WO2006137551A2

WO2006137551A2 - Diagnostic method for cancer and diagnostic method for lung cancer

Info

Publication number: WO2006137551A2
Application number: PCT/JP2006/312672
Authority: WO
Inventors: Norimasa Miura; Goshi Shiota
Original assignee: Univ Tottori; Norimasa Miura; Goshi Shiota
Priority date: 2005-06-20
Filing date: 2006-06-19
Publication date: 2006-12-28
Also published as: JPWO2006137551A1

Description

Description Cancer diagnosis method and S city cancer diagnosis method Technical Field

The present invention relates to a method for diagnosing cancer and a method for diagnosing lung cancer, and in particular, it can diagnose whether or not it is lung cancer at an early stage, and can determine whether or not an anticancer agent is effective for a patient. The present invention relates to a method for diagnosing lung cancer using such a method and a method for diagnosing cancer. Background art

Lung cancer remains the leading cause of malignancy-related deaths, although there have been minor changes in survival rates over the past 20 years.

Non-small cell lung cancer (NSCLC) is currently being used by all lung cancer patients.

Many patients continue to die from progressive and metastatic disease, despite new treatments and advances in surgical oncology.

In addition, there is a tumor marker as a diagnostic tool using a scalpel or the like.

This tumor marker is generally used as a diagnostic or therapeutic indicator for cancer.

As a tumor marker, for example, NSE (Neuron-specific enolase, Hereinafter, it is simply referred to as “NSE”. ^ l proGRP iPro— gastorin— releasing peptide, simply called “proGRP”. ) Is a valid marker.

Non-small cell lung cancer (NSCLC, hereinafter simply referred to as “NSCLC”), carcinoembryonic antigen (CEA, hereinafter simply referred to as “CEA”), Squamous cell carcinoma (SCC), hereinafter simply referred to as “SCC”) and cytokeratin 21 1 fragment (CYFRA (cytokeratin 19 fragment), hereinafter simply, CYFRA and Lex-Hagiwara (SLX (sial i Le antigen such as sialyl stage—speciic antigen—1), hereinafter simply referred to as “SLX”), CA19-9 (carbohydrate antigen 19-9, hereinafter simply referred to as “CA19-9”;) is generally used for diagnosis, and at least one group of CEA, SCC and CYFRA is selected. 70% of patients are non-small cell carcinoma (NSCLC) patients.

Also, based on histological categories, the rate of positive for both CEA and CYFRA was higher in patients with adenocarcinoma, and the rate of positive for both CYFRA and SCC was higher for squamous cell carcinoma It is considered high in patients with mous cell carcinoma.

In addition, standard techniques such as X-ray examinations, diagnostics using conventional tumor markers, and bronchial lavage (BL) are important in detecting lung cancer. There is a problem that these methods are not sufficient for detecting lung cancer in the early clinical stage. In addition, epidermal growth factor receptor (EGFR), hereinafter simply It is called “EGFR”. ) Tyrosine kinase activity (Tyr osine kinase activity), which is involved in tumor cell growth, cell survival, angiogenesis, exudation, and metastasis a synthetic anilinoquinazoline), Gefitinib (trade name: “Iressa” (registered trademark), sales company: Aslorazene Riki Co., Ltd.).

The EGFR tyrosine kinase inhibitory action of Gefitinib (trade name: "Iressa" (registered trademark), sales company: Aslorazene force Co., Ltd.) is an extremely effective drug in some patients, but there is a problem of side effects. There is.

EGFR is expressed in 80% of NSCLC tissue specimens. Its expression is observed in the progressive type of small cell lung carcinoma (SCLC). , An excellent biomaker for lung cancer, and EGFR targeted therapy (EGFR-targeted therapies) ^, (tumor response) molecular determinant (determined by molecular deta ermmants) .

EGFR 1) If it can be used like a tumor marker, it will be easier for doctors to decide whether or not to prescribe Gefitini b to patients, and to patients Even after prescribing (Gefitinib), follow-up studies such as determining the effect of Geifinib on the tumor can be easily performed.

[Non-Patent Document 1] Greenlee RT, Hill-Harmon MB, Murray T, Thun M. Cancer statistics. CA cancer J Clin 2005; 51: 15-36.

'[Non-Patent Document 2] Giaccone G. Clinical impact of novel treatment strategies. On cogene 2002; 21: 6970— 81.

