WO2007011434A2 - Procedes destines a prevenir et a traiter des cancers qui expriment l'axe gonadal pituitaire ophtalmique d'hormones et de recepteurs - Google Patents
Procedes destines a prevenir et a traiter des cancers qui expriment l'axe gonadal pituitaire ophtalmique d'hormones et de recepteurs Download PDFInfo
- Publication number
- WO2007011434A2 WO2007011434A2 PCT/US2006/010668 US2006010668W WO2007011434A2 WO 2007011434 A2 WO2007011434 A2 WO 2007011434A2 US 2006010668 W US2006010668 W US 2006010668W WO 2007011434 A2 WO2007011434 A2 WO 2007011434A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- patient
- positive cancer
- gnrh
- hpg axis
- hpg
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
- A61K38/09—Luteinising hormone-releasing hormone [LHRH], i.e. Gonadotropin-releasing hormone [GnRH]; Related peptides
Definitions
- the present invention relates to methods for treating, preventing, delaying, or mitigating HPG axis-positive cancers, for decreasing the level of HPG axis-positive cancer-specific markers, and for preventing or slowing proliferation of malignant cells of HPG axis-positive cancers.
- GnRH Gonadotropin releasing hormone receptor-positive cancers are derived at many different sites in the body. Cancers that express GnRH receptors include the following: prostate, brain (including but not limited to glioblastoma, astrocytoma, medulloblastoma, neuroblastoma, meningioma), breast, ovary, endometrial, pancreas, lung, malignant melanoma, renal cell carcinoma, hepatocarcinoma, oral carcinoma, laryngeal carcinoma, angiomyxoma, and colon cancer.
- prostate including but not limited to glioblastoma, astrocytoma, medulloblastoma, neuroblastoma, meningioma
- breast ovary
- endometrial pancreas
- lung malignant melanoma
- renal cell carcinoma hepatocarcinoma
- oral carcinoma laryngeal carcinoma
- angiomyxoma and colon cancer.
- HPG hypothalamic-pituitary-gonadal
- FSH follicle stimulating hormone
- LH luteinizing hormone
- Receptors for luteinizing hormone releasing hormone have been detected in meningiomata, glioblastoma multiforme, gliomata, and chordoma using LHRH binding assays, demonstrating a possible autocrine signaling loop in brain cancers (van Groeninghen JC, Kiesel L, Winkler D, Zwirner M. Effects of luteinising-hormone-releasing hormone on nervous-system tumors. Lancet 352:372- 373, 1998). It was estimated for the year 2005 that a total of 18,500 new brain cancers would be diagnosed and 12,760 deaths would be attributed to brain cancers in the United States (American Cancer Society, Cancer Facts and Figures 2005. Atlanta: American Cancer Society; 2005).
- GnRH receptors have been detected in the cytoplasm of breast carcinoma cells from invasive ductal carcinoma and positively correlated with estrogen and progesterone receptor labeling indices (Moriya T, Suzuki T, Pilichowska M, Ariga N, Kimura N, Ouchi N, Nagura H, Sasano H. Immunohistochemical expression of gonadotropin releasing hormone receptor in human breast carcinoma. Pathol. Int. 51:333-337, 2001).
- the expression of GnRH and GnRH receptors has been demonstrated in breast cancer at the protein and gene level (reviewed in Emons G, Grundker C, Gunthert AR, Westphalen S, Kavanagh J, Verschraegen C.
- GnRH antagonists in the treatment of gynecological and breast cancers Endocrine-Related Cancer 10:291-299, 2003). It was estimated for the year 2005 that a total of 212,930 new breast cancers would be diagnosed and 40,870 deaths would be attributed to breast cancers in the United States (American Cancer Society, Cancer Facts and Figures 2005. Atlanta: American Cancer Society; 2005).
- GnRH and its receptor have been shown to be expressed in as many as 80% of endometrial cancers at the protein and gene levels (Volker P, Grundker C, Schmidt O, Schulz KD, Emons G. Expression of receptors for luteinizing hormone-releasing hormone in human ovarian and endometrial cancers: frequency, autoregulation, and correlation with direct antiproliferative activity of luteinizing hormone-releasing hormone analogs. Am. J. Obstetr. Gynecol. 186:171-179, 2002). It was estimated for the year 2005 that a total of 40,880 new uterine cancers would be diagnosed and 7,310 deaths would be attributed to uterine cancers in the United States (American Cancer Society, Cancer Facts and Figures 2005. Atlanta: American Cancer Society; 2005).
- Pancreatic cancer induced by N-nitrosobis(2-oxopropyl)amine in hamsters also has been shown to express GnRH receptors (Fekete M, Zalatnai A, Schally AV. Presence of membrane binding sites for [D-TRP6] -luteinizing hormone-releasing hormone in experimental pancreatic cancer. Cancer Lett. 45:87-91, 1989). Additional studies demonstrated the presence of GnRH receptors in 67% of patients with chronic pancreatitis and in 57% of patients with pancreatic cancer (Friess H, Buchler M,
- GnRH receptors were shown to be expressed by human malignant melanoma cell lines at the gene and protein levels (Moretti RM, Montagnani Marelli M, Van Groeninghen JC, Limonta P. Locally expressed LHRH receptors mediate the oncostatic and antimetastatic activity of LHRH agonists on melanoma cells. J. Clin. Endocrinol. Metab. 87:3791-3797, 2002). Further, GnRH receptor expression was demonstrated in 19 of 19 human melanoma tissue specimens derived from primary tumors and metastases (Keller G, Schally AV, Gaiser T, Nagy A, Baker B, Westphal G, Halmos G, Engel JB.
- GnRH receptor expression was demonstrated in 37 of 37 human renal cell carcinomas derived from primary tumors and metastases (Keller G, Schally AV 5 Gaiser T, Nagy A 5 Baker B 5 Halmos G, Engel JB. Receptors for luteinizing hormone releasing hormone expressed on human renal cell carcinomas can be used for targeted chemotherapy with cytotoxic luteinizing hormone releasing hormone analogues. Clin. Cancer Res. 11 :5549-5557 5 2005). It was estimated for the year 2005 that a total of 36, 160 new renal cancers would be diagnosed and 12,660 deaths would be attributed to renal cancers in the United States (American Cancer Society, Cancer* Facts and Figures 2005. Atlanta: American Cancer Society; 2005).
- GnRH receptor expression and hormone binding was demonstrated in normal human liver and in a human hepatocarcinoma cell line (Pati D, Habibi HR. Inhibition of human hepatocarcinoma cell proliferation by mammalian and fish gonadotropin- releasing hormones. Endocrinol. 136:75-84, 1995).
- a published study using a Pseudomonas exotoxin-based chimeric toxin aimed at targeting cancer cells bearing GnRH receptors demonstrated that a liver cancer cell line was growth-inhibited and even killed by the conjugated toxin.
- GnRH receptors appear during progression of the cancer (Crean DH, Liebow C 5 Lee MT 5 Kamer AR 5 Schally AV, Mang TS. Alterations in receptor-mediated kinases and phosphatases during carcinogenesis. J. Cancer Res. Clin. Oncol. 121:141-149, 1995). GnRH ' receptor binding was demonstrated in oral carcinoma and laryngeal carcinoma cell lines (Kreb LJ, Wang X, Nagy A 5 Schally AV, Prasad PN 5 Liebow C. A conjugate of doxorubicin and an analog of luteinizing hormone-releasing hormone shows increased efficacy against oral and laryngeal cancers. Oral Oncol.
- GnRH receptor expression was detected by reverse transcriptase-polymerase chain reaction in normal colon tissue (Tieva A, Stattin P, Wikstrom P, Bergh A, Damber JE. Gonadotropin-releasing hormone receptor expression in the human prostate. Prostate 47:276-284, 2001).
- a published study using a Pseudomonas exotoxin-based chimeric toxin aimed at targeting cancer cells bearing GnRH receptors demonstrated that colon cancer cell lines and primary cultures from colon cancers were growth-inhibited and even killed by the conjugated toxin. This work provided evidence of GnRH receptor expression in colon cancer (Nechushtan A, Yarkoni S, Marianovsky I, Lorberboum-Galski H.
- Adenocarcinoma cells are targeted by the new GnRH-PE66 chimeric toxin through specific gonadotropin-releasing hormone binding sites. J. Biol. Chem. 272: 11597-11603, 1997). It was estimated for the year 2005 that a total of 104,950 new colon cancers would be diagnosed and 56,290 deaths would be attributed to colon cancers in the United States (American Cancer Society, Cancer Facts and Figures 2005. Atlanta: American Cancer Society; 2005).
- HPG axis-positive cancers such as prostate cancer, brain cancer (including but not limited to glioblastoma, astrocytoma, meduUoblastoma, neuroblastoma, and meningioma), breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, lung cancer, malignant melanoma, renal cell carcinoma, hepatocarcinoma, oral carcinoma, laryngeal carcinoma, angiomyxoma, and colon cancer.
- the present invention provides such treatments and measures.
- autocrine refers to secretion of a factor that stimulates the secretory cell itself.
- Endocrine refers to secretion (as of an endocrine gland) that is transmitted by blood to a tissue on which the secretion has its specific effect.
- Parenter refers to a form of signaling in which the target cell is physically close to the signal-releasing cell.
- “Chemical castration” refers to use of a GnRH analogue to reduce serum levels of testosterone to "castrate levels,” which is typically considered to be less than or equal to about 50 ng/dL of testosterone.
- HPG axis refers to the hypothalamic-pituitary-gonadal endocrine feedback loop through which the production of sex steroids (estrogen and testosterone) is regulated.
