WO2006125001A2 - Compositions and methods related to the intracellular effects of intracellular domains of delta1 and jagged1 - Google Patents

Abstract

The present invention pertains to compositions and methods related to the intracellular domains of Jagged and Delta. More specifically, the invention relates to the cellular roles and effects of the intracellular domains of Jagged and Delta.

Description

TITLE OF THE INVENTION Compositions and Methods Related to the Intracellular Effects of Intracellular Domains of Deltal and Jaggedl

BACKGROUND OF THE INVENTION

A body of experimental data demonstrates that the Notch signaling pathway plays a critical role in vascular development and homeostasis. Notch 1 and Notch4 genes are expressed in endothelial cells of the embryonic vasculature (Del Amo et al., 1992, Development 115:737-44; Reaume et al., 1992, Dev. Biol. 154:377-87). Studies of mouse embryos with homozygous mutations of genes encoding Notch ligands demonstrated that both Jaggedl (Xue et al., 1999, Hum. MoI. Genet. 8:723-30) and Deltal (Hrabe de Angelis et al., 1997, Nature 386:717-21) knockout mouse embryos die at gestational day E10.5 due to vascular defects and hemorrhaging. During early postnatal development, Deltal is predominantly expressed in brain white and grey matter (Irvin et al., 2004, J. Neurosci. Res. 75:330-43), as well as in endothelial cells of blood vessels (Beckers et al., 1999, Mech. Dev. 84:165-8), while Jaggedl is highly expressed in brain nuclei and blood vessels (Irvin et al., 2004, J. Neurosci. Res. 75:330-43). Expression of the human Jaggedl gene is induced in an in vitro angiogenic model; and administration of Jaggedl antisense oligonucleotides modulates angiogenesis in vitro (Zimrin et al., 1996, J. Biol. Chem. 271 :32499-502). Jaggedl and Notch 1 expression has previously been shown to be upregulated in endothelial and smooth muscle cells in sites of vascular injury (Lindner et al., 2001, Am. J. Pathol. 159:875- 83). Support for the role of the Notch pathway in vascular homeostasis is demonstrated by the finding that the degenerative vascular diseases CADASIL and Alagille syndrome are caused by missense mutations in Notch3 and Jaggedl genes (Joutel et al., 2004, Am. J. Hum. Genet. 74:338-47; Oda et al., 1997, In Nature Genet., 16:235-242). In adult Notch3-/- mice, distal arteries exhibit structural defects; and arterial myogenic responses are defective (Joutel et al., 2004, Am. J. Hum. Genet. 74:338-47).

The current model of the Notch signaling pathway suggests that the Notch transmembrane receptor molecule is activated via direct interaction with transmembrane ligands expressed on the surface of neighboring cells. This interaction results in extracellular cleavage of Notch by an ADAM metalloprotease, and subsequent cleavage in its

PHIP\517382\1 transmembrane domain by a presenilin-dependent γ-secretase. The Notch intracellular domain is generated as a result of cleavage, and translocates into the nucleus (Radtke et al., 2003, Nat. Rev. Cancer 3:756-67) where it interacts with the transcription factors of the CSL family (CBF, SuH, Lag-1) which then activate the expression of FIES transcriptional repressors (Lai, 2002, EMBO Rep. 3:840-5). Besides CSL₅ other proteins such as Notchless (Royet et al., 1998, Embo. J. 17:7351-60) and Deltex (Matsuno et al., 2002, Development 129:1049-59) have been identified to be direct partners of the intracellular domain (icd) of Notch, or "Nicd." In fact, not all Notch functions can be explained by activation of the CSL- dependent signaling pathway. For example, analysis of the phenotype of Notch and CSL mutants in Drosophila revealed that the Notch-mutant phenotype is more severe than the SuH-mutant phenotype (Zecchini et al., 1999, Curr. Biol. 9:460-9). Delta-activated Notch signaling is also required for the expression of the transcriptional regulator, Slug. However the expression of the dominant negative form of CSL does not suppress the expression of Slug in the neuroectoderm (Endo et al., 2003, Dev. Growth Differ. 45:241-8). It has been previously demonstrated that the expression of soluble forms of Jagged 1 and Delta 1, representing their extracellular domains, suppressed CSL-mediated Notch signaling (Small et al., 2001, J. Biol. Chem. 276:32022-30; Trifonova et al., 2004, J. Biol. Chem. 279:13285-8). Soluble Jaggedl (sJgl) and soluble Deltal (sDll) transfectants exhibited similar although distinct phenotypes. Indeed, both sDll and sJgl transfectants formed cords on collagen substrate and displayed drastically decreased contact inhibition of growth. However, while sJgl induced attenuation of cell motility that was accompanied by a decrease in actin stress fibers and an increase in adherent cell junctions, sDll transfectants did not demonstrate those characteristics.

Interestingly, Notch-dependent proteolytic cleavage was reported for Delta and Jagged ligands (Bland et al., 2003, J. Biol. Chem. 278:13607-10; LaVoie et al., 2003, J. Biol. Chem. 278:34427-37; Mishra-Gorur et al., 2002, J. Cell Biol. 159:313-24). Upon interaction with Notch, ectodomains of Jagged and Delta are cleaved respectively by ADAM 17 and Kuzbanian metalloproteases, yielding membrane tethered C-terminal fragments. Presenilin/γ-secretase mediates a second cleavage that releases Delta and Jagged icd' s from the plasma membrane. Also, the presence of PDZ binding sites and potential nuclear localization sequences (NLS) in both the intracellular domains of Jaggedl (Jglicd) (Ascano et al., 2003, J. Biol. Chem. 278:8771-9) and Delta 1 (Dllicd) (Pfister et al., 2003, J. MoI. Biol. 333:229-35). Immunohistochemistry experiments demonstrated that Drosophila Dlicd was able to enter the nucleus (Bland et al., 2003, J. Biol. Chem. 278:13607-10). Recent publications revealed that Delta effectively binds PDZ proteins from MAGUK family (Pfϊster et al._s 2003, J. MoI. Biol. 333:229-35; Six et al., 2004, J. Biol. Chem.). The importance of the Jagged 1 PDZ binding site for the induction of RKE cell transformation was demonstrated. Activation of Notch seems to be independent from the Jagged 1 PDZ binding site (Ascano et al., 2003, J. Biol. Chem. 278:8771-9).

Nonetheless, the roles of the intracellular domains of Jagged and Delta remain unknown. Therefore, there exists a need in the art for an understanding of the intracellular roles of the intracellular domains of both Jagged and Delta. This is because Jagged and Delta are involved in the Notch signaling pathway, which plays a role in angiogenesis and cell differentiation. Understanding and modulating these cellular processes are central to management and treatment of such diseases as cancer and injury repair, among others. The present invention meets these needs.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figure 1 is a series of images depicting that cells expressing Dl lied adopt a senescent-like phenotype. Figures IA and IB illustrate cell morphology. Dllicd-transfected NIH 3T3 cells and adenovirally-transduced HUVEC became large, well spread, and non- proliferating 4 days after transfection (NIH 3T3, Figure IA. phase contrast) or transduction (HUVEC, Figure IB, Acidic β-galactosidase expression). HUVEC adenovirally transduced with Dl lied stained for acidic β-galactosidase 4 days after transduction. Figure 1C illustrates inhibition of DNA synthesis. Bars represent average percentage of 3H-labeled nuclei in LacZ- and Dllicd-transduced HUVEC ± standard deviation (SD). Dl lied drastically decreased DNA synthesis.

Figure 2 is a series of images depicting expression of cell cycle regulatory proteins in Dllicd-transduced cells. Figure IA illustrates Dl lied- and LacZ-transduced HUVEC lysates were resolved by 15% SDS-PAGE and immunoblotted for cyclins A, Dl, and E, cdk inhibitors p21 and p27, and activated forms of ERK 1 and 2. An immunoblot for β-actin served as control of equal protein loading. Dl lied enhanced the expression of p21 and p27, and did not change the levels of cyclin Dl and activated ERK1/2. A decrease of cyclin A and cyclin E levels and presence of lower molecular weight forms of these proteins were observed in Dllicd-transduced cells. Figure 3 is a series of images depicint nuclear localization of Dl lied and its anti-proliferative effect. Figure 3 A illustrates a schematic diagram of Dl lied. Dl lied contains two hypothetical nuclear localization signals (NLSs). Figure 3B illustrates the nuclear localization of Dl lied and its NLS mutants. HEK 293 cells were transiently transfected either with Dllicd, or its corresponding NLS mutants as indicated. Cells were fixed, immunostained with anti-V5 antibody (Dllicd and derived NLS mutants), and co-stained with TO-PRO3 48 hours after transfection, and studied using confocal microscopy. Figure 3C illustrates DNA synthesis, wherein HEK 293 were transiently transfected with LacZ, Dllicd or Dllicd-NLS mutants. DNA synthesis in control, Dllicd, and NLS mutant cells after transfection was determined using 3H-thymidine. The mean values of percentage of labeled nuclei ±SD are represented. Mutations of both NLS did not abolish the antiproliferative effect of Dllicd.

