WO2006130022A1 - Modulation de l'ovulation au moyen d'agonistes et d'antagonistes de bmprii - Google Patents

Modulation de l'ovulation au moyen d'agonistes et d'antagonistes de bmprii Download PDF

Info

Publication number
WO2006130022A1
WO2006130022A1 PCT/NZ2006/000134 NZ2006000134W WO2006130022A1 WO 2006130022 A1 WO2006130022 A1 WO 2006130022A1 NZ 2006000134 W NZ2006000134 W NZ 2006000134W WO 2006130022 A1 WO2006130022 A1 WO 2006130022A1
Authority
WO
WIPO (PCT)
Prior art keywords
agonist
antagonist
bmprii
ovulation
bmpriiecd
Prior art date
Application number
PCT/NZ2006/000134
Other languages
English (en)
Other versions
WO2006130022A8 (fr
Inventor
Jennifer Lee Juengel
Kenneth Pattrick Mcnatty
Samu Juuso Petteri Myllymaa
Arja Hannele Pasternack
David Gregory Mottershead
Olli Visa-Pekka Ritvos
Mika Petri Esaias Laitinen
Original Assignee
Agresearch Limited
Biotechvisions Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agresearch Limited, Biotechvisions Limited filed Critical Agresearch Limited
Publication of WO2006130022A1 publication Critical patent/WO2006130022A1/fr
Publication of WO2006130022A8 publication Critical patent/WO2006130022A8/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/24—Follicle-stimulating hormone [FSH]; Chorionic gonadotropins, e.g. HCG; Luteinising hormone [LH]; Thyroid-stimulating hormone [TSH]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/179—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/18—Feminine contraceptives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to an agonist or antagonist capable of modulating the activity of the bone morpho genetic protein receptor II (BMPRII) in vivo, and thereby modulating follicular development.
  • BMPRII bone morpho genetic protein receptor II
  • the present invention also relates to methods of manipulating follicular development, and to methods of modulating ovarian function and ovulation rate, in vivo.
  • GDF-9 and BMP- 15 are members of the transforming growth factor beta (TGF- ⁇ ) superfamily which are expressed in the oocyte of the developing follicle and which play an important role in mammalian fertility (McNatty et al, 2003).
  • TGF- ⁇ s exert their biological effects through binding to specific cell surface receptors.
  • a receptor is a protein, usually spanning the cell membrane, which binds to a ligand from outside the cell, and as a result of that binding transmits a signal to the inside of the cell which alters cellular function.
  • BMPRII bone morphogenetic protein receptor II
  • GDF-9 was shown to be responsible for only approximately 50% of the total BMPRII mediated oocyte bioactivity (Gilchrist et al, 2003). Thus, it is likely that other important oocyte regulatory factors utilize this receptor pathway to affect follicular development and maturation.
  • the present invention provides an agonist or antagonist capable of modulating the activity of the bone morphogenetic protein receptor type II in vivo.
  • the present invention provides an agonist or antagonist that is capable of binding to the bone morphogenetic protein receptor type II and modulating the biological activity thereof in vivo.
  • the present invention provides an agonist or antagonist that is capable of increasing or decreasing the biological availability of agents which bind to bone morphogenetic protein receptor type II, thereby modulating the biological activity thereof in vivo.
  • the present invention further provides a pharmaceutical composition comprising an agonist or antagonist of the invention together with a pharmaceutically acceptable excipient or carrier.
  • the present invention further provides a use of an agonist or antagonist of the invention in the manufacture of a medicament for modulating follicular and/or oocyte development in a female mammal in need thereof.
  • the present invention further provides a use of an agonist or antagonist of the invention in the manufacture of a medicament for modulating ovarian function and ovulation rate in a female mammal in need thereof.
  • the present invention further provides a method of modulating follicular and/or oocyte development and maturation in a female mammal, comprising the steps of administering to said mammal an effective amount of an agonist or antagonist of the invention.
  • the present invention further provides a method of modulating the ovulation rate of a female mammal, said method comprising the step of administering to said mammal an effective amount of an agonist or antagonist of the invention.
  • modulating means any change, whether an augmentative or inhibitive, in a biological process.
  • agonist or antagonist means a biologically active agent that is capable of modulating a biological process. Agonists will usually be interpreted as inducing an augmentation of the biological process. Antagonists will usually be interpreted as inducing an inhibition of a biological process.
  • antibody or antibody fragment means an intact molecule or fragment thereof such as Fab, F(ab')2, Fc and Fv fragments, which are capable of binding an antigenic determinant (i.e., that portion of a molecule (i.e., an epitope) that makes contact with a particular antibody or other binding molecule).
  • Antibodies include, for example, polyclonal, monoclonal, chimeric, and single chain antibodies, single chain Fvs, Fab fragments, and fragments produced by a Fab expression library, or phage display.
  • biologically active means that a particular molecule is capable of binding to BMPRII or transmitting or modulating a BMPRII stimulus to a cell.
  • follicular and/or oocyte development and maturation means the progression of the follicle through the stages of a primordial follicle to a preovulatory follicle through to a fully functional corpus luteum and/or the maturation process of the cumulus granulosa cell oocyte complex occurring prior to fertilization.