- GnRH is produced by hypothalamic cells and binds to gonadotrope cells in the pituitary which produce the gonadotropins (LH and FSH) which then bind to cognate receptors in the ovaries and testes to cause production of estrogen and testosterone, respectively.
- the term "therapeutically effective” means that an amount of an agent or a combination of agents is effective to reduce or suppress local tissue production of hormones of the HPG axis (i.e., effective to cause a paracrine or autocrine effect on the target tissue).
- “Physiologically equivalent dose” refers to a dose of a second physiological agent that achieves the same or similar physiological responses as a dose of a first physiological agent.
- GnRH receptors have been demonstrated in various cancers
- data presented herein demonstrates that GnRH, LH, LH receptor, FSH, and FSH receptor are also expressed in multiple cancers, thus indicating an autocrine/paracrine signaling mechanism that could be blocked by using sufficiently high doses of GnRH analogues to achieve elevated tissue levels of the analogues.
- the present invention provides that suppression of autocrine/paracrine signaling in HPG axis-positive cancers requires doses of GnRH agonists that are significantly higher than those required to suppress endocrine GnRH signaling at the level of the pituitary.
- the present invention further provides that hormones of the hypothalamic-pituitary-gonadal (HPG) axis function not only in an endocrine fashion to modulate cancer cell function but also in an autocrine/paracrine fashion to regulate cancer cell function.
- HPG hypothalamic-pituitary-gonadal
- GnRH agonists and antagonists may generally be considered to be adequate to suppress endocrine influences of hormones of the HPG axis by lowering their serum concentrations
- these same doses of GnRH antagonists and agonists are believed to be subtherapeutic when it comes to adequately suppressing local tissue production of these hormones.
- therapeutically effective as used with reference to the HPG axis means that an amount of an agent or a combination of agents is effective to reduce or suppress local tissue production of hormones of the HPG axis.
- a therapeutically effective amount of a GnRH agonist as used in the present invention for treatment of prostate cancer is expected to be higher than the current doses used in the treatment, prevention, mitigation, or slowing of the progress of prostate cancer.
- GnRH analogues examples include leuprolide, triptorelin, buserelin, nafarelin, desorelin, histrelin, and goserelin.
- Other LH/FSH-inhibiting agents that can be used according to the invention include GnRH antagonists, GnRH receptor blockers, such as cetrorelix and abarelix, and LH or FSH receptor blockers.
- LUPRON ® DEPOT 3.75mg 1 month injection gives a mean plasma leuprolide concentration of 4.6-10.2 ng/ml at 4 hours postdosing
- LUPRON ® DEPOT 7.5mg 1 month injection gives a mean plasma leuprolide concentration of 20 ng/ml at 4 hours and 0.36 ng/ml at 4 weeks
- LUPRON ® DEPOT-PED 11.25mg 1 month injection gives a mean plasma leuprolide concentration of 1.25 ng/ml at 4 weeks
- LUPRON ® DEPOT-PED 15mg injection gives a mean plasma leuprolide concentration of 1.59 ng/ml at 4 weeks
- LUPRON ® DEPOT 22.5mg 3 month injection gives a mean plasma leuprolide concentration of 48.9 ng/ml at 4 hours and 0.67 ng/
- the GnRH analogues plasma levels listed above are generally considered sufficient in prostate cancer patients to achieve the desired endocrine effects of reducing serum androgens to below castrate levels ( ⁇ 50 ng/dL), resulting in chemical castration.
- the present invention makes use of therapeutically effective amounts of agents or combinations of agents to reduce or suppress local tissue production of hormones of the HPG axis (i.e., effective to cause a paracrine or autocrine effect on the target tissue).
- GnRH agonists were developed as a method of suppressing sex steroid production as an alternative to surgical castration in the treatment of advanced prostate cancer.
- GnRH agonists are analogues of the endogenous GnRH decapeptide with specific amino acid substitutions. Replacement of the GnRH carboxyl-terminal glycinamide residue with an ethylamide group greatly increases the affinity of these analogues for the GnRH receptor compared to the endogenous peptide. Many of these analogues also have a longer half-life than endogenous GnRH.
- GnRH antagonists have also been developed for use in the treatment of prostate cancer.
- the GnRH antagonists were developed to inhibit gonadotropin and sex steroid synthesis and secretion without the initial spike in gonadotropins and sex steroids associated with GnRH agonists. While GnRH antagonists do prevent this initial burst, there is more "breakthrough" in LH and testosterone secretion than with GnRH agonists (Praecis Pharmaceuticals Incorporated, Plenaxis Package Insert.
- GnRH antagonists are associated with occasional anaphylactic reactions due to their high histamine releasing properties (Millar, R.P., Lu, Z.L., Pawson, A.J., Flanagan, C.A., Morgan, K., and Maudsley, S.R. (2004) Gonadotropin-releasing hormone receptors. Endocr. Rev. 25:235-275). Therefore, for chronic use, the GnRH agonists are often preferred as more effective than the GnRH antagonists at suppressing gonadotropins.
- sustained high serum levels of leuprolide acetate are achievable using a polymer- based subcutaneous implant formulation.
- This serum level of drug is considerably higher than the serum levels achieved with currently available depot formulations used to treat advanced prostate cancer.
- Tumor xenograft studies (FIGS. 17-23) were performed with subcutaneous implants of leuprolide acetate.
- the high leuprolide serum levels resulted in inhibition or significant slowing of tumor growth compared to placebo control-treated tumors.
- high serum levels of leuprolide are expected to result in high local or tissue/tumor levels of leuprolide.
- the centrally produced hormones include gonadotropin releasing hormone (GnRH) from the hypothalamus; and gonadotropins, luteinizing hormone (LH), and follicle stimulating hormone (FSH) from the pituitary.
- Peripherally produced hormones include estrogen, progesterone, testosterone, and inliibins that are primarily of gonadal origin, while activins and follistatin are produced in all tissues including the gonads (Carr BR, in Williams Textbook of Endocrinology, JD Wilson, DW Foster, HM Kronenberg, and PR Larsen, eds. (Philadelphia PA, WB Saunders Co.), pp. 751-817 (1998)).
- Activins which are produced by most tissues, stimulate GnRH secretion from the hypothalamus which stimulates the anterior pituitary to secrete the gonadotropins, LH and FSH, which in turn enter the blood stream and bind to receptors in the gonads and stimulate oogenesis/spermatogenesis as well as sex steroid and inhibin production.
- Among the goals of the present invention are treatment, mitigation, slowing the progression of, and preventing HPG axis-positive cancers by achieving higher tissue levels of GnRH agonists and/or GnRH antagonists than are currently achieved with available formulations (listed above), whether by administering more of such drugs, by preventing degradation of such drugs once administered, by delivering the drugs at a site where they are needed, by a combination of these methods, or by other methods.
- the present invention relates to methods for treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers, or preventing or slowing proliferation of cells of HPG axis-positive cancer origin, or decreasing the level of a cancer-specific marker in a patient, by administering high doses of at least one physiological agent, such as a GnRH agonist or a GnRH antagonist, that decreases or regulates the blood or tissue levels, expression, production, function, or activity of LH, LH receptors, FSH, FSH receptors, androgenic steroids, androgenic steroid receptors, activins, or activin receptors, or administering a physiological agent that increases or regulates the blood or tissue levels, expression, production, function, or activity of GnRH, GnRH receptors, inhibins, inhibin receptors, beta-glycan, or follistatins.
- a physiological agent such as a GnRH agonist or a GnRH antagonist
- the invention further encompasses, for example, a method of preventing or inhibiting an upregulation of the cell cycle in HPG axis-positive cancer-derived cells by administering high doses of at least one physiological agent that is a GnRH agonist or antagonist, effective to reduce local tissue production of hormones of the HPG axis or to down-regulate hormone receptors.
- the physiological agent is leuprolide
- the amount administered is sufficient to maintain serum leuprolide levels at greater than about 1.5 ng/ml for a full dosing period.
- the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.0 ng/ml for the full dosing period.
- the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.5 ng/ml for the full dosing period. In still other embodiments, the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 3.0 ng/ml for the full dosing period.
- the physiological agent is an agent other than leuprolide, and the amount administered is an amount sufficient to maintain serum levels of the agent at greater than about 1.5 ng/ml for the full dosing period, greater than about 2.0 ng/ml for the full dosing period, or greater than about 2.5 ng/ml for the full dosing period, or greater than about 3.0 ng/ml for the full dosing period.
- the invention also encompasses, as another example, a method for treating HPG axis- positive cancer in a patient having cancer comprising administering to the patient a physiological agent that decreases the degradation of GnRH agonists or GnRH antagonists, increases the half-life of GnRH agonists or GnRH antagonists, or increases tissue levels of GnRH agonists or GnRH antagonists within the patient.
- a “full dosing period” refers to a period of time sufficient to achieve a therapeutic effect in the treatment, mitigation, delay, or prevention of HPG axis-positive cancers, and may be from about one month to about twelve months, or such shorter or longer period of time as is required to achieve the therapeutic effect.
- the full dosing period is in the range of from about 30 days to about 90 days. In other embodiments, the full dosing period is about 60 days.
- the invention also encompasses, as another example, a method for treating cancer in a patient having HPG axis-positive cancer comprising administering to the patient a physiological agent that decreases the degradation of GnRH agonists or
- GnRH antagonists increases the half-life of GnRH agonists or GnRH antagonists, or increases tissue levels of GnRH agonists or GnRH antagonists within the patient.
