WO2007019901A1 - Food products comprising probiotic micro-organisms and antibodies - Google Patents
Food products comprising probiotic micro-organisms and antibodies Download PDFInfo
- Publication number
- WO2007019901A1 WO2007019901A1 PCT/EP2006/005060 EP2006005060W WO2007019901A1 WO 2007019901 A1 WO2007019901 A1 WO 2007019901A1 EP 2006005060 W EP2006005060 W EP 2006005060W WO 2007019901 A1 WO2007019901 A1 WO 2007019901A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibodies
- food product
- fragments
- pharmaceutical preparation
- antibody fragments
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23G—COCOA; COCOA PRODUCTS, e.g. CHOCOLATE; SUBSTITUTES FOR COCOA OR COCOA PRODUCTS; CONFECTIONERY; CHEWING GUM; ICE-CREAM; PREPARATION THEREOF
- A23G9/00—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor
- A23G9/32—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor characterised by the composition containing organic or inorganic compounds
- A23G9/36—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor characterised by the composition containing organic or inorganic compounds containing microorganisms or enzymes; containing paramedical or dietetical agents, e.g. vitamins
- A23G9/363—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor characterised by the composition containing organic or inorganic compounds containing microorganisms or enzymes; containing paramedical or dietetical agents, e.g. vitamins containing microorganisms, enzymes
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23G—COCOA; COCOA PRODUCTS, e.g. CHOCOLATE; SUBSTITUTES FOR COCOA OR COCOA PRODUCTS; CONFECTIONERY; CHEWING GUM; ICE-CREAM; PREPARATION THEREOF
- A23G9/00—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor
- A23G9/32—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor characterised by the composition containing organic or inorganic compounds
- A23G9/38—Frozen sweets, e.g. ice confectionery, ice-cream; Mixtures therefor characterised by the composition containing organic or inorganic compounds containing peptides or proteins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/745—Bifidobacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present invention relates to food products or pharmaceutical preparations comprising antibodies or antibody fragments which are active in the gut and probiotic micro-organisms independent from the antibodies or antibody fragments.
- the invention relates to a method for preparing food products and pharmaceutical preparations comprising the antibodies or antibody fragments and probiotic micro-organisms and the use of these products to deliver health benefits to humans.
- Antibodies are glycoproteins, which specifically recognise foreign molecules. These recognised foreign molecules are called antigens. When antigens invade humans or animals, an immunological response is triggered which involves the production of antibodies by B-lymphocytes. By this immunological response, microorganisms, larger parasites, viruses and bacterial toxins can be rendered harmless.
- IgGs are the most abundant immunoglobulins in the blood. They have a basic structure of two identical heavy (H) chain polypeptides and two identical light (L) chain polypeptides.
- the H and L chains are kept together by disulfide bridges and non-covalent bonds.
- variable domains of the heavy and light chain (V H and V L ) which are extremely variable in amino acid sequences are located at the N-terminal part of the antibody molecule. V H and V L together form the unique antigen-recognition site.
- the amino acid sequences of the remaining C-terminal domains are much less variable and are called C H 1 , C H 2, C H 3 and C L .
- the non-antigen binding part of an antibody molecule is called the constant domain Fc and mediates several immunological functions, such as binding to receptors on target cells and complement fixation.
- the unique antigen-binding site of an antibody consists of the heavy and light chain variable domains (V H and V L ). Each domain contains four framework regions (FR) and three regions called CDRs (complementarity determining regions) or hypervariable regions. The CDRs strongly vary in sequence and determine the specificity of the antibody. V L and V H domains together form a binding site, which binds a specific antigen.
- Fab, Fv or single domain fragments could be engineered by proteolysis of antibodies, using for example papain digestion, pepsin digestions or other enzymatic approaches. Such a technique can be used to yield Fab, Fv or single domain fragments.
- Fab fragments are the antigen-binding domains of an antibody molecule.
- Fab fragments can be prepared by papain digestions of whole antibodies.
- Fv fragments are the minimal fragment ( ⁇ 30 kDa) that still contains the whole antigen-binding site of a whole IgG antibody.
- Fv fragments are composed of both the variable heavy chain (V H ) and variable light chain (V L ) domains. This heterodimer, called Fv fragment (for fragment variable) is still capable of binding the antigen.
- Escherichia coli has been used as an expression system for antibody fragment production.
- E. coli is easily accessible for genetic modifications, requires simple inexpensive media for rapid growth and they can easily be cultured in fermentors permitting large-scale production of proteins of interest.
- Lactobacilli have been investigated with regards to their anti-diarrhoeal properties since the 1960's (Beck, C 1 et al. Beneficial effects of administration of Lactobacillus acidophilus in diarrhoeal and other intestinal disorders. Am. J. Gastroenterol (1961 ) 35, 522-30). A limited number of recent controlled trials have shown that certain strains of lactobacilli may have therapeutic as well as prophylactic properties in acute viral gastroenteritis (Mastretta, E., et al. Effect of Lactobacillus CG and breast-feeding in the prevention of rotavirus nosocomial infection. J. Pediatr. Gastroenterol. Nutr. (2002) 35, 527-531 ). Selected strains of Lactobacillus casei and Lactobacillus plantarum have also been shown to exert strong adjuvant effects on the mucosal and the systemic immune response.
- Lactobacilli are well-known bacteria applied in the production of food products.
- yogurt is normally made by fermenting milk with among others a Lactobacillus strain.
- the fermented acidified product, still containing the viable Lactobacillus, is then cooled and consumed at the desired moment.
- Lactobacillus in food products is in the production of meat products for example sausages.
- the Lactobacillus is added to the meat mass prior to applying the casing, followed by a period of ripening in which the fermentation process takes place.
- Lactobacillus in the production of food products is the brining of vegetables such as cabbage (sauerkraut), carrots, olives or beets.
- the natural fermentation process can be controlled by the addition of an appropriate Lactobacillus starter culture.
- Lactobacillus in food products is often associated with several health effects, see for example A.C. Ouwehand et al. in Int. Dairy Journal 8 (1998) 749-758.
- the application of products is associated with several health effects for example relating to gut well being such as IBS (Irritable Bowel Syndrome), reduction of lactose maldigestion, clinical symptoms of diarrhoea, immune stimulation, anti-tumour activity and enhancement of mineral uptake.
- WO 99/23221 discloses multivalent antigen binding proteins for inactivating phages.
- the hosts may be lactic acid bacteria which are used to produce antibody binding fragments which are recovered.
- WO 99/23221 discloses adding the harvested antibody fragments to bacteria to provide anti-diarrhoea effects.
- WO 00/65057 is directed to the inhibition of viral infection, using monovalent antigen- binding proteins.
- the antigen-binding protein may be a heavy chain variable domain derived from an immunoglobulin naturally devoid of light chains, such as those derived from Camelids as described in WO 94/04678.
- WO 00/65057 discloses transforming a host with a gene encoding the monovalent antigen-binding proteins. Suitable hosts can include lactic acid bacteria.
- This disclosure relates to the field of fermentation processing and the problem of phage infection which hampers fermentation. Specifically, llama VHH fragments are used to solve the problem of phage infection by neutralising Lactoccoccus lactis bacteriophage P2.
- Both WO 00/65057 and WO 99/23221 involve the use of antibody fragments harvested from a bacterial expression system.
- US 6,605,286 is directed to the use of gram positive bacteria to deliver biologically active polypeptides, such as cytokines, to the body.
- US 6,190,662 and EP 0 848 756 B1 are directed to methods for obtaining surface expression of a desired protein or polypeptide.
- Monedero et at "Selection of single-chain antibodies against the VP8 Subunit of rotavirus VP4 outer capsid protein and their expression in L. casei" Applied and Environmental Microbiology(2004) No.4 6936-6939, is directed to in-vitro studies on the use of single-chain antibodies (scFv) expressed by L.
- yeasts are well-known in the brewing and baking and their associated food products including, for example bread and beer.
- the present invention aims to provide health benefits to a subject in need thereof.
- a food product or pharmaceutical preparation comprising i) antibodies or antibody fragments which are active in the gut and ii) probiotic micro-organisms independent from the antibodies or antibody fragments.
- a method for making a food product or pharmaceutical preparation according to the first aspect comprising adding independently the antibodies or antibody fragments and the probiotic micro- organisms during the manufacture of the food product or pharmaceutical preparation or an ingredient thereof.
- a third aspect of the invention there is provided the use of the food product or pharmaceutical preparation according to the first aspect of the invention or made according to the second aspect of the invention to deliver health benefits to the gut of a subject.
- a method of delivering health benefits to the gut of a subject comprising administering the food product or pharmaceutical preparation according to the first aspect of the invention or made according to the second aspect of the invention to a subject in need thereof.
- a dispensing implement for use with a food product comprising probiotic micro-organisms wherein the dispensing implement is coated on at least one surface with antibodies or anti-body fragments which are active in the gut.
- a dispensing implement for use with a food product wherein the dispensing implement is coated on at least one surface with antibodies or anti-body fragments which are active in the gut and probiotic micro-organisms.
- the term "food product” as used herein encompasses beverages.
- non-viable bacteria as used herein is meant a population of bacteria that is not capable of replicating under any known conditions. However, it is to be understood that due to normal biological variations in a population, a small percentage of the population (i.e. 5% or less) may still be viable and thus capable of replication under suitable growing conditions in a population which is otherwise defined as non-viable.
- viable bacteria as used herein is meant a population of bacteria that is capable of replicating under suitable conditions under which replication is possible. However, it is to be understood that due to normal biological variations in a population, a small percentage of the population (i.e. 5% or less) may still be non- viable and thus not capable of replication under those conditions in a population which is otherwise defined as viable.
- probiotic micro-organisms independent from the antibodies or antibody fragments is meant that the probiotic micro-organisms do not form a part of any delivery system for the antibodies or antibody fragments and are not binded therewith.
- Figures 1a and b shows that rotavirus specific VHH particles neutralise rotavirus in- vitro.
- Figure 2 shows that rotavirus specific VHH particles neutralise rotavirus in-vivo.
- Figure 3 shows a Map of Lactobacillus expression vectors:
- VHH1 -anchor mediating surface-anchored expression of antibody fragments by fusion to the last 244 amino acids of L. casei proteinase P;
- c 2A10-secreted;
- TAA stop codon
- Tldh transcription terminator of the lactate dehydrogenase gene of L. casei; deleted TId:, remaining sequence after deletion of Tldh;
- VHH1 heavy chain antibody fragment against rotavirus; long anchor, anchor sequence from the proteinase P gene of L. casei (244 amino acids);
- Tcbh transcription terminator sequence of the conjugated bile acid hydrolase gene of L. plantarum 80;
- Pldh Promotor sequence of the lactate dehydrogenase gene of L. casei, SS
- PrtP signal sequence of the PrtP gene (33 aa), N-terminus PrtP, N-terminus (36 amino cids) of the PrtP gene; Amp r : ampicillin-resistance gene;
- Rep repA gene of plasmid p353-2 from L. pentosis
- Figure 4a shows the results of Flow cytometry showing the expression of 2A10-scFv
- Figure 12 shows an alignment of the VHH's having affinity for Rotavirus viral particles.