[Non-Patent Document 3] Johnson BE, Grayson J, Makuch RW, et al. Ten -year surviva

1 of patients with small— cell lung cancer treated with combination chemother apy with or without irradiation. J Clin Oncol 1990; 8: 396-401.

[Non-Patent Document 4] Morina R, Filella X, Auge JM. ProGRP: a new biomarker for small cell lung cancer. Clinical Biochemistry

2004; 37: 505-11.

[Non-Patent Document 5] Sugio K, Sugaya M, Hanagiri T, Yasumoto K. Tumor marker in primary lung cancer. JUOEH 2004; 1: 473-9.

[Non-Patent Document 6] Schneider J, Philipp M, Velcovsky HG, Morr H, Katz N. Proo- gastrin— releasing peptide (ProGRP), neuron specific enolase (NSE), carci no embryonic antigen (CEA), and cyto keratin 19— fragments (CYFRA 21— 1) in patients with lung cancer in comparison to other lung diseases.Anticancer Res 2003; 23: 885- 93.

[Non-Patent Document 7] Tagliaferri P, Tassone P, Blotta S, et al. Antitumor therapeutic strategies based on the targeting of epidermal growth factor— induced surv ival pathways. Curr Drug Targets 2005; 6: 289-300.

[Non-Patent Document 8] Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-smal 1 cell lung cancer to gefitinib.N En gl J Med 2004; 350: 2129-39.

[Non-patent document 9] Gamou S, Hunts J, Harigai H, et al. Molecular evidence for the lack of epidermal growth factor receptor gene expression in small cell lung carcinoma cell. Cancer Res 1987; 4 2 68-73.

[Non-Patent Document 10] Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to Gefitinib therapy. Science 200 4; 304: 1497- 500. Disclosure of the Invention

The present invention has been made to solve the above-mentioned problems and the demands of doctors and the like, and more specifically, cancer, more specifically, the presence of cancer cells can be detected in the blood in the early stage of lung cancer. It is an object of the present invention to provide a cancer diagnostic method and a lung cancer diagnostic method using such a cancer diagnostic method.

The method for diagnosing cancer according to claim 1 comprises a step of obtaining a sample containing only RNA as a somatic cell component of a cancer cell from a body fluid, and a sample force containing only RNA. Reverse transcription that generates cDNA with reverse transcriptase PCR using an enzyme reaction and fluorescent dye is performed using a primer set that detects the presence of EGFR 'mRNA, and the PCR product amplified by PCR is quantitatively analyzed using a fluorescent dye combined with the PCR product. And a process for measuring.

Here, the term “body fluid” used in the present specification means blood, lymph fluid and other body fluids.

The method for diagnosing cancer according to claim 2, wherein the primer set used in the method for diagnosing cancer according to claim 1, The upstream primer is AACTGTGAGGTGGTCCTTGG, and the downstream primer is GTTGAGGGCAATGAGGACAT.

The method for diagnosing cancer according to claim 3 is body fluid blood or lymph used in the method for diagnosing cancer according to claim 1 or claim 2.

The method for diagnosing lung cancer according to claim 4 uses the method for diagnosing cancer according to any one of claims 1 to 3. The cancer diagnostic method according to the present invention can detect the presence of cancer cells in the blood at an early stage of cancer, so that cancer cells can be eradicated by early medical treatment.

In addition, since a sample containing mRNA was obtained from body fluid, the presence of cancer cells can be detected more accurately than when EGFR is detected in tumor tissue tumor formation and post-metastasis tissue force. be able to. In addition, by devising the primers used for PCR, it has become possible to detect the presence of cancer cells in the blood in the early stages of cancer. Brief Description of Drawings

FIG. 1 is an explanatory diagram for schematically explaining the cancer diagnostic method and its object according to the present invention.

FIG. 2 is a diagram for explaining a primer set used in the method for diagnosing cancer according to the present invention.

FIG. 3 shows the full-length base sequence of EGFR.

FIG. 4 shows the full-length base sequence of EGFR.

FIG. 5 shows the full-length base sequence of EGFR.

Fig. 6 shows the correlation between serum and each tissue of hTERT mRNA and EGFR mRNA Fig. 6 (a) is a graph showing the correlation between hTERT mRNA tissue and serum, and Fig. 6 (b) is the correlation between EGFR mRNA tissue and serum. It is a graph showing a relationship.