- the present invention additionally encompasses a method for treating HPG axis-positive cancers comprising administering to a patient an initial dose of a GnRH agonist or a GnRH antagonist, monitoring for decreases in an HPG axis-positive cancer-specific marker level in the patient, and subsequently administering to the patient increasing doses of the GnRH agonist or the GnRH antagonist until no further decrease in an HPG axis-positive cancer-specific marker level in the patient is observed.
- FIG. IA presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the T47D breast cancer cell line twice daily for a 5-day period.
- FIG. IB presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the T47D breast cancer cell line twice daily for a 5-day period.
- FIG. 2 A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the MCF-7 breast cancer cell line twice daily for a 5-day period.
- FIG. 2B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the MCF-7 breast cancer cell line twice daily for a 5-day period.
- FIG. 3 A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H358 lung cancer cell line twice daily for a 5 -day period.
- FIG. 3 B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H358 lung cancer cell line twice daily for a 5-day period.
- FIG. 3 C presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H358 lung cancer cell line twice daily for a 5 -day period.
- FIG. 4A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H838 lung cancer cell line twice daily for a 5 -day period.
- FIG. 4B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H838 lung cancer cell line twice daily for a 5-day period..
- FIG. 4C presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the H838 lung cancer cell line twice daily for a 5-day period.
- FIG. 5 A presents results of an in vitr-o experiment in which leuprolide acetate was administered to cells of the HPAC pancreatic cancer cell line twice daily for a 5- day period.
- FIG. 5B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the HPAC pancreatic cancer cell line twice daily for a 5- day period.
- FIG. 6 presents average results from two in vitro experiments in which leuprolide acetate was administered to cells of the PANC pancreatic cancer cell line twice daily for a 5-day period.
- FIG. 7 A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the CaO V3 ovarian cancer cell line twice daily for a 5- day period.
- FIG. 7B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the CaOV3 ovarian cancer cell line twice daily for a 5- day period.
- FIG. 7C presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the CaOV3 ovarian cancer cell line twice daily for a 5- day period.
- FIG. 8 A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the SKO V3 ovarian cancer cell line twice daily for a 5- day period.
- FIG. 8B presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the SKOV3 ovarian cancer cell line twice daily for a 5- day period.
- FIG. 9A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the MV4-11 leukemia cell line twice daily for a 3 -day period.
- FIG. 9A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the MV4-11 leukemia cell line twice daily for a 5-day period.
- FIG. 9C presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the MV4-11 leukemia cell line twice daily for a 5-day period.
- FIG. 1 OA presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the ACHN kidney cancer cell line twice daily for a 5-day period.
- FIG. 1OB presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the ACHN kidney cancer cell line twice daily for a 5 -day period.
- FIG. 1OC presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the ACHN kidney cancer cell line twice daily for a 5-day period.
- FIG. 1 IA presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the 786-0 kidney cancer cell line twice daily for a 5-day period.
- FIG. 1 IB presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the 786-0 kidney cancer cell line twice daily for a 5-day period.
- FIG. 11C presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the 786-0 kidney cancer cell line twice daily for a 5-day period.
- FIG. 12 presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the HT-29 colon cancer cell line twice daily for a 5-day period.
- FIG. 13A presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the HCT-116 colon cancer cell line twice daily for a 5- day period.
- FIG. 13B presents results of a duplicate in vitro experiment in which leuprolide acetate was administered to cells of the HCT-116 colon cancer cell line twice daily for a 5-day period.
- FIG. 13C presents results of a triplicate in vitro experiment in which leuprolide acetate was administered to cells of the HCT-116 colon cancer cell line twice daily for a 5-day period.
- FIG. 14 presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the HS294T malignant melanoma cancer cell line twice daily for a 5-day period.
- FIG. 15 presents results of an in vitro experiment in which leuprolide acetate was administered to cells of the RPMI 7951 malignant melanoma cancer cell line twice daily for a 5-day period.
- FIG. 16 presents results of a pharmacokinetic study in which male and female dogs were either injected intramuscularly with a leuprolide depot formulation or implanted subcutaneously with a leuprolide implant formulation.
- FIG. 17 presents tumor growth data from an experiment in which human
- LN229 brain cancer cells were injected as xenografts into nude mice that were concurrently treated with placebo or leuprolide implants.
- FIG. 18 A presents tumor growth data from an experiment in which human UI l 8-MG brain cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants one week prior to the injection.
- FIG. 18B presents tumor growth data from an experiment in which human
- UI l 8-MG brain cancer cells were injected as xenografts into nude mice that were concurrently treated with placebo or leuprolide implants.
- FIG. 19A presents tumor growth data from an experiment in which human U87-MG brain cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants one month prior to the injection.
- FIG. 19B presents tumor growth data from an experiment in which human U 87-MG brain cancer cells were injected as xenografts into nude mice that were concurrently treated with placebo or leuprolide implants. Large tumors: > 2000mm 3 , small tumors: ⁇ 2000mm 3 .
- FIG. 20 presents tumor growth data from an experiment in which human CWR22 prostate cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants eight days prior to the injection.
- FIG. 21 presents tumor growth data from an experiment in which human
- LNCaP-C42 prostate cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants twelve days prior to the injection.
- FIG. 22 presents tumor growth data from an experiment in which human
- HPAC pancreatic cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants seven days prior to the injection.
- FIG. 23 presents tumor growth data from an experiment in which human PANC 10.05 pancreatic cancer cells were injected as xenografts into nude mice that were treated with placebo or leuprolide implants seven days prior to the injection.
- FIG. 24 presents results of protein expression studies to analyze the expression of GnRH receptor I protein in various cancer cell lines.
- FIG. 25 presents results of gene expression studies to analyze the expression of GnRH, GnRH receptor I, ⁇ LH, LH receptor, ⁇ FSH and FSH receptor in various cancer cell lines.
- FIG. 26 presents representative results of gene expression studies in breast and lung cancer cell lines to illustrate data presented in FIG. 25.
- FIG. 27 is a schematic representation of the HPG axis.
- nucleotide sequences of eighteen DNA primer sequences are presented as SEQ ID NO: 1 through SEQ ID NO: 18 in the Sequence Listing of the present application.
- the free text "Artificial primer sequence" appearing under numeric identifier ⁇ 223> for each listed sequence indicates that the sequence is that of a primer that was artificially synthesized.
- the protocol for primer synthesis is set out in detail below in the Experimental Design section of the Detailed Description.
- the present invention encompasses methods of preventing or treating HPG axis-positive cancers, or preventing or slowing proliferation of such cancer cells, or inhibiting or preventing upregulation of the cell cycle of such cancers by administering an agent that decreases or regulates blood and tissue levels, production, function, or activity of LH or FSH (an "LH/FSH-inhibiting agent").
- the LH/FSH-inhibiting agent comprises one or more of GnRH; leuprolide; triptorelin; buserelin; nafarelin; desorelin; histrelin; goserelin; follistatin; a compound that stimulates the production of follistatin; a GnRH antagonist; a GnRH receptor blocker; cetrorelix; abarelix; a vaccine or antibody that stimulates the production of antibodies that inhibit the activity of any of LH, FSH, or GnRH; a vaccine or antibody that stimulates the production of antibodies that block an LH receptor, an FSH receptor, or a GnRH receptor; a compound that regulates expression of an LH or FSH receptor; a compound that regulates post-receptor signaling of an LH or FSH receptor; or a physiologically acceptable analogue, metabolite, precursor, or salt of any of the foregoing LH/FSH-inhibiting agents.
- HPG axis-positive cancers that may be prevented or treated according to the present invention with LH/FSH-inhibiting agents include, but are not limited to, the following: prostate, brain (including but not limited to glioblastoma, astrocytoma, medulloblastoma, neuroblastoma, and meningioma), breast, ovary, endometrial, pancreas, lung, malignant melanoma, renal cell carcinoma, hepatocarcinoma, oral carcinoma, laryngeal carcinoma, angiomyxoma, and colon cancer.
- prostate including but not limited to glioblastoma, astrocytoma, medulloblastoma, neuroblastoma, and meningioma
- breast ovary
- endometrial pancreas
- lung malignant melanoma
- renal cell carcinoma hepatocarcinoma
- oral carcinoma laryngeal carcinoma
- angiomyxoma and
- the underlying rationale for using hormonal therapy in the treatment of prostate cancer is the suppression of androgens in the bloodstream to concentrations seen with castration. Therefore, according to conventional therapeutic strategies, once this suppression is achieved, there is no reason to continue to escalate doses of such therapies.
- the present invention provides that higher doses, meaning doses that achieve and maintain higher serum or tissue concentrations of GnRH agonists or antagonists, are more effective at treating, mitigating, slowing the progression of, or preventing multiple cancers.
- GnRH agonists are the most commonly used type of hormonal therapy for prostate cancer, with leuprolide acetate being an example of a GnRH agonist used in the treatment of prostate cancer.
- GnRH agonists are analogues of the endogenous GnRH decapeptide with specific amino acid substitutions. Replacement of the GnRH carboxy-terminal glycinamide residue with an ethylamide group increases the affinity of these analogues for the GnRH receptor compared to the endogenous peptide. Many of these analogues also have a longer half-life than endogenous GnRH (Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K, Maudsley SR.