- the present invention is directed to a food product or pharmaceutical preparation comprising i) antibodies or antibody fragments which are active in the gut and ii) probiotic micro-organisms independent from the antibodies or antibody fragments.
- the antibodies or antibody fragments which are active in the gut may be used either as part of a delivery system therefor or not.
- the antibodies or fragments thereof comprise part of a delivery system to deliver them to the GIT (hereinafter referred to as the "delivery system").
- a delivery system for the antibodies or fragments thereof when using a delivery system for the antibodies or fragments thereof to deliver them to the GIT, this can be effected by the use of encapsulates, such as those known in the food and pharmaceutical industries. Natural biopolymers may be used. Examples include Ca-alginate, carrageenan, gellan gum or gelatine.
- the delivery system may be an encapsulation method known in the art which will deliver the immunoglobulin or fragments thereof specifically to the gut. The encapsulate must therefore be able to survive until entry to the gut and then be released.
- Such a delivery system comprises a general protective system that protects the antibodies from degradation. Such techniques may include liposome entrapment, spinning disk and coacervation.
- Any trigger can be used to prompt the release of the encapsulated ingredient, such as pH change (enteric coating), mechanical stress, temperature, enzymatic activity.
- enteric coating an enteric coating is used.
- the encapsulation method may allow the slow release of the antibody in the gut and/or stomach. This will enable a constant release of the antibody or functional fragment or equivalent over a set period of time.
- the delivery system may comprise a micro-organism, preferably transformed to be able to produce the antibodies or antibody fragments.
- This micro-organism is additional to the probiotic micro-organisms referred to herein as ii) and which is independent from the antibodies or antibody fragments.
- the invention may comprise two different micro-organisms. The first is the probiotic microorganism referred to herein as ii) which does not form part of any delivery system for the antibodies or fragments thereof. The second is the micro-organism which may form part of the delivery system.
- the former is referred to herein as the "probiotic micro-organism” and the latter as the "micro-organism”.
- a pharmaceutical preparation comprising a delivery system for delivering antibodies to the GIT wherein the antibodies are active in the gut and the delivery system comprises a micro-organism transformed with antibodies or fragments thereof wherein the antibodies are heavy chain immunoglobulins of the VHH type or fragments thereof, preferably derived from Camelids, most preferably llama heavy chain antibodies or fragments thereof, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof and independently a probiotic micro-organism.
- the delivery system comprises a micro-organism transformed with antibodies or fragments thereof wherein the antibodies are heavy chain immunoglobulins of the VHH type or fragments thereof, preferably derived from Camelids, most preferably llama heavy chain antibodies or fragments thereof, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof and independently a probiotic micro-organism.
- the micro-organism should preferably be able to survive passage in the GIT and should be active in the stomach/gut.
- the micro-organism should be able to undergo transient colonization of the GIT; be able to express the gene in the GIT; and be able to stimulate the gut immune system.
- the micro-organism may also be a probiotic micro-organism with the above characteristics.
- probiotics are defined as viable microbial food supplements which beneficially influence the host by improving its intestinal microbial balance in accordance to Fuller (1989) probiotics in man and animals, Journal of Applied Bacteriology 66, 365-378. If the probiotic microorganism is a bacterium, it is preferred that it is a lactic acid bacterium.
- probiotic micro-organisms examples include yeast such as Saccharomyces, Debaromyces, Kluyveromyces and Pichia, moulds such as Aspergillus, Rhizopus, Mucor and Penicillium and bacteria such as the genera Bifidobacterium, Propionibacterium, Streptococcus, Enterococcus, Lactococcus, Bacillus, Pediococcus, Micrococcus, Leuconostoc, Weissella, Oenococcus and Lactobacillus. Kluyveromyces lactis may also be used.
- yeast such as Saccharomyces, Debaromyces, Kluyveromyces and Pichia
- moulds such as Aspergillus, Rhizopus, Mucor and Penicillium
- bacteria such as the genera Bifidobacterium, Propionibacterium, Streptococcus, Enterococcus, Lactococcus, Bacillus, Pediococcus, Micro
- probiotic micro-organisms are:
- Kluyveromyces lactis Kluyveromyces fragilis, Pichia pastoris, Saccharomyces cerevisiae, Saccharomyces boulardii, Aspergillus niger, Aspergillus oryzae, Mucor miehei, Bacillus subtilis, Bacillus natto, Bifidobacterium adolescentis, B. animalis, B. breve, B. bifidum, B. infantis, B. lactis, B. longum, Enterococcus faecium,
- Enterococcus faecalis Escherichia coli, Lactobacillus acidophilus, L. brevis, L. casei, L. delbrueckii, L. fermentum, L. gasseri, L. helveticus, L. johnsonii, L. lactis, L. paracasei, L. plantarum, L. reuteri, L. rhamnosus, L. sakei, L. salivarius, L. sanfranciscus, Lactococcus lactis, Lactococcus cremoris, Leuconostoc mesenteroides, Leuconostoc lactis, Pediococcus acidilactici, P. cerevisiae, P. pentosaceus, Propionibacterium freudenreichii, Propionibacterium shermanii and Streptococcus salivarius.
- Particular probiotic strains are:
- the micro-organism may be a lactic acid bacterium. More, preferably, the micro-organism is chosen from either lactobacillus or bifidobacteria. Even more preferably, the micro-organism is Lactobacillus. Particularly, the Lactobacillus is Lactobacillus casei 393 pLZ15. Lactobacillus casei has recently been reidentified as Lactobacillus paracasei (Perez-Martinez, 2003). Another preferred Lactobacillus is Lactobacillus reutarii.
- the micro-organism may be yeast.
- suitable yeasts include the baker's yeast S. cerevisiae.
- Other yeasts like Candida boidinii, Hansenula polymorpha, Pichia methanolica and Pichia pastoris which are well known systems for the production of heterologous proteins and may be used in the present invention.
- Filamentous fungi in particular species from the genera Trichoderma and Aspergillus have the capacity to secrete large amounts of proteins, metabolites and organic acids into their culture medium. This property has been widely exploited by the food and beverage industries where compounds secreted by these filamentous fungal species have been used for decades.
- a delivery system based on probiotic bacteria represents a safe and attractive approach and represents one of the cheapest antibodies production systems.
- the wide scale application of the micro-organism, preferably Lactobacillus, expressing antibodies is relatively easy and requires minimal handling and storage costs and economical.
- the micro-organism is transformed with an expression vector comprising the gene for the antibody.
- the expression vector may contain a constitutive promoter in order to express the antibodies or fragments thereof.
- a constitutive promoter will support in situ expression of antibodies by transformed lactobacilli persisting (at least for a short period) in the intestinal tract after administration.
- the promoter may be chosen to be active only in the GIT and/or stomach/gut i.e. suitable for GIT specific expression only. This will ensure expression and/or secretion of the llama heavy chain antibody or fragments thereof in the GIT, preferably the gut.
- the expression vectors described in the examples are able to replicate in the transformed lactobacilli and express the antibodies of fragments thereof. It will be understood that the present invention is not limited to these replication expression vectors only.
- the whole expression cassette can be inserted in a so-called "integration" plasmid, whereby the expression cassette will be integrated into the chromosome of the lactobacilli after transformation, as known in the art (Pouwels, P.H. and Chaillou, S. Gene expression in lactobacilli (2003) Genetics of lactic acid bacteria page 143-188).
- replicating or integrating vectors may be used in accordance with the invention.
- the delivery system comprises a micro-organism transformed with antibodies or fragments thereof the antibodies are expressed and/or secreted in the gut.
- a micro-organism as the delivery system has the advantages that in vivo production of antibody fragments locally in the GIT circumvents the practical problem of degradation of orally administered antibodies in the stomach.
- probiotic bacteria represents a safe and attractive approach to delivering antibodies to the GIT.
- the wide scale application of the lactobacilli expressing antibodies is relatively easy and requires minimal handling and storage costs and economical.
- the probiotic bacteria will remain in the gut for longer and enable the constant production of the antibody to enable more constant protection against the enteropathogenic microorganism.
- the amount of the micro-organism in the delivery system in food products of the invention is between 10 6 and 10 11 per serving or (for example if serving size is not known) between 10 6 and 10 11 per 100 g of product, more preferred these levels are from 10 8 to 10 9 per serving or per 100 g of product.
- the antibodies for use according to the present invention must be active in the gut/stomach, i.e. they must be functional and retain their normal activity including inactivating their target.
- the active antibodies according to the invention should bind to their target as normal, thus, the binding affinity of the antibody for the antigen should be as normal. Binding affinity is present when the dissociation constant is more than 10 5 .
- the food product or pharmaceutical preparation according to the invention will be able to selectively address a specific disease or symptom of a disease.
- the choice of antibody will determine the disease or symptom to be treated or reduced.
- the product is a food product any antibody may be used.
- the product is a pharmaceutical preparation heavy chain immunoglobulins or fragments thereof of the VHH or VNAR type or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof are preferred.
- the antibody or fragments thereof should have one or more of the following characteristics:
- the antibodies should be thermostable which enables their inclusion in a variety of food products.
- the food products may be prepared in a process requiring pasteurization and it is preferred that the activity of the antibodies is largely maintained despite heat treatment.
- fragments or portions of a whole antibody which can nevertheless exhibit antigen binding affinity is also contemplated.
- Fragments should preferably be functional fragments.
- a functional fragment of an immunoglobulin means a fragment of an immunoglobulin which fragment show binding affinity for an antigen and has the same biological activity as the full length sequence.
- Such fragments include Fab and scFv fragments. Binding affinity is present when the dissociation constant is more than 10exp5.
- Such a fragment can be advantageously used in therapy, for example, as it is likely to be less immunogenic and more able to penetrate tissues due to its smaller size.
- a functional equivalent means a sequence which shows binding affinity for an antigen similar to the full length sequence.
- a functional equivalent means a sequence which shows binding affinity for an antigen similar to the full length sequence.
- additions or deletions of amino acids which do not result in a change of functionality are encompassed by the term functional equivalents.
- the antibody or fragment thereof should be able to be expressed and secreted in the gut.
- assays are well known in the art which mimic GIT conditions and are used for instance to select suitable probiotics that can survive GIT conditions.
- a suitable assay for determining whether an antibody can survive the GIT conditions is described by Picot, A. and Lacroix, C. (International Dairy Journal 14 (2004) 505- 515).
- the antibody produced is selected under specific conditions of low pH, preferably from 1.5 to 3.5, and in the presence of pepsin (a protease abundant in the stomach) to result in highly beneficial molecules that work well in the G/l tract and are suitable for use according to the present invention.
- pepsin a protease abundant in the stomach
- the antibody or fragment thereof may be naturally occurring or may be obtained by genetic engineering using techniques well known in the art.
- the antibody can be chosen to be active against many different antigens, including micro-organisms, larger parasites, viruses and bacterial toxins.
- the present application may be applicable to the management of enteropathogenic micro-organisms in general.
- Enteropathogenic micro-organisms include viruses or enteropathogenic bacteria. Management is understood to mean therapy and/or prophylaxis.
- Enteropathogenic bacteria may include, for example, Salmonella, Campilobacter, E. coli or Helicobacter.