Figure 4 is a series of images illustrating that the expression of Jglicd induces apoptosis in HUYEC. Figure 4A depicts annexinV binding and permeability to 7-AAD. Apoptosis in Jglicd-transduced cells was assessed by the intake of 7-AAD and by AnnexinV binding to exposed phosphatidylserine. LacZ and Jglicd-transduced HUVEC were collected 16 hours after transduction, stained with Annexin V-FITC conjugate or 7-AAD, and assayed by flow cytometry. The percentage of apoptotic cells is represented by bars ±SD. Figure 4B illustrates the DNA content of HUVEC cells that were transduced with Jglicd or LacZ, and 16 hours later fixed and stained with propidium iodide, as illustrated by the flow cytometry histograms. Late apoptotic cells appeared as cell debris: about 20% in Jglicd and only 2% in LacZ control. Figure 4C illustrates transcriptional activity of a p53- responsive element. HEK 293 cells were transiently transfected with Jglicd or LacZ and p53-luciferase construct, and Firefly luciferase activity was measured. Renilla luciferase activity served as internal control for transfection efficiency. The mean values of Luciferase/Renilla ratio ±SD are represented. Jglicd elevates luciferase transcription driven by a p53-responsive element. Figure 4D illustrates the morphological changes, wherein LacZ- and Jglicd-transduced HUVEC as well as UV-irradiated HUVEC were stained either with TO-PRO3, FITC-phalloidin or with anti- vinculin antibody and analyzed by confocal fluorescence microscopy. Chromatin condensation (upper row), reduction in FAS (middle row), decrease and disorientation of actin stress fibers (lower row) were observed in Jglicd-transduced HUVEC. Figure 4E illustrates DNA breaks. A TUNEL assay of Jglicd and LacZ-transduced HUVEC was performed 16 hours after adenoviral transduction. Jglicd induced DNA breaks as reported by incorporation of fluorescein-labeled dUTP. Figure 5 is a series of images illustrating that N lied expression prevents the effects of Jglicd and Dl lied. Figure 5 A illustrates Dllicd-induced β-galactosidase activity of HUVEC that were transduced with Nlicd or LacZ. Sixteen hours later, cells were additionally transduced with either Dl lied or LacZ. Cells were stained for acidic β- galactosidase 4 days after the second transduction. Nlicd coexpression prevents induction of acidic β-galactosidase activity by DIl icd. Figure 5B illustrates the Dllicd-induced inhibition of DNA synthesis. HUVEC were transduced with Nlicd or LacZ; and 16 hours later, the second transduction with DIl icd or LacZ was performed. Cells were labeled for 16 hours with 3H-thymidine 36 hours after the second transduction. The mean values of the percentage of 3H-thymidine-labeled nuclei ±SD are presented. Nlicd rescues the DNA synthesis from Dllicd-induced inhibition. Figure 5C illustrates Jglicd-induced apoptosis. HUVEC were transduced with Nlicd or LacZ 16 hours before Jglicd or LacZ transduction. Twenty-four hours after the second transduction, cells were stained with 7-AAD and analyzed by flow cytometry. The percentages of apoptotic cells ±SD are presented. Constitutively-active Notch 1 prevents Jglicd-induced apoptosis.

DETAILED DESCRIPTION OF THE INVENTION

Notch signaling plays an important role in the regulation of angiogenesis and endothelial cell phenotype. Activation of Notch receptors results in proteolytic cleavage of their intracellular domains, which translocate to the cell nucleus and act as transcriptional regulators. Notch ligands Delta and Jagged also undergo Notch-dependent cleavage of their intracellular domains.

The present invention demonstrates for the first time the biological effects of the intracellular domains of Jaggedl and Deltal (Jglicd and Dllicd, respectively). In one aspect of the invention, the effects are demonstrated in the endothelium. In another aspect of the invention, human umbilical vein endothelial cells (HUVEC) were transduced with Jglicd and Dllicd. As demonstrated herein, Jglicd expression induces apoptosis in these cells. Also as shown herein, Dllicd expression resulted in a non-proliferating senescent-like cell phenotype, characterized, in part, by accumulation of p21 and p27.

The present invention also demonstrates for the first time that cell phenotypes induced by either Jglicd or Dllicd are abolished by co-expression of constitutively active Notch 1. Accordingly, the invention set forth herein discloses heretofore unknown intracellular roles for Jagged and Delta ligands and support a bi-directional model of Notch signaling. The understanding and regulation of the associated biological effects of these polypeptides is useful for the treatment of cancer, and for the understanding and control of injury repair, among other benefits.

Definitions

Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are those well known and commonly employed in the art.

Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art and various general references (e.g., Sambrook and Russell, 2001, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, NY, and Ausubel et al., 2002, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

The nomenclature used herein and the laboratory procedures used in analytical chemistry and organic syntheses described below are those well known and commonly employed in the art. Standard techniques or modifications thereof, are used for chemical syntheses and chemical analyses.

As used herein, each of the following terms has following meaning:

The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

As used herein, the term "adjacent" is used to refer to nucleotide sequences which are directly attached to one another, having no intervening nucleotides. By way of example, the pentanucleotide 5'-AAAAA-3' is adjacent to the trinucleotide 5'-TTT-3' when the two are connected thus: 5'-AAAAATTT-3' or 5'-TTTAAAAA-3', but not when the two are connected thus: 5'-AAAAACTTT-3'.

As used herein, amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table: Full Name Three-Letter Code One-Letter Code

Aspartic Acid Asp D

Glutamic Acid GIu E

Lysine Lys K

Arginine Arg R

Histidine His H

Tyrosine Tyr Y

Cysteine Cys C

Asparagine Asn N

Glutamine GIn Q

Serine Ser S

Threonine Thr T

Glycine GIy G

Alanine Ala A

Valine VaI V

Leucine Leu L

Isoleucine He I

Methionine Met M

Proline Pro P

Phenylalanine Phe F

Tryptophan Trp W

By the term "angiogenic effective amount," as the term is used herein, is meant an amount of Dl lied or Jg lied which, when administered to a cell, tissue, or organism, induces a detectable increase in the level of angiogenesis in the cell, tissue, or organism, compared with the level of angiogenesis prior to or on the absence of the administration of the Dl lied or JgI icd.

"Angiogenesis," as used herein, means the formation of new blood vessels and encompasses the development of angiogenic tissue and/or altered cell or tissue morphology typical of angiogenic tissue development. One skilled in the art would appreciate, based upon the disclosure provided herein, that the level of angiogenesis can be assessed using, for example but not limited to, a CAM assay, a nude mouse in vivo assay, an endothelial cell migration assay to assess sprout formation, the development of chord-like structures, and the like.

By the term "angiogenesis effective amount," as used herein, is meant an amount of soluble Jagged that mediates a detectable increase or decrease in the level of angiogenesis in a cell, tissue, or organism. One skilled in the art would appreciate, based upon the disclosure provided herein, that such amount depends on the nature of the cell, tissue or organism to which the soluble Jagged is administered. The skilled artisan would further appreciate, based upon the disclosure provided herein, that there are a number of assays, several of which are disclosed elsewhere herein, useful for assessing the level of angiogenesis in a cell, a tissue, and/or an organism, and such assays, as well as those developed in the future, are contemplated in the present invention.

"Antisense nucleic acid sequence," "antisense sequence," "antisense DNA molecule" or "antisense gene" refer to pseudogenes which are constructed by reversing the orientation of the gene with regard to its promoter, so that the antisense strand is transcribed. The term also refers to the antisense strand of RNA or of cDNA which compliments the strand of DNA encoding the protein or polypeptide of interest. In either case, when introduced into a cell under the control of a promoter, the anti-sense nucleic acid sequence inhibits the synthesis of the protein of interest from the endogenous gene. The inhibition appears to depend on the formation of an RNA-RNA or cDNA-RNA duplex in the nucleus or in the cytoplasm. Thus, if the antisense gene is stably introduced into a cultured cell, the normal processing and/or transport is affected if a sense-antisense duplex forms in the nucleus; or if antisense RNA is introduced into the cytoplasm of the cell, the expression or translation of the endogenous product is inhibited.

"Antisense" refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.

Antisense nucleic acid sequences can further include modifications which can affect the biological activity of the antisense molecule, or its manner or rate of expression. Such modifications can also include, e.g., mutations, insertions, deletions, or substitutions of one or more nucleotides that do not affect the function of the antisense molecule, but which may affect intracellular localization. Modifications include, but are not limited to, 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxymethyl uracil, 5-carboxyhydroxymethyl-2-thiouridine, 5- carboxymethylaminomethyl uracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentyladenine, 1-methylguanine, 1-methylinosine, 2,2 dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methylaminomethyl-2-thioracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methyluracil, 2-methylthio-N6-isopentenyladenine, uracil-5 oxyacetic acid, wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5 -oxyacetic acid methylester, uracil-5- oxyacetic acid, 5-methy-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6- diaminopurine.

The antisense nucleic acid sequence can determine an uninterrupted antisense RNA sequence or it can include one or more introns. The antisense Jagged molecule(s) of the present invention are referred to as ".gamma.-Jagged."

The terms "complementary" and "antisense" as used herein, are not entirely synonymous. "Antisense" refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. "Complementary" as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., two DNA molecules. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs). As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences. '.

A "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene. A "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).

"Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non- coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

The use of the term "DNA encoding" should be construed to include the DNA sequence which encodes the desired protein and any necessary 5 ' or 3' untranslated regions accompanying the actual coding sequence.

Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.

A "differentiation effective amount," as the term is used herein, means an amount of Dl lied or JgI icd that mediates a detectable increase or decrease in the level of behavior associated with endothelial cell differentiation. One skilled in the art would appreciate, based upon the disclosure provided herein, that such amount depends on the nature of the cell, tissue, or organism to which the Dl lied or Jg lied is administered. The skilled artisan would further appreciate, based upon the disclosure provided herein, that there are a number of assays, several of which are disclosed elsewhere herein, useful for assessing the level of differentiation, such as a modified differential display method, endothelial cell (e.g., HUVEC) organization, endothelial cell migration, sprout formation, as well as assays to be developed in the future, contemplated in the present invention.

A first region of an oligonucleotide "flanks" a second region of the oligonucleotide if the two regions are adjacent to one another or if the two regions are separated by no more than about 1000 nucleotide residues, and preferably no more than about 100 nucleotide residues.

By the term "DNA segment" is meant a molecule comprising a linear stretch of nucleotides wherein the nucleotides are present in a sequence that encodes, through the genetic code, a molecule comprising a linear sequence of amino acid residues that is referred to as a protein, a protein fragment, or a polypeptide.