- Gonadotropin- releasing hormone receptors Endocrine Reviews 25:235-275, 2004). Administration of such analogues can result in an initial increase in serum gonadotropin concentrations that persists for several days (there is also a corresponding increase in testosterone in men and estrogen in pre-menopausal women). This can be followed by a precipitous decrease in gonadotropins. This decrease is due to the loss of GnRH signaling due to down regulation of pituitary GnRH receptors (Belchetz PE, Plant TM, Nakai Y, Keogh EJ, Knobil E. Hypophysial responses to continuous and intermittent delivery of hypothalamic gonadotropin-releasing hormone. Science 202:631-633, 1978). This is thought to be secondary to the increased concentration of ligand, the increased affinity of the ligand for the receptor, and the continuous receptor exposure to ligand as opposed to the intermittent exposure that occurs with physiological pulsatile secretion.
- the underlying rationale for treating cancers with hormonal therapy is that abnormal cell division in malignant tissues may be driven or promoted by elevated levels of gonadotropins.
- gonadotropins By reducing the level of gonadotropins in the serum and tissue of patients with cancers, it may be possible to treat, prevent, delay, or mitigate cancer.
- the blood level, production, function, or activity of LH or FSH is decreased or regulated to be near a target blood level, a target production, a target function, or a target activity of LH or FSH, respectively, occurring at or near the time of greatest reproductive function, which in humans corresponds to from about 18 to about 35 years of age.
- the blood level, production, function, or activity of LH or FSH is decreased or regulated to be approximately as low as possible without unacceptable adverse side effects.
- An unacceptable adverse side effect is an adverse side effect that, in the reasonable judgment of one of ordinary skill in the art, has disadvantages that outweigh the advantages of treatment.
- the blood level, production, function, or activity of LH or FSH is decreased or regulated to be undetectable or nearly undetectable by conventional means known in the art, meaning less than about 0.7 mlU/mL for both LH and FSH in a clinical laboratory, and lower in a commercial laboratory.
- Embodiments of the present invention include administration of one or more LH/FSH-inhibiting agents that can be used to decrease or regulate the blood level, production, function, or activity of LH or FSH.
- GnRH or a GnRH analogue can be administered to decrease or regulate the tissue or blood level, production, function, or activity of LH or FSH.
- Studies have shown that increased levels of GnRH or its analogues will result in significant decreases in LH and FSH levels, (Thorner MO, et al, The anterior pituitary, in Williams Textbook of Endocrinology 9 th edition, eds. Wilson JD, Foster DW, Kronenberg H, Larsen PR, 269, W.B.
- leuprolide a GnRH analogue
- TEP-144-SR Advanced Prostatic Cancer: A Dose Response Evaluation, Drugs in Experimental and Clinical Research, 15:373-387 (1989)
- pituitary GnRH receptors are down-regulated, resulting in a significant decrease in LH and FSH secretion.
- GnRH analogues examples include leuprolide, triptorelin, buserelin, nafarelin, desorelin, histrelin, and goserelin.
- Other LH/FSH-inhibiting agents that can be used according to the invention include GnRH antagonists, GnRH receptor blockers, such as cetrorelix and abarelix, and LH or FSH receptor blockers.
- LUPRON ® DEPOT 3.75mg 1 month injection gives a mean plasma leuprolide concentration of 4.6-10.2 ng/ml at 4 hours postdosing
- LUPRON ® DEPOT 7.5mg 1 month injection gives a mean plasma leuprolide concentration of 20 ng/ml at 4 hours and 0.36 ng/ml at 4 weeks
- LUPRON ® DEPOT-PED 11.25mg 1 month injection gives a mean plasma leuprolide concentration of 1.25 ng/ml at 4 weeks
- LUPRON ® DEPOT-PED 15mg injection gives a mean plasma leuprolide concentration of 1.59 ng/ml at 4 weeks
- LUPRON DEPOT 22.5mg 3 month injection gives a mean plasma leuprolide concentration of 48.9 ng/ml at 4 hours and 0.67 ng/ml
- the GnRH analogues plasma levels listed above are sufficient in prostate cancer patients to achieve the desired endocrine effects of reducing serum androgens to below castrate levels ( ⁇ 50 ng/dL), resulting in "chemical castration.”
- the present invention makes use of therapeutically effective amounts of agents or combinations of agents to reduce or suppress local tissue production of hormones of the HPG axis (i.e., effective to cause a paracrine or autocrine effect on the target tissue).
- vaccines or antibodies can be employed to stimulate the production of antibodies that recognize, bind to, block or substantially reduce the activity of LH, FSH, or GnRH.
- vaccines or antibodies can be employed to stimulate the production of antibodies that recognize, bind to, or block the receptors for one of LH, FSH, or GnRH.
- examples of such vaccines include the TaI war vaccine and the vaccine marketed under the trade name GONADIMMUNE ® by Aphton Corporation.
- Other LH/FSH-inhibiting agents that can be used according to the invention include compounds that regulate expression of LH and FSH receptors and agents that regulate post-receptor signaling of LH and FSH receptors.
- a sex steroid hormone such as estrogen, progesterone, or testosterone, or an analogue thereof
- an LH/FSH-inhibiting agent may be co- administered with an LH/FSH-inhibiting agent.
- the presence of estrogen, progesterone, or testosterone signals the hypothalamus to decrease the secretion of GnRH.
- the present invention also encompasses co-administration of sex steroids in order to replenish the sex steroids.
- GnRH agonists are peptides, they are generally not amenable to oral administration. Therefore, they are usually administered subcutaneously, intramuscularly, or via nasal spray. GnRH agonists are highly potent with serum concentrations of less than 1 ng/ml of leuprolide acetate required for testosterone suppression (Fowler, J.E., Flanagan, M., Gleason, D.M., Klimberg, I.W., Gottesman, J.E., and Sharifi, R. (2000) Evaluation of an implant that delivers leuprolide for 1 year for the palliative treatment of prostate cancer. Urol. 55:639-642).
- GnRH agonists are also often considered to be ideal for use in long-acting depot delivery systems. At least ten such products are currently marketed in the United States. The duration of action of these products ranges from one month to one year. Leuprolide acetate has been on the market for close to two decades and continues to demonstrate a favorable side effect profile. Most of the side effects such as hot flashes and osteoporosis can be attributed to the loss of sex steroid production (Stege, R. (2000). Potential side-effects of endocrine treatment of long duration in prostate cancer. Prostate Suppl. 10:38-42).
- leuprolide treatment of cancer cell lines slows or inhibits growth in a dose dependent manner. Inhibition rates of 10-40% were achieved with the highest dose of leuprolide used in the studies. However, in vivo studies demonstrated better efficacy in the inhibition of cancer cell growth. High, sustained levels of leuprolide slowed the growth of various types of tumor xenografts. The experimental tumor xenograft data demonstrated consistent inhibition or significant slowing of tumor growth when leuprolide implants were used to treat mice bearing tumors. Higher serum levels of leuprolide in these experimental animals were thought to have resulted in higher tissue/tumor levels of leuprolide, which led to better inhibition of growth.
- RNA Isolation Reagent AbGene, Rochester NY
- Total RNA Isolation Reagent AbGene, Rochester NY
- RNA was extracted from frozen tumors by physically dissociating tumor tissue using metal beads and agitation in a deep well plate.
- Total RNA Isolation Reagent was used to prepare RNA from dissociated tissues.
- Total RNA purity and quantity was determined by measuring absorbance at 260nm and 280nm using ⁇ Quant BioTek Instruments Inc. plate reader and KC Junior software (Winooski, VT).
- RNA RNA was used for the first strand cDNA production using iScript cDNA Synthesis Kit from Bio-Rad (Cat. # 170-8890).
- the resulting complementary DNA product (one tenth of the volume) was used as template for amplification of human gonadotropin releasing hormone receptor 1 (gnrhrl), human gonadotropin releasing hormone (gnrli), luteinizing hormone beta polypeptide ⁇ lh), luteinizing hormone receptor (lh-r), follicle stimulating hormone beta polypeptide ⁇ fsh), follicle stimulating hormone receptor (fsh-r), and glyceraldehyde-3-p_hosphate dehydrogenase (gapdh) genes with gene specific primers whose sequences are shown below:
- GnRHrecl-Rev 5'- CAGGCTGATCACCACCATCA - 3' (SEQ ID NO:2)
- GAPDH-For 5'- GGGGGAGCCAAAAGGGTCAT - 3 ' (SEQ ID NO:3)
- GAPDH-Rev 5'- GCCCCAGCGTCAAAGGTGGA - S' (SEQ ID NO:4)
- hsGNRH-For 5'- CCTTATTCTACTGACTTCGTGCGT- 3' (SEQ ID NO:5)
- hsGNRH-Rev 5 '- GGAATATGTGCAACTTGGTGTAAGG - 3 ' (SEQ ID NO:6)
- FSHRn-For 5'- GACAGAAACTTCATCCACTGTCC - S ' (SEQ ID NO: 17)
- FSHRn-Rev 5 '- GCCAGGAATATTAAATTAGATG - 3 ' (SEQ ID NO: 18)
- the detailed protocol for primer synthesis is as follows:
- Reaction chamber • Reaction chamber and a type of solid support such as controlled pore glass
- the solid support was prepared with the desired first base already attached via an ester linkage at the 3'-hydroxyl end. The solid support was then loaded into the reaction column. In each step, the solutions were pumped through the column. The reaction column was attached to the reagent delivery lines and the nucleic acid synthesizer.
- Step 1 De-blocking
- the reaction column was washed with either dichloroacetic acid (DCA) or trichloroacetic acid in dichloromethane (DCM) to remove a DMT group from the first base.
- DCA dichloroacetic acid
- DCM trichloroacetic acid in dichloromethane
- Tetrazole activated second monomer base was added to the reaction column.