- Salmonella Salmonella, Campilobacter, E. coli or Helicobacter.
- the use of antibodies that inactivate Helicobacter that causes stomach ulcers is contemplated.
- Enteropathogenic viruses may include, for example, Norovirus (Norwalk like virus), enteric adenovirus, Coronavirus, astroviruses, caliciviruses, and parvovirus.
- Norovirus Neorwalk like virus
- enteric adenovirus Coronavirus
- astroviruses caliciviruses
- parvovirus parvovirus
- Rotavirus and the Norwalk family of viruses are the leading causes of viral gastroenteritis, however, a number of other viruses have been implicated in outbreaks.
- the present invention is directed to the management of rotaviral infection.
- the present application may also be used in the management of other non- enteropathogenic viruses like Hepatitis.
- heavy chain immunoglobulins or fragments thereof of the VHH or VNAR type or domain antibodies of the heavy or light chains of immunoglobulins or fragments thereof may be used in the present invention.
- Such heavy chain immunoglobulins of the VHH or VNAR type are obtained using techniques well known in the art. More preferably, the immunoglobulin or fragment thereof is derived from Camelids, most preferably llamas.
- EP-A-0584421 describes heavy chain immunoglobulin regions obtained from Camelids.
- the antibodies may be llama heavy chain antibodies, more preferably VHH antibodies or fragments thereof.
- VHH antibodies llama heavy chain antibodies
- Hamers-Casterman et al. discovered a novel class of IgG antibodies in Camelidae i.e. camels, dromedaries and llamas.
- Heavy chain antibodies constitute about one fourth of the IgG antibodies produced by the camelids, llamas. These antibodies are formed by two heavy chains but are devoid of light chains.
- the variable antigen binding part is referred to as the VHH domain and it represents the smallest naturally occurring, intact, antigen-binding site
- VNAR Single VH-like domain in their antibodies termed VNAR (Nuttall et al. "Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70" Eur. J. Biochem. (2003) 270, 3543-3554; Dooley et al. "Selection and characterization of naturally occurring single-domain (IgNAR) antibody fragments from immunized sharks by phage display” Molecular Immunology (2003) 40, 25-33; Nuttall et al.
- DAbs are the smallest known antigen-binding fragments of antibodies, ranging from 11kDa to 15kDa. They are highly expressed in microbial cell culture. Each dAb contains three of the six naturally occurring complementarity dertermining regions (CDRs) from an antibody.
- the immunoglobulin or fragment thereof may be monovalent, multivalent
- multispecific i.e. bivalent, trivalent, tetravalent, in that it comprises more than one antigen binding site.
- the antigen binding sites may be derived from the same parent antibody or fragment thereof or from different antibodies which bind the same epitope. If all binding sites have the same specificity then a monospecific immunoglobulin is produced. Alternatively a multispecific immunoglobulin may be produced binding to different epitopes of the same antigen or even different antigens. It is preferred that the, or at least one of the, binding sites is directed to pathogens (or products thereof such as enzymes produced therefrom) found in the gastro-intestinal tract. If is further preferred that the immunoglobulin or fragment thereof binds to rotavirus and more preferably that it neutralises it.
- immunoglobulin or fragment thereof of the VHH- or VNAR-type, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof may be naturally occurring i.e. elicited in vivo upon immunizing an animal with the desired antigen or synthetically made, i.e. obtained by genetic engineering techniques.
- the food product or pharmaceutical preparation comprises antibodies which are heavy chain immunoglobulins or fragments thereof of the VHH- or VNAR-type, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof which are active in the gut.
- the food product or pharmaceutical preparation comprises a delivery system for delivering the aforementioned_antibodies to the GIT wherein the the delivery system is a microorganism and the immunoglobulins are llama derived antibodies or fragments thereof.
- these transformed micro-organisms will express llama heavy chain antibodies or fragments thereof on their surface and are able to reduce the viral load, normalize the pathology and mitigate the diarrhoea in an animal model of rotavirus infection. Furthermore, the llama heavy chain antibodies or fragments thereof were found to be very effective in reducing infection both in in vitro and in vivo models of rotavirus infection. Llama VHH antibody fragments have surprisingly been found to reduce the viral load, normalize the pathology and mitigate diarrhoea during rotavirus infection.
- VHH sequences having affinity of rotavirus are provided by this specification in the sequence listing, SEQ ID No's 1 to 21 , and figure 12.
- VHH sequences having at least 70%, 80%, 85%, 90%, 95%, 98% or 99% amino acid identity with SEQ ID No. 1 and having affinity for a rotavirus particle or antigen are also preferred embodiments according to this invention.
- VHH sequences may be derived from camellids, via immunization and/or by screening for affinity, but may also be derived from other mammalian species such as mice or humans and/or be camelized by amino acid substitutions, as described in the art.
- the VHH sequences may be fused to yield multimeric units of 2, 3, 4, 5 or more VHH units, optionally linked via a spacer molecule.
- several VHH sequences may be combined, either separately or in one multimeric molecule.
- the VHH sequences have different specificities, for instance VHH sequences may be combined to provide a wide spectrum of affinities for a particular pathogen.
- 2, 3, 4, 5 or more VHH sequences having affinity for any one of rotavirus strains Wa, CK5, Wa1 , RRV or CK5 may be combined, as separate monomeric units or as combined units on a carrier, for instance on a probiotic bacterium and/or on a multimeric molecule.
- llama heavy chain antibodies have also unexpectedly been found to be suitable for administration in the GIT.
- Llama heavy chain antibodies were found to be highly resistant to protease degradation in the stomach and to withstand the acidic environment of the stomach. This is despite the fact that the proteolytic system in the GIT is more aggressive an environment than, for example encountered in the mouth. Activity in the gut is hampered by proteolytic activity, including protease and peptidase.
- proteolytic activity including protease and peptidase.
- the present invention is the first system which enables expression of antibodies in the GIT which are suitable for the management of rotavirus infection.
- probiotic micro-organisms When probiotic micro-organisms are chosen as the delivery system, we have found that these transformed micro-organisms will express llama heavy chain antibodies or fragments thereof on their surface and are able to reduce the viral load, normalize the pathology and mitigate the diarrhoea in an animal model of rotavirus infection.
- the llama heavy chain antibodies are then expressed by the micro-organism in the GIT.
- Expression of the llama derived VHH antibody fragment may be both on the surface of the micro-organism and/or as a secreted protein of the micro-organism.
- Preferably secreted forms of the VHH antibody fragment is in multimeric form to enhance aggregation and clearance of the viral load.
- the micro-organism or more preferably a probiotic bacterium is transformed with an expression vector comprising the gene for the llama heavy chain antibody or fragments thereof.
- the expression vector may contain a constitutive promoter in order to express the antibodies or fragments thereof.
- a constitutive promoter will support in situ expression of antibodies by transformed lactobacilli persisting (at least for a short period) in the intestinal tract after administration.
- the promoter may be chosen to be active only in the GIT and/or stomach/gut i.e. suitable for GIT specific expression only. This will ensure expression and/or secretion of the llama heavy chain antibody or fragments thereof in the GIT 1 preferably the gut.
- Many constitutive promoters for lactobacilli are known in the art and an example of a promoter that is specifically inducible in the GIT is Pldh
- the expression vectors described in the examples are able to replicate in the transformed lactobacilli and express the antibodies of fragments thereof. It will be understood that the present invention is not limited to these replication expression vectors only.
- the whole expression cassette can be inserted in a so-called "integration" plasmid, whereby the expression cassette will be integrated into the chromosome of the lactobacilli after transformation, as known in the art (Pouwels, P.H. and Chaillou, S. Gene expression in lactobacilli (2003) Genetics of lactic acid bacteria page 143-188).
- the food product or pharmaceutical preparation according to the invention further comprises a probiotic micro-organism which is independent from the antibodies or fragments thereof.
- the probiotic micro-organism may be used in either a viable or non-viable condition as desired. If the micro-organisms are to be used in a non-viable state then they may be rendered non-viable by any suitable means.
- the probiotic micro-organism may be any suitable, edible, probiotic bacteria, mould or yeast and in particular may be of any of the types, including the preferred types, listed hereinabove for the micro-organism which forms a part of any delivery system for the antibodies or fragments thereof.
- One particularly preferred probiotic bacteria for use as the 'independent probiotic micro-organism' is Lactobacillus reutarii.
- the amount of the micro-organism in the delivery system in food products of the invention is between 10 6 and 10 11 per serving or (for example if serving size is not known) between 10 6 and 10 11 per 100 g of product, more preferred these levels are from 10 8 to 10 9 per serving or per 100 g of product.
- it is advantageous of the total amount of micro-organism in the food product i.e.
- the total of the amount of the micro-organism in the delivery system and the amount of the probiotic micro-organism which is independent from the antibodies or fragments thereof) is between 10 6 and 10 11 per serving or (for example if serving size is not known) between 10 6 and 10 11 per 100 g of product, more preferred these levels are from 10 8 to 10 9 per serving or per 100 g of product.
- the probiotic micro-organism may be added by any suitable means to the food product or pharmaceutical preparation.
- food products may be prepared according to the invention, for example meal replacers, soups, noodles, ice-cream, sauces, dressing, spreads, snacks, cereals, beverages, bread, biscuits, other bakery products, sweets, bars, chocolate, chewing gum, diary products, dietetic products e.g. slimming products or meal replacers etc.
- food products of the invention may also be dietary supplements, although the application in food products of the above type is preferred.
- the transformed micro-organisms can be added as viable cultured (wet) biomass or as a dried preparation, still containing viable micro-organisms as known in the art.
- Table 1 indicates a number of products, which may be prepared according to the invention, and a typical serving size.
- An alternative means of administration of the antibodies or fragments thereof (including a delivery system comprising a micro-organism transformed with antibodies or functional fragments thereof) and the probiotic micro-organisms comprises a dispensing implement for use with a food product comprising probiotic micro-organisms which implement is coated on at least one surface with antibodies or anti-body fragments which are active in the gut. It is preferred that the antibodies or antibody fragments comprise a delivery system for delivering the antibodies or antibody fragments to the GIT.
- Yet another alternative means of administration of the antibodies or fragments thereof and the probiotic micro-organisms comprises a dispensing implement for use with a food product wherein the dispensing implement is coated on at least one surface with antibodies or anti-body fragments which are active in the gut and probiotic micro-organisms. It is preferred that the antibodies or antibody fragments comprise a delivery system for delivering the antibodies or antibody fragments to the GIT.
- the delivery system comprises encapsulated antibodies or antibody fragments and/or that wherein the delivery system comprises a micro-organism transformed to be able to produce antibodies or fragments thereof.
- dispensing implement covers tube, straws, knives, forks, spoons or sticks or other implements which are used to deliver a liquid or semi-solid food product to a consumer.
- the dispensing implement may also be used to deliver a solid food product to a consumer.
- This dispensing tube or straw is especially suitable for use with certain beverages where high or low pH and/or temperature means that direct addition of the micro-organism to the beverage is not recommended.
- the dispensing implement can be also be used when the delivery system of the invention comprises encapsulated antibodies or fragments thereof or even with antibodies or fragments thereof per se.