FIG. 7 is a diagram showing the results of multivariate analysis regarding clinical factors of one tumor marker.

Fig. 8 is a graph showing the results of ROC curve analyses.

FIG. 9 is a diagram illustrating the sensitivity and specificity of various tumor markers for lung cancer. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, an example of the cancer diagnosis method according to the present invention will be described in more detail.

1. Patient and specimen collection

FIG. 1 is an explanatory diagram schematically illustrating the cancer diagnosis method according to the present invention and its target.

To conduct the study shown in Figure 1, 89 patients with lung cancer were enrolled during the period from July 2003 to December 2004, which was approved by the National Yonago Hospital.

The average patient age was 63 years (22 to 90 years).

For these patients, serum tests, chest X-rays, (helical) computed tomography (CT), chest or brain magnetic resonance imaging, cytological examination, transbronchial, percutaneous, or thoracoscopic lung biopsy After histological examination, pathological evaluation of surgically resected specimens was diagnosed.

Clinicopathological findings (sex, age, diagnosis, tumor size, number of tumors, tumor marker tests such as CEA, SCC, CYFRA, proGRP ^ NSE (neuron specific enolase), TPA (tissue polypeptide antigen) and SLX, hepatitis Presence of active hepatitis virus, smoking calendar (smoke history) (estimated by pack—ye ar index) ^ Presence of metastasis or recurrence and clinical stage (IA to IV)] were evaluated. As a control group (comparative example), 27 healthy persons (12 to 78 years old: average age 53) including 12 women were used.

In addition, to examine the same patient for genes of interest in the serum before and after surgery (3 weeks after surgery) and to determine the ability as a tumor marker, to reverse human telomerase in lung cancer patients Expression of transcriptase (abbreviated as hTERT) mRNA and EGFR (epidermal growth factor receptor) mRNA was quantitatively analyzed.

In conducting this study, patient informed consent was obtained, and the study protocol (draft) was in accordance with the 1975 Helsinki Declaration Ethical Guidelines.

In addition, it was approved by the human research committee of Tottori University (approval No. 138, No. 138— 1, 2001 (approval No. 138, No. 138-1, 2001). )).

In the cancer diagnosis method according to the present invention, first, blood of a subject (patient) was collected.

Next, a sample containing RNA was obtained from blood.

More specifically, the body fluid collected in this case (blood in this example) (about 1 to 2 ml) is centrifuged at 10 steps for 10 minutes for 10 minutes (800xg, lOOOxg, 1500xg). Serum samples were obtained in which the presence of lymphocytes was reduced to a negligible amount. In order to examine whether the h TERT mRNA and EGFR mRNA in these serum samples originated from and released from pulmonary malignancies, 23 patients with lung cancer Surgically excised lung tissue and serum (sera) were collected.

2. RNA extraction and Real-time quantitative RT-PCR.

Next, RNA was extracted from serum samples by a known method using a DNase (deoxyribonuclease) treatment.

Serum samples 200 1 Medium strength Extracted RNA was dissolved in nuclease-free water (H 2 O).

Next, a quantitative real-time polymerase chain reaction (quantitative RT-PGR) is added to 1 il of one-step RT-PCR kit (manufactured by Qiagen). This was done using RNA extracts and 21 SYBR Green I (Roche, Basel, Switzerland).

RNA was extracted with HCC tissue using the same volume of serum and then dried to a 20-fold concentration.

Extraction of RNA with HCC tissue strength was performed using TRIzol (registered trademark) reagent (Reagent) according to the instructions of the manufacturer and distributor of this reagent (Invrogen Corp., Carlsbad, CA, USA).

The primers and target base sequences used in this experiment are shown in FIG.

That is, as a primer set for detecting EGFR, the upstream primer (EGFR-F) is AACTGTGAGGTGGTCCTTGG, and the downstream primer (EGFR-R) is GTTGAGGGCAATGAGGACAT.

The upstream primer is set in the forward direction of the target base sequence (5 '→ 3'), and the downstream primer is complementary to the strand corresponding to the forward direction of the upstream primer in the target base sequence. It is an array and set in the reverse direction.

3 to 5 show the full-length base sequence of EGFR.