- the base was capped by undergoing acetylation. Acetic anhydride and N- methylimidazole were added to the reaction column. The reaction column was then washed to remove any extra acetic anhydride or N-methylimidazole.
- Steps one through four were repeated until all desired bases had been added to the oligonucleotide. Each cycle was approximately 98 or 99% efficient.
- the oligonucleotide had to be cleaved from the solid support and de-protected before it could be effectively used. This was done by incubating the chain in concentrated ammonia at a high temperature for an extended amount of time.
- the last step was desalting, which was done to purify the solution. Desalting removes any species that may interfere with future reactions.
- the major problematic ingredient in the heterogeneous mixture is the ammonium ion.
- ethanol precipitation was utilized.
- Stage 2- 35 cycles 20 sec at 95 0 C
- Protein expression studies were carried out as described below.
- cell lines were plated (about 250,000 cells/plate) in 100 mm dishes in appropriate growth media with 1% fetal bovine serum or 1% charcoal-dextran treated fetal bovine serum. Cells were allowed to grow for 5 days followed by scraping and collection in phosphate buffered solution on ice. Protein lysates were prepared by lysing cell pellets in radioimmunoprecipitation (RIPA) buffer. Cell protein lysates were fractionated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by electroblotting to nylon or nitrocellulose membranes.
- Western immunoblot analysis was performed using a GnRH receptor I antiserum (rabbit polyclonal antibody raised against amino acids 1-328 representing the full- length GnRH receptor of human origin, Santa Cruz Biotechnology, Santa Cruz, CA).
- CaOV3 ATCC HTB-75 cells were plated in Dulbecco's modified Eagle's medium with 4mM L- glutamine, 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids, and 10% fetal bovine serum.
- H358 ATCC CRL-5807 cells were plated in RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, 1.0 mM sodium pyruvate and 10% fetal bovine serum.
- H838 (ATCC CRL-5844) cells were plated in RPMI 1640 medium with 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 1OmM HEPES, 1.0 mM sodium pyruvate, 10 U/ml insulin and 10% fetal bovine serum.
- T47D (ATCC HTB-133) cells were plated in Minimum Essential Medium with Earle's Balanced Salt Solution and 4mM L- glutamine, 1.5 g/L sodium bicarbonate, 1.0 mM sodium pyruvate, and 10% fetal bovine serum.
- MCF-7 (ATCC HTB-22) cells were plated in Minimum essential medium (Eagle) with 2 mM L-glutamine and Earle's BSS adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids and 1 mM sodium pyruvate and supplemented with 0.01 mg/ml bovine insulin, 90% and 10% fetal bovine serum.
- HPAC (ATCC CRL-2119) cells were plated in Dulbecco's modified Eagle's/Ham's F12 medium with 10 ng/ml epidermal growth factor, 0.002 mg/ml insulin, 0.005 mg/ml transferrin, 40 ng/ml hydrocortisone, and 5% fetal bovine serum.
- Pane (ATCC CRL-2547) cells were plated in RPMI 1640 medium with 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 1OmM HEPES, 1.0 mM sodium pyruvate, 10 U/ml insulin and 10% fetal bovine serum.
- MV4-11 (ATCC CRL-9591) cells were plated in Iscove's modified Dulbecco's medium with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 90% and 10%fetal bovine serum.
- ACHN (ATCC CRL-1611) cells were plated in Minimum essential medium (Eagle) with 2 mM L-glutamine and Earle's BSS adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids, and 1.0 mM sodium pyruvate, 90% and 10% fetal bovine serum.
- 786-0 (ATCC CRL-1932) cells were plated in RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 90% and 10% fetal bovine serum.
- HT-29 (ATCC HTB-38) cells were plated in McCoy's 5a medium (modified) with 1.5 mM L-glutamine adjusted to contain 2.2 g/L sodium bicarbonate, 90% and 10% fetal bovine serum.
- AU cell lines were plated in their respective growth media (supplemented with either 1% regular fetal bovine serum, 1% charcoal/dextran-stripped fetal bovine serum or 0.25% AlbumaxTM (Invitrogen Corp., Grand Island NY)) and allowed to settle for 24 hours.
- Leuprolide treatments were commenced shortly after plating the cells.
- a lO mM (12.25 mg/ml) solution of leuprolide acetate salt in phosphate buffered saline was prepared and diluted appropriately to obtain the desired final concentrations.
- Treatment concentrations were 0 M (control), 10 "11 M (shown as l.OOE-11, 0.012 ng/ml), 10 "9 M (shown as 1.00E-9, 0.0012 ⁇ g/ml), 10 '8 M (shown as 1.00E-8, 0.012 ⁇ g/ml), 10 "7 M (shown as 1.00E-7, 0.12 ⁇ g/ml), and 10 "5 M (shown as 1.00E-5, 12.25 ⁇ g/ml).
- the number of cells in each group was measured by incubating cells with WST-8 (2-(2-methoxy-4- nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt) which produces a water soluble formazan dye that was detected by measuring optical density (at 450 nm) using a ⁇ QuantTM Universal Microplate Spectrophotometer (Bio-Tek® Instruments, Inc., Winooski, Vermont).
- LN229 (ATCC CRL-2611) cells were prepared by plating in Dulbecco's modified Eagle's medium with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate and 4.5 g/L glucose, 95%; fetal bovine serum, 5%.
- U87-MG (ATCC HTB- 14) cells were prepared by plating in Minimum essential medium (Eagle) with 2 mM L-glutamine and Earle's BSS adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids, and 1.0 mM sodium pyruvate, 90%; fetal bovine serum, 10%.
- Ul 18-MG (ATCC HTB-15) cells were prepared by plating in Dulbecco's modified Eagle's medium with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate and 4.5 g/L glucose, 90%; fetal bovine serum, 10%.
- CWR22 recurrent prostate cancer cells were prepared as described in Wainstein MA, He F, Robinson D, Kung H-J, Schwartz S, Giaconia JM, Edgehouse NL, Pretlow TP, Bodner DR, Kursh ED, Resnick MI, Seftel A, Pretlow TG.
- Tumors were dissected into 100 mg pieces and placed into a 100 mm 3 culture dish with RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 90%; fetal bovine serum, 20%. Tissue pieces were minced for five minutes with sterile scissors and allowed to settle. Cells and tissue pieces in solution were pipetted into a 100 ml glass bottle containing the above culture medium containing 0.1% protease enzyme. This mixture was placed on a stir plate with a stir bar in the bottle and stirred at room temperature for 20 minutes followed by 2 minutes without stirring.
- the medium containing cells was decanted into a 50 ml culture tube on ice and more culture medium with enzyme was added to the bottle with the tumor tissue. This process was repeated eight times, with the supernatant being collected on ice each time. The final combined supernatants were mixed, cell numbers were determined by counting with a hemacytometer, and an aliquot of cells was subjected to centrifugation at 1200 x g for 15 minutes and the supernatant was discarded.
- the resulting cell pellet was resuspended in an appropriate volume of MatrigelTM (Becton Dickinson) at 4°C, triturated repeatedly through an 18-G needle and 5 ml syringe, followed by repeated trituration through a 22-G needle and 1 ml syringe. 100 ⁇ l aliquots of tumor cells were injected through a 22-G needle subcutaneously on the flanks of nude mice.
- MatrigelTM Becton Dickinson
- LNCaP-C42 cells (UroCor, Inc., Oklahoma City, OK) were cultured in RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 90%; fetal bovine serum, 10%. Cultured cells were trypsinized, counted and injected in Matrigel (BD Biosciences, Bedford, Maryland) or Matrigel:cell growth media (no fetal bovine serum), 1 : 1 and implants were placed subcutaneously into anesthetized mice.
- Matrigel BD Biosciences, Bedford, Maryland
- Matrigel:cell growth media no fetal bovine serum
- Pane (ATCC CRL-2547) cells were plated in RPMI 1640 medium with 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 1OmM HEPES, 1.0 mM sodium pyruvate, 10 U/ml insulin and 10% fetal bovine serum. Cultured cells were trypsinized, counted and injected in Matrigel (BD Biosciences, Bedford, Maryland) or Matrigel:cell growth media (no fetal bovine serum), 1 : 1 and implants were placed subcutaneously into anesthetized mice.
- Matrigel BD Biosciences, Bedford, Maryland
- Matrigel:cell growth media no fetal bovine serum
- HPAC HPAC (ATCC CRL-2119) cells were plated in Dulbecco's modified Eagle's/Ham's F12 medium with 10 ng/ml epidermal growth factor, 0.002 mg/ml insulin, 0.005 mg/ml transferrin, 40 ng/ml hydrocortisone, and 5% fetal bovine serum. Cultured cells were trypsinized, counted and injected in Matrigel (BD Biosciences, Bedford, Maryland) or Matrigelicell growth media (no fetal bovine serum), 1:1 and implants were placed subcutaneously into anesthetized mice.
- Matrigel BD Biosciences, Bedford, Maryland
- Matrigelicell growth media no fetal bovine serum
- Tumor measurements were carried out twice weekly using calipers, and length (1) and width (w) were converted to tumor volumes using the following equation: (w 2 x l)/2. AU tumors within one treatment group were used to calculate average tumor volumes ⁇ standard deviations. To calculate tumor growth rates, tumor volumes were normalized to the initial tumor volume (V 0 ). When a single tumor was detectable in a treatment group, that tumor volume was used as V 0 for that treatment group and all tumors measured in that group that formed over time were used to calculate a growth rate (VWo). At the end of the experiments, mice were sacrificed by cervical dislocation, and tissues and blood were collected.