  • Figure 1 shows the histological appearance of the ovaries of 15-day-old mice given PBS (control A and C; 10 x (A) and 20 x (C)), or BMPRIIecd-Fc-fusion protein (treatment group B and D; 10 x (B) and 20 x (D));
  • Figure 2 shows a graph of oocyte diameter relative to various follicular stages in control mice (CO 1 and CO 3) or BMPRIIecd-Fc-fusion protein treated mice (BR 2, BR 4 and BR 5).
  • Figures 4 A and 4B show abnormal follicular architecture in BMPRII ecd-Fc -treated mice;
  • Figure 5 shows the histological appearance of the ovaries of 15-day-old mice given PBS (control, A) or the BMPRIIed-Fc-fusion protein with increasing protein doses (20 ⁇ g, B; 60 ⁇ g, C; and 200 ⁇ g, D).
  • a 5 a type of 5a follicle in the control mouse ovary shows many granulosa cell layers and a well developed theca layer (arrow).
  • C and D Usually 3b and 4 follicles with a large oocyte, asymmetric granulosa cell layer and a poorly formed theca cell layer (arrow).
  • Figure 6 shows the distribution of follicle developmental stages in mice receiving PBS or 20 ⁇ g, 60 ⁇ g or 200 ⁇ g of the BMPRIIecd-Fc-fusion protein. The values represent mean ⁇ SEM;
  • Figures 7A and B show abnormal follicular architecture in mice treated with 200 ⁇ g BMPRIIecd-Fc-fusion protein.
  • A relatively large oocytes are surrounded by one layer of cuboidal and flattened granulosa cells (arrow).
  • B a highly unusual type 3b follicle (arrow).
  • Figure 8 shows the oocyte diameter relative to the follicular stage in control or the BMPRIIecd-Fc-fusion protein treated mice. The values represent mean ⁇ SEM;
  • Figure 9 shows the mean oocyte diameters pooled from the follicles with a growing oocyte. The values represent mean ⁇ SEM.
  • FIG. 10 shows the distribution of follicle developmental stages in the mice receiving PBS 100 ⁇ g or the DMPRIIecd-Fc-fusion protein. The values represent mean ⁇ SEM. Asterisk, p ⁇ 0.05 vs. control. Double asterisk, p ⁇ 0.01 vs control;
  • Figure 11 shows the analysis of the oocyte diameter relative to the follicular stage.
  • the data represents the mean oocyte diameters ( ⁇ SEM) from the respective follicle stages.
  • Figure 12 shows the number of antral, preovulatory and corpus leteums in the control animals and the treatment groups.
  • A relative proportions of follicles corpus luteums.
  • B absolute numbers of follicles and CLs.
  • the values represent mean ⁇ SEM.
  • Figure 13 shows the number of ovulated eggs in the mice receiving PBS, 20 ⁇ g of the BMPRIIecd-Fc-fusion protein combined to the standard mouse superovulation protocol with 2.5 IU PMSG ( Figure 13A) or 5 IU PMSG and 5 IU hCG ( Figure 13B).
  • the values represent mean ⁇ SEM;
  • Figure 14 shows the percentage of atretic oocytes found in the oviducts of the respective study groups.
  • the data represents the mean ( ⁇ SEM); and
  • Figure 15A shows the number of ovulated eggs in the mice receiving PBS or 60 ⁇ g BMPRIIecd-Fc-fusion protein per injection combined to the 1 IU or 10 IU hFSH and 5 IU hCG and Figure 15B shows the number of ovulated eggs in the mice when only those animals with ovulations have taken into the analysis.
  • the values represent mean ⁇ SEM. Asterisk, p ⁇ 0.05 (Student's t-test).
  • BMPRII bone morphogenetic protein receptor II
  • the present invention provides an agonist or antagonist capable of modulating the activity of the BMPRII in vivo.
  • agonists or antagonists include ligands that will bind to the BMPRII and either activate or inhibit the signal transduction to the cell.
  • ligands include a known or putative drug, polypeptide or an antibody raised against BMPRII or a portion thereof.
  • the agonist or antagonist is an antibody raised against the binding or ecto-domain of BMPRII, or an antibody fragment thereof.
  • agonists or antagonists include molecules that will affect the bioavailability of endogenous ligands.
  • molecules include a purified or recombinant BMPRII or a fragment thereof that will bind or scavenge endogenous ligands that naturally bind to BMPRII in vivo, thereby modulating the activity of the BMPRII regulatory pathway.
  • the molecule is a recombinant protein comprising the BMPRII binding or ecto-domain.
  • Potential agonists or antagonists of the invention may be tested for their ability to bind to, or affect the signal transduction pathway of BMPRII using an assay system which comprises the BMPRII using labelled candidate ligands and/or a reporter gene operably linked to a response element such that a signal sent by the receptor turns on the reporter gene.
  • an assay system which comprises the BMPRII using labelled candidate ligands and/or a reporter gene operably linked to a response element such that a signal sent by the receptor turns on the reporter gene.
  • Such identified agonists or antagonists could be further modified or administered directly to a female mammal to either activate or inhibit the natural function of the BMPRII, thereby modulating the ovulation rate in said mammal.
  • the present invention therefore provides a use of one or more of the agonists or antagonists of the invention in a method of modulating the ovulation rate in a female mammal.
  • Preferred agonists or antagonists of the invention comprise antibodies raised against BMPRII or a fragment thereof derived from the binding domain of BMPRII.
  • Such antibodies may be administered directly to a female mammal (passive immunisation) or may be raised in said mammal in vivo by administering BMPRII or a fragment thereof derived from the binding domain thereof, (active immunisation) as would be appreciated by a skilled worker.