A "complementary DNA" or "cDNA" gene includes recombinant genes synthesized by reverse transcription of messenger RNA ("mRNA") lacking intervening sequences (introns).

By the term "nucleic acid hybridization," is meant a process by which two single-stranded nucleic acid molecules will bind with each other. The process depends on the principle that two single-stranded molecules that have complementary base sequences will reform into the thermodynamically favored double-stranded configuration ("reanneal") if they are mixed in solution under the proper conditions. The reannealling process can occur even if one of the single strands is immobilized.

"Homologous" as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 3ΑTTGCC5' and 3¹ TATGGC share 50% homology.

As used herein, "homology" is used synonymously with "identity." In addition, when the term "homology" is used herein to refer to the nucleic acids and proteins, it should be construed to be applied to homology at both the nucleic acid and the amino acid levels.

A first oligonucleotide anneals with a second oligonucleotide with "high stringency" if the two oligonucleotides anneal under conditions whereby only oligonucleotides which are at least about 60%, more preferably at least about 65%, even more preferably at least about 70%, yet more preferably at least about 80%, and preferably at least about 90% or, more preferably, at least about 95% complementary anneal with one another. The stringency of conditions used to anneal two oligonucleotides is a function of, among other factors, temperature, ionic strength of the annealing medium, the incubation period, the length of the oligonucleotides, the G-C content of the oligonucleotides, and the expected degree of non-homology between the two oligonucleotides, if known. Methods of adjusting the stringency of annealing conditions are known (see, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm. For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877). This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. MoI. Biol. 215:403- 410), and can be accessed, for example, at the National Center for Biotechnology Information (NCBI) world wide web site. BLAST nucleotide searches can be performed with the NBLAST program (designated "blastn" at the NCBI web site), using the following parameters: gap penalty=5; gap extension penalty=2; mismatch penalty=3; match reward=l; expectation value 10.0; and word size=l 1 to obtain nucleotide sequences homologous to a nucleic acid described herein. BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the NCBI web site) or the NCBI "blastp" program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein.

To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402). Alternatively, PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (id.) and relationships between molecules which share a common pattern. When utilizing BLAST, Gapped BLAST, PSI-Blast, and PHI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See National Center for Biotechnology Information world wide web site.

The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.

As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide of the invention. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the invention.

Moreover, nucleic acid molecules encoding proteins of the invention from other species (homologs), which have a nucleotide sequence which differs from that of the human proteins described herein are within the scope of the invention. Nucleic acid molecules corresponding to natural allelic variants and homologs of a cDNA of the invention can be isolated based on their identity to human nucleic acid molecules using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.

An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.

In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

The term "ligand," as used herein, refers to any protein or proteins that can interact with a receptor binding domain, thus having a "binding affinity" for such domain. Ligands can be soluble or membrane bound, and they can be a naturally occurring protein, or synthetically or recombinantly produced. The ligand can also be a nonprotein molecule that acts as ligand when it interacts with the receptor binding domain. Interactions between the ligand and receptor binding domain include, but are not limited to, any covalent or non- covalent interactions.

"Mutants," "derivatives," and "variants" of the peptides of the invention (or of the DNA encoding the same) are peptides which may be altered in one or more amino acids (or in one or more base pairs) such that the peptide (or nucleic acid) is not identical to the sequences recited herein, but has the same property as the Dl lied or JgI icd peptides disclosed herein.

A "functional derivative" of a sequence, either protein or nucleic acid, is a molecule that possesses a biological activity (either functional or structural) that is substantially similar to a biological activity of Jagged protein or a nucleic acid sequence encoding Jagged, or a portion thereof. A functional derivative of a protein may or may not contain post-translational modifications such as covalently linked carbohydrate, depending on the necessity of such modifications for the perfoπnance of a specific function. The term "functional derivative" is intended to include the "fragments," "segments," "variants," "analogs," or "chemical derivatives" of a molecule.

As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties can improve the molecule's solubility, absorption, biological half life, and the like. The moieties can alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, and the like. Moieties capable of mediating such effects are disclosed in, for example, Remington's Pharmaceutical Sciences (1980, Mack Publishing Co., Easton, Pa.). Procedures for coupling such moieties to a molecule are well known in the art.

A "variant" or "allelic or species variant" of a protein or nucleic acid is meant to refer to a molecule substantially similar in structure and biological activity to either the protein or nucleic acid. Thus, provided that two molecules possess a common activity and may substitute for each other, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the amino acid or nucleotide sequence is not identical.

By describing two polynucleotides as "operably linked" is meant that a single- stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is characterized upon the other. By way of example, a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.

Preferably, when the nucleic acid encoding the desired protein further comprises a promoter/regulatory sequence, the promoter/regulatory sequence is positioned at the 5' end of the desired protein coding sequence such that it drives expression of the desired protein in a cell.

As used herein, the term "pharmaceutically acceptable carrier" means a chemical composition with which the active ingredient may be combined and which, following the combination, can be used to administer the active ingredient to a subject.

As used herein, the term "physiologically acceptable" ester or salt means an ester or salt form of the active ingredient which is compatible with any other ingredients of the pharmaceutical composition, which is not deleterious to the subject to which the composition is to be administered.

As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.

A "constitutive" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

An "inducible" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.

A "tissue-specific" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

By the term "exogenous nucleic acid" is meant that the nucleic acid has been introduced into a cell or an animal using technology which has been developed for the purpose of facilitating the introduction of a nucleic acid into a cell or an animal.

The term "expression of a nucleic acid "as used herein means the synthesis of the protein product encoded by the nucleic acid. More specifically, expression is the process by which a structural gene produces a polypeptide. It involves transcription of the gene into mRNA, and the translation of such mRNA into a polypeptide.

By the term "positioned at the 5' end" as used herein, is meant that the promoter/regulatory sequence is covalently bound to the 5' end of the nucleic acid whose expression it regulates, at a position sufficiently close to the 5' start site of transcription of the nucleic acid so as to drive expression thereof.

The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."

A "portion" of a polynucleotide means at least about twenty sequential nucleotide residues of the polynucleotide. It is understood that a portion of a polynucleotide may include every nucleotide residue of the polynucleotide.

A "polyadenylation sequence" is a polynucleotide sequence which directs the addition of a poly A tail onto a transcribed messenger RNA sequence.

A "polynucleotide" means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid.

The term "nucleic acid" typically refers to large polynucleotides.

The term "oligonucleotide" typically refers to short polynucleotides, generally, no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."

The term "oligonucleotide or oligomer", as used herein, refers to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. An oligonucleotide may be derived synthetically or by cloning.

Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction. "Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase. A primer is typically single-stranded, but may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.

By the term "amplification primer", as used herein, is meant an oligonucleotide which is capable of annealing adjacent to a target sequence and serving as an initiation point for DNA synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is initiated.

"Probe" refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide. A probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions. Probes can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.

One skilled in the art would appreciate, based upon the disclosure provided herein, that to visualize a particular DNA sequence in a hybridization procedure, a labeled DNA molecule or "hybridization probe" can be reacted to a fractionated nucleic acid bound to a nitrocellulose filter. The areas on the filter that carry nucleic acid sequences complementary to the labeled DNA probe become labeled themselves as a consequence of the reannealing reaction. The areas of the filter that exhibit such labeling are visualized. The hybridization probe is generally produced by molecular cloning of a specific DNA sequence.

"Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell. A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.

A "recombinant polypeptide" is one which is produced upon expression of a recombinant polynucleotide.

"Polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non- naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer.

The term "protein" typically refers to large polypeptides.

The term "peptide" typically refers to short polypeptides.

Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.

A cell that comprises an exogenous nucleic acid is referred to as a

"recombinant cell." Such a cell may be a eukaryotic cell or a prokaryotic cell. A gene λvhich is expressed in a recombinant cell wherein the gene comprises a recombinant polynucleotide, produces a "recombinant polypeptide."

"Sequence amplification," as the term is used herein, means a method for generating large amounts of a target sequence. In general, one or more amplification primers are annealed to a nucleic acid sequence. Using appropriate enzymes, sequences found adjacent to, or in between the primers are amplified.

By the term "specifically binds," as used herein, is meant a compound, e.g., a protein, a nucleic acid, an antibody, and the like, which recognizes and binds a specific molecule, but does not substantially recognize or bind other molecules in a sample.

A "substantially pure" protein or nucleic acid is a protein or nucleic acid preparation that is generally lacking in other cellular components with which it is normally associated in vivo. That is, as used herein, the term "substantially pure" describes a compound, e.g., a nucleic acid, protein or polypeptide, which has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least about 10%, preferably at least about 20%, more preferably at least about 50%, still more preferably at least about 75%, even more preferably at least about 90%, and most preferably at least about 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., by column chromatography, gel electrophoresis or HPLC analysis.

A compound, e.g., a nucleic acid, a protein or polypeptide is also

"substantially purified" when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state. Thus, a "substantially pure" preparation of a nucleic acid, as used herein, refers to a nucleic acid sequence which has been purified from the sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment in a genome in which it naturally occurs.

Similarly, a "substantially pure" preparation of a protein or a polypeptide, as used herein, refers to a protein or polypeptide which has been purified from components with which it is normally associated in its naturally occurring state. A substantially pure peptide can be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (1990, In: Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).