- the DURIN-Leuprolide 2-month implant used as described below, available from Durect Corporation (Cupertino, California), is a solid formulation comprising approximately 25-30 weight % leuprolide acetate dispersed in a matrix of poly (DL- lactide-co-glycolide).
- the implant is a cylindrical, opaque rod with nominal dimensions of 1.5 mm (diameter) x 2.0 cm (length).
- the formulation provides 11.25 mg of leuprolide acetate per 2 cm rod, with a substantially uniform release profile.
- FIGS. IA and IB present results of cell growth studies in which the T47D breast cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 0, 3, and 5 or study days 2, 3, and 5.
- FIG. IA presents results of cell growth studies in which about 2500 cells/well were plated in cell culture medium with 1% fetal bovine serum, allowed to grow for 2 days, and then treated twice daily out to day 5.
- FIG. IB presents results of cell growth studies in which about 5000 cells/well were plated in cell culture medium with 1% charcoal-dextran-treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 2 A and 2B present results of cell growth studies in which the MCF-7 breast cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (1. OE-Il), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 0, 3, and 5 or study days 2, 3, and 5.
- FIG. 2A presents results of cell growth studies in which about 5000 cells/well were plated in cell culture medium with 1% fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 2B presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 3 A, 3B, and 3C present results of cell growth studies in which the H358 non-small cell lung cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (1.0E- 11), 10 iiM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 0, 3, and 5 or study days 2, 3, and 5.
- FIG. 3 A presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% fetal bovine serum. Cells were allowed to grow for two days and leuprolide treatments were commenced and performed twice daily out to day 5.
- FIG. 3 B presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 3 C presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 4A, 4B, and 4C present results of cell growth studies in which the H838 non-small cell lung cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (1.0E- 11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 4A presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 4B presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 4C presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 0.25% AlbumaxTM II lipid rich bovine serum albumin. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 5 A and 5B present results of cell growth studies in which the HPAC pancreatic cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 0, 3, and 5 or study days 2, 3, and 5.
- FIG. 5 A presents results of cell growth studies in which about 2500 cells/well were plated in cell culture medium with 1% fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 5B presents results of cell growth studies in which about 5000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5. Experiment 6
- FIG. 6 presents results of cell growth studies in which the PANC pancreatic cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.OE-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 6 presents results of cell growth studies in which about 5000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 6 represents the mean absorbances from two independent experiments.
- FIGS. 7 A, 7B, and 7C present results of cell growth studies in which the CaO V3 ovarian cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (1. OE-I l), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 0, 1, 3, and 5 or study days 2, 3, and 5.
- FIG. 7A presents results of cell growth studies in which about 2000 cells/well were plated in cell culture medium with 1% fetal bovine serum. Cells were allowed to grow for two days and leuprolide treatments were commenced and performed twice daily out to day 5.
- FIG. 7B presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 7C presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- Experiment 8
- FIGS. 8 A and 8B present results of cell growth studies in which the SKOV3 ovarian cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 8 A presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG 8B presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 9 A, 9B, and 9C present results of cell growth studies in which the MV4-11 leukemia cancer cell line was plated in a 6 well plate format (FIGS. 9 A and 9B) or a 96 well format (FIG. 9C) and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8). or 10 ⁇ M (1.0E- 5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 9 A presents results of cell growth studies in which about 300,000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 3.
- FIG. 9B presents results of cell growth studies in which about 300,000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 9C presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 10A, 1OB, and 1OC present results of cell growth studies in which the ACHN kidney cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (1.0E-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 1OA presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 1OB presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 1OC presents results of cell growth studies in which about 250 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 1 IA, 1 IB, and 11C present results of cell growth studies in which the 786-0 kidney cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 1 IA presents results of cell growth studies in which about 250 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 1 IB presents results of cell growth studies in which about 250 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 11C presents results of cell growth studies in which about 2500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 12 presents results of cell growth studies in which the HT-29 colon cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 12 presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIGS. 13A, 13B, and 13C present results of cell growth studies in which the HCT-116 colon cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 nM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 13 A presents results of cell growth studies in which about 1000 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 13B presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 13C presents results of cell growth studies in which about 250 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 14 presents results of cell growth studies in which the HS294T malignant melanoma cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (l.OE-11), 10 iiM (1.0E-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 14 presents results of cell growth studies in which about 100 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- FIG. 15 presents results of cell growth studies in which the RPMI 7951 malignant melanoma cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (LOE- 11), 10 nM (l.OE-8), or 10 ⁇ M (1.0E-5). Absorbance was detected as described above and reflected the number of cells present on study days 2, 3, and 5.
- FIG. 15 presents results of cell growth studies in which about 500 cells/well were plated in cell culture medium with 1% charcoal-dextran treated fetal bovine serum. Leuprolide treatments were commenced immediately and performed twice daily out to day 5.
- Experiment 16 presents results of cell growth studies in which the RPMI 7951 malignant melanoma cancer cell line was plated in a 96 well plate format and treated twice daily for 5 days with leuprolide acetate at doses of 0 M (control), 10 pM (LOE- 11), 10
- FIG. 16 presents results of a pharmacokinetic study in which male and female dogs were either injected intramuscularly with a leuprolide depot formulation or implanted subcutaneously with a leuprolide implant formulation.
- Six dogs of each sex were dosed with 60 mg of Lupron Depot® by injection (males - X, females - A) on day 1.
- Six dogs of each sex were dosed with single subcutaneous doses (males - ⁇ , females - ⁇ ) of 3 DURINTM-Leuprolide 11.3 mg implants (total dose 34 mg) on day 1 and again on day 64. Serum leuprolide levels were determined and plotted against time out to 200 days.
- Serum leuprolide levels were about 5 to 8 times higher in the DURINTM-Leuprolide treated dogs compared to the Lupron Depot® treated dogs. Higher levels of serum leuprolide sustained over a consistent length of time were thought to have resulted in higher tissue levels of leuprolide sustained over a consistent length of time, which led to inhibition of tumor growth, as demonstrated in FIGS. 17-23.
- FIG. 17 presents results of an experiment in which about 5 x 10 cells of the LN229 human glioblastoma brain cancer cell line were injected bilaterally into two groups (one treatment group and a control group), each with four mice.
- a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group.
- Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 17 presents results of tumor xenograft growth over time in the placebo group and leuprolide implant group.
- tumor volume measurements were commenced on the fourteenth day following injection, when tumors were detectable in all groups.
- FIGS. 18A and 18B present results of two experiments in each of which about 1 x 10 6 cells of the Ul 18-MG human glioblastoma cell line were injected bilaterally into two groups (one treatment group and a control group), each with four mice. Seven days prior to the cell injection (FIG. 18A) or concurrently with cell injection (FIG. 18B), a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 18A presents results of the first Ul 18 tumor xenograft growth study of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- FIG. 18 A shows, tumor measurements were started on day 28 after injection. On day 62, mice were re-dosed with new implants (placebo and leuprolide) and tumor measurements were continued out to 140 days after .injection. Due to variation in final tumor volumes, tumors were divided into three groups (large: >4000 mm 3 , medium: 2000-4000 mm 3 , and small: ⁇ 2000 mm 3 ).
- There were no small tumors in the placebo group, while the small tumors in the 4 cm LA group (n 2) had grown to about 1250 mm 3 .
- FIG. 18B presents results of the second study of Ul 18 tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 17 after injection and continued until day 144 after injection.
- FIG. 19 presents results of two experiments in which about 5.O x IO 6 cells of the U87MG glioblastoma cell line were injected bilaterally into two groups (one treatment group and a control group), each with four mice. One month prior to the cell injection (FIG. 19A) or concurrently with cell injection (FIG. 19B), a controlled- release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 19A presents results from a study of U87MG xenograft growth over time in the placebo group and leuprolide implant group.
- tumor measurements were started on day 45 after tumor cell injection and continued until day 62 after injection.
- small tumors in the 4cm LA treatment group (n 5) had grown to approximately 475 mm 3 .
- FIG. 19B presents results of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 13 after injection. Due to variation in final tumor volumes, tumors were divided into two groups (large: > 2000 mm and small: ⁇ 2000 mm ).
- FIG. 20 presents results of an experiment in which about 1.25 x 10 6 cells of the CWR22 recurrent prostate cancer xenograft tumor were injected bilaterally into two groups (one treatment group with three mice and a control group with four mice). Eight days prior to the cell injection, a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 20 presents results of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 27 after injection.
- FIG. 21 presents results of an experiment in which about 1.0 x 10 cells of the LNCaP-C42 prostate cancer xenograft tumor were injected bilaterally into two groups (one treatment group and a control group), each with four mice. Twelve days prior to the cell injection, a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 21 presents results of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 22 after injection. Tumor data was plotted according to the sizes of the tumors (large tumors: initial tumor volume > 100 mm 3 ; and small tumors: initial tumor volume ⁇ 100 mm 3 ).
- FIG. 22 presents results of an experiment in which about 3.0 x 10 6 cells of the HPAC pancreatic cancer cell line were injected bilaterally into two groups (one treatment group and a control group), each with four mice. Seven days prior to the cell injection, a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 22 presents results of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 17 after injection. Tumor data was plotted according to the sizes of the tumors (large tumors: > 1500 mm 3 ; small tumors: ⁇ 1500 mm 3 ; and extra small tumors: ⁇ 100 mm 3 ).