This amplification target was the tyrosine kinase phosphorylation site of EGFR, and this primer contained a mutation in its base sequence.

For comparison, as a primer set for detecting hTERT, the upstream primer (hTERT-F) was designated as CGGAAGAGTGTCTGGAGCAA, and the downstream primer (hTERT—R) was designated as GGATGAAGCGGAGTCTGGA.

In 2-m i c r o g l o b i n, the upstream primer (2—m i c r o g 1 o b i n— F) is TGAGTGCTGTCTCCATGTTTGA, and the downstream primer (2-microglobin-R) is

It was set as TCTGCTCCCCACCTCTAAGTTG.

The RT-PCR conditions were as follows: the first reverse transcription reaction was performed at 50 ° C for 30 minutes, and then the reaction activation stage was maintained at 95 ° C for 12 minutes, followed by 50 cycles of the PCR reaction. (95 ° C (0 seconds)), 55 ° C (10 seconds), then 72 ° C (15 seconds), and melting at 40 ° C for 20 seconds (also called “denaturation”) ." did.

The range of real-time PCR analysis for hTERT mRNA and EGFR mRNA is about 5 copies in this analysis, and we can falsely make negative in serum samples from patients and comparative examples Sex was able to be excluded.

This PCR produced a 131 bp product for hTERT, a 114 bp product for EGFR, and an 88 bp product for β 2-microglobin RNA.

This RT-PCR analysis was repeated twice, and this quantification was confirmed to be reproducible by using a LightCycler (Roche, Basel, Switzerland).

3.Immunohistochemistry

The excised tissue was processed for embedding in paraffin. For immunohistochemical studies, 3 patients (12 patients in all) with strong protein expression of tumor markers in serum were selected, hTERT (Santa Cruz), EGFR (Santa Cruz), SCC (Sigma) And a lung cancer cross-sectional study using antibodies that discriminate CYFRA (Sigma).

For immune tissue studies, liver tissues fixed in 4% paraformaldehyde were umbedded in paraffin. For immunohistochemical analysis, the following antibodies were cultured in successive sections, and a mouse monoclonal antibody 5-micron- thick se ctions from Tsukiichi's excised specimens was deparaffinized in a series of xylene baths. A series of xylene baths and these trials were rehydrated in graded alcohols. All stained sections were heat treated in a lOmmol / litter sodium citrate buffer at 600W for 15 minutes using a microwave oven.

After washing in PBS (abbreviated phosphate buffered saline), these cut surfaces are avidin-biotin-peroxidase complex (Vector Laboratories, Burlmgam e, CA).

This number was expressed as a number per portal field (0.25 x 0.25 mm2). The proliferating cell nuclear antigen (PCNA) —positive oval cells were counted in the same way.

Epitope (antigenic determinant) To enhance exposure, slides at 98 ° C with 10-mmolZlitter citrate buffer (CITRATE BUFFER) at pH 6 for 90 minutes , Preprocessed.

Sections were then cultured in 2.5% blocking serum to reduce non-specific binding. Following this, samples were obtained at 37 ° C at the primary monoclonal mouse hTERT (H—231) sc—7212 antibody (primary monoclonal mouse hTERT (H—231) sc-7212antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA). , human EGFR (1005), sc—03 antibody (Santa Cruz Biotechnology, Santa Cruz, Calif., USA) for 90 minutes on a paraffin section at a 1:50 dilution. Sections were treated with standard avidin-biotin immunochemistry according to company recommendations (Vector Laboratories, Burlingame, CA, USA).

Finally, diaminobenzene was used as the chromogen and hematoxylin was used as the nuclear counterstain. As a negative target, the temporary antibody was omitted and staining was performed. Results were expressed as a percentage. Nucleolus hTERT is associated with telomere function. Only nucleolar stained cells were included in the numerator. Immunoreactivity is visualized using a fluorescent dye-conjugated secondary antibody did.

hTERT staining was classified as negative (> 50% of tumor cells positive at the nucleolar level) and positive (> 50% of them).

4. Statistical analysis

SPSS II (SPSS Corp., Tokyo, Japan) was used to make important clinicopathological findings affecting hTERT, EGFR and other markers.

Stratification classification for each clinical factor (parameter) was evaluated by multivariate analysis using a logical regression model.

For each tumor marker, a multivariate analysis was used to examine the significant differences seen during lung disease.