By "tag" polypeptide is meant any protein which, when linked by a peptide bond to a protein of interest, may be used to localize the protein, to purify it from a cell extract, to immobilize it for use in binding assays, or to otherwise study its biological properties and/or function. A chimeric (i.e., fusion) protein containing a "tag" epitope can be immobilized on a resin which binds the tag. Such tag epitopes and resins which specifically bind them are well known in the art and include, for example, tag epitopes comprising a plurality of sequential histidine residues (His6), which allows isolation of a chimeric protein comprising such an epitope on nickel-nitrilotriacetic acid-agarose, a hemagglutinin (HA) tag epitope allowing a chimeric protein comprising such an epitope to bind with an anti-HA- monoclonal antibody affinity matrix, a myc tag epitope allowing a chimeric protein comprising such an epitope to bind with an anti-myc-monoclonal antibody affinity matrix, a glutathione-S-transferase tag epitope, and a maltose binding protein (MBP) tag epitope, which can induce binding between a protein comprising such an epitope and a glutathione- or maltose-Sepharose column, respectively. Production of proteins comprising such tag epitopes is well known in the art and is described in standard treatises such as Sambrook et al., 1989, supra, and Ausubel et al., supra. Likewise, antibodies to the tag epitope (e.g., anti-HA, anti- myc antibody 9E10, and the like) allow detection and localization of the fusion protein in, for example, Western blots, ELISA assays, and immunostaining of cells. A "vector," as used herein, refers to a plasmid or phage DNA or other DNA sequence into which DNA may be inserted to be cloned. The vector can replicate autonomously in a host cell, and can be further characterized by one or a small number of endonuclease recognition sites at which such DNA sequences can be cut in a determinable fashion and into which DNA may be inserted. The vector can further contain a marker suitable for use in the identification of cells transformed with the vector. The words "cloning vehicle" are sometimes used for "vector."

Additionally, the term "vector" encompasses any plasmid, phage and virus encoding an exogenous nucleic acid. The term also includes non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into virions or cells, such as, for example, polylysine compounds and the like. The vector can be a viral vector which is suitable as a delivery vehicle for delivery of the nucleic acid encoding, e.g., Jagged, soluble Jagged, .gamma.-Jagged, and/or or a portion thereof, to a cell and/or a patient, or the vector can be a non-viral vector which is suitable for the same purpose.

Examples of viral and non-viral vectors for delivery of DNA to cells and tissues are well-known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U.S.A. 94:12744-12746). Examples of viral vectors include, but are not limited to, a recombinant vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like (Cranage et al., 1986, EMBO J. 5:3057-3063; International Patent Application No. WO94/17810, published Aug. 18, 1994; International Patent Application No. WO94/23744, published Oct. 27, 1994). Examples of non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like.

"Expression vector," as the term is used herein, means a vector or vehicle similar to a cloning vector but which is capable of expressing a gene which has been cloned into it, after transformation into a host. The cloned gene is usually placed under the control of (i.e., operably linked thereto) certain regulatory/control sequences such as, e.g., promoter sequences. Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites. One skilled in the art would appreciate, based upon the disclosure provided herein and methods well-known in the art, that not all regulatory/control elements need be present in all constructs; rather, the present invention encompasses an expression vector comprising any combination of elements known in the art such that a nucleic acid of interest is expressed as desired.

"Full length Jagged," as the term is used herein, refers to the full length, contiguous Jagged nucleic acid sequence. It also refers to the full-length, contiguous Jagged amino acid sequence.

"Jagged intracellular domain," as the term is used herein, refers to any fragment, variant or homolog of full length Jagged, wherein the fragment, variant or homolog is derived from the portion of Jagged that does not extend outside of the cell. A "Jagged intracellular domain polynucleotide" encodes the corresponding "Jagged intracellular domain polypeptide."

"Full length Delta," as the term is used herein, refers to the full length, contiguous Delta nucleic acid sequence. It also refers to the full-length, contiguous Delta amino acid sequence. For a discussion of Delta, and of "full-length" Delta, see, for eg., Trifonova et al. (2004, J. Biol. Chem., 279:13285-13288).

"Delta intracellular domain," as the term is used herein, refers to any fragment, variant or homolog of full length Delta, wherein the fragment, variant or homolog is derived from the portion of Delta that does not extend outside of the cell. A "Delta intracellular domain polynucleotide" encodes the corresponding "Delta intracellular domain polypeptide."

"Full length Notch," as the term is used herein, refers to the full length, contiguous Notch nucleic acid sequence. It also refers to the full-length, contiguous Notch amino acid sequence.

"Notch intracellular domain," as the term is used herein, refers to any fragment, variant or homolog of full length Notch, wherein the fragment, variant or homolog is derived from the portion of Notch that does not extend outside of the cell. A "Notch intracellular domain polynucleotide" encodes the corresponding "Notch intracellular domain polypeptide."

The term "modulate," as used herein, refers to the alteration of a condition, interaction, process, or the like, from a first state to a second state measurably different from the first state. The term "modulate" also refers to the alteration of a condition, interaction, process, or the like, from a first state to a second state measurably different from the first state, and back to the first state, or to a state that is not measurably different than the first state. For example, a ligand that up-regulates the activity of a receptor can be said to "modulate" the activity of the receptor. Also, a ligand that down-regulates the activity of a receptor can be said to "modulate" the activity of the receptor.

Description of the Invention

Isolated Nucleic Acids Encoding Deltal, Jaggedl and Notch Intracellular Domain Polypeptides

It will be understood that nucleic acids of the invention include a Dl lied nucleic acid and a JgI icd nucleic acid. Further, in certain embodiments, a nucleic acid of the invention also includes a Nl icd nucleic acid.

The invention includes an isolated nucleic acid encoding a Deltal intracellular domain (Dllicd) polypeptide. Preferably, the nucleic acid encoding a Dllicd is at least about 90% homologous to a nucleic acid having the nucleic acid sequence of SEQ ID NO:9. The nucleic acid encoding Dllicd (SEQ ID NO:9) comprises from about nucleotide 1704 to about nucleotide 2172 of full-length Delta sequence (GenBank Ace. No. NM005618, [SEQ ID NO:3]).

More preferably, the isolated nucleic acid encoding a Dllicd is at least about 95% and more preferably, at least about 98% homologous, and even more preferably, at least about 99% homologous to SEQ ID NO:9. More preferably, the isolated nucleic acid encoding a Dllicd is SEQ ID NO:9.

The invention also includes a nucleic acid encoding a Dllicd polypeptide, or a fragment or portion thereof. That is, the invention encompasses a nucleic acid encoding less than the full-length Dllicd polypeptide disclosed herein. This is because one skilled in the art would appreciate, based upon the disclosure provided herein, that a nucleic acid encoding less than the full-length Dllicd can be useful for a variety of purposes including, but not limited to, providing portions of the protein for use in antibody production and treatments related to inhibiting the role of Delta in the Notch signaling pathway.

In another aspect, the invention includes a Dllicd nucleic acid comprising at least one mutation in a nuclear localization sequence (NLS). As described in detail elsewhere herein, Dllicd comprises two potential NLSs, one extending from amino acid 575 through amino acid 579 of Delta (KHRPP, SEQ ID NO:15), and a second extending from amino acid 689 through amino acid 692 of Delta (RKRPP, SEQ ID NO: 16).

As will be understood by the skilled artisan, when equipped with the present disclosure, the role and function of the NLSs of Dllicd can be investigated and ascertained through many methods, including, but not limited to, site-directed mutagenesis of the NLSs in Dl lied. Such mutagenesis techniques can serve to selectively inactivate or to hyper- activate Dllicd, and the activity and biological effect of the mutant Dllicd can be determined using one of the many assays as set forth in detail in the present application.

In one embodiment, a Dllicd nucleic acid encoding a Dllicd polypeptide having a mutation in a NLS comprises at least one mutation, insertion, deletion, or combination thereof in the nucleic acid sequence encoding the KHRPP nuclear localization sequence. In one aspect, the nucleic acid sequence encoding the KHRPP NLS is mutated to a nucleic acid sequence encoding KHAP, as set forth in SEQ ID NO:11. In another embodiment, a Dllicd nucleic acid comprises at least one mutation, insertion, deletion, or combination thereof in the nucleic acid sequence encoding the RKRPP nuclear localization sequence. In one aspect, the nucleic acid sequence encoding the RKRPP NLS is mutated to a nucleic acid sequence encoding RQP, as set forth in SEQ ID NO: 13. In yet another embodiment of the invention, a Dllicd nucleic acid comprises multiple mutations across both NLSs. In one aspect, a nucleic acid encoding a Dllicd has the nucleic acid sequence encoding the KHRPP NLS mutated to a nucleic acid sequence encoding KHAP and the nucleic acid sequence encoding the RKRPP NLS mutated to a nucleic acid sequence encoding RQP.

The invention also includes an isolated nucleic acid encoding a Jaggedl intracellular domain (JgI icd) polypeptide. Preferably, the nucleic acid encoding a JgI icd is at least about 90% homologous to a nucleic acid having the nucleic acid sequence of SEQ ID NO:7. The nucleic acid encoding JgI icd (SEQ ID NO:7) comprises from about nucleotide 3264 to about nucleotide 3657 of full-length Jagged sequence (GenBank Ace. No. U73936, SEQ ID NO: 1).

More preferably, the isolated nucleic acid encoding a Jg lied is at least about 95% and more preferably, at least about 98% homologous, and even more preferably, at least about 99% homologous to SEQ ID NO:7. More preferably, the isolated nucleic acid encoding a Jglicd is SEQ ID NO:7.

The invention also includes a nucleic acid encoding a Jg lied polypeptide, or a fragment or portion thereof. That is, the invention encompasses a nucleic acid encoding less than the full-length Jg lied polypeptide disclosed herein. This is because one skilled in the art would appreciate, based upon the disclosure provided herein, that a nucleic acid encoding less than the full-length JgI icd can be useful for a variety of purposes including, but not limited to, providing portions of the protein for use in antibody production and for treatments related to inhibiting Jagged/Notch interactions.