- the dispensing implement is coated with the relevant components according to the above, the implement is stored in an outer envelope which is impermeable to moisture and other contamination.
- the coating material which contains these particles is non-toxic to humans and to bacteria and can be an oil such as com oil or a wax. This aspect is described in US 6,283,294 B1. Once the dispensing implement containing these components penetrates the beverage or semi-solid food product, the particles are integrated into the food product, giving a desirable dose of the antibodies or fragments thereof and the probiotic micro-organisms with a serving of the product.
- the components above to be coated onto the implement may be suspended in water which is then applied to the dispensing implement and evaporated.
- the dispensing implement will have a coating of the components which can then be released when the dispensing implement comes into contact with the liquid or semi-solid food product.
- a still further embodiment of the invention relates to a method for making a food product or pharmaceutical preparation according to the fourth aspect of the invention.
- the micro-organism and/or the probiotic micro-organism is/are alive in the product, for example, if the product is heated during processing, the microorganism has to be added after the heating step (post-dosing). However, if a product is fermented with the micro-organism, a heating step after the fermentation may not be acceptable. If the product is a liquid product, administration of the micro-organism could take place by use of a dispensing implement such as a drinking straw.
- a further embodiment of the invention relates to the use of the food product or pharmaceutical preparation according to the invention to deliver health benefits to the gut of a subject after administration.
- health benefits include the specific health benefit the antibody may provide.
- the micro-organism itself used in any delivery system may also provide several health effects for example relating to gut well being such as IBS (Irritable Bowel Syndrome), reduction of lactose maldigestion, clinical symptoms of diarrhoea, immune modulation, anti-tumor activity, adjuvant effects and enhancement of mineral uptake.
- the food product or pharmaceutical preparation according to the present invention may be suitable for the management, including treatment or prophylaxis of infections caused by enteropathogenic bacteria or viruses.
- Other antibodies which may be incorporated into the invention will be able to provide a multitude of other health benefits.
- the present invention is based on the finding that heavy chain immunoglobulins or fragments thereof of the VHH- or VNAR-type, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof, of the invention may be used in the therapy or prophylaxis of infection by enteropathogenic micro- organisms. Furthermore, the immunoglobulins or fragments thereof of the VHH- or VNAR-type, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof, may be used in the therapy or prophylaxis of viral gastroenteritis or diarohoea caused by the enteropathogenic microorganism rotavirus.
- a further advantage of the present invention is that the use of food products or pharmaceutical preparations comprising probiotic micro-organisms expressing immunoglobulins or fragments thereof of the VHH- or VNAR-type, or domain antibodies (dAbs) of the heavy or light chains of immunoglobulins or fragments thereof, enables the micro-organism used as part of any delivery system, for example Lactobacillus, to provide the normal health benefits associated therewith, together with the prophylactic/therapeutic benefits in the management of the infection to be treated.
- This "dual effect" therapy provides greater health benefits to the subject than that known in the art.
- the heavy chain immunoglobulins or fragments thereof of the VHH type are derived from camelids, including llama and camels. Many llama derived heavy chain antibody fragments have been disclosed in the art. More preferred is the heavy chain immunoglobulin or fragment thereof which shows binding affinity with a dissociation constant of at least 10 exp 5 for rotavirus, especially rotavirus strains Wa, CK5, Wa1 , RRV or CK5.
- llama heavy chain antibodies are effective in the management of rotavirus infection.
- the health benefit delivered will include an anti-diarhoeal effect.
- llama heavy chain antibodies can be used in the management of rotavirus infection, including the therapy or prophylaxis of rotavirus infection.
- llama VHH antibody fragments can reduce the viral load, normalize the pathology and mitigate diarrhoea during rotavirus infection.
- Rotavirus continues to be the single most common cause of infantile diarrhoea in the world and most children get infected during the first 5 years of life. In developing countries, rotavirus induced diarrhoea may cause 600,000 to 870,000 deaths each year and in developed countries, rotavirus disease accounts for immense economic loss.
- llama heavy chain antibodies have also unexpectedly been found to be suitable for administration in the gut.
- the llama heavy chain antibodies were found to be highly resistant to protease degradation in the stomach and to withstand the acidic environment of the stomach. This is despite the fact that the proteolytic system in the gut/stomach is more aggressive an environment than, for example encountered in the mouth.
- the in vivo production of antibody fragments locally in the GIT circumvents the practical problem of degradation of orally administered antibodies in the stomach.
- the present invention is the first system which enables expression of antibodies in the GIT which are suitable for the management of rotavirus infection.
- the use of food products or pharmaceutical preparations comprising lactobacilli expressing llama heavy chain antibodies enables the lactobacilli used as part of any delivery system to provide the normal health benefits associated therewith together with the prophylactic/therapeutic benefits in the management of rotavirus infection.
- the present invention is the first system which enables expression of antibodies in the GIT which are suitable for the management of rotavirus infection.
- the food product or pharmaceutical preparation can be administered in order to deliver a health benefit to the subject and/or to combat a specific disease or infection.
- the choice of the antibody will depend on the disease to be treated.
- the micro-organism is transformed with an expression vector comprising the gene for the llama heavy chain antibody or fragment thereof.
- an expression vector comprising the gene for the llama heavy chain antibody or fragment thereof.
- Either an integrating or a replicating vector may be used.
- the encapsulation method should survive passage to the stomach through the GIT and should be able to provide a sustained release of the antibody over a set period of time. This will ensure that the llama heavy chain antibody or fragment is delivered over time to the stomach. Llama heavy chain antibodies or heavy chains thereof are particularly suitable for this encapsulation method due to their ability to survive in the gut when released.
- the antibodies which form part of any delivery system may be delivered to the GIT using a micro-organism transformed with llama heavy chain antibodies comprising the steps of i) transforming the micro-organism with the gene encoding llama heavy chain antibodies; and ii) administering the transformed micro-organism to the GIT of the human or animal in need of therapy.
- Margarines and other spreads typically these are oil in water or water in oil emulsions, also spreads which are substantially fat free are covered. Typically these products are spreadable and not pourable at the temperature of use e.g. 2-10 C.
- Fat levels may vary in a wide range e.g. full fat margarines with 60-90 wt% of fat, medium fat margarines with 30-60 wt% of fat, low fat products with 10-30 wt% of fat and very low or fat free margarines with O to 10 wt% of fat.
- the fat in the margarine or other spread may be any edible fat, often use are soybean oil, rapeseed oil, sunflower oil and palm oil. Fats may be used as such or in modified form e.g. hydrogenated, esterified, refined etc. Other suitable oils are well known in the art and may be selected as desired.
- the pH of a margarine or spread may advantageously be from 4.5 to 6.5.
- spreads other than margarines are cheese spreads, sweet spreads, yogurt spreads etc.
- Optional further ingredients of spreads may be emulsifiers, colourants, vitamins, preservatives, emulsifiers, gums, thickeners etc.
- the balance of the product will normally be water.
- a typical size for an average serving of margarine or other spreads is 15 grams.
- Preferred VHH-producing Lactobacillus in the margarine or spread are 10 6 and 10 11 per serving most preferred 10 8 to 10 10 per serving.
- the Lactobacillus strain has to be added aseptically after the heating steps in the process.
- encapsulated VHH's may be added to these food products.
- frozen confectionery product includes milk containing frozen confections such as ice-cream, frozen yoghurt, sherbet, sorbet, ice milk and frozen custard, water-ices, granitas and frozen fruit purees.
- the level of solids in the frozen confection is more than 3 wt%, more preferred from 10 to 70 wt%, for example 40 to 70 wt%.
- Ice-cream will typically comprise 2 to 20 wt% of fat, 0 to 20 wt% of sweeteners, 2 to 20 wt% of non-fat milk components and optional components such as emulsifiers, stabilisers, preservatives, flavouring ingredients, vitamins, minerals, etc, the balance being water.
- ice-cream will be aerated e.g. to an overrun of 20 to 400 %, more general 40 to 200 % and frozen to a temperature of from -2 to -200 C, more general -10 to -30 C. Ice-cream normally comprises calcium at a level of about 0.1 wt%.
- a typical size of an average serving of frozen confectionary material is 150 grams.
- Preferred Lactobacillus levels are from 10 6 and 10 11 per serving, more preferred these levels are from 10 7 to 10 10 per serving most preferred 10 8 to 10 9 per serving.
- the Lactobacillus strain has to be added aseptically after the heating steps in the process.
- encapsulated VHH's may be added to these food products.
- Lactobacillus can advantageously be used to beverages for example fruit juice, soft drinks etc.
- a very advantageous beverage in accordance to the invention is a tea based product or a meal replacers drink. These products will be described in more detail herein below. It will be apparent that similar levels and compositions apply to other beverages comprising vitamin Lactobacillus bacteria.
- tea based products refers to products containing tea or tea replacing herbal compositions e.g. tea-bags, leaf tea, herbal tea bags, herbal infusions, powdered tea, powdered herbal tea, ice-tea, ice herbal tea, carbonated ice tea, carbonated herbal infusion etc.
- tea based products of the invention may need a preparation step shortly before consuming, e.g. the making of tea brew from tea-bags, leaf tea, herbal tea bags or herbal infusions or the solubilisation of powdered tea or powdered herbal tea.
- a preparation step shortly before consuming, e.g. the making of tea brew from tea-bags, leaf tea, herbal tea bags or herbal infusions or the solubilisation of powdered tea or powdered herbal tea.
- the level of Lactobacillus in the product such that one serving of the final product to be consumed has the desired levels of Lactobacillus as described above.
- ice-tea For ice-tea, ice herbal tea, carbonated ice tea, carbonated herbal infusions the typical size of one serving will be 200 ml or 200 grams.
- Meal replacer drinks are typically based on a liquid base which may for example be thickened by means of gums or fibres and whereto a cocktail of minerals and vitamins are added.
- the drink can be flavoured to the desired taste e.g. fruit or choco flavour.
- a typical serving size may be 330 ml or 330 grams.
- Lactobacillus levels are 10 6 and 10 11 per serving, more preferred these levels are form 10 7 to 10 10 per serving most preferred 10 8 to 10 9 per serving.
- encapsulated VHH's may be added to these food products. Preferably between 25 and 5000 ⁇ g per serving is added, more preferably between 50 and 500 ⁇ g are added per serving. Most preferably two or three servings are given each day.
- the aim is to ensure that one serving of 200 ml or 200 grams comprises the desired amounts as indicated above.
- the Lactobacillus present in the tea based product to be extracted will eventually be extracted into the final tea drink.
- the Lactobacillus may advantageously be incorporated into the tea component. However it will be appreciated that for some application it may be advantageous to separate the Lactobacillus from the tea, for example by incorporating it into a separate compartment of the tea bag or applying it onto the tea-bag paper. Alternatively, the micro-organism may be administered in dried form through the use of a straw, spoon or stick with a coating of dried microorganism.
- the oil phase of the emulsion generally is 0 to 80 wt% of the product.
- the level of fat is typically from 60 to 80%, for salad dressings the level of fat is generally 10-60 wt%, more preferred 15-40 wt%, low or no fat dressings may for example contain triglyceride levels of 0, 5, 10, 15% by weight.