  • the agonists and antagonists of the present invention will be able to be used to both increase as well as decrease ovulation. Where the effect is to reduce ovulation, this effect may be permanent, to induce sterility, or may be reversible or temporary, and could be used as a means of contraception.
  • BMPRII agonists and antagonists of the invention work to neutralize or enhance the biological activity of factors that are know to effect ovulation via the BMPRII, such as GDF-9 and BMPl 5.
  • Reduction of the biologically effective amount of GDF-9 to approximately 50% was linked to an increase in ovulation rate in Irish Cambridge and Belcare sheep (WO03/102199) whilst neutralization of GDF-9 and/or BMP15 is known to reduce the ovulation rate in sheep (Juengal et al, 2002).
  • the present invention is also directed to the use of one or more of the agonists or antagonists of the invention in the manufacture of a medicament for modulating follicular development and/or for modulating the ovulation rate in a female mammal.
  • the present invention is also directed to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one agonist or antagonist of the present invention together with a pharmaceutically acceptable carrier useful for the modulation of ovulation rate.
  • compositions of the present invention may comprise, in addition to one or more agonists or antagonists of the present invention, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other material well known in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • a pharmaceutically acceptable excipient such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material will be dependent upon the desired nature of the pharmaceutical composition, and the route of administration e.g. oral, intravenous, cutaneous, subcutaneous, intradermal, intramuscular or intraperitoneal.
  • compositions for oral administration may be in tablet, lozenge, capsule, powder, granule or liquid form.
  • a tablet or other solid oral dosage form will usually include a solid carrier such as gelatine, starch, mannitol, crystalline cellulose, or other inert materials generally used in pharmaceutical manufacture.
  • liquid pharmaceutical compositions such as a syrup or emulsion, will generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen- free and has suitable pH, isotonicity and stability.
  • the invention contemplates the use of one or more additional modulators of ovulation to be co-administered with the pharmaceutical composition of the present invention to give an additive or synergistic effect to the treatment regime.
  • additional modulators of ovulation include follicle stimulating hormone (FSH), luteinising hormone (LH), chorionic gonadotrophs (CG), a GnRH agonist or antagonist, a
  • FSH angonist or antagonist a derivative of FSH, LH or CG.
  • Androvax an androstenedione protein vaccine conjugate
  • steroid hormones or antibodies that modulate the bioavailability of
  • modulators may be administered either separately, sequentially or simultaneously with at least one agonist or antagonist of the present invention depending upon whether ovulation is to be increased or decreased as will be appreciated by a skilled worker.
  • Such combined treatment may be particularly useful in fertility treatment to enhance ovulation (ie. superovulation).
  • Administration of the pharmaceutical composition of the invention is preferably in a "therapeutically effective amount", this being sufficient to show the desired benefit to the individual.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the female mammals underlying condition. Prescription of treatment, e.g. decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Oslo, A. (ed), 1980.
  • a BMPRII peptide was synthesised corresponding to the binding domain.
  • the peptide sequence was:
  • a BMPRII-Fc -fusion protein was prepared using recombinant techniques.
  • the human BMPRII ecto-domain was PCR amplified (GCGCTAGCATGACTTCCTCGCTGCAG (SEQ ID NO: 2) and GCGGATCCGCCTCATCTCGGTTAAATGAATGAGG) (SEQ ID NO: 3) from aplasmid containing the human BMPRII sequence and cloned into the plgPlus (R&D Systems Europe) expression plasmid via the Nhel/BamHI sites.
  • the resulting plasmid, plgPlus-BMPRIIecd was checked by DNA sequencing.
  • a version of the human IgGl Fc domain incorporating a C-terminal His6 tag was produced by PCR amplifying the Fc domain (GCAGATCTAATCGAAGGTCGTGGTGATCCCAAATCTTGTGAC (SEQ ID NO: 4) and AAGCGGCCGCTCAATGGTGATGGTGATGGTGTTTACCCGGAGACAGGGA) (SEQ ID NO: 5) from the plgPlus expression plasmid.
  • the PCR product was cloned into pGEM-T easy (Promega) and checked by DNA sequencing.
  • the BMPRIIecd was fused to the Fchis ⁇ domain by removing the BMPRIIecd DNA fragment from the plasmid plgPlus-BMPRIIecd by Nhel/BamHI digestion and cloned into the vector pGEM-Teasy-Fchis6 cut by the Spel/Bglll restriction enzymes. Finally the BMPRIIecdFchis ⁇ coding cassette was removed from pGEM-Teasy-BMPRIIecdFchis6 via EcoRI/Notl digestion and cloned into the pEFIRES expression vector (Hobbs et al., 1998) via the same sites.
  • the BMPRII-fc -fusion protein was then expressed in CHO cells, secreted into the cell media, and purified for use as follows:
  • CHO Cells were selected initially with puromycin. During expansion, cells were grown in IMDM medium supplemented with 10% FCS. At passage twenty, 20 triple-decker flasks were seeded. The first production medium was put on the cells the following day, when the flasks were approximately 60% confluent. As the production medium used was not optimal for CHO cells, 0.5% FCS was added into the medium. This helped maintain the cells in a better condition and made 4 successive harvests possible. The production media containing the produced fusion protein was stored in -2O 0 C for 0-6 days.
  • the cell culture supernatants were thawed and subsequently clarified by filtration through