The invention includes an isolated nucleic acid encoding a Notchl intracellular domain (Nlicd) polypeptide. Preferably, the nucleic acid encoding a Nlicd is at least about 90% homologous to a nucleic acid having the nucleic acid sequence of SEQ ID NO:21. The nucleic acid encoding Nlicd (SEQ ID NO:21) comprises from about nucleotide 5385 to about nucleotide 7596 of full-length Notch sequence (GenBank Ace. Nos. Zl 1886, S47228, [SEQ ID NO:5]).

More preferably, the isolated nucleic acid encoding a Nlicd is at least about 95% and more preferably, at least about 98% homologous, and even more preferably, at least about 99% homologous to SEQ ID NO:21. More preferably, the isolated nucleic acid encoding a Dl lied is SEQ ID NO:21.

The invention includes a nucleic acid encoding a Dl lied polypeptide wherein optimally a nucleic acid encoding a tag polypeptide is covalently linked thereto. That is, the invention encompasses a chimeric nucleic acid wherein a nucleic acid sequence encoding a tag polypeptide is covalently linked to a nucleic acid encoding DIl icd. Such chimeric (i.e., fusion) tag polypeptides are well known in the art and include, for instance, myc, myc- pyruvate kinase (myc-PK), His-6, maltose biding protein (MBP), glutathione-S-transferase (GST), and green fluorescence protein (GFP). However, the invention is not limited to the nucleic acids encoding the above-listed tag polypeptides. Rather, any nucleic acid sequence encoding a polypeptide which can function in a manner substantially similar to these tag polypeptides should be construed to be included in the present invention. Further, more than one tag polypeptide can be expressed along with a nucleic acid encoding a protein of interest. That is, one skilled in the art would understand, based upon the disclosure provided herein, that more than one tag polypeptide can be covalently linked with a Dl lied polypeptide. In another embodiment of the invention, one or more tag polypeptides as described herein can be covalently linked with a Jg lied polypeptide of the invention.

A nucleic acid encoding a protein of interest (e.g., Dl lied, Jg lied, or Nlicd, and any mutant, derivative, variant, or fragment thereof either) comprising a nucleic acid encoding a tag polypeptide and a fusion protein produced therefrom can be used to, among other things, localize Dl lied, JgI icd or Nlicd polypeptide within a cell and to study expression, localization, and role(s) of the tagged protein in a cell before, during, and/or after exposing the cell to a test compound. Further, addition of a tag to a protein of interest facilitates isolation and purification of the "tagged" protein such that the protein of interest can be easily produced and purified.

In other related aspects, the invention includes a nucleic acid encoding a Dl lied polypeptide operably linked to a nucleic acid comprising a promoter/regulatory sequence such that the nucleic acid is preferably capable of directing expression of the protein encoded by the nucleic acid. In yet another aspect, the invention includes a nucleic acid encoding a JgI icd polypeptide operably linked to a nucleic acid comprising a promoter/regulatory sequence. In still another aspect, the invention includes a nucleic acid encoding a Nl icd polypeptide operably linked to a nucleic acid comprising a promoter/regulatory sequence.

Expression of a polypeptide of the invention, either alone or fused to a detectable tag polypeptide, in cells which either do not normally express a polypeptide of the invention or which do not express polypeptide of the invention comprising a tag polypeptide, can be accomplished by operably linking the nucleic acid encoding polypeptide of the invention to a promoter/regulatory sequence which serves to drive expression of the protein, with or without a tag polypeptide, in a cell into which the exogenous nucleic acid is introduced. In one aspect of the invention, the polypeptide is a Dl lied polypeptide. In another aspect, the polypeptide is a JgI icd polypeptide. In yet another aspect, the polypeptide is a Nlicd polypeptide.

As disclosed previously elsewhere herein, many promoter/regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, the cytomegalovirus immediate early promoter enhancer sequence, the SV40 early promoter, both of which were used in the experiments disclosed herein, as well as the Rous sarcoma virus promoter, and the like. Moreover, inducible and tissue specific expression of the nucleic acid encoding Dl lied can be accomplished by placing the nucleic acid encoding Dl lied, with or without a tag polypeptide, under the control of an inducible or tissue specific promoter/regulatory sequence. Examples of tissue specific or inducible promoter/regulatory sequences which are useful for his purpose include, but are not limited to the MMTV LTR inducible promoter, and the SV40 late enhancer/promoter. In addition, promoters which are well known in the art which are induced in response to inducing agents such as metals, glucocorticoids, and the like, are also contemplated in the invention. Thus, it will be appreciated that the invention includes the use of any promoter/regulatory sequence, which is either known or unknown, and which is capable of driving expression of the desired protein encoded by a nucleic acid operably linked to the promoter/regulatory sequence. Based on the disclosure set forth in detail herein, it will be understood that either JgI icd orNlicd can also be placed under the control of a specific promoter/regulatory sequence.

Expressing a Dl 1 icd, JgI icd or Nl icd polypeptide using a promoter/regulatory sequence allows the isolation of large amounts of recombinantly produced protein. Further, where the lack or decreased level of Dl lied expression causes a disease, disorder, or condition associated with such expression, the expression of the protein driven by a promoter/regulatory sequence can provide useful therapeutics including, but not limited to, gene therapy whereby the protein is provided. In another aspect, where the lack or decreased level of JgI icd expression causes a disease, disorder, or condition associated with such expression, the expression of the protein driven by a promoter/regulatory sequence can provide useful therapeutics including, but not limited to, gene therapy whereby the protein is provided.

Vectors

In one embodiment, the invention also includes a vector comprising a nucleic acid encoding a DIl icd. In another embodiment, the invention includes a vector comprising a nucleic acid encoding a JgI icd. In yet another embodiment, the invention includes a vector comprising a nucleic acid encoding a N lied. Methods for incorporating a desired nucleic acid into a vector and the choice of vectors is well-known in the art as described in, for example, Sambrook et al., supra, and Ausubel et al., supra, and are disclosed elsewhere herein.

Further, the invention encompasses expression vectors and methods for the introduction of exogenous nucleic acid encoding a nucleic acid of the invention into a cell with concomitant expression of the exogenous nucleic acid in the cell using such methods as those described in, for example, Sambrook et al. (1989, supra), and Ausubel et al. (1997, supra), and as disclosed elsewhere herein.

Selection of any particular plasmid vector or other DNA vector is not a limiting factor in this invention and a wide plethora vectors are well-known in the art (see, e.g., Sambrook et al., supra, and Ausubel et al., supra.). Further, it is well within the skill of the artisan to choose particular promoter/regulatory sequences and operably link those promoter/regulatory sequences to a DNA sequence encoding a desired polypeptide. Such technology is well known in the art and is described, for example, in Sambrook, supra, and Ausubel, supra. The invention also includes cells, viruses, proviruses, and the like, containing such vectors. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, e.g., Sambrook et al., supra; Ausubel et al., supra.

The nucleic acids encoding a nucleic acid of the invention can be cloned into various plasmid vectors. However, the present invention should not be construed to be limited to plasmids or to any particular vector. Instead, the present invention should be construed to encompass a wide plethora of vectors which are readily available and/or well- known in the art.

Recombinant Cells

Additionally, the nucleic and amino acids of the invention can be used to produce recombinant cells which are useful tools for the study of Dl lied, the identification of novel Dllicd-based therapeutics, and for elucidating the cellular role(s) of Dl lied, among other things. Further still, the nucleic and amino acids of the invention can be used to produce recombinant cells which are useful tools for the study of Jg lied, the identification of novel Jglicd-based therapeutics, and for elucidating the cellular role(s) of Jglicd, among other things. Furthermore, the nucleic and amino acids of the invention can be used to produce recombinant cells which are useful tools for the study of N lied, the identification of novel Nlicd-based therapeutics, and for elucidating the cellular role(s) of Nlicd, among other things.

Moreover, the nucleic and amino acids of the invention can be used diagnostically, by assessing either the level of gene expression or protein expression and the biological activity of the protein, to assess severity and prognosis of a disease, disorder, or condition associated with altered level of Delta expression and/or activation, or associated with altered level of Jagged expression and/or activation.

The invention also includes expression of a Dl lied polypeptide in a cell where it is not normally expressed or expression of Dllicd-tagged fusion protein in cells where this fusion protein is not normally expressed. In a preferred embodiment, nucleic acid encoding Dl lied was covalently linked with a nucleic acid expressing a tag polypeptide and used to transfect a mammalian cell. Plasmid constructs containing Dl lied, or mutants, variants, derivatives and fragments thereof, can be cloned into a wide variety of vectors including a vector comprising a nucleic acid encoding a tag polypeptide. In another embodiment, the invention includes express of a Jglicd polypeptide in a cell where it is not normally expressed or expression of Jglicd-tagged fusion protein in cells where this fusion protein is not normally expressed.

The plasmids comprising a nucleotide of the invention can be introduced into a cell using standard methods well-known in the art (e.g., calcium phosphate, electroporation, and the like). Methods for cloning and introducing an isolated nucleic acid of interest into a cell are exemplified herein and are described in, for example, Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York), Ausubel et al. (1997, Current Protocols in Molecular Biology, Green & Wiley, New York), and other standard treatises.

The present invention also encompasses expression of an isolated Dl lied of the invention in non-mammalian cells (e.g. yeast, insect, and avian cells) using methods well- known in the art such as those disclosed elsewhere herein. In another embodiment, the invention encompasses expression of an isolated Jg lied or Nlicd of the invention in non- mammalian cells. Thus, it is clear that the invention is not limited to any particular vector or to any particular method of introducing the exogenous nucleic acid encoding Dl lied, JgI icd or Nlicd into a cell.

Expression of proteins of interest (e.g., Dllicd, Jglicd or Nlicd) in a cell, especially when the protein comprises a tag polypeptide, allows localization of the nucleic acid and/or the protein expressed therefrom within the cell under selected conditions such that the fiιnction(s) of the protein in the cell can be studied and identified.