- Dressings and mayonnaise are generally low pH products having a preferred pH of from 2-6.
- Dressings or mayonnaise optionally may contain other ingredients such as emulsifiers (for example egg-yolk), stabilisers, acidifiers, biopolymers, bulking agents, flavours, colouring agents etc.
- emulsifiers for example egg-yolk
- stabilisers for example acidifiers, biopolymers, bulking agents, flavours, colouring agents etc.
- the balance of the composition is water which could advantageously be present at a level of 0.1 to 99,9 wt%, more general 20-99 wt%, most preferred 50 to 98 wt%.
- a typical size for an average serving of dressings or mayonnaise is 30 grams.
- Preferred levels of Lactobacillus in such products would be 10 6 and 10 11 per serving, more preferred these levels are from 10 7 to 10 10 per serving most preferred 10 8 to 10 9 per serving.
- the Lactobacillus strain has to be added aseptically after the heating steps in the process.
- encapsulated VHH's may be added to these food products.
- the matrix may be a fat based (e.g. couverture or chocolate) or may be based on bakery products (bread, dough, cookies etc) or may be based on agglomerated particles (rice, grain, nuts, raisins, fruit particles).
- a typical size for a snack or meal replacement bar could be 20 to 200 g, generally from 40 to 100 g.
- Preferred levels of Lactobacillus in such products would be 10 6 and 10 11 per serving, more preferred these levels are from 10 7 to 10 10 per serving most preferred 10 8 to 10 10 per serving.
- the Lactobacillus strain has to be added aseptically after the heating steps in the process.
- encapsulated VHH's may be added to these food products.
- Preferably between 25 and 5000 ⁇ g per serving is added, more preferably between 50 and 500 ⁇ g are added per serving. Most preferably two or three servings are given each day.
- flavouring materials may be added to the above product such as flavouring materials, vitamins, minerals etc.
- Lactobacillus per serving has been given as a preferred example. It will be understood that alternatively any suitable micro-organism or virus may be present at this level.
- Lemonade powder Lactobacillus can also be used in dry powders in sachets, to be dissolved instantly in water to give a refreshing lemonade.
- a powder may have a food-based carrier, such as maltodextrin or any other.
- Optional further ingredients may be colourants, vitamins, minerals, preservatives, gums, thickeners etc.
- a typical size for an average serving or margarine or other spreads is 30-50 grams.
- Preferred VHH-producing Lactobacillus in the lemonade powder are 10 6 and 10 11 per serving most preferred 10 8 to 10 10 per serving.
- the Lactobacillus strain has to be sprayed on the carrier in such a way that it is kept alive, according to methods known by those skilled in the art.
- encapsulated VHH's may be added to these food products. Preferably between 25 and 5000 ⁇ g per serving is added, more preferably between 50 and 500 ⁇ g are added per serving.
- the transformed micro-organism can be added as viable cultured (wet) biomass or as a dried preparation, still containing the viable microorganisms as known in the art.
- Examples 1 to 3 Generation of Antibody fragments with subsequent in-vitro and in vivo testing.
- Rhesus rotavirus strain RRV (serotype G3) was purified, amplified and concentrated as described previously (Svensson L., Finlay B. B., Bass D., Vonbonsdorff CH. ,
- a llama was immunized subcutaneously and intramuscularly at day 0, 42, 63, 97 and
- RNA was isolated from the 153-day blood sample of about 150 ml via centrifugation on a Ficoll (Pharmacia) discontinuous gradient. From these cells, total RNA (between 250 and 400 ⁇ g) was isolated by acid guanidium thiocyanate extraction Chomczynski, P. and Sacchi, N. "Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction". Anal. Biochem. (1987)162:156-159. Subsequently, first strand cDNA was synthesized using the Amersham first strand cDNA kit (RPN1266). In a 20 ⁇ l reaction mix 0.4-1 ⁇ g mRNA was used. The 6-mer random primer was used to prime the first DNA strand. After cDNA synthesis, the reaction mix was directly used for amplification by PCR. VHH genes were amplified with primers
- Lam-16 (GAGGTBCARCTGCAGGASAGYGG); Lam-17 : (GAGGTBCARCTGCAGGASTCYGG); Lam-07 (priming to the short hinge region); and Lam-08 (long hinge specific)
- the amplified products were digested with Pst ⁇ and ⁇ /ofl (New England Biolabs, US) and cloned in phagemid vector pUR5071 , which is based on pHEN1
- lmmunotubes (Nunc, Roskilde, Denmark) were coated overnight at 4 0 C with either a 1 :1000 dilution of anti-rotavirus rabbit sera or anti-rotavirus guinea pig sera in carbonate buffer (16% (v/v) 0.2 M NaHCO 3 + 9% (v/v) 0.2 M Na 2 CO 3 ). Viral particles were captured via polyclonal anti-rotavirus sera.
- the antibody fragment displaying phages have selected in an acidic environment. This was done by selecting in a dilute HCI solution (pH 2.3). After this adapted selection process, the standard procedure was followed. Soluble VHH was produced by individual E.
- Microlon F (Greiner Bio-One GmbH, Germany) plates were coated with 50 ⁇ l / well of a 1 :1000 dilution of either anti-rotavirus rabbit polyclonal sera or anti- rotavirus guinea pig polyclonal sera in carbonate buffer (16% (v/v) 0.2 M NaHCO3 + 9% (v/v) 0.2 M Na 2 CO 3 ) and subsequently incubated with rotavirus strain RRV or CK5 (approx. 10 9 pfu/ml).
- VHH's were detected with a mixture of the mouse anti-myc monoclonal antibody 9E10 (500 ng/ml, in-house production) and anti-mouse HRP conjugate (250 ng/ml, Dako, Denmark). Alternatively, detection was performed with anti-6*His-HRP antibody conjugate (1000 ng/ml, Roche Molecular, US). Fingerprint analysis (Marks, J.D., Hoogenboom, H.R., Bonnert, T.P., McCafferty, J., Griffiths, A.D. and Winter, G. "By-passing immunization: Human antibodies from V-gene libraries displayed on phage". J. MoI. Biol. (1991 ) 222: 581-597) with the restriction enzyme H/nFI (New England Biolabs, US) was performed on all clones. Sequencing was performed at Baseclear B.V. (Leiden, The Netherlands).
- a set of rotavirus-specific antibody fragments was selected. DNA sequences encoding these antibody fragments were isolated from pUR5071 (PstUBstEW, New England Biolabs, US)) and cloned into pUR4547 which is identical to the previously described pUR4548 (Frenken, L.G.J. , et al. "Isolation of antigen specific Llama VHH antibody fragments and their high level secretion by Saccharomyces cerevisiae”. J. Biotechnol. (2000) 78, 11-21 ) but does not encode any C-terminal tag-sequences.
- This episomal yeast expression vector contains the G ALl promoter, the SUC2 signal sequence for high level expression and secretion into the growth medium, respectively.
- the S. cerevisiae strain VWK18gal1 was transformed and induced for antibody fragment production as described previously (Van der Vaart, J. M., "Expression of VHH antibody fragments in Saccharomyces cerevisiae”. In Methods in Molecular Biology (2001) Vol. 178, p 359-366, Edited by P.M. O'Brien and R. Aiken, Humana Press Inc., Totowa, NJ). Antibody fragments were purified and concentrated by filtration over microcon filters with a 1OkDa cut-off (Amicon, US).
- Bovine Rotavirus Compton CK5 was obtained from the Moredun Institute, Midlothian, Scotland and the BS-C1 cells were purchased from the European Animal Cell Culture Collection.
- the BS-C1 cells were cultured in Earles Modified Essential Medium supplemented with 10% Heat inactivated foetal calf serum, 1% MEM Amino Acids solution (100X) 1 20mmol I "1 L-Glutamine, 100 I. U. ml "1 penicillin, 100 ⁇ g ml "1 streptomycin and 2.5 ⁇ g ml "1 amphotericin B (all from Sigma, US).
- CK5 Rotavirus stock was diluted in Serum Free Medium (SFM) EMEM supplemented with 1 % MEM Amino Acids solution (100X), 20mmol I "1 L-Glutamine and 0.5 ⁇ g/ml crystalline trypsin and then 5ml of diluted seed was added to confluent monolayers of BS-C1 cells in 162cm 2 tissue culture flasks (Costar, UK). The virus was adsorbed onto the cells for one hour at 37°C then the medium was topped up to 75ml. The bottles were incubated at 37°C until complete cytopathic effect was observed.
- SFM Serum Free Medium
- 100X 1 % MEM Amino Acids solution
- Cultures were frozen (-70 0 C) and thawed twice, then pooled and centrifuged at 145Og for 15 minutes at 4 0 C to remove cell debris. The supernatant was decanted and stored in aliquots at -70 0 C.
- Monolayers of BS-C1 cells were cultured in 12-well tissue culture plates at 37 0 C in an atmosphere of 95% air and 5% carbon dioxide. The medium was removed and replaced with SFM for at least 2 hours prior to use.
- the CK5 virus was diluted to give approximately 50 pfu/ml in SFM.
- the selected anti-rotavirus fragments were diluted in SFM and then equal volumes of virus and fragment dilution were mixed (200 ⁇ l total volume) and incubated for one hour at 37°C.
- the virus-fragment mixtures were then plated onto the monolayers of cells (three replicate wells each). The plates were incubated for one hour at 37°C in an atmosphere of 95% air and 5% carbon dioxide.
- Figure 1 shows virus neutralisation of rotavirus CK5 determined by an in vitro plaque assay. The average neutralisation-rate from the four obtained measurements is indicated at each data-point. If there is a spread of over 10% at a data point, the two most extreme measurements are indicated (dashed bar). The tested antibody fragments were divided over 2 graphs, A and B. A's negative controls either the virus was omitted (no virus) or a non-rotavirus specific VHH was added. The non-specific VHH fragment is specific for the human pregnancy hormone hCG.
- VHH fragments were identified that can inhibit rotavirus infection in an in vitro system.
- mice 14 days pregnant, rotavirus negative BALB/c mice were obtained from M ⁇ llegard, Denmark. The mice were housed individually in the animal facility at Huddinge Hospital. Approval was obtained from the local ethical committee of Karolinska Institute at Huddinge Hospital, Sweden. Normal pellet diet and water was provided ad libitum.
- VHH fragments were premixed with titrated amounts (2 x 10 7 ffu) of RRV before it was used for infection on day 1.
- mice pups Four-day old mice pups were treated daily with VHH fragments, including day 0 (day before infection) up to and including day 4 (Fig. 2) and diarrhoea was assessed. A marked reduction in occurrence of diarrhoea was observed for antibody fragment 2B10, shown in figure 2. The number of pups with diarrhoea is significantly lower at day 2 in the group receiving fragment 2B10 compared to the untreated group. Moreover, at days 3, 4 and 5 none of the pups in 2B10 treated group displayed signs of diarrhoea compared to the majority of the pups in the other RRV treated groups (Fig. 2).
- Variable region encoding sequences of both the heavy (VH) and light (VK) chains were amplified using a 5 1 RACE kit (5' RACE System for Rapid Amplification of cDNA Ends (Version 2.0, InvitrogenTM life technologies, Carlsbad, CA).
