the same or different from each other and the following (0 or (ii) force is also selected,

(0:-CH (0R ^A )-R ^B ,-C (R °) (0R ^A )-R ^B ,-CO- CO- NR ^C R ^D ,-CO- CO- NR ^C -0R ^D ,-C (0 R ^E ) (0R ^F )-R ^B ,-C (0R ^E ) (0R ^F )-R °, -CH (0R ^E ) -CH (0R ^F ) -R ^C and / or-CH (0R ^E ) -CH (0R ^F ) -R ^B ,

(ii): — H ゝ -halogen, -CO H, -CO R. , -NO, -CN, -R. , -Lower alkenyl, CO-C

2 2 2

0 H, -C0-C0-0R °, -halogeno lower alkyl and / or -lower alkylene -NR ^C R ^D ,

2

R ^A : the same or different, -H, -R °, -halogeno lower alkyl or -R °° -aryl, R ^B : -CO H, -CO R °, -CO-NR ^C R ^D , -CO-NR ^C -OR ^D , -R °° -NR ^C R ^D , -R °° -OR ^A , -R. ⁰ -C

twenty two

OR °, -lower alkylene-CO-NR ^C R ^D or -R °° -CO-Nl-OR ^D ,

2

R ^C and R ^D : the same or different from each other,-H,-R °,-R °° -N (R ^A ),-R °° -0R ^A ,-R °° -C0 H

twenty two

, — R °° — C〇 R ° or — R °° — C〇— N (R ^A ),

twenty two

R ^E and: the same or different from each other, the group described in R ^A , or R ^E and R ^F are in the form of R ⁰⁰ ,

R ³ and R ^4: same or different from each other, - H, - halogen, - R °, - the halogeno-lower alkyl or - R ⁰⁰ - 0H,

R ⁵ : -H, -R °, -halogeno lower alkyl,-(optionally substituted aryl) or -R °°-(substituted, optionally aryl).

However, when A is 0, B represents an aryl substituted with at least one -SO R °. )

2

[0009] Further, the present application also relates to a pharmaceutical comprising the condensed heterocyclic compound represented by the general formula (I) or a salt thereof as an active ingredient, particularly a GK activator and a therapeutic agent for diabetes.

The present application further relates to the use of the condensed heterocyclic compound represented by the general formula (I) or a salt thereof for the manufacture of a therapeutic agent for diabetes and a method for treating diabetes.

The invention's effect

[0010] Since the compound of the present invention has a GK activation action, it is useful as a therapeutic and prophylactic agent for diabetes, particularly type 2 diabetes. It is also useful for the treatment and prevention of diabetic complications such as nephropathy, retinopathy, neuropathy, peripheral circulatory disorder, cerebrovascular disorder, ischemic heart disease, and arteriosclerosis. Furthermore, by suppressing overeating, it is useful as a therapeutic and prophylactic agent for obesity and metabolic syndrome.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

In the present specification, “alkyl”, “alkylene” and “alkyl” mean a linear or branched hydrocarbon chain. “Lower alkyl” is a C 1-6 (hereinafter referred to as C) alkyl.

1-6 alkyl groups, preferably methyl, ethyl, n-propyl, 2-propyl, hexyl and the like. “Lower alkylene” means a divalent group formed by removing any one hydrogen atom of the above “lower alkyl”, preferably C alkylene, more preferably methylene, ethyl. Len, methylmethylene and propylene. A “lower alkali” is a C alkali having one or more double bonds, preferably a C alkaline, and more preferably.

2-6 2-4

And vinyl, 1-propenyl and aryl.

“Halogen” is F, Cl, Br and I. “Halogeno lower alkyl” means C alkyl substituted with one or more (preferably 1-5, more preferably 1-3) halogens.

1-6

C alkyl substituted with one or more F, more preferably 1 to 3

1-6

C alkyl substituted with F, even more preferably, fluoromethyl, difluoro

1-6

Lomethyl, trifluoromethyl and trifluoroethyl.

[0012] "Cycloalkyl" is a C cycloalkyl, which forms a bridged ring such as adamantyl.

3-10

But, okay. Preferably the same cycloalkyl, more preferably cyclopropyl.

3-7

, Cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl. A “cycloalkyl” is a C ring group having 1 or 2 double bonds. "Areel" is C

3-7 6- aromatic hydrocarbon group, phenyl group fused with “cycloalkenyl”, for example

14

Contains indul, tetrahydronaphthyl and fluorenyl groups. Preferred are a file and naphthyl, and more preferred is a file.

The “hydrocarbon ring” includes the above “cycloalkyl”, “cycloalkenyl” and “aryl”.

A “heterocyclic group” is a 3- to 7-membered monocyclic or bicyclic heterocyclic group containing 1 to 4 heteroatoms selected from 0, S and N forces, and a saturated ring , Aromatic rings, and partially hydrogenated ring groups thereof. For example, pyridyl, pyrazinyl, pyrimidyl, pyridazil, imidazolyl, benzoimidazolyl, benzofural, benzochel, benzothiadiazolinole, benzothiazolinol, benzoisothiazolinole, benzoxiaxazolyl, benzoiso Oxazolyl, pyrrolyl, pyrrolidinyl, chenyl, furyl, dioxanyl, dioxolanyl, triazinyl, triazolyl, thiazolyl, thiadiazolyl, oxadiazolyl, pyrazolyl, virazolidinyl, isothiazolyl, oxazolyl, isoxazolyl, quinolyl, isoquinolyl, tetraquinolyl, tetraquinolyl , Quinazolinyl, quinoxalinyl, phthalazinyl, piperidyl, piperazinyl, azepanyl, diazepanyl, tetrahydrofuranyl, tetrahydrovilla Le, morpholinyl, methylenedioxy O carboxymethyl-phenylalanine, E Tylene dioxyphenyl, trithianyl, indolyl, isoindolyl, indolyl, indazolyl, tetrahydrobenzimidazolyl, chromal, chromol (4-oxo-4H-1-benzoyl), benzo And imidazolazol, chenovirazolyl and (2,3-dihydro-2-oxobenzoimidazolyl). Preferred is 5- to 6-membered monocyclic heteroaryl, more preferred is furyl, chael, imidazolyl, thiazolyl, or pyridyl.

“Optionally substituted” means “unsubstituted” or “having 1 to 5 substituents which are the same or different”. In the case of having a plurality of substituents, these substituents may be the same or different from each other! /, May! /.