One skilled in the art would appreciate, based upon the disclosure provided herein, that the invention also includes expression of Dllicd, Jglicd, Nlicd polypeptides, and the like, in prokaryotic cells (e.g., bacterial cells such as, for example, E. coli). Accordingly, the invention includes expression of the proteins of the invention in such cells as well.

The invention should not be construed as being limited to these plasmid vectors, bacterial strains, or to these tag polypeptides. Further, the invention is not limited to calcium phosphate transfection or to NIH cells as exemplified herein. Instead, the invention encompasses other expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (1989, supra), and Ausubel et al. (1997, supra).

In one embodiment, the cell line is mammalian cell comprising an expression vector comprising a nucleic acid encoding Dllicd constitutively expressed under the control of a high-level expression promoter/regulatory sequence. Further, the skilled artisan would appreciate based upon the disclosure provided herein that the cells can be transfected with constructs which comprise Dl lied in either a sense (i.e., sense cells) or an antisense orientation (i.e., antisense cells). In another embodiment, a mammalian cell line comprises a JgI icd constitutively expressed, as described in detail herein.

One skilled in the art would further appreciate that selected forms of nucleic acids encoding a polypeptide of the invention can be introduced to a cell in order to study the effect of any mutant, derivative, and variant of polypeptide of the invention (e.g., fusion proteins comprising at least a portion of Dllicd and a tag polypeptide) in this system. In one embodiment, the polypeptide of the invention is a Dllicd. In another embodiment, the polypeptide is a JgI icd.

Further, the invention includes a recombinant cell comprising an antisense nucleic acid (e.g., γ-Dllicd) which cell is a useful model for the study of a disease, disorder, or condition associated with or mediated by inhibition of the biosynthesis of a polypeptide of the invention and for elucidating the role(s) of the polypeptide in such processes. In one aspect, the polypeptide is a Dllicd. In another aspect of the invention, the polypeptide is a JgI icd. In yet another aspect, the polypeptide is an Nl icd.

In one embodiment of the invention, the lack of expression of Dllicd in patients may indicate, among other things, a disease, disorder or condition. Accordingly, a recombinant (i.e., transgenic) cell comprising an antisense nucleic acid complementary to a nucleic acid encoding Dllicd is a useful tool for the study of the mechanism(s) of action of Dllicd and its role(s) in the cell and for the identification of therapeutics that ameliorate the effect(s) of decreased levels of Dllicd expression. In another embodiment, the lack of expression of Jg lied in patients may indicate, among other things, a disease, disorder or condition, and therefore, an antisense nucleic acid comprising JgI icd may be useful, as described in detail herein.

The invention further includes a recombinant cell comprising an isolated nucleic acid encoding a polypeptide of the invention. In one embodiment, the polypeptide is a Dllicd. In another aspect, the polypeptide is a JGl icd. The cell can be transiently transfected with a plasmid encoding a portion of the nucleic acid encoding the protein of interest, e.g., Dllicd. The nucleic acid need not be integrated into the cell genome nor does it need to be expressed in the cell. Moreover, the cell may be a prokaryotic or a eukaryotic cell and the invention should not be construed to be limited to any particular cell line or cell type.

When the cell is a eukaryotic cell, the cell may be any eukaryotic cell which, when the isolated nucleic acid of the invention is introduced therein, and the protein encoded by the desired gene is no longer expressed therefrom, a benefit is obtained. Such a benefit may include the fact that there has been provided a system in which lack of expression of the desired gene can be studied in vitro in the laboratory or in a mammal in which the cell resides, a system wherein cells comprising the introduced gene deletion can be used as research, diagnostic and therapeutic tools, and a system wherein animal models are generated which are useful for the development of new diagnostic and therapeutic tools for selected disease, disorder, or condition states in a mammal.

Alternatively, the invention includes a eukaryotic cell which, when the isolated nucleic acid of the invention is introduced therein, and the protein encoded by the desired gene, i.e., Dl lied, is expressed therefrom where it was not previously present or expressed in the cell or where it is now expressed at a level or under circumstances different than that before the isolated nucleic acid was introduced, a benefit is obtained. Such a benefit may include the fact that there has been provided a system wherein the expression of the desired gene can be studied in vitro in the laboratory or in a mammal in which the cell resides, a system wherein cells comprising the introduced gene can be used as research, diagnostic and therapeutic tools, and a system wherein animal models are generated which are useful for the development of new diagnostic and therapeutic tools for selected disease states in a mammal.

Isolated Dl lied, Jg lied and Nlicd Polypeptides of the Invention

It will be understood that polypeptides of the invention include, but are not limited to a Dl lied polypeptide and a JgI icd polypeptide. In other embodiments, polypeptides of the invention also include a Nlicd polypeptide.

The invention includes an isolated polypeptide encoded by a nucleic acid encoding a Dl lied where the amino acid sequence of the polypeptide is preferably, at least about 90% homologous to the amino acid sequence of Dllicd (SEQ ID NO: 10). More preferably, the isolated nucleic acid encodes a Dllicd which is at least about at least about 95%, more preferably, about 98%, and even more preferably, at least about 99% homologous to SEQ ID NO: 10. Most preferably, the isolated nucleic acid encodes a Dllicd having the amino acid sequence SEQ ID NO: 10. The invention also includes an isolated polypeptide comprising a Dllicd.

The invention also includes an isolated polypeptide encoded by a nucleic acid encoding a Jglicd where the amino acid sequence of the polypeptide is preferably, at least about 90% homologous to the amino acid sequence of Jglicd (SEQ ID NO: 8). More preferably, the isolated nucleic acid encodes a Jglicd which is at least about 95%, more preferably, about 98%, and even more preferably, at least about 99% homologous to SEQ ID NO:8. Most preferably, the isolated nucleic acid encodes a JgI icd having the amino acid sequence SEQ ID NO:8. The invention also includes an isolated polypeptide comprising a JgI icd.

The invention includes an isolated polypeptide encoded by a nucleic acid encoding a Nl icd where the amino acid sequence of the polypeptide is preferably, at least about 90% homologous to the amino acid sequence of Nlicd (SEQ ID NO:22). More preferably, the isolated nucleic acid encodes a Nlicd which is at least about 95%, more preferably, about 98%, and even more preferably, at least about 99% homologous to SEQ ID NO:22. Most preferably, the isolated nucleic acid encodes a Nlicd having the amino acid sequence SEQ ID NO: 10. The invention also includes an isolated polypeptide comprising a Nlicd.

The present invention also provides for analogs of proteins or peptides which comprise a polypeptide of the invention as disclosed herein. Analogs may differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function. Conservative amino acid substitutions typically include substitutions within the following groups:

glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.

Modifications (which do not normally alter primary sequence) include in vivo, or in vitro, chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.

Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.

The present invention should also be construed to encompass "mutants," "derivatives," and "variants" of the peptides of the invention (or of the DNA encoding the same). In one aspect, such mutants, derivatives and variants are Dl lied polypeptides which are altered in one or more amino acids (or, when referring to the nucleotide sequence encoding the same, are altered in one or more base pairs) such that the resulting polypeptide (or DNA) is not identical to the sequences recited herein, but has the same biological property as the peptides disclosed herein, in that the polypeptide has biological/biochemical properties of the Dllicd polypeptide of the present invention. A biological property of a Dllicd includes, but is not limited to, the ability of the polypeptide to induce a senescent-like phenotype in a cell, as disclosed elsewhere herein. Further, another biological activity of Dllicd is the ability to affect the level of DNA synthesis in a cell, as discussed in detail elsewhere herein. Further still, the activities of Dllicd include, but are not limited to, the ability to induce the downregulation of cyclins A and E, and the ability to induce the upregulation of p21 and p27, among others.

In another aspect, such mutants, derivatives and variants are JgI icd polypeptides which are altered in one or more amino acids (or, when referring to the nucleotide sequence encoding the same, are altered in one or more base pairs) such that the resulting polypeptide (or DNA) is not identical to the sequences recited herein, but has the same biological property as the peptides disclosed herein, in that the polypeptide has biological/biochemical properties of the Jglicd polypeptide of the present invention. A biological property of a Jglicd includes, but is not limited to, the ability of the polypeptide to induce a apoptosis in a cell, as disclosed elsewhere herein. Further, additional biological activities of Jglicd include, but are not limited to, the ability to reduce the number of focal adhesion sites in a cell, the ability to reduce the number and/or organization of F-actin stress fibers in a cell, and the ability to increase p53 reporter activity in a cell. When armed with the disclosure set forth herein, the skilled artisan will understand that such activities can also be assayed in an in vitro system, using methods known in the art.

In yet another aspect, such mutants, derivatives and variants are N lied polypeptides which are altered in one or more amino acids (or, when referring to the nucleotide sequence encoding the same, are altered in one or more base pairs) such that the resulting polypeptide (or DNA) is not identical to the sequences recited herein, but has the same biological property as the peptides disclosed herein, in that the polypeptide has biological/biochemical properties of the Nl icd polypeptide of the present invention. Such properties include, but are not limited to, abrogation of the effects and/or function of JgI icd and abrogation of the effects and/or function of Dl lied.

Further, the invention should be construed to include naturally occurring variants or recombinantly derived mutants of a DIl icd polypeptide, which variants or mutants render the protein encoded thereby either more, less, or just as biologically active as the full- length proteins and/or the truncated soluble proteins of the invention. Further still, the invention should be construed to include naturally occurring variants or recombinantly derived mutants of JgI icd polypeptide, which variants or mutants render the protein encoded thereby either more, less, or just as biologically active as the full-length proteins and/or the truncated soluble proteins of the invention.

In addition, the skilled artisan would appreciate that changes can be introduced by mutation of the nucleic acid encoding the protein thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein. For example, one can make nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity. For example, amino acid residues that are not conserved or only semi-conserved among homo logs of various species may be non-essential for activity and thus would be likely targets for alteration. Alternatively, amino acid residues that are conserved among the homologs of various species (e.g., murine and human) may be essential for activity and thus would not be likely targets for alteration.