- the primers for the 5' RACE of VH were
- ACRACE1 ⁇ '-CAGACTCAGGATGGGTAAC-S'
- ACRACE2 ⁇ '-CACTTGAATGATGCGCCACTGTT-S'
- ACRACE3 ⁇ '-GAGGGCTCCCAGGTGAAGAC-S', while the primers, mkRACEI ( ⁇ '-TCATGCTGTAGGTGCTGTCT-S 1 ), mkRACE2 ( ⁇ '-TCGTTCACTGCCATCAATCT-S') and mkRACE3 ( ⁇ '-TGGATGGTGGGAAGATGGAT-S 1 ) were utilized to amplify the variable region of the light chain. The resulting A-tailed
- PCR product was cloned into a pGEM®-T easy vector with 3'-T overhangs and sequenced.
- the VH and VK sequences were fused together with a linker encoding gene (with the amino acid sequence (G 4 S) 3 ). Both chains were re-amplified from the cloned 5' RACE products using the primers
- Linker-VHas (5'- CGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGA
- VH and VK PCR products were mixed together and used as a template for a fusion PCR using the primers CIaI-VHs and EcoRI-VKas.
- the fused PCR products were cloned into a pGEM®-T easy vector after addition of overhang A using Taq DNA polymerase.
- the fused scFv-2A10 encoding sequence was finally cut out from the plasmids using EcoRI plus C/al and subcloned into pBluescript Il SK (+) (Stratagene,
- the VHH1 was amplified from pUR655 using a sense primer containing C/al restriction site and an anti-sense primer containing EcoRI restriction site and then inserted into the pBS-E-tag vector.
- the scFv-2A10-E-tag and the VHH1 -E-tag were excised from the pBS-E- tag vector using C/al and Xho ⁇ restriction sites, and fused to an anchor sequence, the last 244 amino acids of the proteinase P protein of L. casei (Kr ⁇ ger et a/, Nature Biotechnol (2002) 20:702-706), into the Lactobacillus expression vector pLP502 (Fig. 3A and 3C).
- a stop codon was inserted by PCR amplification after the E-tag and the products were inserted into pLP502 between the C/al and Xho ⁇ restriction sites (Fig. 3B and 3D).
- the pLP502 vector contains the constitutive promoter of the lactate dehydrogenase gene ⁇ Pldh).
- lactate dehydrogenase gene ⁇ Pldh.
- Xhol-VHH (5 ' CCGCTCGAGTGCGGCACGCGGTTCC 3 ) for the insert.
- L. paracasei containing the constructs were cultured to an OD 6 oo of 0.8. After centrifugation, the pH of the supematants was adjusted to 7 and filtered through a 0.45 ⁇ m filter.
- the secreted antibody fragments were subsequently purified according to the instructions provided in the RPAS Purification Module (Amersham-Bioscience, Little Chalfont, Buckinghamshire, UK). Dialysis overnight at 8°C was performed with a Spectra/Por ® membrane MWCO 6-8000 (Spectrum Medical Industries, Inc., Los Angeles, CA) against IxPBS. The purified antibody fragments were run on a 15% SDS-poly acrylamide gel to verify the purity of the sample and the concentration of total protein was determined by the BioRad protein assay (BioRad Laboratories, Hercules, CA).
- L. paracasei containing the constructs 2A10-anchor, VHH1-anchor, 2A10-secreted, VH H 1 -secreted, irrelevant-secreted and irrelevant-anchor were cultured in MRS broth containing 3 ⁇ g/ml erythromycin to an OD 6O o of 0.8.
- the bacteria were lysed in 10 mM Tris-HCI pH 8.0 containing 10 mg/ml lysozyme at 37°C for one hour and then disrupted by sonication (6 x 30 s on/off cycles) with 60% duty cycle (Digital Sonifier®, model 250, Branson Ultrasonics coorporation, Danbury, CT). Debris was removed by centrifugation. The supernatants were concentrated 50 x using ultrafiltration (Amicon, Beverly, MA). BioRad protein assay was used to determine the protein concentration as described above.
- Rhesus rotavirus stock (RRV) was used for secondary coating. After blocking, the plates were incubated with the protein extracts or concentrated supernatants.
- Mouse anti-E-tag antibodies (Amersham Pharmacia Biotech, Bucks, UK) or rabbit anti-llama antibodies, horse raddish (HRP) conjugated goat anti-mouse antibodies or swine anti-rabbit antibodies (DAKO A/S, Glostrup, Denmark) and
- TMB 3,3 ' ,5,5 ' -tetramethylbenzidine substrate
- Vmax Microplate Reader Molecular Devices, Sunnyvale, CA
- All antibodies were diluted 1/1000.
- Purified VHH1-E-tag and monoclonal 2A10 antibodies were used as standard to determine the concentration of antibody fragments produced by the different lactobacilli transformants.
- SEM Scanning Electron Microscope
- TEM Transmission Electron Microscope
- Rhesus rotavirus was cultured in MA104 cells as previously described. Plaque- purified RRV was used throughout the study. A single virus stock was produced for the entire study by infecting MA104 cells with RRV at a multiplicity of infection (MOI) of 0.1 in serum-free M199 medium (Gibco Laboratories, Grand Island, N.Y.) containing 0.5 ⁇ g of trypsin (Sigma Chemical Co., St. Louis, Mo.) per ml. When the cytopathogenic effect reached approximately 75% of the monolayer, cells were freeze-thawed twice and cell lysates were cleared by low-speed centrifugation. The virus suspension was divided into aliquots and stored at -80 0 C until use. Determination of virus titers was performed by an immunoperoxidase focus reduction test. A single virus stock was produced for the entire study.
- MOI multiplicity of infection
- Antibody expressing lactobacilli were further tested for inhibitory effect on rotavirus by a microneutralization assay as described previously (Giammarioli et al 1996 as above).
- the bacteria were serially diluted in MEM media and incubated for 1 h at 37°C with 200 ffu of trypsin-activated RRV (100 ⁇ l). At the end of incubation, bacteria were removed by centrifugation and the supernatant was used for inoculating MA104 cell monolayers grown in 96-well plates.
- mice All animal experiments were approved by the local ethical committee of the Karolinska lnstitutet at Huddinge Hospital, Sweden. Pregnant BALB/c female mice were purchased from M ⁇ llegard, Denmark. Four-day-old pups were used for the study. Pups were fed 10 ⁇ of different treatments once a day, starting on day -1 until day 3. Lactobacilli were administered once, one day before rotavirus challenge. Infections were made orally on day 0 using 2x10 7 ffu RRV in 10 ⁇ l volume.
- Sections of the small intestine were taken on day 4 and perfused with 4% neutral buffered formalin and Hematoxylin and Eosin staining was performed after sectioning according to standard protocols. Individual slides were evaluated blindly for typical signs of rotavirus infection.
- Total cellular RNA was isolated from small intestinal tissue and was used for Real Time analysis after digestion of residual genomic DNA using RNase free DNase ® .
- EZ RT-PCR ® core reagent kit PE Applied Biosystems, Foster City, CA, USA
- a standard curve was generated using a pet28a (+) vector with the RRV vp7 gene cloned between the Ncol and Xhol restriction sites.
- Rotavirus vp7 mRNA or viral genomic RNA was amplified at 58 0 C (ABI 7000 cycler, Applied Biosystems) in the presence of 600 nM primers, 30OnM probe, 5mM Mn to generate a 121 bp long amplicon.
- the sense primer (VP7f : 5'-CCAAGGGAAAAT GTAGCAGTAATTC-3') (nucleotide (nt) 791-815), the antisense primer (VP7r: 5'- TGCCACCATTCTTT CCAATTAA-3'), (nt 891-912), and the probe (5'- 6FAM- TAACGGCTGATCCAACCACAGCACC -TAMRA-3' (nt 843-867) were designed based on the vp7 gene sequence of rhesus rotavirus (accession number AF295303). The lowest level of detection of the PCR is 10 viral RNA copies.
- RNA samples from each animal was normalized for the internal housekeeping gene control GAPDH (Overbergh et al, (1999) Cytokine 11 : 305-312). Detection of no virus or less than 10 virus genomes was defined as clearance from infection. Results are shown in Figure 7.
- Feacal samples of three animals from the groups receiving the lactobacilli expressing the VHH1 anchored fragments, non-transformed lactobacilli or a non treated group were collected at the day of termination. The samples were smeared on a Super frost coated glass slide and fixed by methanol.acetone (1 :1) for 10 minutes on ice. A mouse anti-E-tag antibody (1/200) and thereafter a cy2 labelled donkey anti-mouse antibody (1/200) was added to the slides and incubated for 1 hour under humid conditions. The surface expressed VHH1 fragments were detected by fluorescence microscope.
- the diarrhoeal illness in pups was assessed on the basis of consistency of feces. Watery diarrhoea was given a score 2 and loose stool was given a score 1 , no stool or normal stool was given a score 0. The percentage of diarrhoea score was calculated each day. Total daywise score in a treatment group was compared to untreated group by Fisher's exact test. Severity was defined as the sum of diarrhoea score for each pup during the course of the study and duration was defined as the sum of days with diarrhoea. Both severity and duration were analysed by Kruskal Wallis and Dunn tests.
- Fig. 4a shows the surface expression of the 2A10-scFv and VHH1 by lactobacilli was shown by flow cytometry using an anti-E-tag antibody A lower level of detection of the E-tag was observed on lactobacilli producing the 2A10 anchored fragments compared to the VHH1 anchored and irrelevant scFv and VHH control fragments expressing bacteria (data not shown). The binding activity of the antibody fragments was analyzed by ELISA and electron microscopy.
- VHH1 -anchor transformants The amount of antibody fragments produced by the VHH1 -anchor transformants was calculated to be approximately 10 4 VHH1 fragments/bacteria, and 600 2A10 fragments/bacteria (intracellular and on the surface). The VHH1-secreted transformants produced approximately 1 ⁇ g/ml of VHH1 fragments in the supernatant.
- Figures 4b and 11a show lactobacilli expressing VHH1 antibody fragments on their surface, which were incubated with rotavirus and then analyzed by SEM. The results showed binding of the virus on the bacterial surface (Fig 4ba and 11 b), but not to a non-transformed L. paracasei strain (Fig. 11 b).
- TEM negative staining
- binding to the virus by llama antibody fragments from the supernatant of lactobacilli transformed with the VHH1 -secreted vector could be demonstrated, whereas the non-transformed L. paracasei strain control supernatant did not bind rotavirus (data not shown).
- Lactobacillus produced antibody fragments in a rotavirus neutralization assay was analysed in Figure 5.
- the solid line of this figure represents neutralization level achieved by lactobacilli produced E-tag purified VHH 1 antibody (20 ⁇ g/ml). Dotted line indicates the neutralization level of 2A10 monoclonal hybridoma supernatant (147 ng/ml). Neutralization achieved by different concentrations of VHH 1 anchored lactobacilli ( ⁇ ), 2A10 anchored lactobacilli ( ⁇ ) and non-transformed lactobacilli (D).