Substituents in “substituted and optionally aryl”, “substituted and optionally heterocyclic” and “optionally substituted cycloalkyl” are preferably —R °, halogeno lower alkyl Kill, halogen, -OH, -R °° -OH, -N, -OR °, -R °° -OR °, -O-hydrocarbon ring, -O-hete

Three

Mouth ring, -CN, -NO, -CHO, -CO H, -CO R °, -R °° -CO H, -R °° -CO R °, -CO-R °, -C

2 2 2 2 2

O-hydrocarbon ring, -CO-heterocycle, -CO-NH, -CO-NH-R °, -CO-N (R °), -CO-N (R ^G )

twenty two

-R °°-OR ^G ,-CO- N (R °)-R °°-N (R ^G ),-CO- NR ^G -hydrocarbon ring,-CO- NR ^G -heterocycle,-

2

CO-N (R ^G )-R. . -Heterocycle, -NHCO-R °, -N (R °) CO-R °, -NHCO-hydrocarbon ring, -NHC O-heterocycle, -SH, -SR °, -S-hydrocarbon ring,- S-heterocycle, -SO- R °, -SO-hydrocarbon ring, -SO-heterocycle, -SO R °, -SO -hydrocarbon ring, -SO -heterocycle, -SO H, -SO NH, -S

2 2 2 3 2 2

O NH- R °, -SO N (R °), -SO NH-hydrocarbon ring, -SO NH-heterocycle, -NHSO-R °, -N (

2 2 2 2 2 2

R °) -SO-R °, -NHSO -hydrocarbon ring, -NHSO -heterocycle, more preferably -R °,

2 2 2

Halogeno lower alkyl, halogen,-. H,-R °° -〇H, -N, -OR °,-R °° -〇R °, -〇-carbonized

Three

Hydrogen ring, 〇-heterocycle, CN, -NO, -CH〇, -CO H, -CO R °,-R °°-CO H,-R °°-C

2 2 2 2

〇 R °,-C〇- R °,-C〇-hydrocarbon ring,-C〇-heterocycle,-C〇-NH, -C〇-NH-R °,-C〇-

twenty two

N (R °), -C〇-NH-hydrocarbon ring, -C〇-NH-heterocycle, -NHCO-R °, -N (R °) C〇-R °, -N

2

HC0-hydrocarbon ring, -NHCO-heterocycle, -SH, -SR ^G , -S-hydrocarbon ring, -S-heterocycle, -S0- ^RG , -S0-hydrocarbon ring, -SO -Heterocycle, -SO R ^G , -SO -hydrocarbon ring, -SO -hete

2 2 2 Neck, -SO H, -SO NH, -SO NH- R °, -SO N (R °), -SO NH-hydrocarbon ring, -SO NH-

3 2 2 2 2 2 2 2 heterocycle, -NHSO-R °, -N (R °) -SO-R °, -NHSO -hydrocarbon ring, -NHSO -heterocycle

2 2 2 2

Wherein the “hydrocarbon ring” and the “heterocycle” include 1 to 5 —R ^Q , halogeno Alkyl, halogen, -OH, -OR ° and -N (R ^G ) forces optionally substituted with selected groups

2

Preferably 1 to 5 -R °, halogeno lower alkyl, halogen, -OH and -OR. May be substituted with a group selected from:

Further, the substituent in the "optionally substituted lower alkylene" - R ° or - R °° - OR ^G are preferred.

Preferred embodiments of the present invention are shown below.

(1) A is preferably S or N (R ⁵ ). Here, R ⁵ is preferably H, lower alkyl or substituted phenyl, more preferably C alkyl or 4-alkyl at C alkyl-SO.

1-4 1-2 2

The file is replaced with-.

(2) X is preferably 0.

(3) B is preferably substituted with 1 or 2 substituents !, may! /,

More preferably, at least one is a phenyl having a substituent at the 4-position, and more preferably a phenyl having one substituent at the 4-position. Here, the optionally substituted “aryl”, “heteroaryl” or “cycloalkyl” in B is preferably a halogeno lower alkyl, halogen, —OR ⁰ , —CN, —NO, -CHO, -CO H, -CO

2 2 2

R °, -CO-R °, -CO-hydrocarbon ring, -CO-heterocycle, -SO R °, -SO -hydrocarbon ring or -S

twenty two

0-heterocycle, more preferably halogeno lower alkyl, halogen, -NO, -CO-R °,

twenty two

-CO- hydrocarbon ring, -CO- heterocyclic or - SO R ^Q, more preferably - SO - methyl also

2 2 is -so-ethyl, and more preferably -so-methyl.

twenty two

(4) D is thiazole (ie thiazol-2-yl), pyridine (ie 2-pyridyl) or virazine (ie pyrazine-2-) which is bonded to the nitrogen atom of the amide group at the 2-position. It is).

(5) R ¹ and R ² are preferably both H; another preferred embodiment of R ¹ and R ² is preferably as follows: one is H and the other is (0 and GO force selected A group other than H, more preferably R ¹ is H and R ² is a group other than H (0 and (ii) force selected, where

(0 is -CH (OR ^A )-R ^B ,-CO- CO- NR ^C R ^D ,-CO- CO- NR ^C -OR ^D ,-C (OR ^E ) (OR ^F )-R ^B ,- C (OR ^E ) (OR ^F ) -R °, -CH (OR ^E ) -CH (OR ^F ) -R ^C and / or -CH (OR ^E ) -CH (OR ^F ) -R ^B , ( ii) are: -H ハロゲン -halogen, -CO H, -CO R °, -NO, -CN ゝ-R °, -lower alkali, -CO- CO H, -CO-CO-OR °, -halogeno lower alkyl and / or -lower alkylene -NR ^D

2

It is.

(Groups in which 0 and GO force are also selected are preferably -CO H, -CO R °, -CH (OR ^A )-R ^B ,-C

twenty two

^{^{O- CO- NR C R D, -}} C (OR E) (OR F) - R B, - C (OR E) (OR F) - R. Or -CH (OR ^E )-CH (OR ^F )-R ^C , more preferably ί—CH (OH) —CH OH, —CH (OR °) -CH OH, —CH (OR °) —CH OR ⁰ , — C

2 2 2

H (OH) -CO H, -CH (OR °) -CO H, -CH (OH) -CO R. , -CH (OR °) -COR. Or -CO- C

2 2 2 2

O—NR ^C R ^D , more preferably ί—CH (OH) —CH OH, —CH (OR °) —CH OH, —CH (OR.) —

twenty two

CH OR °, —CH (OH) —CO R °, —CH (OR °) —CO R °, —CO—CO—NH, —CO—CO—NH—R ⁰ ,

2 2 2 2

-CO-CO-N (R °), -CO-CO-NH-lower alkylene-O-R °, or -CO-CO-NH-lower

2

Lucylene-OH.

(6) R ³ and R ⁴ are preferably H or R °.

As another preferred embodiment, a compound comprising a combination of each preferred group described in the above (1) to (6) is preferred. That is,

(7) B is R °,-(optionally substituted aryl) or -R °°-(optionally substituted aryl), and R ¹ and R ² are the same or different from each other. The compound according to (5), which is a group selected from (0 or GO).

(8) The compound of (7) above, wherein X is 0.

(9) The compound of ( ⁷ ) or ( ⁸ ) above, wherein R ¹ and R ² are H.

(10) R ¹ is H, R ² CH (OH) -CH OH, -CH (OR °) -CH OH, -CH (OR.)-CH OR.

2 2 2

, —CH (OH) —CO R. , -CH (OR °) -COR. , —CO—CO—NH, —CO—CO—NH—R. , — CO— C

2 2 2

O-N (R °), -CO-CO-NH-lower alkylene-O-R °, or -CO-CO-NH-lower alkyle

2

The compound of (7) or (8) above, which is N-OH.

The compound of the present invention may have other tautomers and geometric isomers depending on the type of substituent. In the present specification, only one form of these isomers may be described, but the present invention includes these isomers, and also includes a separated isomer or a mixture thereof.

In addition, compound (I) may have asymmetric carbon atoms or axial asymmetry, and optical isomers such as (R) and (S) isomers may exist based on this. The present invention is a mixture of these optical isomers or a simple one. Includes everything that has been released.

Furthermore, the present invention includes pharmacologically acceptable prodrugs of Compound (I). A pharmacologically acceptable prodrug is a compound having a group that can be converted into an amino group, —OH, —CO 2 H, etc. of the present invention by solvolysis or under physiological conditions. Prodrug

2

Examples of the group to be formed include groups described in Prog. Med., 5, 2157-2161 (1985) and “Drug Development” (Yodogawa Shoten, 1990), No. 7 Molecular Design 163-198.