  • mice Five female FVB/N newborn mice were chosen randomly either to the treatment group or control group. Each mouse received six intraperitoneal injections (40 ⁇ l injection volume) at two day intervals starting at postnatal day two and were then sacrificed at postnatal day 15.
  • the BMPRIIecd-Fc treatment group received three injections with 200 micrograms of the BMPRIIecd-Fc protein on days 2, 4 and 6 followed by PBS injections on days 8, 10 and 12. Control mice received only PBS injections at the given days.
  • mice ovaries were removed and fixed in 4% PFA and embedded in paraffin. Samples were serially sectioned and 5-micrometer sections were treated by standard haematoxylin-eosin staining for histological analysis. Due to technical difficulties in sectioning of the ovaries, representative histology was received from 3 animals from the treatment group and 2 animals from the control group. The data were analyzed using Student's t test.
  • Oocytes and follicles were classified according to the proposed model of Pedersen and Peters 1968, which is based (1) on the size of oocyte, (2) on the size of the follicle as defined by the number of granulosa cells (represented by the number of cells seen on the largest cross section of the follicle) and (3) on the morphology of the follicle.
  • the follicles were divided into:
  • Type 3 a Small (diameter less than 20 micrometers) or growing (diameter 20-70 micrometers) oocyte surrounded by a ring of granulosa cells (not more than 20 cells on the largest cross section).
  • Primary follicle Type 3b: Growing oocyte surrounded by a ring of 21-60 granulosa cells.
  • Primary follicle Type 4: Growing oocyte surrounded by two layers of granulosa cells (61 to 100 cells on the largest section). (Secondary follicle);
  • Type 5a A transitory stage between medium and large follicles.
  • the oocyte which might be a growing or a larger (diameter 70 micrometers) one is enveloped in three layers of granulosa cells (101 to 200 cells on the largest cross section). (Preantral follicle);
  • Type 5b A large oocyte surrounded by many layers of granulosa cells (201 to 400 cells on the largest cross section).
  • Preantral follicle A large oocyte with many layers of granulosa cells (400 to 600 cells on the largest cross section).
  • Preantral follicle A follicle (more than 600 cells on the largest cross section) with a single cavity of follicle fluid. The cumulus oopherus but not its stalk, has formed.
  • Type 8 A large follicle with a single cavity of fluid and a well formed cumulus stalk.
  • mice were found dead after the second injection (postnatal day 6) whereas all the mice in the treatment group survived until the end of the trial. No major differences in structure, behavior or body weight were noticed between the groups at the end of the trials.
  • a type 5a follicle in the control mouse ovary (C) showed a well developed theca layer (black arrow).
  • Type 3b and 4 follicles with a large oocyte, asymmetric granulosa cell layer and poorly formed theca cell layer are shown in the BMPRII treated group (D), (white arrow).
  • Figure 2 demonstrates that the oocyte diameter in type 3b and 4 follicles of the BMPRIIecd-Fc treated mice increased more rapidly relative to the follicle class, compared to control mice.
  • the distribution of the follicle types in the BMPRIIecd-Fc treatment group was different from that of the control group.
  • the proportion of type 3b follicles was significantly increased in the treatment group and no type 5 a follicles were found demonstrating that the BMPRIIecd-Fc blocks ovarian folliculogenesis beyond the type 4 follicular stage ( Figure 3).
  • ovarian follicles were found in BMPRIIecd-Fc-fusion protein treated mice. These follicles were characterized by a growing oocyte (> 20 micrometers) surrounded by one layer of granulosa cells which was comprised of an unusual combination of flattened and cuboidal cells (Figure 4). Only one such abnormal follicle was seen in control animals. Interestingly most abnormal follicles were seen in the ovarian cortex which is more exposed to the BMPRIIecd-Fc fusion protein, suggesting that the abnormal growth of follicles is likely dose dependent. Discussion
  • the BMPRII-Fc fusion protein was prepared as described in example 2.
  • mice were chosen randomly either to be placed in the treatment group, with different doses of BMPRIIecd-Fc -fusion protein, or to the control group which received PBS injections only.
  • follicles in the ovaries of mice which received 200 microgram/injection of the BMPRIIecd-Fc -fusion protein were structurally abnormal. These follicles were characterized by a growing oocyte (> 20 micrometers) surrounded by one layer of granulosa cells which was comprised of only flattened cells or a combination of flattened and cuboidal cells (Figure 7A-black arrow). Most abnormal follicles in the treatment groups were found in the cortical layer of the ovary whereas in the control animals these follicles were confined to the hilus region of the ovary. Figure 7B shows an exceptionally large type 3b follicle with the oocyte diameter of 66 micrometers (white arrow).
  • the BMPRIIecd-Fc -fusion protein also appears to disturb the communication between the oocyte and the surrounding granulosa cells. This is reflected in Figure 8 by a decrease in the number of granulosa cells (represented as follicle type) in relation to the oocyte diameter when increasing amounts of the BMPRIIecd-Fc -fusion protein are adminstered to mice.
  • the mean oocyte diameters are presented in Table 5 below and the statistical significance of the data in Table 6. The data shows that there is very little individual variation inside the particular treatment group. TABLE 5
  • Figure 9 further demonstrates that the average diameter of the oocyte in the BMPRIIecd-Fc treated mice increases dose dependency.