- Figure 5 shows a significant dose-dependent reduction of the infection in the presence of lactobacilli expressing surface bound VHH1 or in the presence of the supernatant containing the secreted VHH1. A slight neutralizing capacity of the supernatant from non-transformed lactobacilli was also observed.
- the 2A10- transformed lactobacilli secreted and anchored were not protective even though the supernatant of the 2A10 monoclonal hybridoma cells, containing 150 ng/ml of the antibody was 95% protective.
- Figure 6 shows the prevalence of diarrhoea in mice trated with lactobacilli expressing VHH1 -anchored fragments.
- Figure 7 shows that in the untreated group, histology of the duodenum and jejunum sections reveals typical signs of rotavirus infection; swelling of villus tips, vacuolization, constriction of villus bases and unpolarized nuclei within cells (a).
- Figure 8 shows that the mean viral load in VHH 1 anchored treatment group is at least 200 fold lower than untreated group. A probiotic effect of irrelevant lactobacilli controls was also seen (10 fold reduction in viral load). Clearance from virus was defined as no vp7 detection or detection of less than 10 vp7 RNA molecules. 27% animals were cleared of rotavirus in VHH1 anchored treatment group as compared to 9% in untreated group.
- Pups were fed lactobacilli expressing the anchored VHH1 against rotavirus once (on day 0) and half of them were subsequently infected with RRV on day 1. Two pups in each group were sacrificed every second day and checked for the presence of Lactobacillus transformants by culturing of the intestinal content. The bacteria could be detected in the duodenum and the ileum 48 h post treatment with no difference between the rotavirus infected and uninfected groups, whereas at 96 h post treatment, no transformants could be detected (data not shown).
- the therapeutic effect of the transformed lactobacilli was tested in a mouse pup model of rotavirus-induced diarrhea.
- Pups were orally fed lactobacilli expressing the 2A10-scFv or the VHH1 in secreted or anchored forms during five days (day -1 to 3) and infected with RRV on day 0.
- Control groups included non-transformed L. paracasei and bacteria expressing an irrelevant anchored VHH antibody fragment. 10 8 CFU as the optimal dose for diarrhea intervention (Fig. 9).
- the surface VHH1 expressing bacteria shortened the disease duration (normal duration 1.2 days) by approximately 0.9 days (P ⁇ 0.01 ) and by 0.7 days compared to mice treated with non-transformed L. paracasei (P ⁇ 0.05).
- the severity of the diarrhea was also reduced from 3.7 to 1.7 in mice treated with surface VHH1 expressing lactobacilli as compared to the disease severity in untreated pups (P ⁇ 0.001 ) and by a factor of 1.2 in comparison to pups treated with non-transformed L. paracasei (P ⁇ 0.01 ).
- a minor probiotic effect by the non-transformed lactobacilli was also observed (Table 2).
- the diarrhea prevalence was significantly lowered both on days 2 and 3 in mice treated with the Lactobacillus expressing surface VHH 1 in comparison to untreated mice (P ⁇ 0.0001 , for both days) or mice treated with non-transformed L. paracasei (P ⁇ 0.02, for day 2) (Fig. 6a).
- Histological examination of proximal small intestine sections on day 4 revealed a marked reduction of pathological changes in rotavirus infected animals treated with surface VHH 1 expressing lactobacilli and in some mice, the histology was completely normalized.
- the histology in the group receiving no lactobacilli revealed typical signs of rotavirus infection with swelling of villus tips, constriction of villus bases, vacuolization and irregularly placed cell nuclei (Fig. 7a,b,c,d).
- a real time PCR for expression of the rotavirus vp7 gene was developed.
- the mean viral load in animals receiving lactobacilli expressing surface bound VHH1 antibody fragments was at least 250 fold lower than in untreated mice. Lactobacilli expressing an irrelevant VHH fragment also reduced the viral vp7 load (up to 10 fold). The clearance rate was 27% in the group given lactobacilli expressing surface anchored VHH1 as compared to 9% in the untreated group ( Figure 8).
- a solution of 2% sodium alginate was added dropwise to a solution of 0.1 M calcium chloride, containing 1% of the VHH, resulting in the formation of calcium alginate beads (with a size of about 2 mm).
- the dispersion was allowed to stand for 30 min for the calcium alginate beads to settle at the bottom of the beaker.
- the beads were then collected with a sieve and washed once with water
- compositions and preparations of ice creams containing encapsulated anti- rotavirus VHH or a Lactobacillus producing this VHH and probiotic bacteria are included in compositions and preparations of ice creams containing encapsulated anti- rotavirus VHH or a Lactobacillus producing this VHH and probiotic bacteria.
- ice cream composition is a food product according to the invention.
- Probiotic bacteria* 1 at an amount of between 10 6 and 10 11 per 100 g of the ice-cream composition
- the probiotic bacteria may be any of the types mentioned in the detailed description.
- All the ice cream ingredients are mixed together using a high shear mixer for approximately 3 minutes.
- the water is added at a temperature of 80 0 C.
- the temperature of the water ice mix is approximately 55-65°C after mixing.
- the mix is then homogenized (2000 psi) and passed through to a plate heat exchanger for pasteurization at 81 0 C for 25 seconds.
- the mix is then cooled to approximately 4°C in the plate heat exchanger prior to use.
- an anti-rotavirus VHH producing Lactobacillus strain can be added instead of the encapsulated VHH solution, preferably in a concentration of 10 9 per serving or higher.
- the ice cream pre-mix is then frozen using a Technohoy MF 75 scraped surface heat exchanger, e.g. with no overrun introduced into the ice cream.
- the ice cream can be extruded at a temperature of from -4.4 0 C to -5.4° C.
- the product can then be hardened in a blast freezer at -35 0 C, then stored at -25 0 C.
- a water ice solution having the following composition was prepared as follows;
- Probiotic bacteria *1 at an amount of between 10 6 and 10 11 per 100 g of the ice-cream composition, water to 100 Total soluble solids; 25.5 % by weight Ice content at -18 0 C; 62% by weight
- All the water ice ingredients are mixed together using a high shear mixer for approximately 3 minutes.
- the water is added at a temperature of 80 0 C.
- the temperature of the water ice mix is approximately 55-65 0 C after mixing.
- the mix is then homogenized (2000 psi) and passed through to a plate heat exchanger for pasteurization at 81 0 C for 25 seconds.
- the mix is then cooled to approximately 4° C in the plate heat exchanger prior to use.
- a anti-rotavirus VHH producing Lactobacillus strain can be added preferably in a concentration of 10 9 per serving or higher.
- the water ice solution may be frozen in a Technohoy MF 75 scraped surface heat exchanger with an overrun (volume fraction of air) of 30%.
- the water ice may be extruded at a temperature of from -3.8 0 C to -4.5 0 C.
- the product may then be hardened in a blast freezer at -35° C, and stored at -25°C.
- Lactobacillus producing this VHH and probiotic bacteria Lactobacillus producing this VHH and probiotic bacteria.
- a anti- rotavirus VHH producing Lactobacillus strain can be added aseptically, preferably in a concentration of 10 9 per serving or higher.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Food Science & Technology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Polymers & Plastics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nutrition Science (AREA)
- Immunology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- Inorganic Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Alternative & Traditional Medicine (AREA)
- Biotechnology (AREA)
- Medical Informatics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP06753916A EP1915174A1 (en) | 2005-08-19 | 2006-05-24 | Food products comprising probiotic micro-organisms and antibodies |
| BRPI0615547-2A BRPI0615547A2 (en) | 2005-08-19 | 2006-05-24 | food preparation, pharmaceutical preparation, food product manufacturing method, pharmaceutical preparation manufacturing method, food product use, pharmaceutical preparation uses, gut health benefit delivery method and release implements for use with food product |
| US11/990,214 US20090226418A1 (en) | 2005-08-19 | 2006-05-24 | Food Products Comprising Probiotic Micro-Organisms and Antibodies |
| MX2008002222A MX2008002222A (en) | 2005-08-19 | 2006-05-24 | Food products comprising probiotic micro-organisms and antibodies. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP05076940.5 | 2005-08-19 | ||
| EP05076940 | 2005-08-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007019901A1 true WO2007019901A1 (en) | 2007-02-22 |
Family
ID=35509292
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2006/005060 Ceased WO2007019901A1 (en) | 2005-08-19 | 2006-05-24 | Food products comprising probiotic micro-organisms and antibodies |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20090226418A1 (en) |
| EP (1) | EP1915174A1 (en) |
| CN (1) | CN101360512A (en) |
| BR (1) | BRPI0615547A2 (en) |
| MX (1) | MX2008002222A (en) |
| WO (1) | WO2007019901A1 (en) |
| ZA (1) | ZA200800978B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009127519A1 (en) * | 2008-04-18 | 2009-10-22 | Unilever Nv | Compositions comprising antibodies or antibody fragments |
| EP2138187A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory IgA and infection |
| EP2138186A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory IgA and inflammation |
| US20100291101A1 (en) * | 2007-04-24 | 2010-11-18 | Bio-Support Co., Ltd. | New anti-irc85 monoclonal antibody; and composition comprising the same for preventing and treating tuberculosis or enteritis disease; and the use thereof |
| CN102304489A (en) * | 2011-09-23 | 2012-01-04 | 北京龙科方舟生物工程技术中心 | Lactobacillus reuteri strain and application thereof |
| EP2452576A1 (en) * | 2010-11-11 | 2012-05-16 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2482535A (en) * | 2010-08-05 | 2012-02-08 | Hera Pharmaceuticals Inc | Expression of antibody or a fragment thereof in lactobacillus |
| GB2482536B (en) | 2010-08-05 | 2013-07-24 | Hera Pharmaceuticals Inc | Expression of antibody or a fragment thereof in lactobacillus |
| CN103209596A (en) * | 2010-11-11 | 2013-07-17 | 雀巢产品技术援助有限公司 | Frozen confections containing probiotic micro-organisms |
| ES2742734T3 (en) | 2010-11-23 | 2020-02-17 | Pantheryx Inc | Compositions and procedures for treatment in clinical applications of general spectrum, not differentiated or mixed |
| AU2012234193B2 (en) * | 2011-03-29 | 2016-07-21 | Nestec S. A. | Natural derivative of the Lactobacilus johnsonii strain CNCM I-1225, deficient in D-lactic acid production and with a further improved immune profile |