[0017] Furthermore, the compound of the present invention may form a salt with a base depending on the type of the acid addition salt or the substituent, and the present invention is not limited as long as the earning salt is a pharmaceutically acceptable salt. Is included. Specifically, inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid Acid, lactic acid, malic acid, tartaric acid, citrate, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, aspartic acid, acid addition salts with organic acids such as glutamic acid, sodium, potassium, magnesium, calcium, aluminum Inorganic bases such as methylamine, ethylamine, ethanolamine, lysine, and ortho salts, and ammonium salts.

The present invention also includes various hydrates and solvates of the compound of the present invention and pharmaceutically acceptable salts thereof, and substances having crystalline polymorphs.

[0018] (Production method)

The compound of the present invention and a pharmaceutically acceptable salt thereof can be produced by applying various known synthetic methods utilizing characteristics based on the basic skeleton or the type of substituent. At that time, depending on the type of functional group, it is effective in terms of manufacturing technology to replace the functional group with an appropriate protecting group (a group that can be easily converted into the functional group) at the raw material or intermediate stage. There is a case. Examples of such functional groups include amino groups, hydroxyl groups, and carboxyl groups, and examples of their protecting groups include Greene and Wuts, “Protective Groups in Organic Synthesis (3rd edition, 1999). And the like, and these may be appropriately selected and used according to the reaction conditions. In such a method, after carrying out the reaction by introducing the protecting group, the desired compound can be obtained by removing the protecting group as necessary. Similarly to the above protecting group, the prodrug of compound (I) can be produced by introducing a specific group at the raw material or intermediate stage, or reacting with the obtained compound (I). The reaction can be carried out by applying a method known by those skilled in the art, such as ordinary esterification, amidation, dehydration and the like.

Hereafter, the typical manufacturing method of this invention compound is demonstrated. The production method of the present invention is not limited to the examples shown below!

First manufacturing method

[Chemical 3]

(In the formula, L represents a leaving group or OH. The same shall apply hereinafter.)

This production method is a method for obtaining the compound of the present invention represented by the formula (I) by subjecting the carboxylic acid derivative (II) and the amino compound (III) to an amidy reaction. Examples of the leaving group for L include an organic sulfonic acid group such as methanesulfonyloxy or P-toluenesulfo-oxy, halogen, and the like. Alternatively, various acid anhydrides can be used as (II).

When L is a hydroxyl group, Ν, Ν'-dicyclohexylcarbodiimide (DCC), 1-ethyl-3- (3'-dimethylaminopropyl) carbodiimide (WSC), 1,1'-carbodidiimidazole ( CDI), diphenylphosphoryl azide (DPPA), phosphorus oxychloride / pyridine, triphenylphosphine / Ν-promosuccinimide and other condensing agents can be used. (For example, Ν-hydroxysuccinimide (HONSu), 1-hydroxybenzotriazole (HOBt), etc.) can be used. Further, in some cases, polystyrene resin carrying an isocyanate for the purpose of removing excess amine after completion of the reaction, such as PS-isocyanate (manufactured by Argonaut), PL-isocyanate resin (PL-isocyanate). NCO Resin) (Polymer Laboratories, UK) is preferably used. Further, for the purpose of removing excess carboxylic acid after the completion of the reaction, the above-mentioned additives, etc., polystyrene resin supporting quaternary ammonium salt, for example, MP-force MP-Carbonate (manufactured by Biotage) or polystyrene-terminated resin loaded with amine, such as PS-Trisamine (manufactured by Biotage), PL-DETA Resin Resin (PL-DETA Resin) ) (Polymer Laboratories, UK) may be preferred.

When L is a leaving group, the reaction may be carried out in the presence of an inorganic base such as sodium carbonate, potassium carbonate, sodium hydrogen carbonate, potassium hydrogen carbonate, or an organic base such as triethylamine, diisopropylethylamine, pyridine. It may be preferable.

Solvents include aromatic hydrocarbons such as benzene, toluene and xylene, ethers such as jetyl ether, tetrahydrofuran (THF), dioxane, diglyme, 1,2-dimethoxyethane, 2-methoxydiethyl ether, dichloromethane, 1, Halogenated hydrocarbons such as 2-dichloroethane and chloroform, dimethylformamide (DMF), dimethylacetamide (DMA), acetonitrile, ethyl acetate, and other solvents inert to the reaction, or a mixture of two or more Can be used. Compound (II) and compound (III) are used in an equimolar to excess amount depending on the reaction and the compound.

Second manufacturing method

[Chemical 4]

Compound (la) can be produced by the etherification / thioether reaction of the corresponding alcohol or thiol compound (IV) with compound (V). As the same, halogen or P-toluenesulfoxy group is preferred. When B is 4-substituted phenol, F is preferred as the same. The reaction can be carried out in the presence of a base using DMF, DMA, N-methylpyrrolidone or the like as a solvent from room temperature under heating conditions.

Further, by subjecting the starting material compound (la) to a compound in which X ¹ is S in an acid reaction, a compound in which X ¹ is SO or SO can be obtained. [0021] The various substituents on the groups R ¹ and R ² or B in the formula (I) can be used as reactions starting from the compound (I) of the present invention, or modifications thereof. By using this method, it can be easily converted to other functional groups. For example, the steps that can be usually employed by those skilled in the art, such as alkylation, acylation, oxidation, reduction, hydrolysis, amidin, etc., can be carried out in any combination. For example, in the production of a compound having a hydroxyl group, a reduction reaction of ketone or ester, an oxidation reaction of olefin (such as osmium tetroxide), and the like can be appropriately selected in consideration of the structure of the compound. In addition, the carboxylic acid as a substituent on B can be converted to various amides.

(Raw material synthesis)

[0022] [Chemical 5]

(In the formula, P ¹ represents a protecting group for carboxylic acid such as lower alkyl. The same shall apply hereinafter.) The starting compound (lib) was etherified / thioether using Compound (VI) in the same manner as in the second production method described above. Next, a raw material compound (IXa) in which A force N (R ⁵ ) and R ⁵ is other than H can be produced by deprotecting the carboxylic acid in the following step: It can be manufactured by this method.

[0023] [Chemical 6]

(In the formula, P ² represents a hydroxyl-protecting group. The same shall apply hereinafter.)

Various alkylation conditions can be applied to the alkylation reaction of the compound (Vllb). Of the various alkylation conditions, an alkylating agent using (tributylphosphor-lidene) acetonitrile as a reactant in the presence of the corresponding alcohol may be effective. P ² is preferably a benzyl group!

In addition, the raw material compound (IX) in which X ¹ is 0 can be produced by the following method.

[Chemical 7]

(In the formula, P ³ represents a hydroxyl-protecting group. The same shall apply hereinafter.)

This synthesis can be performed according to the method described in J. Chem. Soc. (C), 3171-3173 (1971). That is, succinate is allowed to act on the benzaldehyde derivative (X) to give (XI), which is then subjected to a cyclization reaction in the presence of an acid anhydride to obtain a cyclized product (VIII). Thereafter, the raw material compound (IX) can be obtained by deprotection. P ³ A til group is preferred

[0025] [Chemical 8]

(In the formula, P ⁴ represents a hydroxyl-protecting group. The same shall apply hereinafter.)