In order to investigate the correlation between hTERT mRNA, EGFR mRNA, conventional tumor markers and clinical factors (parameters), Pearson's relative index was calculated.

As a result, it was found that there was a statistical difference with the establishment of 0.05 or less.

In order to assess the accuracy of diagnostic tests, SPSS II (SPSS Corp., Tokyo, Japan) was used to match tests on CEA, SCC, CYFRA, EGFR mRNA and hTERT mRNA ( The matched data sets (patients with and without malignancies m lung) ¾f, ROC (receiver operator characteristic) 7 curve analysis.

ProGRP, NSE, TPA, and SLX were not evaluated because there was no data for the comparison group. This evaluation analysis indicated a strong linear relationship between copy number and PCR cycles using RNA controls (r2> 0.99). The correlation between hTE RT mRNA and EGFR mRNA between lung tissue and serum was analyzed using both the 2-point t test (Paired t test) and the Spearman's test.

In each quantitative analysis, a strong linear relationship was shown between the copy number and the PCR cycles using RNA controls (r ² > 0.99).

The expression of hTERT mRNA and EGFR mRNA gradually increased as the disease progressed, and the quantitative values were significantly higher in lung cancer than in healthy individuals (P 0. 01). Also, according to Pearson's relative index, hTERT mRNA level is significantly different from EGFR mRNA level (level), lung disease, TPA (tissue polypeptide antigen), SCC :, and the number of tumors. It was found that there was no relationship with the difference (P = 0.015, P = 0.0117, P = 0.001, and P = 0.042 respectively).

In addition, according to Pearson's relative index, EGFR mRNA has a significant difference in the number of occupied lobes (occupied lobular segments), metastasis, recurrence, and clinical stage. There was a correlation force S (P = 0.033, P = 0.043, P = 0.002, and P <0.001 respectively). The Spearman's test showed that there is a strong relationship between hTERT mRNA and EGFR mRNA in lung cancer tissues and hTERT mRNA and EGFR mRNA in serum (P = 0. P = 0.002).

Figure 6 shows the correlation between the serum and each tissue of hTERT mRNA and EGFR mRNA. Fig. 6 (a) is a graph showing the correlation between hTERT mRNA tissue and serum, and Fig. 6 (b) is the correlation between EGFR mRNA tissue and serum. It is a graph showing a relationship.

This correlation between tissue and serum indicates that hTERT mRNA and EGFR mRNA in serum originate from lung cancer tissue.

Multivariate analysis revealed that there is a strong relationship between the expression of hTERT and EGFR in serum as a clinicopathological finding (see Figure 7).

Cigarette smoking, tumor size, number of tumors, metastasis and recurrence have a strong relationship with hTERT mRNA expression. S half IJ (P = 0.029, P = 0.002, P = 0. 003, P = 0.004 and P = 0.013, respectively) ₀

Tumor number, tumor size, recurrence and clinical stage were found to be strongly related to EGFR mRNA expression (P = 0.047, P = 0.043, P = 0.037 and P = 0, respectively) 032).

In lung cancer, all tumor markers do not show a relationship with etiology. Speaking of the strength of conventional tumor markers, CEA levels are strongly related to the number of occupied lobular segments occupied by smoking and (cancer) (P = 0. 031 for each), and SGC levels are There is a strong relationship with the number of tumors, tumor size and metastasis (P = 0.016, P = 0.015 and Ρ = 0 · 044, respectively), and the CYFRA level is the number of tumors, tumor size, There is a strong relationship with metastasis and recurrence (各々 = 0.017, Ρ = 0.019, Ρ = 0.045 and P = 0. Oil, respectively) (see Figure 7).

Fig. 8 is a graph showing the results of ROC curve analyses.

From Figure 8, the sensitivity Z-specificity of hTERT mRNA and EGFR mRNA for lung cancer is 71. It was found to be 8% / 72.5% and 60.8% / 62.5% (see Figure 9).

The optimal cut-off values for hTERT mRNA and EGFR mRNA expression are statistically at 103.76copies / 0.2 ml and 101.21 copies / 0.2 ml, respectively. It was calculated as there was.

In addition, the positive predictive value (PPV) and the negative negative predictive value (NPV) at the time of cancer formation are 0.775 / 0.667 for hTERT mRNA, and 0 for EGFR mRNAi. 667/0.