| US9788563B2 (en) * | 2011-04-15 | 2017-10-17 | Pepsico, Inc. | Encapsulation system for protection of probiotics during processing |
| CN103656633A (en) * | 2012-09-10 | 2014-03-26 | 刘占良 | Food grade lactic acid bacteria active carrier Group A rotavirus vaccine and preparation method thereof |
| US10524493B2 (en) * | 2013-09-16 | 2020-01-07 | The Johns Hopkins University | Compositions and methods for preventing or relieving symptoms of infections |
| WO2015145250A2 (en) | 2014-03-27 | 2015-10-01 | Ghosh Sambuddha | Expression of a single chain antibody against salmonella in lactobacillus |
| EP3600365A4 (en) | 2017-03-29 | 2021-01-06 | President and Fellows of Harvard College | Methods of regulating gene expression in a cell |
| CN111491657A (en) | 2017-10-20 | 2020-08-04 | 哈佛学院院长及董事 | Artificial secreted peptides for heterologous protein production |
| WO2020176637A1 (en) | 2019-02-26 | 2020-09-03 | Pantheryx, Inc. | Compositions for management of disorders of the gastrointestinal tract |
| CN114009751B (en) * | 2021-11-16 | 2024-03-26 | 上海昌进生物科技有限公司 | Composition, preparation method and application thereof |
| CN114225025B (en) * | 2021-12-29 | 2022-07-26 | 贵州酵德生物科技有限公司 | Use of probiotic-containing formulations for the treatment of gastrointestinal disorders |
| WO2025225737A1 (en) * | 2024-04-26 | 2025-10-30 | 国立大学法人 東京大学 | Combination and use of microorganism and antibody |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3735777A1 (en) * | 1987-10-22 | 1989-05-03 | Mueller Lierheim S A | Carrier-bound mono- or polyclonal antibody |
| EP0739981A1 (en) * | 1995-04-25 | 1996-10-30 | Vrije Universiteit Brussel | Variable fragments of immunoglobulins - use for therapeutic or veterinary purposes |
| EP0904784A1 (en) * | 1997-09-22 | 1999-03-31 | N.V. Nutricia | Probiotic nutritional preparation |
| WO1999046300A1 (en) * | 1998-03-12 | 1999-09-16 | Unilever Plc | Products comprising inactivated yeasts or moulds and active vhh-type antibodies |
| WO2000006764A1 (en) * | 1998-07-30 | 2000-02-10 | Wisconsin Alumni Research Foundation | Gastrointestinal bacterial antibody factories |
| US20020037341A1 (en) * | 1999-02-08 | 2002-03-28 | Heo Cheol Seong | Food containing active strains for inhibiting infection and treating gastritis, gastric and duodenal ulcers |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AP2007004019A0 (en) * | 2004-11-25 | 2007-06-30 | Unilever Plc | Heavy chain and single domain antibodies |
| MX2008000722A (en) * | 2005-07-20 | 2008-03-18 | Unilever Nv | Edible product containing beneficial moulds and/or yeasts. |
-
2006
- 2006-05-24 ZA ZA200800978A patent/ZA200800978B/en unknown
- 2006-05-24 US US11/990,214 patent/US20090226418A1/en not_active Abandoned
- 2006-05-24 CN CNA2006800301604A patent/CN101360512A/en active Pending
- 2006-05-24 BR BRPI0615547-2A patent/BRPI0615547A2/en not_active IP Right Cessation
- 2006-05-24 WO PCT/EP2006/005060 patent/WO2007019901A1/en not_active Ceased
- 2006-05-24 MX MX2008002222A patent/MX2008002222A/en not_active Application Discontinuation
- 2006-05-24 EP EP06753916A patent/EP1915174A1/en not_active Withdrawn
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3735777A1 (en) * | 1987-10-22 | 1989-05-03 | Mueller Lierheim S A | Carrier-bound mono- or polyclonal antibody |
| EP0739981A1 (en) * | 1995-04-25 | 1996-10-30 | Vrije Universiteit Brussel | Variable fragments of immunoglobulins - use for therapeutic or veterinary purposes |
| EP0904784A1 (en) * | 1997-09-22 | 1999-03-31 | N.V. Nutricia | Probiotic nutritional preparation |
| WO1999046300A1 (en) * | 1998-03-12 | 1999-09-16 | Unilever Plc | Products comprising inactivated yeasts or moulds and active vhh-type antibodies |
| WO2000006764A1 (en) * | 1998-07-30 | 2000-02-10 | Wisconsin Alumni Research Foundation | Gastrointestinal bacterial antibody factories |
| US20020037341A1 (en) * | 1999-02-08 | 2002-03-28 | Heo Cheol Seong | Food containing active strains for inhibiting infection and treating gastritis, gastric and duodenal ulcers |
Non-Patent Citations (3)
| Title |
|---|
| KRUGER C ET AL: "In situ delivery of passive immunity by lactobacilli producing single-chain antibodies", NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 20, no. 7, July 2002 (2002-07-01), pages 702 - 706, XP002321895, ISSN: 1087-0156 * |
| MONEDERO VICENTE ET AL: "Selection of single-chain antibodies against the VP8*subunit of rotavirus VP4 outer capsid protein and their expression in Lactobacillus casei", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 70, no. 11, November 2004 (2004-11-01), pages 6936 - 6939, XP002362665, ISSN: 0099-2240 * |
| REILLY R M ET AL: "Oral delivery of antibodies - future pharmacokinetic trends", CLINICAL PHARMACOKINETICS, LEA & FEBIGER, PHILADELPHIA, PA, US, vol. 32, no. 4, April 1997 (1997-04-01), pages 313 - 323, XP002102664 * |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100291101A1 (en) * | 2007-04-24 | 2010-11-18 | Bio-Support Co., Ltd. | New anti-irc85 monoclonal antibody; and composition comprising the same for preventing and treating tuberculosis or enteritis disease; and the use thereof |
| US8445643B2 (en) * | 2007-04-24 | 2013-05-21 | Bio-Support Co., Ltd. | Anti-IRC85 monoclonal antibody; and composition comprising the same for preventing and treating tuberculosis or enteritis disease; and the use thereof |
| WO2009127519A1 (en) * | 2008-04-18 | 2009-10-22 | Unilever Nv | Compositions comprising antibodies or antibody fragments |
| US9173937B2 (en) | 2008-06-24 | 2015-11-03 | Nestec S.A. | Probiotics, secretory IgA and infection |
| EP2138187A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory IgA and infection |
| EP2138186A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory IgA and inflammation |
| JP2011525483A (en) * | 2008-06-24 | 2011-09-22 | ネステク ソシエテ アノニム | Probiotics, secretory IgA and inflammation |
| JP2011525484A (en) * | 2008-06-24 | 2011-09-22 | ネステク ソシエテ アノニム | Probiotics, secretory IgA and infectious diseases |
| US10501530B2 (en) | 2008-06-24 | 2019-12-10 | Societe Des Produits Nestle S.A. | Probiotics, secretory IgA and inflammation |
| WO2009156301A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory iga and inflammation |
| US9822167B2 (en) | 2008-06-24 | 2017-11-21 | Nestec S.A. | Probiotics, secretory IgA and inflammation |
| WO2009156307A1 (en) * | 2008-06-24 | 2009-12-30 | Nestec S.A. | Probiotics, secretory iga and infection |
| US9629908B2 (en) | 2008-06-24 | 2017-04-25 | Nestec S.A. | Probiotics, secretory IgA and infection |
| CN105816875A (en) * | 2008-06-24 | 2016-08-03 | 雀巢产品技术援助有限公司 | Probiotics, secretory IgA and infection |
| EP2700411A1 (en) * | 2008-06-24 | 2014-02-26 | Nestec S.A. | Probiotics, secretory IgA and infection |
| EP2700412A1 (en) * | 2008-06-24 | 2014-02-26 | Nestec S.A. | PROBIOTICS, SECRETORY IgA AND INFLAMMATION |
| EP2452576A1 (en) * | 2010-11-11 | 2012-05-16 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
| AU2011328068B2 (en) * | 2010-11-11 | 2015-04-30 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
| US8961952B2 (en) | 2010-11-11 | 2015-02-24 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
| US9320767B2 (en) | 2010-11-11 | 2016-04-26 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
| RU2583692C2 (en) * | 2010-11-11 | 2016-05-10 | Нестек С.А. | Extruded non-replicating probiotic microorganisms and application thereof for health |
| CN103561590A (en) * | 2010-11-11 | 2014-02-05 | 雀巢产品技术援助有限公司 | Extruded non-replicating probiotic micro-organisms and their health benefits |
| WO2012062895A1 (en) * | 2010-11-11 | 2012-05-18 | Nestec S.A. | Extruded non-replicating probiotic micro-organisms and their health benefits |
| CN102304489B (en) * | 2011-09-23 | 2013-06-12 | 北京龙科方舟生物工程技术有限公司 | Lactobacillus reuteri strain and application thereof |
| CN102304489A (en) * | 2011-09-23 | 2012-01-04 | 北京龙科方舟生物工程技术中心 | Lactobacillus reuteri strain and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1915174A1 (en) | 2008-04-30 |
| US20090226418A1 (en) | 2009-09-10 |
| BRPI0615547A2 (en) | 2011-05-24 |
| ZA200800978B (en) | 2009-08-26 |
| MX2008002222A (en) | 2008-03-25 |
| CN101360512A (en) | 2009-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8105592B2 (en) | Heavy chain and single domain antibodies | |
| US20090226418A1 (en) | Food Products Comprising Probiotic Micro-Organisms and Antibodies | |
| US7498162B2 (en) | Lactic acid bacteria capable of reducing an individual's tendency to develop allergic reactions | |
| EP1795204A1 (en) | Functional composition or food containing whey protein, antibody derived from milk, or antibody | |
| US20190365832A1 (en) | Compositions and methods for treating inflammatory related diseases or conditions using pediococcus acidilactici probiotics | |
| NO327205B1 (en) | Lactobacillus paracasei strain, composition containing such strain and uses thereof. | |
| AU2002220561A1 (en) | Lactic acid bacteria capable of reducing an individual's tendency to develop allergic reactions | |
| US20100233162A1 (en) | LOCAL ADMINISTRATION OF CHICKEN YOLK IMMUNE GLOBULINS (IgY) TO TREAT AND PREVENT FUNGAL INFECTIONS | |
| Günaydın et al. | Engineered Lactobacillus rhamnosus GG expressing IgG-binding domains of protein G: Capture of hyperimmune bovine colostrum antibodies and protection against diarrhea in a mouse pup rotavirus infection model | |
| JP7111700B2 (en) | bacteria | |
| JP2002537867A (en) | Lactobacillus strains can prevent diarrhea caused by pathogens and rotavirus | |
| US20110123546A1 (en) | Compositions Comprising Antibodies or Antibody Fragments | |
| CN101052418B (en) | Use of bacterial endotoxin antibody in preparing medicine for treating rheumatoid arthritis | |
| US20150079115A1 (en) | Compositions and Methods for Preventing or Relieving Symptoms of Infections | |
| Leszczyńska et al. | Evaluation of Immunoreactivity of Wheat Bread Made from Fermented Wheat Flour. | |
| Von Mollendorff | Characterization of bacteriocins produced by lactic acid bacteria from fermented beverages and optimization of starter cultures | |
| JP2006014654A (en) | Antibody-containing food | |
| JP2007330193A (en) | Food having new function, and method for producing the same | |
| Hultberg | Lactobacilli expressing antibody fragments against pathogens | |
| EP4514848A1 (en) | Targeted anti-sglt1 avian igy antibodies as treatment of pre-diabetes, type 2 diabetes and gestational diabetes | |
| BACTERIOCIN | NEHA GAUTAM | |
| RU2659240C2 (en) | Method for obtaining a functional food for aftercare of oncologic patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200680030160.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006753916 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11990214 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 246/MUMNP/2008 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2008/002222 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006753916 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0615547 Country of ref document: BR Kind code of ref document: A2 Effective date: 20080122 |