The production method of the starting compound (IVa) is described below. Compound (XII) was obtained through protection of the hydroxyl group of compound (IX) and deprotection of carboxylic acid. Next, according to the amidation method of the first production method described above, a compound (XIII) is obtained by amidation with amin (III), and finally a raw material compound (IVa) is obtained by deprotection of the hydroxyl group. be able to. P ⁴ is preferably a methoxymethyl group.

[0026] The compound of the present invention is isolated and purified as a free compound, a pharmaceutically acceptable salt, hydrate, solvate, or crystalline polymorphic substance. The pharmaceutically acceptable salt of the compound (I) of the present invention can also be produced by subjecting it to a conventional salt formation reaction.

Isolation and purification are performed by applying ordinary chemical operations such as extraction, fractional crystallization, and various fractional chromatography.

Various isomers can be separated by selecting an appropriate raw material compound or by utilizing the difference in physical and physical properties between isomers. For example, optical isomers can be obtained by stereochemically pure isomers by general optical resolution methods (for example, fractional crystallization leading to diastereomeric salts with optically active bases or acids, chromatography using chiral columns, etc.). Can lead to. It can also be produced from a suitable optically active raw material compound.

[0027] The pharmacological activity of the compound of the present invention was confirmed by the following test. Test Example 1: Measurement of GK activation

The measurement of GK activation of the test drug was performed in accordance with the method described in Science 301: 370-373, 2003, with some modifications. GK activity is the change in absorbance due to NADPH directly produced by NADP (nicotinamide adenine dinucleotide phosphate) when glucose-6-phosphate is dehydrogenated by glucose-6-phosphate dehydrogenase. It was measured.

The recombinant human liver GK (GST-hGK2) used in this assay was expressed in E. coli as GST (Glutathi one S transferase) -fusion protein and purified with Glutathione Sepharose 7 fume.

The sequence of Glucokinase isoform 2 was based on AK122876.1 (accession number), and ORF (open reading frame) was cloned on the following Tagawa page. pME18S- FL3- Glu cokinase isoform 2 as a saddle, 5'— TAGAATTCATGGCGATGGATGTCACAAG— 3 ′ (SEQ ID NO: 1) as 5 ′ primer, 5′-ATCTCGAGTCACTGGCCCAGCATACAG-3-3 (SEQ ID NO: 2) as 3 ′ primer PCR (polimerase chain reaction) was performed, and the PCR product was TA-cloned into the pGEM-T easy vector. The sequence of this clone was confirmed by sequencing. Thereafter, the fragment cleaved with EcoRI and Xhol was ligated to the similarly cleaved vector pGE X-5X-1 to prepare pGEX-human Glucokinase 2.

The enzyme reaction was measured at 27 ° C using a 96-well flat bottom plate. 25 mM HEPES pH 7.4; 25 mM KC1; 2 mM MgCl; 1 mM ATP; 0.1% BSA; 1 mM DTT;

2

0.8 mM NADP; 2.5 U / ml glucose-6-phosphate dehydrogenase; GST-hGK2 (both are final concentrations. However, GST-hGK2 content is about 10% increase in absorbance (Δ OD) of absorbance for 10 minutes of DMSO control) Prepared). The enzyme mixture 891 was collected on the plate, and a test drug or DMSO control 11 dissolved in DMSO was added. Subsequently, 10 μl of glucose (final concentration 5 mM) was added as a substrate solution, and the reaction was started at 27 ° C. After the start of the reaction, the absorbance was measured every 30 seconds at a wavelength of 340 nM for 15 minutes, and the increase in absorbance (ΔOD) power of the first 10 minutes was calculated. As an index of GK activation of the test drug, the following formula force was also calculated as GK activation (%).

GK activation (%) = [(A OD)-(A OD)] / (A OD) X100 A OD: A OD in 10 tons of test drug

Test

Δ〇D: DMS〇 control Δ〇D

Cont

As a result of the above measurement, the compound of Example 2 showed 178% and the compound of Example 7 showed 158% GK activity.

[0028] Test Example 2: Blood glucose lowering effect in C57BL6 mice

The body weight of freely fed C57BL6 mice (N = 5) was measured. The test compound was dissolved in Cremophor (registered trademark) solvent (Cremophor: DMSO: Water 5: 5: 90, v / v / v). Mice were orally dosed with 10 ml / kg of drug solution or 10 ml / kg of solvent control. Approximately 60 1 blood was collected from the orbital venous plexus immediately before administration of the test compound. Blood was collected in the same manner 1 to 4 hours after administration of the test compound. The collected blood was separated from plasma, and the blood glucose level was measured. After administration of the test compound, the blood glucose level after 4 hours was compared with the blood glucose level of the solvent control group at the same time.

As a result of the above test, the compound of Example 2 showed 21.6% inhibition (30 mg / kg) of hypoglycemic action.

[0029] Test Example 3: Effects on hyperglycemia after oral glucose load in ICR mice

ICR mice (N = 5) were fasted overnight and then weighed. The test compound was dissolved in Cremophor solvent (Cremophor: DMSO: Water 5: 5: 90, v / v / v). Mice were orally dosed with 10 ml / kg of drug solution or 10 ml / kg of solvent control. Approximately 60 1 blood was collected from the orbital venous plexus immediately before administration of the test compound. 30 minutes after administration of the test compound, an aqueous solution of 200 mg / ml glucose was orally administered at 10 ml / kg (corresponding to 2 g / kg). Approximately 60 L of blood was collected from the orbital venous plexus just before glucose administration. Blood was collected in the same manner 0.5, 1, and 2 hours after glucose administration. The collected blood was separated from plasma and the blood glucose level was measured. The AUC of the blood glucose level from the administration of the test compound to 2 hours after the addition of sugar and the AUC of the solvent control group at the same time were compared.

[0030] Test Example 4: Effect on hyperglycemia after oral glucose load in db / db mice

After db / db (C57BL / KsJ-db / db) mice (N = 5) were fasted, body weights were measured. The test compound was dissolved in Cremophor solvent (Cremophor: DMSO: Water 5: 5: 90, v / v / v). The drug solution was orally administered to db / db mice at 10 ml / kg or solvent control at 10 ml / kg. Covered Approximately 60 1 blood was collected from the orbital venous plexus immediately before administration of the test compound. 30 minutes after administration of the GK activator, an aqueous solution of 200 mg / ml glucose was orally administered at 10 ml / kg (corresponding to 2 g / kg). Approximately 60 1 blood was collected from the orbital venous plexus just before glucose administration. Blood was collected in the same manner 0.5, 1, and 2 hours after glucose administration. The collected blood was separated from plasma and the blood glucose level was measured. The AUC of the blood glucose level from the administration of the test compound to 2 hours after the addition of sugar and the AUC of the solvent control group at the same time were compared.

From the above test results, it was confirmed that the compound of the present invention has a good GK activation action. In addition, since various compounds with improved side effects (effects on hERG and CYP) and Z or solubility have been found, the compounds of the present invention are useful as preventive or therapeutic agents for diabetes and the like. it is obvious.

A preparation containing one or more of the compounds (I) of the present invention or a salt thereof as an active ingredient is usually used using a pharmaceutical carrier, excipient, etc. that are usually used in the art. Can be prepared by the following method.

Administration is oral by tablets, pills, capsules, granules, powders, solutions, etc., or injections such as intraarticular, intravenous, intramuscular, suppositories, eye drops, eye ointments, transdermal solutions. Any form of parenteral administration such as an ointment, a transdermal patch, a transmucosal liquid, a transmucosal patch, and an inhalant may be used.