Accordingly, another aspect of the invention pertains to polypeptides encoded by nucleic acid molecules of the invention, which polypeptides contain changes in amino acid residues that are not essential for activity. Such polypeptides differ in amino acid sequence from SEQ ID NO: 10, yet retain biological activity. In another aspect of the invention, such polypeptides differ in amino acid sequence from SEQ ID NO:8, yet retain biological activity. To generate variant proteins of Dl lied, an isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of any SEQ ID NO: 10, such that one or more amino acid residue substitutions, additions or deletions are introduced into the encoded DIl icd polypeptide. To generate variant proteins of Jglicd, an isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of any SEQ ID NO:8, such that one or more amino acid residue substitutions, additions or deletions are introduced into the encoded Jglicd polypeptide. One of skill in the art will understand, when armed with the disclosure set forth herein, that variant polypeptides of Nl icd can be similarly generated.

Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.

One skilled in the art would appreciate, based upon the disclosure provided herein, that a mutant polypeptide that is a variant of a polypeptide of the invention can be assayed for one or more of the following: 1) the ability to induce a senescent-like phenotype in a cell; 2) the ability to affect the level of DNA synthesis in a cell; 3) the ability to induce the downregulation of cyclins A and E; 4) the ability to induce the upregulation of p21 and p27; 5) the ability to reduce the number of focal adhesion sites; 6) the ability to reduce the number and/or organization of F-actin stress fibers; 7) the ability to induce apoptosis in a cell; and 8) the ability to increase p53 reporter activity, among other activities. Therefore, in an aspect of the invention, the invention includes a Dl lied polypeptide comprising at least one mutation in a nuclear localization sequence (NLS). As described in detail elsewhere herein, Dl lied comprises two potential NLSs, one extending from amino acid 575 through amino acid 579 of Delta (KHRPP, SEQ ID NO: 15), and a second extending from amino acid 689 through amino acid 692 of Delta (RKRPP, SEQ ID NO: 16).

As will be understood by the skilled artisan, when equipped with the present disclosure, the role and function of the NLSs of Dl lied can be investigated and ascertained through many methods, including, but not limited to, site-directed mutagenesis of the NLSs in Dl lied. Such mutagenesis techniques can serve to selectively inactivate or to hyper- activate Dl lied, and the activity and biological effect of the mutant DIl icd can be determined using one of the many assays as set forth in detail in the present application.

In one embodiment, a Dl lied polypeptide comprises at least one mutation, insertion, deletion, or combination thereof in the KHRPP nuclear localization sequence. In one aspect, the KHRPP NLS is mutated to KHAP, as set forth in SEQ ID NO: 12. In another embodiment, a Dl lied polypeptide comprises at least one mutation, insertion, deletion, or combination thereof in the RKRPP nuclear localization sequence. In one aspect, the RKRPP NLS is mutated to RQP, as set forth in SEQ ID NO: 14. In yet another embodiment of the invention, a Dl lied polypeptide comprises multiple mutations across both NLSs. In one aspect, a Dl lied has the KHRPP NLS mutated to KHAP and the RKRPP NLS mutated to RQP.

The nucleic acids, and peptides encoded thereby, are useful tools for elucidating the function(s) of Dl lied in a cell. Additionally, the nucleic acids, and peptides encoded thereby, are useful tools for elucidating the function(s) of Jglicd in a cell. Further, they are useful for localizing a nucleic acid of the invention, a protein of the present invention, or both, in a cell and for assessing the level of expression of the nucleic acid and/or protein under selected conditions including in response to therapeutic treatment. Further, nucleic and amino acids comprising Dl lied or Jglicd are useful diagnostics which can be used, for example, to identify a compound that affects expression of the protein and is a candidate therapeutic for a disease, disorder, or condition associated with altered expression of Dl lied of Jglicd, respectively.

In addition, the nucleic acids, the proteins encoded thereby, or both, can be administered to a mammal to increase or decrease expression of Dl lied in the mammal. This can be therapeutic to the mammal if under or over-expression of Dl lied in the mammal mediates a disease or condition associated with altered expression of the protein compared with normal expression of Dl lied in a healthy mammal. Further still, the nucleic acid, proteins encoded thereby, or both can be used to obtain a therapeutic benefit based on the under- or over-expression of Jglicd.

Antibodies

The invention also includes an antibody specific for a DIl icd, or a portion thereof. The invention further includes an antibody specific for a Jglicd, or a portion thereof. While the following discussion of the production of antibodies in accordance with the present invention refers in name to a Dllicd of the invention, it will be understood to apply equally and completely to a Jglicd of the invention.

In one embodiment, the antibody is a rabbit polyclonal antibody to Dllicd. The antibody can be specific for any portion of the protein and the full-length protein can be used to generate antibodies specific therefor. However, the present invention is not limited to using the full-length protein as an immunogen. Rather, the present invention includes using an immunogenic portion of the protein to produce an antibody that specifically binds with Dllicd. That is, the invention includes immunizing an animal using an immunogenic portion of the protein.

The antibodies can be produced by immunizing an animal such as, but not limited to, a rabbit or a mouse with a protein of the invention, or a portion thereof, or by immunizing an animal using a protein comprising at least a portion of Dllicd and a tag polypeptide portion comprising, for example; a maltose binding protein tag polypeptide portion and a portion comprising the appropriate Dllicd amino acid residues. One skilled in the art would appreciate, based upon the disclosure provided herein, that smaller fragments of these nucleic acids can also be used to produce antibodies that specifically bind Dllicd.

One skilled in the art would appreciate, based upon the disclosure provided herein, that various portions of an isolated Dllicd polypeptide can be used to generate antibodies to either highly conserved regions of Dllicd or to non-conserved regions. Once armed with the sequence of Dllicd and the detailed analysis localizing the various conserved and non-conserved domains of the protein, the skilled artisan would understand, based upon the disclosure provided herein, how to obtain antibodies specific for the various domains using methods well-known in the art.

Further, the skilled artisan, based upon the disclosure provided herein, would appreciate that the non-conserved regions of a protein of interest can be more immunogenic than the highly conserved regions which are conserved among various organisms. Immunization using a non-conserved immunogenic portion can produce antibodies specific for the non-conserved region thereby producing antibodies that do not cross-react with other proteins which can share one or more conserved portions.

One skilled in the art would appreciate, based upon the disclosure provided herein, which portions of Di lied are less homologous with other proteins sharing conserved domains. However, the present invention is not limited to any particular domain; instead, the skilled artisan would understand that other non-conserved regions of the Dl lied polypeptides of the invention can be used to produce the antibodies of the invention as disclosed herein.

The invention should not be construed as being limited solely to the antibodies disclosed herein or to any particular immunogenic portion of the proteins of the invention. Rather, the invention should be construed to include other antibodies, as that term is defined elsewhere herein, to Dl lied, or portions thereof, or to proteins sharing at least about 65% homology with these proteins.

The invention encompasses polyclonal, monoclonal, synthetic antibodies, and the like. One skilled in the art would understand, based upon the disclosure provided herein, that the crucial feature of the antibody of the invention is that the antibody bind specifically with DIl icd. That is, the antibody of the invention recognizes Dl lied, or a fragment thereof, on Western blots, in immunostaining of cells, and immunoprecipitates Dl lied using standard methods well-known in the art.

One skilled in the art would appreciate, based upon the disclosure provided herein, that the antibodies can be used to localize the relevant protein in a cell and to study the role(s) of the antigen recognized thereby in cell processes. Moreover, the antibodies can be used to detect and or measure the amount of protein present in a biological sample using well-known methods such as, but not limited to, Western blotting and enzyme-linked immunosorbent assay (ELISA). Moreover, the antibodies can be used to immunoprecipitate and/or immuno-affinity purify their cognate antigen using methods well-known in the art.

The generation of polyclonal antibodies is accomplished by inoculating the desired animal with the antigen and isolating antibodies which specifically bind the antigen therefrom using standard antibody production methods such as those described in, for example, Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor,

N.Y.).

Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide can be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al.₅ 1988, supra, and in Tuszynski et al. (1988, Blood, 72:109-115), and methods set forth elsewhere herein. Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.

A nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. Immunol. 12:125-168), and the references cited therein. Further, the antibody of the invention may be "humanized" using the technology described in Wright et al. (supra), and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77:755-759).

To generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al., supra.

Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art and are described for example, in Wright et al. (supra).

Processes such as those described above, have been developed for the production of human antibodies using Ml 3 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into M13 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.

The procedures presented herein describe the generation of phage which encode the Fab portion of an antibody molecule. However, the invention should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the invention. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al. (1991, J. MoI. Biol. 222:581-597). Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.

The invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1:837-839; de Kruif et al. 1995, J. MoI. Biol. 248:97-105).

As described above, the preceding discussion of the production of antibodies specific for Dl lied according to the present invention applies with equal force to the production of antibodies specific for JgI icd of the present invention. Based on the disclosure set forth herein, it will be understood by the skilled artisan how to prepare such JgI icd antibodies in accordance with the present invention.

Compositions

The invention includes a composition comprising an isolated purified Dl lied, or fragment thereof, and a composition comprising an isolated nucleic acid encoding Dl lied. The compositions can be used, for example, to assess the level of expression of Dl lied, to affect the level of Dl lied in a cell and/or in a mammal, as well as to affect angiogenesis, differentiation, or both, in a cell and/or in a mammal, to identify useful compounds, and the like.

The invention also includes a composition comprising an isolated purified JgI icd, or fragment thereof, and a composition comprising an isolated nucleic acid encoding JgI icd. The compositions can be used, for example, to assess the level of expression of Jglicd, to affect the level of Jglicd in a cell and/or in a mammal, as well as to affect angiogenesis, differentiation, or both, in a cell and/or in a mammal, to identify useful compounds, and the like.