  • This data represents the mean of the oocyte diameters pooled from all the growing oocytes (i.e. follicles with the oocyte diameter > 20 ⁇ m) within the same treatment group.
  • the BMPRII-Fc fusion protein construct was prepared as described in example 2. However, the constructs were expressed in CHO cells using a different protocol as described below:
  • CHO cells were transfected with the pEFIRES/BMPRIIecdFchis ⁇ expression plasmid and a stable cell line was selected via exposure to increasing concentrations of puromycin (Hobbs et al., 1998).
  • Frozen recombinant CHO cells producing hBMPRII-Fc-His6 were taken to Biovian Ltd., Turku, Finland. The cells were taken to cultivation and adapted to animal component free medium in flask and spinner cultivations. Cultivation was carried out in spinner flasks and expanded into wave bioreactors (3 times 20-25 liters). Cell density was at the time of inoculation 1.9 x 10 5 cells/ml. Duration of cultivation was 13-14 days, where after cells were removed by centrifugation and medium harvest was clarified using Polysep filter. The medium harvest was concentrated 10 times using 10 kDa concentration device.
  • Concentrated harvest material was purified using immobilized metal affinity chromatography (IMAC) Ni Sepharose HP on an AKTA system (Amersham). Concentrated harvest was divided to 6 parts, which were run individually. Sample was conditioned to 5 niM imidazole,
  • the quality of the purified protein was analyzed by running samples on SDS-PAGE and performing silver staining and western blotting.
  • the protein was quantified by the UV A280 method and the MgG 1 immunoassay.
  • Mice were sacrificed on day 32 and ovaries were taken for histological analyses. The injections were given with a 40 microliters injection volume on the given days (Table 7 below).
  • mice ovaries were removed and fixed in 4% PFA and embedded in paraffin. Ovaries were serially sectioned throughly and 5-micrometer sections were treated by standard haematoxylin-eosin staining for histological analysis. AU the sections were photographed and measurements were performed. The data were analyzed using Student's t test. Special care was taken that each follicle was counted only once. The analyses of the sections were performed in a blind manner.
  • Oocytes and follicles were classified according to the proposed model of Pedersen and Peters, 1968 as described in example 2, above.
  • Figure 12 shows that 2 week and 4 week treatment with the BMPRIIecd-Fc -fusion protein promoted the folliculogenesis towards the later developmental stages.
  • Figure 12A shows that the relative proportions of the preovulatory follicles and corpus luteums were increased by the BMPRIIecd-Fc -fusion protein treatment
  • Figure 12B and Tables 9 and 10 below show that the absolute numbers of preovulatory follicles and corpus luteums were also increased by the BMPRIIecd-Fc -fusion protein in the 4 week treatment group (treatment group 2). No clear differences in the thecal layer of the antral follicles or differences in the size of the antral stage follicles or corpus luteums between the control animals and the study animals were noticed.
  • the results of the current study show that the bone morphogenic protein type II receptor ectodomain fusion protein is able to modulate in vivo ovarian folliculogenesis in mouse in a dual manner. Namely the early folliculogenesis is inhibited whereas the later stages of the follicle development are accelerated and the ovulation rate is increased by the BMPRIIecd-Fc -fusion protein.
  • the previous Examples 2 and 3 showed that juvenile mice tolerate the BMPRIIecd-Fc -fusion protein dose as high as 20-40 mg/kg per injection.
  • the current data shows no harmful effects even with repeated protein administration for 4 weeks with a relatively high protein dose.
  • the protein dose used in the present study equals about 5-20 mg/kg per injection. The range in the dose is due to the growth of the mouse during the study (3day- 28day). Again only ovarian effects were noticed indicating that the BMPRIIecd-Fc -fusion protein has an ovary specific effect at this developmental stage.
  • Example 3 In the present study the 100 ⁇ g protein dose per injection inhibited but did not block early folliculogenesis. However the follicular distribution of the early follicle stages resembled that seen in Example 3 with 20 ⁇ g, 60 ⁇ g or 200 ⁇ g protein doses per injection. A clear effect on the follicle distribution was also seen during the preantral stage. No differences in the number of abnormal follicles between the control and treatment groups were noticed. This is again in line with the results obtained in Example 3 wherein injections of 20 or 60 micrograms of the the BMPRIIecd-Fc -fusion protein did not increase statistically the number of abnormal follicles whereas 200 micrograms/injection did.
  • the folliculogenesis was clearly accelerated by the BMPRIIecd-Fc - fusion protein and more follicles at later developmental stages (Type 7 and 8) were seen. Without being bound by theory, it is thought that this is most likely due to the increased responsiveness of the granulosa cells to the circulating gonadotrophin hormones (Shimasaki et al, 2004). It is also thought that the inhibition of the early stages of the follicular development is most likely due to poor cell division of the granulosa cells, however the size of the later stage follicles and corpus luteums is similar between the control and the treatment groups.
  • the BMPRIIecd-Fc fusion protein was prepared as described in example 4.
  • mice BMPRIIecd-Fc -fusion protein (six animals per group). The study was started when the mice were 24 days old (groups 1-3) or 25 days old (groups 4-6). The study groups received intraperitoneal injections of either PBS (groups 1 and 4), or 20 ⁇ g (groups 2 and 5) and 100 ⁇ g (groups 3 and 6) of the BMPRII receptor ectodomain-Fc -fusion protein during the first three consecutive days of the study. Mice received also intraperitoneal injections of Pregnant