As the solid composition for oral administration according to the present invention, tablets, powders, granules and the like are used. In such solid compositions, one or more active ingredients are combined with at least one inert excipient such as lactose, mannitol, glucose, hydroxypropyl cellulose, microcrystalline cellulose, starch. , Polybulurpyrrolidone, and / or magnesium aluminate metasilicate. The composition may contain an inert additive, for example, a lubricant such as magnesium stearate, a disintegrant such as carboxymethyl starch sodium, a stabilizer, and a solubilizing agent according to a conventional method. Good. If necessary, tablets or pills may be coated with a sugar coating or a film of a gastric or enteric substance. Liquid compositions for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or elixirs, etc., commonly used inert diluents such as purified Contains water or ethanol. The liquid composition is solubilized in addition to the inert diluent It may contain adjuvants such as humectants, wetting agents and suspending agents, sweeteners, flavors, fragrances and preservatives.

Injections for parenteral administration contain sterile aqueous or non-aqueous solutions, suspensions or emulsions. Examples of the aqueous solvent include distilled water for injection or physiological saline. Examples of the water-insoluble solvent include propylene glycol, polyethylene glycol or vegetable oil such as olive oil, alcohols such as ethanol, or polysorbate 80 (Pharmacopeia name). Such compositions may further contain isotonic agents, preservatives, wetting agents, emollients, dispersants, stabilizers, or solubilizing agents. These are sterilized by, for example, filtration through a pacteria retention filter, blending of a bactericide or irradiation. These can also be used by producing a sterile solid composition and dissolving or suspending it in sterile water or a sterile solvent for injection before use.

Transmucosal agents such as inhalants and nasal agents are used in solid, liquid or semi-solid form and can be produced according to conventionally known methods. For example, known excipients, and further pH adjusters, preservatives, surfactants, lubricants, stabilizers, thickeners and the like may be appropriately added. For administration, an appropriate device for inhalation or insufflation can be used. For example, using a known device such as a metered dose inhalation device or a nebulizer, the compound is administered alone or as a powder in a formulated mixture or as a solution or suspension in combination with a pharmaceutically acceptable carrier. be able to. The dry powder inhaler or the like can use a dry powder or a powder-containing capsule which can be used for single or multiple administrations. Alternatively, it may be in the form of an appropriate propellant such as a pressurized aerosol spray using a suitable gas such as black mouth fluoroalkane, hydrofluoroalkane or carbon dioxide.

In the case of oral administration, the appropriate daily dose is about 0.001 to 100 mg / kg, preferably 0.1 to 30 mg / kg, more preferably 0.1 to 10 mg / kg per body weight. Or administer in 2 to 4 divided doses. When administered intravenously, the appropriate daily dose is about 0.0001 to 10 mg / kg per body weight, and should be administered once to several times a day. As a transmucosal agent, administer about 0.001 to 100 mg / kg per body weight once or multiple times a day. The dosage is appropriately determined according to the individual case in consideration of symptoms, age, sex, etc. Example

[0033] Hereinafter, the production method of the compound (I) of the present invention will be described in more detail based on Examples. The compounds of the present invention are not limited to the compounds described in the Examples below. The production method of the raw material compound is shown in the reference example.

Reference example 1

Potassium t-butoxide (1.3 g) was dissolved in t-butyl alcohol (5.6 ml) and stirred at 70 ° C. for 1 hour. To the reaction solution, a solution of 5-methyl-2-thiophenecarbaldehyde (1.0 g) and dimethyl succinate (1.2 ml) in t-butyl alcohol (1.2 ml) was added dropwise and stirred at 70 ° C. for 1 hour. Under ice cooling, acetic acid (1.0 ml) was added to adjust the pH to about 5 and the mixture was stirred for 10 minutes. Jetyl ether (40 ml) and water (30 ml) were added, and after liquid separation, saturated aqueous sodium bicarbonate (40 ml) was added to the organic layer, and the pH of the aqueous layer was adjusted to about 8. The aqueous layer was washed with jetyl ether (30 ml), and then concentrated hydrochloric acid (6 ml) was added to adjust the pH of the aqueous layer to about 3. The aqueous layer was extracted with ethyl acetate (40 ml), and the obtained organic layer was washed with saturated brine (30 ml) and dried over anhydrous magnesium sulfate. After the solvent was distilled off under reduced pressure, the resulting residue was purified by silica gel column chromatography (hexane / ethyl acetate) to give 3- (methoxycarbol) -4- (5-methyl-2-t- L) -3-Butenecarboxylic acid (1.3 g) was obtained as a pale yellow solid.

[0034] Reference Example 2

To a solution of 3- (methoxycarbol) -4- (5-methyl-2-cell) -3-butenecarboxylic acid (1.2 g) in toluene (48 ml), sodium acetate (410 mg) and anhydrous Acetic acid (4.8 ml) was sequentially added, and the mixture was stirred at 70 ° C for 3 hours. The reaction solution was allowed to cool to room temperature, stirred with saturated aqueous sodium hydrogen carbonate (30 ml) for 10 minutes, and diluted with ethyl acetate (40 ml). The obtained organic layer was washed successively with water (30 ml) and saturated brine (30 ml), and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (hexane / ethyl acetate) to give methyl 4- (acetyloxy) -2-methyl-1-benzothiophene-6-carboxylate ( 1.1 g) was obtained as a pale yellow solid.

Reference example 3

Methyl 4- (acetyloxy) -2-methyl-1-benzothiophene-6-carboxylate (1.0 g) A 28% sodium methoxide / methanol solution (3.3 ml) was added to the ethanol (32 ml) solution, and the mixture was stirred at 75 ° C overnight. Under ice-cooling, ethyl acetate (40 ml) was added for dilution, and 1M hydrochloric acid (18 ml) was added to adjust the pH of the aqueous layer to about 3. The organic layer obtained by the liquid separation operation was washed successively with water (30 ml) and saturated brine (30 ml), and then dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain methyl 4-hydroxy-2-methyl-1-benzothiophene-6-carboxylate (823 mg) as a pale yellow solid.

[0035] Reference Example 4

Bromomethylbenzene (320 μ 1) was added dropwise at -10 ° C to a DMF (10 ml) suspension of methyl 4-hydroxy-1H-indole-6-carboxylate (500 mg) and potassium carbonate (361 mg). The mixture was stirred for 30 minutes, and further stirred at room temperature for 5 hours. To the reaction mixture are added water (30 ml) and sodium acetyl acetate (30 ml), and the mixture is separated. The organic layer is washed successively with saturated aqueous sodium hydrogen carbonate (30 ml) and saturated brine (30 ml), and dried over anhydrous magnesium sulfate. did. The residue obtained by evaporating the solvent under reduced pressure was purified by silica gel column chromatography (hexane / ethyl acetate) to obtain methyl 4- (benzyloxy) -1H-indole-6-carboxylate (543 mg). Was obtained as a yellow solid.

Reference Example 5

Potassium carbonate (200 mg) and 2-iodoisopropane (100 μ 1) were added to a solution of methyl 4-hydroxy-1-benzothiophene-6-carboxylate (150 mg) in DMF (3 ml) overnight. Stir. Water (30 ml) and ethyl acetate (40 ml) are added to the reaction solution, and the organic layer obtained by the liquid separation operation is separated into water (30 mix x 3), saturated aqueous sodium hydrogen carbonate (30 ml), and saturated saline. Washed sequentially with (30 ml). The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane / methyl acetate) to obtain methyl ₄ -isopropoxy-benzothiophene-6-carboxylate (142 mg) as an ocher solid.