- FIG. 23 presents results of an experiment in which about 3.0 x l0 6 cells of the PANC 10.05 pancreatic cancer cell line were injected bilaterally into two groups (one treatment group and a control group), each with four mice. Seven days prior to the cell injection, a controlled-release leuprolide acetate formulation was implanted into each mouse in the treatment group. Four centimeters of leuprolide rod, providing 22.5 mg of leuprolide, were implanted in each mouse of the treatment group. Four centimeters of placebo rod (without leuprolide) were implanted one week prior to injection into each mouse of the control group.
- FIG. 23 presents results of tumor xenograft growth over time in the placebo group and the leuprolide implant group.
- tumor measurements were started on day 21 after injection. Tumor data was plotted according to the sizes of the tumors (large tumors: > 500 mm 3 ; small tumors: ⁇ 500 mm 3 ).
- FIG. 24 presents results of protein expression studies to analyze the expression of the GnRH receptor I in various cancer cell lines and tumors.
- protein was extracted from cell lines and tumors and subjected to fractionation by denaturing polyacrylamide gel electrophoresis. Proteins were electroblotted to nitrocellulose membranes, and GnRH receptor I protein was detected by incubating membranes with rabbit antiserum directed against the human receptor, followed by incubation with a secondary antibody to rabbit. Chemiluminescence was used to visualize specific protein bands for GnRH receptor I.
- GnRH receptor I was detected in non-small cell lung carcinoma cell lines (H358, H838), pancreatic cancer cell lines (Pane, HPAC), brain cancer cell lines (DAOY, LN229, Ul 18MG, U87MG, SKNMC, and SttGl), breast cancer cell lines (T47D, MCF-7), prostate cancer cell lines (LNCaP, C-42, PC3, and CWR-Rl), and ovarian cancer cell lines (CaO V3 and
- M refers to molecular weight marker used for protein size determination
- C refers to HPAC protein lysate used as a positive control of GnRH receptor I expression.
- FIG. 25 presents results of gene expression studies to analyze the expression of GnRH, GnRH receptor I, LH ⁇ , LH receptor, ⁇ FSH, and FSH receptor in various cancer cell lines.
- RNA was extracted from cell lines and tumors and subjected to enzymatic amplification of complementary DNAs. These complementary DNA samples were then amplified by PCR using specific primers for the genes listed above and a constitutively-expressed gene for glyceraldehyde-3- phosphate-dehydrogenase (GAPDH).
- GPDH glyceraldehyde-3- phosphate-dehydrogenase
- GnRH, GnRH receptor I, LH ⁇ , LH receptor, ⁇ FSH, and FSH receptor were detected in prostate cancer cell lines (DU145, PC3, CWR-Rl, LNCaP, and LNCaP-C42), brain cancer cell lines (DAOY, SKNMC, CFF-SttGl , LN229, U87MG, and Ul 18MG), non-small cell lung carcinoma cell lines (H358, H838), pancreatic cancer cell lines (HPAC, Pane), ovarian cancer cell lines (SKO V3 and CaOV3), breast cancer cell lines (MCF-7, T47D), kidney cancer cell lines (ACHN, 786-0), colon cancer cell lines (HCT-116, HT-29), and a malignant mela
- FIG. 26 demonstrates results of gene expression analysis in a breast cancer cell line (T47D), designated “B”, and non-small cell lung carcinoma cell lines (H358, H838), designated “Ll” and “L2", respectively, representative of the results achieved with reverse-transcriptase PCR.
- M refers to a DNA molecular weight marker. Arrowheads mark the PCR products of interest.
- Gnrhrl refers to gonadotropin releasing hormone receptor- 1
- gnrh refers to gonadotropin releasing hormone
- fshr refers to follicle stimulating hormone receptor
- lhr refers to luteinizing hormone receptor
- ⁇ fsh refers to follicle stimulating hormone
- ⁇ lh refers to luteinizing hormone.
- FIG. 27 is a schematic diagram of the HPG axis.
- HPG axis-positive cancers are prevented, treated, delayed, or mitigated by administering high doses of at least one physiological agent that is a GnRH agonist or antagonist, effective to reduce local tissue production of hormones of the HPG axis or to down-regulate hormone receptors.
- the physiological agent is leuprolide
- the amount administered is sufficient to maintain the serum leuprolide levels at greater than about 1.5 ng/ml for the full dosing period.
- the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.0 ng/ml for the full dosing period.
- the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.5 ng/ml for the full dosing period. In other embodiments, the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 3.0 ng/ml for the full dosing period.
- the physiological agent is an agent other than leuprolide
- the amount administered is an amount sufficient to maintain the serum levels of the agent at greater than about 1.5 ng/ml for the full dosing period, greater than about 2.0 ng/ml for the full dosing period, greater than about 2.5 ng/ml for the full dosing period, or greater than about 3.0 ng/ml for the full dosing period.
- a “full dosing period” refers to a period of time sufficient to achieve a therapeutic effect in the treatment, mitigation, delay, or prevention of HPG axis-positive cancers, and may be from about one month to about twelve months, or such shorter or longer period of time as is required to achieve the therapeutic effect.
- the full dosing period is in the range of from about 30 days to about 90 days. In other embodiments, the full dosing period is about 60 days.
- other embodiments of this invention include treating, preventing, slowing the progression of, or mitigating HPG axis-positive cancers by continually increasing the dose of the GnRH agonist or antagonist until a decrease in a cancer-specific marker is achieved, or until the patient develops adverse effects that represent greater risk or discomfort than does the risk or discomfort of the cancer.
- Cancer-specific markers include or are expected to include, but are not limited to: dynein, ⁇ -PIX, and sorcin, which are proteins that have been shown to be differentially expressed in gliomas compared to normal brain; prostate-specific antigen (PSA); Ki67, a cell proliferation marker that decreases if cells slow in proliferation, and which is expected to be a useful marker for any cancer, including any HPG axis-positive cancer; and carcinoembryonic antigen (CEA), a marker for colon cancers.
- PSA prostate-specific antigen
- Ki67 a cell proliferation marker that decreases if cells slow in proliferation, and which is expected to be a useful marker for any cancer, including any HPG axis-positive cancer
- CEA carcinoembryonic antigen
- HPG axis-positive cancers would be prevented, treated, delayed, or mitigated by directly and constantly infusing GnRH agonists or antagonists into the affected tissue. It is well known in the art to deliver drugs by infusion through a catheter embedded directly in a part of a patient's body requiring treatment, for example, in the liver of a patient requiring chemotherapy drugs for the treatment of liver cancer.
- controlled release formulations of GnRH agonists or antagonists would be implanted directly into or near the cancer tissue in order to prevent, treat, delay, or mitigate HPG axis-positive cancers, for example by implantation directly into the tumor site following a surgical resection of a tumor. This would allow for high concentrations of the GnRH agonist or antagonist while minimizing peripheral exposure.
- a needle may be used to inject about 1 mg/day of GnRH agonists or antagonists into a patient.
- a dose of a GnRH agonist or antagonist administered for the prevention, treatment, delay, or mitigation of HPG axis-positive cancers when delivered by implantation of controlled release formulations directly into or near the tumor, results in serum levels of up to about 3 ng/ml or more, and is expected to result in tumor/organ tissue levels of up to about 3 ng/ml.
- the dosage regime of GnRH agonist or antagonist to treat, prevent, mitigate, or slow the progression of HPG axis- positive cancers would be a dose that is physiologically equivalent to a dose of leuprolide in the range of about 11.25 mg/month to about 22.5 mg/month, or a dose of an agent resulting in daily dosages physiologically equivalent to a dose of leuprolide of approximately 0.375 mg/day to approximately 0.75 mg/day.
- a controlled release formulation would be formulated to maintain a tissue concentration of the GnRH agonist or antagonist at levels that maintain the serum leuprolide levels at greater than about 1.5 ng/ml for the full dosing period.
- the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.0 ng/ml for the full dosing period. In other embodiments, the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 2.5 ng/ml for the full dosing period. In other embodiments, the amount of leuprolide administered is sufficient to maintain the serum leuprolide levels at greater than about 3.0 ng/ml for the full dosing period. In embodiments of the invention, the higher tissue concentration would be substantially sustained at a high level instead of spiking initially and briefly to a very high level and then dropping substantially.
- an implanted controlled release formulation of GnRH agonists or antagonists would achieve a release profile that provides a substantially stable serum concentration of GnRH agonists or antagonists that is at least about two to about five times the serum concentration provided by currently-known cancer treatments using GnRH agonists or antagonists (for example, treatments for prostate cancer), with the serum concentration being substantially sustained at the higher level instead of spiking initially and briefly to a very high level and then dropping substantially as occurs with currently-known treatments.
- an implanted controlled release formulation of the present invention for preventing, treating, delaying, or mitigating GnRH receptor-positive cancers would provide a GnRH agonist or antagonist serum concentration of at least about 1.5 ng/ml, in embodiments up to about 3.0 ng/ml or more over the lifetime of the formulation.
- Such formulations, using polymeric controlled release technology, are available from Durect Corporation, Cupertino, California.
- the lifetime of the implanted controlled release formulation according to the present invention may be from about one month to about twelve months, or such shorter or longer lifetime as is appropriate for the treatment, mitigation, delay, or prevention of HPG axis-positive cancers.
- the lifetime of the formulation is in the range of from about 30 days to about 90 days. In other embodiments, the lifetime of the formulation is about 60 days.
- GnRH agonists or antagonists are also suitable for administering GnRH agonists or antagonists according to the present invention, such as intramuscular injection of microspheres.