The positive predictive value (PPV) / negative predictive value (NPV) for carcinogenesis of CYFRA, SCC, and CEA are 0. 650/0. 500, 0. 207/0. 875, and 0. 650/0, respectively. It was 391.

By comparing the sensitivity / specificity for positive predictive value (PPV) / negative predictive value (NPV) at the time of cancer formation, an accurate cut-off value using quantification of many patients The set-up could further improve the statistical evaluation of hTERT mRNA and EGFR mRNA.

Next, the quantitative values of hTERT mRNA and EGFR mRNA before and after surgical treatment (3 weeks after surgery) will be explained. '

According to the comparison before excision and 3 weeks after surgical treatment, the postoperative quantitative values of hTERT mRNA and EGFR mRNA were lower than the preoperative quantitative values.

In immunohistological studies, high expression of hTERT mRNA, EGFR mRNA, SCC, and CYFRA indicates high expression of hTERT, EGFR, SCC, CYFRA protein, and as a result, measured values in serum It was completely compatible with the measured values.

In addition, the correlation between hTERT mRNA and EGFR mRNA between serum and tumor tissue is It was strongly shown to be derived from hTERT mRNA tumor cells found in.

In addition, comparing the pre-surgical treatment and 3 weeks after the surgical treatment, the quantitative values of both the hTERT mRNA and EGFR mRNA biomarkers of both the hTERT mRNA and EGFR mRNA before surgery were compared. Compared to the quantitative value of biomarkers, this suggested that both pomas could be the most accurate tumor markers.

As is clear from the above explanation, EGFR mRNA showed high sensitivity and specificity for lung cancer patients.

That is, the cancer diagnostic method according to the present invention can detect evidence of the presence of cancer cells from the blood in the early stage of cancer, and thus can eradicate cancer cells by early medical practice.

In addition, since samples containing mRNA were obtained from body fluids, the presence or absence of cancer cells can be detected more accurately than in the case where cancer tissue tumor formation, metastasized tissue after metastasis is detected. it can.

In addition, by devising the primers used for PCR, it has become possible to detect the presence of cancer cells in the blood in the early stage of cancer.

In addition, the cancer diagnosis method according to the present invention makes it easy for a doctor to determine whether or not to prescribe an EGFR tyrosine kinase inhibitor such as gefitinib to a patient. Whether an EGFR tyrosine kinase inhibitor such as Gefitinib is effective against tumors even after the prescription of an EGFR tyrosine kinase inhibitor such as Gefitinib Can be easily traced.

In the best mode for carrying out the invention of the present specification, the method for diagnosing cancer according to the present invention includes blood. In the cancer diagnosis method according to the present invention, an example in which fluid force RNA is extracted is not limited to extraction of blood force RNA, and fluid fluid RNA other than blood may be extracted. Industrial applicability

The cancer diagnostic method and lung cancer diagnostic method according to the present invention can detect evidence of the presence of cancer cells from the blood in the early stage of cancer, and thus can eradicate cancer cells by early medical practice. If the cancer diagnosis method and lung cancer diagnosis method according to the present invention are performed before prescribing to the patient, based on the results, it is determined whether the anticancer agent is effective, and after the patient is prescribed the anticancer agent, the patient When the cancer diagnosis method and lung cancer diagnosis method according to the present invention are performed, it is possible to determine whether or not the anticancer drug prescribed by the patient is effective. Therefore, industrial applicability is high.

Claims

The scope of the claims

1. A step of obtaining a sample containing only RNA as a somatic cell * cancer cell component from a body fluid; a sample force containing only the RNA; a reverse transcriptase reaction that generates cDNA with reverse transcriptase and a fluorescent dye PCR using the primer set to detect the presence of EGFR mRNA, quantitatively measuring the PCR product amplified by the PCR using the fluorescent dye bound to the PCR product, and A method for diagnosing cancer.

2. The cancer diagnostic method according to claim 1, wherein the primer set is an upstream primer AACTGTGAGGTGGTCCTTGG and the downstream primer is GTTGAGGGCAATGAGGACAT.

3. The method for diagnosing cancer according to claim 1, wherein the body fluid is blood.

4. A method for diagnosing lung cancer using the method for diagnosing cancer according to any one of claims 1 to 3.