[0036] Reference Example 6

4- (Benzyloxy) -1H-indole-6-carboxylate (150 mg) and methanol (61 μl) in toluene (3 ml) in toluene (tributylphosphorylidene) acetonitrile (193 mg) The (0.6 ml) solution was added dropwise under ice cooling. The reaction solution was stirred for 30 minutes under ice cooling, and then stirred at 50 ° C. overnight. After allowing the reaction solution to cool to room temperature, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (hexane / ethyl acetate). Methyl (benzyloxy) -1-methyl-1H-indole-6-carboxylate (139 mg) was obtained as a reddish brown solid.

Reference Example 7

A suspension of 20% palladium hydroxide / carbon (58 mg) and 4- (benzyloxy) -1-methyl-1H-indole-6-carboxylate (130 mg) in methanol (4 ml) was added at 4 atm. The mixture was stirred at room temperature for 2 hours under a hydrogen atmosphere. The reaction mixture was filtered through celite, and the solvent was evaporated under reduced pressure to give methyl 4-hydroxy-1-methyl-1H-indole-6-carboxylate (78 mg) as a colorless solid.

[0037] Reference Example 8

To a solution of methyl 4-hydroxy-1-methyl-1H-indole-6-carboxylate (80 mg) in DMA (1.6 ml) was added potassium carbonate (81 mg) and 1-fluoro-4- (methylsulfol) benzene ( 102 mg) was sequentially added, and the mixture was stirred at 150 ° C overnight. The reaction mixture was allowed to cool to room temperature, and water (30 ml) and ethyl acetate (30 ml) were added. The organic layer obtained by the liquid separation operation was washed successively with saturated aqueous sodium hydrogen carbonate (30 ml) and saturated brine (30 ml), and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was purified by silica gel column chromatography (hexane / ethyl acetate) to give 1-methyl-4- [4- (methylsulfol) phenoxy] -1H-indole- Methyl 6-carbonate (94 mg) was obtained as a colorless solid.

Reference Example 9

1-Methyl-4- [4- (methylsulfol) phenoxy] -1H-indole-6-carboxylate (90 mg) in methanol (2 ml) and THF (2 ml) mixed solution with 1M sodium hydroxide aqueous solution (4 ml) was added and stirred at room temperature for 6 hours. Water (20 ml) and jetyl ether (20 ml) were added to the reaction solution, and 1M hydrochloric acid (4.5 ml) was added to the aqueous layer obtained by the liquid separation operation to adjust the pH to about 3. Ethyl acetate (30 ml) was added, and the organic layer obtained by liquid separation was washed with saturated brine (20 ml) and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 1-methyl-4- [4- (methylsulfoyl) phenoxy] -1H-indole-6-carboxylic acid (83 mg) as a colorless solid.

[0038] Reference examples 10-27

Similar to Reference Example 1, the compound of Reference Example 10 was used, the compound of Reference Example 11 was similar to Reference Example 2, the compound of Reference Examples 12 and 13 was similar to Reference Example 3, and the same as Reference Example 6. Thus, the compounds of Reference Examples 14 and 15 were combined with the compounds of Reference Examples 16 and 17 in the same manner as Reference Example 7. The compounds of Reference Examples 18-22 were synthesized in the same manner as in Reference Example 8, and the compounds of Reference Examples 23-27 were synthesized in the same manner as in Reference Example 9, respectively.

[0039] Reference Example 28

To a solution of methyl 4-hydroxy-2-methyl-1-benzothiophene-6-carboxylate (6 g) and Ν, Ν-disopropylethylamine (11.4 ml) in dichloromethane (150 ml) under ice-cooling Then, chloromethane (2.4 ml) was added dropwise, and the mixture was warmed to room temperature and stirred for 16 hours. Water (150 ml) and black mouth form (150 ml) were vigorously separated into the reaction solution. The obtained organic layer was washed successively with saturated aqueous sodium hydrogen carbonate solution (150 ml) and saturated brine (150 ml), dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give 4- ( Methoxymethoxy) -2-methyl-1-benzothiophene-6-carboxylate (5.9 g) was obtained as a pale yellow solid.

Reference Example 29

To a mixed solution of methyl 4- (methoxymethoxy) -2-methyl-1-benzothiophene-6-carboxylate (5.9 g) in TH F (31 ml) and methanol (31 ml), 1M sodium hydroxide (66 ml) And stirred at room temperature for 2 hours and at 50 ° C for 1 hour. The reaction solution was concentrated under reduced pressure and subjected to liquid separation operation with jetyl ether (50 ml) and water (50 ml). The aqueous layer was crushed with 1M hydrochloric acid to pH about 7 and extracted with ethyl acetate (100 ml). The obtained organic layer was washed with saturated brine (70 ml) and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 4- (methoxymethoxy) -2-methyl-benzobenzophen-6-carboxylic acid (5.5 g) as a pale yellow solid.

[0040] Reference Example 30

N-bromosuccinimide (6.6 g) was added to a methylene chloride solution (250 ml) of triphenylphosphine (9.6 g) under ice cooling. After stirring for 20 minutes under ice-cooling, a methylene chloride suspension (250 ml) of 4- (methoxymethoxy) -2-methyl-tobenzothiophene-6-carboxylic acid (5.5 g) was added. After stirring for 20 minutes under ice-cooling, 2-aminothiazole (5.5 g) was stirred at the same temperature for 20 minutes and at room temperature overnight. The reaction mixture was concentrated under reduced pressure, ethyl acetate (200 ml) was added to the resulting residue, and the mixture was washed successively with water (200 ml), saturated aqueous sodium hydrogen carbonate (150 ml), and saturated brine (150 ml). After drying over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (hexane: ethyl acetate = 80/20 → 60/40) to give 4- (methoxy Methoxy) -2-methyl-N-1,3-thiazol-2-yl-1-benzothiophene-6-carboxamide (6.1 g) was obtained as a pale yellow solid.

Reference Example 31

4- (Methoxymethoxy) -2-methyl-N-1,3-thiazol-2-yl-1-benzothiophene-6-force Ruboxamide (6.1 g) in THF (191 ml) under ice-cooling 3M hydrochloric acid (64 ml) was stirred at room temperature for 60 hours. The reaction mixture was concentrated under reduced pressure, and the resulting solid was dissolved in methanol (140 ml) at 80 ° C and allowed to cool to room temperature. The solvent was distilled off under reduced pressure, and when the total amount reached 20 g, the precipitated solid was collected by filtration to give 4-hydroxy-2-methyl-N-1,3-thiazol-2-yl-1-benzothiophene. -6-carboxamide (4.3 g) was obtained as an ocherous solid.

[0041] Reference Example 32

4-Hydroxy-2-methyl-N-1,3-thiazol-2-yl-1-benzothiophene-6-carboxamide (841 mg) in N-methylpyrrolidone (20 ml) solution with ethyl 4-fluoro Benzoate (58 5 mg) and potassium carbonate (602 mg) were added, and the mixture was stirred at 150 ° C overnight and at 200 ° C for 4 hours. Ethyl acetate (30 ml) and water (30 ml) were added, and after separation, the organic layer was washed with water (30 ml). The aqueous layer was extracted with ethyl acetate, and the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography to obtain ethyl 4-({2-methyl-6-[(1,3-thiazole-2-ylamino) carbonyl] -1-benzophen-4-yl. } Oxy) benzoate (318 mg) was obtained.