- GnRH agonists or antagonists include but are not limited to Antide ® brand of iturelix; Lupron ® brand of leuprolide acetate; Zoladex ® brand of goserelin acetate; Synarel ® brand of nafarelin acetate; Trelstar Depot brand of triptorelin; Supprelin brand of histrelin; Suprefact ' brand of buserelin; Cetrotide ® brand of cetrorelix; Plenaxis ® brand of abarelix; Antagon brand of ganirelix; and degarelix (FE200486).
- Embodiments of the present invention also include treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers by coadministering a GnRH agonist or antagonist with conventional chemotherapeutic treatment, the GnRH agonist or antagonist being administered in accordance with the treatment protocols described herein, or with modifications to the protocols that would be apparent to one of ordinary skill in the art in light of the present specification.
- Embodiments of the present invention further include treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers by coadministering a GnRH agonist or antagonist with conventional radiation therapy, the GnRH agonist or antagonist being administered in accordance with the treatment protocols described herein, or with modifications to the protocols that would be apparent to one of ordinary skill in the art in light of the specification.
- Embodiments of the present invention also include treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers by administering a GnRH agonist or antagonist prior to surgical resection of a tumor, the GnRH agonist or antagonist being administered in accordance with the treatment protocols described herein, or with modifications to the protocols that would be apparent to one of ordinary skill in the art in light of the present specification.
- Embodiments of the present invention additionally include treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers by administering a GnRH agonist or antagonist during the immediate period after a surgical resection and indefinitely thereafter to prevent tumor recurrence, the GnRH agonist or antagonist being administered in accordance with the treatment protocols described herein, or with modifications to the protocols that would be apparent to one of ordinary skill in the art in light of the present specification.
- Embodiments of the present invention also include treating, mitigating, slowing the progression of, or preventing HPG axis-positive cancers by coadministering a GnRH agonist or antagonist with LH receptor blockers or analogues thereof, which include but are not limited to interleukin-1 and anti-LH receptor immunoglobulins; co-administering a GnRH agonist or antagonist with activin receptor blockers or analogues thereof; and administering other agents, including agents not yet known, that decrease the degradation of, increase the half-life of, or increase tumor tissue levels of GnRH agonists or antagonists.
- the GnRH agonist or antagonist would be administered in accordance with the treatment protocols described herein, or with modifications to the protocols that would be apparent to one of ordinary skill in the art in light of the present specification.
- the present invention encompasses pharmaceutical formulations containing GnRH agonists and/or GnRH antagonists and which are configured to be implanted in or near tumor tissue and to provide serum concentrations or certain tissue concentrations of the GnRH agonists and/or GnRH antagonists that are up to about 10 times higher than serum levels resulting from conventional cancer treatments using GnRH agonists or antagonists, such as, for example, conventional prostate cancer treatments.
- the pharmaceutical formulations could be used, for example, to treat, delay, mitigate, or prevent HPG axis-positive cancers.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Reproductive Health (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Endocrinology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
L'invention concerne des procédés destinés à traiter des cancers positifs à axe gonadotrophine hypophysaire (HPG), à prévenir ou à ralentir la prolifération de cellules d'origine cancéreuse positives à axe HPG, à prévenir les cancers positifs à axe HPG chez un patient à risque, à prévenir ou à inhiber la régulation positive du cycle cellulaire dans des cellules dérivées du cancer positif à axe HPG chez un patient, et à réduire le niveau de marqueurs spécifiques du cancer positif à axe HPG chez un patient.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/180,667 | 2005-07-14 | ||
US11/180,668 US20060148697A1 (en) | 2001-12-19 | 2005-07-14 | Methods for treating and preventing brain cancers |
US11/180,667 US20070015713A1 (en) | 2005-07-14 | 2005-07-14 | Methods for treating prostate cancer |
US11/180,668 | 2005-07-14 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2007011434A2 true WO2007011434A2 (fr) | 2007-01-25 |
WO2007011434A3 WO2007011434A3 (fr) | 2008-01-10 |
Family
ID=37669296
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2006/010668 WO2007011434A2 (fr) | 2005-07-14 | 2006-03-22 | Procedes destines a prevenir et a traiter des cancers qui expriment l'axe gonadal pituitaire ophtalmique d'hormones et de recepteurs |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2007011434A2 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2090322A1 (fr) * | 2008-02-18 | 2009-08-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Utilisation de ligands du récepteur de la FSH pour le diagnostic et le traitement du cancer |
WO2010141630A1 (fr) * | 2009-06-03 | 2010-12-09 | University Of Southern California | Compositions et méthodes de traitement du cancer faisant appel à la perturbation de la voie de signalisation lh/lhr |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6642274B1 (en) * | 1999-09-09 | 2003-11-04 | Gary W. Neal | Methods and compositions for preventing and treating prostate disorders |
-
2006
- 2006-03-22 WO PCT/US2006/010668 patent/WO2007011434A2/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6642274B1 (en) * | 1999-09-09 | 2003-11-04 | Gary W. Neal | Methods and compositions for preventing and treating prostate disorders |
Non-Patent Citations (6)
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2090322A1 (fr) * | 2008-02-18 | 2009-08-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Utilisation de ligands du récepteur de la FSH pour le diagnostic et le traitement du cancer |
WO2009103741A2 (fr) * | 2008-02-18 | 2009-08-27 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Utilisation de ligands des récepteurs de la fsh pour diagnostiquer et traiter le cancer |
WO2009103741A3 (fr) * | 2008-02-18 | 2010-01-21 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Utilisation de ligands des récepteurs de la fsh pour diagnostiquer et traiter le cancer |
EP2599504A3 (fr) * | 2008-02-18 | 2013-07-31 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Utilisation de conjugués de ligands du récepteur de la FSH et d'agents antitumoraux pour le traitement du cancer |
US8784776B2 (en) | 2008-02-18 | 2014-07-22 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Use of FSH receptor ligands for diagnosis and therapy of cancer |
US9200076B2 (en) | 2008-02-18 | 2015-12-01 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Use of FSH receptor ligands for diagnosis and therapy of cancer |
WO2010141630A1 (fr) * | 2009-06-03 | 2010-12-09 | University Of Southern California | Compositions et méthodes de traitement du cancer faisant appel à la perturbation de la voie de signalisation lh/lhr |
US20120164136A1 (en) * | 2009-06-03 | 2012-06-28 | University Of Southern California | Compositions and Methods for Treatment of Cancer by Disrupting the LH/LHR Signaling Pathway |
US8680055B2 (en) | 2009-06-03 | 2014-03-25 | University Of Southern California | Methods for decreasing steroidogenesis in prostate cancer cells |
Also Published As
Publication number | Publication date |
---|---|
WO2007011434A3 (fr) | 2008-01-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20110286998A1 (en) | Methods for treating and preventing cancers that express the hypothalamic-pituitary-gonadal axis of hormones and receptors | |
Sartor | Eligard: leuprolide acetate in a novel sustained-release delivery system | |
JP3313113B2 (ja) | 雌馬の排卵制御用生体適合性インプラント | |
Schally et al. | Discovery of LHRH and development of LHRH analogs for prostate cancer treatment | |
US20090197813A1 (en) | Methods for treating FSH related conditions with GnRH antagonists | |
TWI405578B (zh) | 用以治療荷爾蒙依賴型癌症之起始劑量的lhrh類似物及維持劑量的lhrh拮抗劑之施用法及相對應之藥學套組 | |
US20070238647A1 (en) | Methods for treating prostate cancer | |
Chengalvala et al. | GnRH agonists and antagonists in cancer therapy | |
ZA200700068B (en) | Sustained release composition | |
JP2006525306A (ja) | ゴナドトロピン・ホルモン放出ホルモンを使用する方法及び組成物 | |
Davies et al. | Regulation of endometrial cancer cell growth by luteinizing hormone (LH) and follicle stimulating hormone (FSH) | |
WO2007011434A2 (fr) | Procedes destines a prevenir et a traiter des cancers qui expriment l'axe gonadal pituitaire ophtalmique d'hormones et de recepteurs | |
Marelli et al. | Novel insights into GnRH receptor activity: role in the control of human glioblastoma cell proliferation | |
Gonzalez‐Barcena et al. | Inhibition of the pituitary‐gonadal axis by a single intramuscular administration of D‐Trp‐6‐LH‐RH (Decapeptyl) in a sustained‐release formulation in patients with prostatic carcinoma | |
Klijn et al. | Effects of somatostatin analog (Sandostatin) treatment in experimental and human cancer | |
US20060148697A1 (en) | Methods for treating and preventing brain cancers | |
Chi et al. | In vivo characterization of a novel GnRH (gonadotropin-releasing hormone) antagonist, LXT-101, in normal male rats | |
WO2019122998A1 (fr) | Combinaison d'un anticorps agoniste anti-pd-1 avec un agoniste ou antagoniste gnrh pour le traitement du cancer | |
WO2007011339A1 (fr) | Methodes de traitement et de prevention des cancers du cerveau | |
Gonzalez‐Barcena et al. | Persistent blockade of the pituitary‐gonadal axis in patients with prostatic carcinoma during chronic administration of D‐Trp‐6‐LH‐RH | |
Graul et al. | Abarelix | |
WO2007011340A1 (fr) | Methodes de traitement du cancer de la prostate | |
Fraser | GnRH and its analogues: current therapeutic applications and new prospects | |
WO2005063276A1 (fr) | Procedes et compositions faisant appel a la gonadoliberine | |
CA2341974A1 (fr) | Antagoniste de l'hormone de liberation des gonadotrophines |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 06739459 Country of ref document: EP Kind code of ref document: A2 |