  • the number of eggs ovulated was measured as a first endpoint in this study. However, no differences were detected in the number of eggs found in the oviducts. The number of ovulations detected in each animal are shown in the Table 12, below.
  • corona radiata (cumulus cells) surrounding the oocyte in the BMPRIIecd-Fc -fusion protein treated animals.
  • the effect of the BMPRIIecd-Fc protein during the standard superovulation protocol in mouse was investigated.
  • the results show that the administration protocol of the BMPRIIecd-Fc - fusion protein used does not increase the number of ovulations when compared to the standard mouse superovulation protocol. It was also found that the number of atretic oocytes was decreased by the BMPRIIecd-Fc -fusion protein treatment.
  • Example 4 showed that 2 or 4 week administration of the BMPRIIecd- Fc -fusion protein increased the number of preovulatory follicles and the number of ovulations reflected by the number of corpus luteum in the mouse and it was expected that an increase in ovulation would be seen in this study.
  • the BMPRIIecd could have been administered too late to be able to induce the formation of multiple antral or preovulatory follicles, or the hCG amount could have been too high.
  • Andersen et al. show that the ovulation rate in mouse reduces rapidly when the hCG amount is increased.
  • the BMPRIIecd-Fc fusion protein was prepared as described in example 4.
  • mice were chosen randomly either to be placed in the control groups (ten animals per group) which received PBS injections or the treatment groups which received 60 ⁇ g of the BMPRIIecd-Fc -fusion protein (ten animals per group). The study was started when the mice were 11 days old. The study groups received intraperitoneal injections of either PBS (groups 1 and 3), or 60 ⁇ g (groups 2 and 4) of the BMPRII receptor ectodomain-Fc -fusion protein on days 11, 14, 16 and 18.
  • mice received also intraperitoneal injections of either 1 IU or 10 IU recombinant human follicle stimulating hormone, FSH, (Gonal-F®, Serono Nordic, Finland) and 5 IU human chorionic gonadotropin, hCG, (Pregnyl®, Organon Oss., The Netherlands). Stimulations with human recombinant FSH were given on the day 22. Groups 1 and 2 received 1 IU FSH while groups 3 and 4 received 10 IU FSH. All the mice received 5 IU hCG 47 h after the FSH stimulation. The mice were sacrificed and the oviducts were collected for the ovulation analyses 24 h after the hCG injections. The study protocol is presented in Table 13, below. TABLE 13 - The Study Protocol
  • the eggs were harvested from the oviducts and counted 24 hours after the hCG injection.
  • the analysis of the data was performed in a blind manner and the data was subjected to the analysis with the Student's t-test.
  • Figure 15A shows the data pooled from all the animals in a particular study group. Although there is a clear trend towards the increase in the ovulation rate in the mice which received 60 ⁇ g of the
  • Example 5 failed to show an increase in the number of ovulations using BMPRIIecd-Fc -fusion protein and PMSG.
  • the present study used recombinant human FSH instead of the PMSG and administered the BMPRIIecd-Fc -fusion protein 4-11 days before stimulation with FSH.
  • only one dose, 60 ⁇ g per injection, of the BMPRIIecd-Fc -fusion protein was used on a larger number of animals per treatment group.
  • the present invention shows for the first time that an agonist or antagonist of the BMPRII is capable of modulating ovulation in female animals in vivo.
  • BMPRIIecd-Fc fusion protein BMPRIIectodomain fusion protein
  • BMPRIIecd-Fc fusion protein modulated ovarian folliculogenesis and ovulation rate in female mice.
  • short- term administration of BMPRIIecd-Fc fusion protein blocked folliculogenesis
  • long term administration increased folliculogenesis and ovulation.
  • Long term administration increased both the number of antral and preovulatory follicles, and the number of corpus luteums. This effect was likely due to the increased responsiveness of the granulosa cells to the circulating gonadotrophin hormones (Shimasaki et al, 2004).
  • BMPRII BMPRII agonist or antagonist of BMPRII
  • peptides targeted to the BMPRII or recombinant BMPRII molecules may be useful to increase folliculogenesis and ovulation rate in female mammals in vivo, and in particular, for use in fertility treatment in vivo (ie. to induce superovulation).
  • the present results also showed an increase in the size of the oocyte during early folliculogenesis with the BMPRII agonists and antagonists of the invention, it is likely that the present invention will be useful in both in vitro and in vivo fertility treatment regimens. It is also contemplated that the molecules of the present invention will be useful in suppressing ovulation, ie permanently to induce sterility, or temporarily as a contraceptive.
  • the present invention provides agonists and antagonists of the BMPRII capable of modulating ovulation in female mammals.
  • Such agonists and antagonists find particular use in fertility treatment as well as in reducing fertility either permanently (to induce sterility) or temporarily (as a contraceptive).
  • Bone morphogenetic protein receptor type II is a receptor for growth differentiation factor-9. Biol. Reprod. 67, 473-480, 2002.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Endocrinology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Reproductive Health (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gynecology & Obstetrics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