Reference Example 33

Ethyl 4-({2-methyl-6-[(1,3-thiazol-2-ylamino) carbol] -1-benzochen-4-yl} oxy) benzoate (318 mg) (20 ml The solution was charged with 1M aqueous sodium hydroxide solution (1.80 ml) and stirred at 60 ° C. overnight. Further, 1M aqueous sodium hydroxide solution (1.80 ml) was added and stirred at 80 ° C. for 4 hours. 1M Hydrochloric acid (3.6 ml) was added, and the resulting solid was collected by filtration and washed with water. The obtained solid was crystallized with DMF-ethyl acetate to give 4-({2-methyl-6-[(1,3-thiazol-2-ylamino) carbol] -1-benzophen-4-yl} oxy ) Benzoic acid (142 mg) was obtained.

The structures and physicochemical data of each Reference Example compound are shown in Tables 1 to 5 below.

[0042] Example 1

1-methyl-4- [4- (methylsulfol) phenoxy] -1H-indole-6-carboxylic acid (75 mg ) And 1,3-thiazol-2-amamine (24 mg) in pyridine (2.5 ml) were added dropwise phosphorus oxychloride (20 μ 1) at −10 ° C. The reaction mixture was stirred at −10 ° C. for 30 minutes and then stirred at 50 ° C. overnight. The reaction solution was allowed to cool to room temperature, diluted with chloroform (30 ml), and stirred with water (30 ml) for 10 minutes. The organic layer obtained by the liquid separation operation was washed successively with 1M hydrochloric acid (30 ml), saturated aqueous sodium hydrogen carbonate (30 ml) and saturated brine (30 ml), and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was purified by silica gel column chromatography (hexane / ethyl acetate) to give 1-methyl-4- [4- (methylsulfol) phenoxy] -N- (l , 3-Thiazole-2-yl) -1H-indole-6-carboxamide (44 mg) was obtained as a colorless solid.

Example 2

To a solution of 4-methylmorpholine-4-oxide (75 mg) in THF (5 ml) and water (3 ml) under ice cooling, osmium tetroxide (0.08 M 2-methyl-2-propanol solution) (0.800 ml) And 2_methyl-4- [4- (methylsulfoyl) phenoxy] -N- (5-bulpyrazine-2-yl) -1-benzothiophene-6-carboxamide (280 mg) in THF (7 ml) Were ordered sequentially. After stirring for 1 hour under ice-cooling, the mixture was stirred for 15 hours at room temperature. Ethyl acetate (30 ml), 10% aqueous sodium thiosulfate solution (30 ml) were added to the reaction solution, and the organic layer obtained by separation was washed with saturated brine (20 ml) and then dried over anhydrous magnesium sulfate. . The residue obtained by evaporating the solvent under reduced pressure was purified by silica gel column chromatography (chloroform / methanol) to give N- [5- (l, 2-dihydroxyethyl) pyrazine-2-yl. ] -2-Methyl-4- [4- (methylsulfol) phenoxy] -1-benzothiophene-6-carboxamide (244 mg) was obtained as a light brown amorphous substance.

Examples 3-10

In the same manner as in Example 1, the compounds of Examples 3 to 10 shown in the table below were produced using the corresponding raw materials.

Example 11

1- (4-Fluoro-1-naphthyl) ethanone (35 μmol) and 4-hydroxy-2-methyl-Ν-1,3-thiazol-2-yl-1-benzothiophene-6-carboxamide (30 μmol ) To カリウム -methylpyrrolidone (1 ml) solution was added potassium carbonate (40 mol), and the mixture was stirred at 150 ° C overnight. Water (2 ml) and black mouth form (3 ml) were stirred in the reaction solution. The organic layer was collected with IPS (Whatman), concentrated under reduced pressure, and preparative high performance liquid chromatography (ODS; methanol-0.1% formic acid). 4-[(4-Acetyl-1-naphthyl) oxy] -2-methyl-N-1,3-thiazol-2-yl-1-benzothiophene-6-carboxamide (5.5 mg) Got.

Example 12

1-Bromobutane (40 μmol) and methyl 4-hydroxy-2-methyl-1-benzothiophene-6-carboxylate (30 mol) in N-methylpyrrolidone (1 ml) solution in potassium carbonate (40 mol) and iodide Potassium (3 μmol) was added and stirred at 80 ° C. overnight. Water (2 ml) and chloroform (3 ml) were stirred in the reaction solution, and the organic layer was collected with IPS (Whatman) and concentrated under reduced pressure. Ethanol (2 ml) and 1M aqueous sodium hydroxide solution (0.1 ml) were added to the resulting residue, and the mixture was stirred at 80 ° C. overnight. 1M Aqueous hydrochloric acid solution (0.1 ml) was added, and the mixture was stirred at room temperature for 2 hr and concentrated under reduced pressure. A solution of oxalyl chloride (70 μmol) in dichloroethane (1 ml) and DMF (0.25 mg) in dichloroethane (0.5 ml) was added and stirred at 60 ° C. for 3 hours. A solution of 2-aminothiazole (70 mol) in diclonal ethane (1 ml) and Ν, Ν-diisopropylethylamine (210 mol) were added, and the mixture was stirred at room temperature for 16 hours. Water (2 ml) and black mouth form (2 ml) were added and stirred, and then the organic layer was recovered with IPS (Whatman). After concentration under reduced pressure, purification by preparative high performance liquid chromatography (ODS; methanol-0.1% formic acid aqueous solution) gave 4-butoxy-2-methyl-N-1,3-thiazol-2-yl-1- Benzothiophene-6-carboxamide (5.9 mg) was obtained.

[0044] Example 13

4-({2-Methyl-6-[(1,3-thiazol-2-ylamino) carbol]-1-benzochen-4-yl} oxy) benzoic acid (30 μmol) in DMF (1 ml ) Solution, a mixture of HOBt (30 μmol) and dimethylamine (40 mol) in N-methylpyrrolidone (801) and PS-Carbodiimide (50 mg, Argon onaut) were shaken overnight at room temperature. PS-Trisamine (50 mg, Argonaut) and PS-Isocyanate (50 mg, Argonaut) were added and shaken for another 4 hours at room temperature. Filter through a filter tube and concentrate the filtrate under reduced pressure to give 4- {4-[(dimethylamino) carbol] phenoxy} -2-methyl-N- 1,3-thiazol-2-yl- 1-benzothiophene-6-carboxamide (13.1 mg) was obtained.

[0045] The compounds of Examples 14 to 20 and Examples 22 to 31 shown in the following table in the same manner as in Example 11 were prepared, and the compounds of Examples 32 to 138 shown in the following table in the same manner as in Example 12 were used. The compounds were prepared in the same manner as in Example 13, but in Examples 21 and 139 to 147 shown in the table below. Were prepared using the corresponding raw materials. The structures and physicochemical data of each Example compound are shown in Tables 6-18.

Tables 19 and 20 show the structures of other compounds of the present invention. These can be easily synthesized by using the above-described production methods, the methods described in the examples, methods obvious to those skilled in the art, or variations thereof.