La présente invention concerne un agoniste ou un antagoniste de BMPRII utile pour moduler la folliculogenèse et la vitesse d'ovulation chez des mammifères femelles. La présente invention peut être utile dans un traitement de fertilité consistant à accélérer la folliculogenèse et augmenter la vitesse d'ovulation, ou peut être utile pour freiner la folliculogenèse et réduire la vitesse d'ovulation par induction de stérilité et/ou par contraception.
PCT/NZ2006/000134 2005-05-30 2006-05-30 Modulation de l'ovulation au moyen d'agonistes et d'antagonistes de bmprii WO2006130022A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NZ54042205 2005-05-30
NZ540422 2005-05-30

Publications (2)

Publication Number Publication Date
WO2006130022A1 true WO2006130022A1 (fr) 2006-12-07
WO2006130022A8 WO2006130022A8 (fr) 2007-01-25

Family

ID=37481877

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NZ2006/000134 WO2006130022A1 (fr) 2005-05-30 2006-05-30 Modulation de l'ovulation au moyen d'agonistes et d'antagonistes de bmprii

Country Status (1)

Country Link
WO (1) WO2006130022A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017176938A1 (fr) * 2016-04-06 2017-10-12 Acceleron Pharma, Inc. Polypeptides bmprii et leurs utilisations
US10336800B2 (en) 2014-07-10 2019-07-02 Cambridge Enterprise Limited Therapeutic use of bone morphogenetic proteins

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014412A2 (fr) * 1994-11-04 1996-05-17 The Procter & Gamble Company Adn complementaire codant pour un recepteur de type ii de proteines morphogenetiques osseuses (bmp)
WO2003102199A1 (fr) * 2002-05-30 2003-12-11 Ovita Limited Nouvelles sequences gdf-9 et gdf-9b (bmp-15) destinees a modifier la fonction ovarienne et la vitesse d'ovulation chez des mammiferes
WO2004062621A2 (fr) * 2003-01-13 2004-07-29 Georgia Tech Research Corporation Agents antiinflammatoires et leurs procedes d'utilisation
WO2005097978A1 (fr) * 2004-04-06 2005-10-20 Adelaide Research & Innovation Pty Ltd Modulation de la proliferation et de la differenciationdes cellules de la granulosa
US20060063208A1 (en) * 2004-08-02 2006-03-23 Woolf Clifford J DRG11-responsive (DRAGON) gene and uses thereof
WO2006059913A1 (fr) * 2004-12-02 2006-06-08 Agresearch Limited Modulation de l'ovulation

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014412A2 (fr) * 1994-11-04 1996-05-17 The Procter & Gamble Company Adn complementaire codant pour un recepteur de type ii de proteines morphogenetiques osseuses (bmp)
WO2003102199A1 (fr) * 2002-05-30 2003-12-11 Ovita Limited Nouvelles sequences gdf-9 et gdf-9b (bmp-15) destinees a modifier la fonction ovarienne et la vitesse d'ovulation chez des mammiferes
WO2004062621A2 (fr) * 2003-01-13 2004-07-29 Georgia Tech Research Corporation Agents antiinflammatoires et leurs procedes d'utilisation
WO2005097978A1 (fr) * 2004-04-06 2005-10-20 Adelaide Research & Innovation Pty Ltd Modulation de la proliferation et de la differenciationdes cellules de la granulosa
US20060063208A1 (en) * 2004-08-02 2006-03-23 Woolf Clifford J DRG11-responsive (DRAGON) gene and uses thereof
WO2006059913A1 (fr) * 2004-12-02 2006-06-08 Agresearch Limited Modulation de l'ovulation

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 10 December 2001 (2001-12-10), KAWAKAMI Y. ET AL., XP003004932, Database accession no. (AAL40035) *
DRAGOVIC R.A. ET AL.: "Role of Oocyte-Secreted Growth Differentiation Factor 9 in the Regulation of Mouse Cumulus Expansion", ENDOCRINOLOGY, vol. 146, no. 6, March 2005 (2005-03-01), pages 2798 - 2806, XP003004931 *
GILCHRIST R.B. ET AL.: "Evidence that the Mitogenic Activity of Oocytes Functions Through Bone Morphogenic Protein Receptor-II but is Only Partly Attributable to Growth Differentiation Factor-9", ESHRE CAMPUS, 2003 *
JUENGEL J.L. ET AL.: "Growth Differentiation Factor 9 and Bone Morphogenetic Protein 15 are Essential for Ovarian Follicular Development in Sheep", BIOLOGY OF REPRODUCTION, vol. 67, 2002, pages 1777 - 1789, XP002999768 *
MCNATTY K.P. ET AL.: "Oocyte-Derived Growth Factors and Ovulation Rate in Sleep", REPRODUCTION, vol. 61, 2003, pages 339 - 351 *
MOORE R.K. ET AL.: "Molecular Basis of Bone Morphogenetic Protein-15 Signaling in Granulosa Cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 1, 2003, pages 304 - 310, XP003004929 *
VITT U.A. ET AL.: "Bone Morphogenetic Protein Receptor Type II Is a Receptor for Growth Differentiation Factor-9", BIOLOGY OF REPRODUCTION, vol. 67, 2002, pages 473 - 480, XP003004928 *
WIATER E. ET AL.: "Inhibin is an Antagonist of Bone Morphogenetic Protein Signaling", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 10, 2003, pages 7934 - 7941, XP003004930 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10336800B2 (en) 2014-07-10 2019-07-02 Cambridge Enterprise Limited Therapeutic use of bone morphogenetic proteins
EP3669886A1 (fr) 2014-07-10 2020-06-24 Cambridge Enterprise, Ltd. Protéines morphogénétiques osseuses
EP3906936A1 (fr) 2014-07-10 2021-11-10 Cambridge Enterprise, Ltd. Protéines morphogénétiques osseuses
US11572396B2 (en) 2014-07-10 2023-02-07 Cambridge Enterprise Limited Therapeutic use of bone morphogenetic proteins
WO2017176938A1 (fr) * 2016-04-06 2017-10-12 Acceleron Pharma, Inc. Polypeptides bmprii et leurs utilisations

Also Published As

Publication number Publication date
WO2006130022A8 (fr) 2007-01-25

Similar Documents

Publication Publication Date Title
Schneider et al. Gonadotropin-releasing hormone (GnRH) and its natural analogues: a review
Filicori et al. Novel concepts of human chorionic gonadotropin: reproductive system interactions and potential in the management of infertility
Ma et al. Localization and modulation of calcitonin gene-related peptide-receptor component protein-immunoreactive cells in the rat central and peripheral nervous systems
US11254720B2 (en) Methods and systems for designing and/or characterizing soluble lipidated ligand agents
Magee et al. Biological and anatomical evidence for kisspeptin regulation of the hypothalamic-pituitary-gonadal axis of estrous horse mares
McCartney et al. Neuroendocrinology of reproduction
CA2960120C (fr) Ligands potentialisants de la bioactivite des gonadotrophines
Kara et al. Modulation of gonadotropins activity by antibodies
WO2006130022A1 (fr) Modulation de l'ovulation au moyen d'agonistes et d'antagonistes de bmprii
WO2006059913A9 (fr) Modulation de l'ovulation
DE60125959T2 (de) Unterscheidung zwischen gnrh-i und gnrh-ii
Jung et al. LAPS-FSH: a new and effective long-acting follicle-stimulating hormone analogue for the treatment of infertility
Kozowska et al. Changes in the cholinergic innervation pattern of porcine ovaries with cysts induced by dexamethasone administration
McGrath Characterisation of the neuroanatomy of kisspeptin and RFRP-3 in the mare, and determination of the effect of kisspeptin on LH release and ovulation
Zalesky et al. Effect of immunization against LHRH on isoforms of LH in the ovine pituitary
Ciriello et al. Effects of the calcium-regulating glycoprotein hormone stanniocalcin-1 within the nucleus of the solitary tract on arterial pressure and the baroreceptor reflex
Naqvi et al. Increase in ovulation rate by active immunization against bovine inhibin-based synthetic peptides in a non-prolific sheep breed
McCartney et al. PART 1 ENDOCRINOLOGY OF
EP1819726A1 (fr) Modulation de l'ovulation
NZ536943A (en) Modulation of ovulation
CA3160999A1 (fr) Compositions et methodes de regulation de la folliculogenese pour le traitement de la senescence ovarienne
EP3191516B1 (fr) Ligand potentialisant la bioactivite de la fsh
John Wu et al. A Biological Role for the Gonadotrophin‐Releasing Hormone (GnRH) Metabolite, GnRH‐(1‐5)
WO2021129915A1 (fr) Protéine recombinante gbd-sstad-sstad, procédé de production et utilisation
Lopez Morphological and Functional Evidence of Sexual Dimorphism in the Retrochiasmatic Area Population of NK3R-containing Neurons in Sheep

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06747711

Country of ref document: EP

Kind code of ref document: A1