[0046] The following abbreviations are used in the table below. REx: Reference number, Ex: Example number, No: Compound number, Str: Structural formula, Dat: Physicochemical data (MS: m / z value in mass spectrometry (+: Cation, —: Yin Ion), NMRl: δ (ppm) in NMR in DMSO—d, NMR2: ^{1 in} CDC1

6 3

Δ (ppm) in H NMR, HPLC: retention time in high performance liquid chromatography (min) (HPLC measurement conditions are column: WakosiHI (Wako Pure Chemical Industries, Ltd.) 5C18 (ODS, 5micron) AR; 4.6 x 30mm, Developing solvent: methanol / 5 mM trifluoroacetic acid aqueous solution = 10/90 (0 min) -10 0/0 (4.0 min) -100/0 (4.5 min) ゝ flow rate: 1.2 ml / min ゝ wavelength: 254 nm. )), Me: methyl, Et: ethyl, iPr: 2-propyl, cPr: cyclopropyl, nBu: nonoremanole butinore, tBu: tert-butinole, cBu: cyclobutyl, nPen: normal pentyl, cHex: cycloto Xyl, Ms: methylsulfol, A-acetyl, Ph: phenol, Bn: benzyl. The number before the substituent represents the substitution position, for example, 4-Ms-Ph represents 4-methylsulfurphenol.

[0047] [Table 1]

O 82ε-oozAV: / v> d s s900zfcl

Ks 00 Master] [6 rinse]

^ et0ZC900idfX3J 62 8e9e oz.ooz O

£ 0Z £ / 900Zd £ / 13d οε 8 £ 9 £ Bride ΟΟί OAV [S 峯] [Ϊ500]

8 £ 9 O / OOZ OAV

Ex R ³ B Dat

NMRl: 1.41 (6H, d, J = 5.9 Hz). 4.90-5.00 (IH, m). 7.28 (IH, d, .1 = 3.7 Hz), 7.49 (IH. D, J = 5.5 Hz), 7.58 ( IH, d, J = 3.5 Hz), 7.63

5 H iPr

(I H, s), 7.89 (IH. D. J = 5.5 Hz), 8.35 (IH, s). 12.69 (IH, s); MS (ESI +): 319

NMRl: 3.23 (3H, s), 7.25-7.31 (3H, m), 7.42 (IH. D. J = 5.6

6 H 4-Ms-Ph Hz), 7.55 (IH, d, J = 3.6 Hz), 7.82 (I H, s), 7.96 (2H, d. J = 8.8

Hz), 8.06 (IH, d, J = 5.5 Hz), 8.74 (I H, s); MS (HSI +): 431

NMRl: 2.60 (3H, s), 3.22 (3H, s), 7.12-7.15 (IH. M), 7.24 (2H, d, J = 9.0 Hz), 7.28 (III, d, J = 3.6 Hz), 7.56 (IH, d, J = 3.6 Hz),

7 Me 4-Ms-Ph 7.78-7.82 (IH, m), 7.94 (211, d, J = 8.7 Hz), 8.63 (I H, s);

MS (ESI Ten): 445

NMR2: 1.39 (3H, t, J = 7.5 Hz). 2.97 (2H, q, J = 7.5 Hz), 3.09 (3H, s), 6.97-7.01 (IH, m), 7.07 (IH. S), 7.10 -7.17 (2H, m).

8 Et 4-Ms-Ph

7.22-7.29 (I H.m), 7.55-7.59 (I H.m) .7.88-7.97 (2H, m).

8.25-8.26 (IH. M); MS (ESI +): 459

[0054] [Table 8]

[0055] [Table 9]

Ten] [n eoo]

£ 0Ζ £ / 900Ζάΐ / 13ά 9ε 8 £ 9 £ 00 00 OAV

t £ t0l £ / 900Zdr / 13d 9S 8 £ 9 £ bride 00Z ΟΛ \ ] [] [9005

[]

[ΐ9οο]

£ 0Z £ / 900ZdT / 13d 6S 8 £ 9 £ 00 00 OAV

16]

[0063] [Table 17] [8ΐ 挲] 900]

nt0l £ / 900ZdT / L3d zv 8f 9 £ bride 00Z ΟΛ \

19]

ΘΙΛΙ SIAI oz ΛΙ L \

HO ^ 厂 SIAI 31

N

H 0 ^£ d 61 H 91

HO N

H ΘΙΛΙ 81 9ΙΛΙ H SI

ON ON

[9900]

WW / 900Zdf / e :) d cha 8 £ 9 £ 00 00 OAV Industrial applicability

[0067] Since the compound of the present invention has a GK activation action, it is useful as a therapeutic and prophylactic agent for diabetes, particularly type 2 diabetes. It is also useful for the treatment and prevention of diabetic complications such as nephropathy, retinopathy, neuropathy, peripheral circulatory disorder, cerebrovascular disorder, ischemic heart disease, and arteriosclerosis. Furthermore, by suppressing overeating, it is useful as a therapeutic and prophylactic agent for obesity and metabolic syndrome.

Sequence listing free text

[0068] The numerical heading <223> in the following sequence listing describes "Artificial Sequence. Specifically, the nucleotide sequences represented by the sequences of SEQ ID NOS: 1 and 2 in the sequence listing are artificial. This is a primer sequence that was specifically synthesized.

Claims

The scope of the claims

A condensed heterocyclic compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof.

[Chemical 9]

(The symbols in the formula have the following meanings.

A: S, 0 or N (R ⁵ ),

X: 0, S ゝ SO or SO,

2

B:-R °,-Lower alkale,-R °°-CN,-R °°-CON (R ^G ),-R °°-O- ^RG ,-R °°-N (R ^G ) CO-R.

2

V, may be lower alkylene) -N (R ^G ) CO-,

R °: the same or different from each other, lower alkyl,

R °°: the same or different from each other, lower alkylene,

R ^G : the same or different from each other, H or R °,

D: thiazole, pyridine or virazine,

(ii):-H, -halogen, -CO H, -CO R °, -NO, -CN, -R °, -lower alkali, -CO- C

2 2 2

0 H, -C0-C0-0R °, -halogeno lower alkyl and / or -lower alkylene -NR ^D ,

2

twenty two

OR °, -lower alkylene-CO-NR ^C R ^D or -R °° -CO-Nl-OR ^D ,

2

twenty two

, — R °° — C〇 R ° or — R °° — C〇— N (R ^A ),

twenty two

2

[2] B force R °,-(substituted or optionally aryl) or -lower alkylene- (optionally substituted aryl)

R ¹ and R ² are the same or different from each other, and

(0:-CH (0R ^A )-R ^B ,-CO- CO- NR ^C R ^Dゝ-CO- CO- NR ^C -OR.,-C (OR ^E ) (OR ^F )-R ^Bゝ-C (0

R ^E ) (OR ^F )-R °, -CH (OR ^E ) -CH (OR ^F ) -R ^C and / or -CH (OR ^E ) -CH (OR ^F ) -R ^B ,

(ii):-H, -halogen, -CO H, -CO R °, -NO, -CN, -R °, -lower alkali, -CO- CO

2 2 2

H, -CO-CO-OR °, -halogeno lower alkyl and / or -lower alkylene-NR ^C R ^D ,

2

The compound according to claim 1 or a pharmaceutically acceptable salt thereof.

[3] A pharmaceutical composition comprising the condensed heterocyclic compound represented by the formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[4] The pharmaceutical composition according to claim 3, which is a therapeutic agent for diabetes.

[5] A darcokinase inhibitor comprising the condensed heterocyclic compound represented by the formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof.

[6] Use of a compound represented by formula (I) or a pharmaceutically acceptable salt thereof according to claim 1 for the manufacture of a therapeutic agent for diabetes.

[7] A method for treating diabetes, comprising administering an effective amount of a compound represented by the formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof to a patient.