The invention further includes a composition comprising an isolated purified polypeptide comprising a polypeptide of the invention. In one aspect, the polypeptide is a Dl lied. In another aspect, the polypeptide is a Jglicd. Preferably, the composition comprises a pharmaceutically acceptable carrier. A Dllicd-containing composition can be administered to a mammal afflicted with a disease, disorder or condition associated with a reduced level of Dl lied compared with the level of Dl lied in an otherwise identical mammal not suffering from such disease, disorder or condition. A Jlgicd-containing composition can be administered to a mammal afflicted with a disease, disorder or condition associated with a reduced level of Jglicd compared with the level of Jglicd in an otherwise identical mammal not suffering from such disease, disorder or condition.

Additionally, a composition comprising an isolated purified polypeptide comprising a polypeptide of the invention, or an immunogenic portion thereof, can be administered to an animal to induce an immune response thereto. One skilled in the art would appreciate, based upon the disclosure provided herein, that the composition can be used to produce useful antibodies that specifically bind with Jglicd. Further, the composition can be used to produce useful antibodies that specifically bind with Dl lied.

The invention further includes a composition comprising an isolated Dl lied. One skilled in the art would understand, based upon the disclosure provided herein, that administration of composition comprising isolated Dl lied is an important potential therapeutic for treatment of a disease, disorder or condition mediated by decreased Dl lied expression, function, or both. In another embodiment, the invention includes a composition comprising an isolated Jglicd. One skilled in the art would also understand, based upon the disclosure provided herein, that administration of a composition comprising isolated Jglicd is an important potential therapeutic for treatment of a disease, disorder or condition mediated by decreased Jglicd expression, function, or both. The invention further includes administering Dl lied by administering a nucleic acid encoding DIl icd (e.g., SEQ ID NO:9). Further still, the invention includes administering JgI icd by administering a nucleic acid encoding Jglicd (e.g., SEQ ID NO:7). As more fully set forth elsewhere herein, one skilled in the art would appreciate, based upon the disclosure provided herein, that a protein can be administered to a cell and/or to a mammal, by administering a nucleic acid encoding the protein. Such methods of administering a protein of interest, i.e., a DIl icd or a fragment thereof, or a Jgl2icd, or a fragment thereof, are encompassed in the present invention.

For administration of the above-mentioned compositions to a mammal, a polypeptide, or the nucleic acid encoding it, or both, can be suspended in any pharmaceutically acceptable carrier, for example, HEPES buffered saline at a pH of about 7.8. Other pharmaceutically acceptable carriers which are useful include, but are not limited to, glycerol, water, saline, ethanol and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).

The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3 -butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di- glycerides.

Pharmaceutical compositions that are useful in the methods of the invention may be administered, prepared, packaged, and/or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically- based formulations.

The compositions of the invention may be administered via numerous routes, including, but not limited to, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, or ophthalmic administration routes. The route(s) of administration will be readily apparent to the skilled artisan and will depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like.

Pharmaceutical compositions that are useful in the methods of the invention may be administered systemically in oral solid formulations, ophthalmic, suppository, aerosol, topical or other similar formulations. In addition to the compound such as heparan sulfate, or a biological equivalent thereof, such pharmaceutical compositions may contain pharmaceutically-acceptable carriers and other ingredients known to enhance and facilitate drug administration. Other possible formulations, such as nanoparticles, liposomes, resealed erythrocytes, and immunologically based systems may also be used to administer Dl lied or JgI icd, either alone or in combination with a nucleic acid encoding the same.

The invention encompasses the preparation and use of pharmaceutical compositions comprising a compound useful for treatment of any disease, disorder or condition associated with altered expression of Dllicd in a mammal. The invention also encompasses the preparation and use of pharmaceutical compositions comprising a compound useful for treatment of any disease, disorder or condition associated with altered expression of JgI icd in a mammal. Such a pharmaceutical composition may consist of the active ingredient alone, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these. The active ingredient may be present in the pharmaceutical composition in the form of a physiologically acceptable ester or salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.

The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.

Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs. In addition, the administration of the compositions to birds is also contemplated.

Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, intrathecal or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically- based formulations.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.

In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents. Particularly contemplated additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.

Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.

A formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient. Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, or an emulsion.

As used herein, an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.

A tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients. Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent. Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents. Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate. Known surface active agents include, but are not limited to, sodium lauryl sulfate. Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate. Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid. Known binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxy propyl methyl cellulose. Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.

Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient. By way of example, a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets. Further by way of example, tablets may be coated using methods described in U.S. Pat. Nos. 4,256,108; 4,160,452; and 4,265,874 to form osmotically-controlled release tablets. Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide a pharmaceutically elegant and palatable preparation.

Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may further comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.

Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.

Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.

Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle. Aqueous vehicles include, for example, water and isotonic saline. Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents. Oily suspensions may further comprise a thickening agent. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methyl cellulose, hydroxypropylmethylcellulose. Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include, but are not limited to, lecithin and acacia. Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid. Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin. Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.

Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent. Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water and isotonic saline. Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.

Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of a dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.

A pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of an oil-in-water emulsion or a water-in-oil emulsion. The oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these. Such compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally- occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate. These emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for rectal administration. Such a composition may be in the form of, for example, a suppository, a retention enema preparation, and a solution for rectal or colonic irrigation.

Suppository formulations may be made by combining the active ingredient with a non-irritating pharmaceutically acceptable excipient which is solid at ordinary room temperature (i.e., about 20 ⁰C) and which is liquid at the rectal temperature of the subject (i.e., about 37 ⁰C in a healthy human). Suitable pharmaceutically acceptable excipients include, but are not limited to, cocoa butter, polyethylene glycols, and various glycerides. Suppository formulations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.

Retention enema preparations or solutions for rectal or colonic irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier. As is well known in the art, enema preparations may be administered using, and may be packaged within, a delivery device adapted to the rectal anatomy of the subject. Enema preparations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for vaginal administration. Such a composition may be in the form of, for example, a suppository, an impregnated or coated vaginally-insertable material such as a tampon, a douche preparation, or gel or cream or a solution for vaginal irrigation.

Methods for impregnating or coating a material with a chemical composition are known in the art, and include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material (i.e., such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.

Douche preparations or solutions for vaginal irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier. As is well known in the art, douche preparations may be administered using, and may be packaged within, a delivery device adapted to the vaginal anatomy of the subject. Douche preparations may further comprise various additional ingredients including, but not limited to, antioxidants, antibiotics, antifungal agents, and preservatives.

As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue- penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques. Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di- glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in macrocrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

Formulations suitable for topical administration include, but are not limited to, liquid or semi-liquid preparations such as liniments, lotions, oil-in-water or water-in-oil emulsions such as creams, ointments or pastes, and solutions or suspensions. Topically- administrable formulations may, for example, comprise from about 1% to about 10% (w/w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further comprise one or more of the additional ingredients described herein. A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder- dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. Preferably, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.

Low boiling propellants generally include liquid propellants having a boiling point of below 65 ⁰F at atmospheric pressure. Generally, the propellant may constitute 50 to 99.9% (w/w) of the composition, and the active ingredient may constitute 0.1 to 20% (w/w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).

Pharmaceutical compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension. Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate. The droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.

The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention. Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nasal passage from a container of the powder held close to the nares.

Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) to as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, comprise from about 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for ophthalmic administration. Such formulations may, for example, be in the form of eye drops including, for example, a 0.1-1.0% (w/w) solution or suspension of the active ingredient in an aqueous or oily liquid carrier. Such drops may further comprise buffering agents, salts, or one or more other of the additional ingredients described herein. Other ophthalmically-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form or in a liposomal preparation.

As used herein, "additional ingredients" include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" which may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Genaro, ed. (1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.), which is incorporated herein by reference.

Typically dosages of the compound of the invention which may be administered to an animal, preferably a human, range in amount from 1 microgram to about 100 grams per kilogram of body weight of the animal. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration. Preferably, the dosage of the compound will vary from about 1 milligram to about 10 grams per kilogram of body weight of the animal. More preferably, the dosage will vary from about 10 milligrams to about 1 gram per kilogram of body weight of the animal.

The compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.

Methods

The present invention also includes a method of inhibiting angiogenesis in a system capable of angiogenesis. The invention also includes a method of stimulating angiogenesis in a system capable of angiogenesis, a method of altering the angiogenic potential of a cell, a method of altering cell growth in tissue masses, and a method of affecting differentiation of a cell, among other methods. As more fully set forth elsewhere herein in discussing methods of using a Dl lied polypeptide or a functionally equivalent derivative or allelic or species variant thereof, a Dl lied polypeptide can be used to inhibit angiogenesis due to the anti-proliferative role of Dllicd. That is, the data disclosed herein demonstrate that contacting certain cells with Dllicd has an anti-proliferative effect on the cells, and can lead to a senescent-like cell phenotype, among other things. One skilled in the art would appreciate, based upon the disclosure provided herein, that the anti-proliferative effect of Dllicd can be used to prevent angiogenesis in cells with an angiogenic potential, including, but not limited to stem cells, fibroblast cells, and endothelial cells, among others. More specifically, in one embodiment, the invention features a method of inducing senescent-like phenotype in a cell, comprising the step of administering to a cell a Dl lied polypeptide, wherein the Dl lied polypeptide induces a senescent-like phenotype in the cell. In one aspect, the Dl lied polypeptide comprises the sequence from amino acid number 569 to amino acid number 723 of SEQ ID NO:4.

In another embodiment, the invention features a method of inducing a senescent-like phenotype in a cell, wherein the method comprises the steps of administering an isolated nucleic acid encoding a Dl lied polypeptide to a cell, and expressing a Dl lied polypeptide therefrom, further wherein the expressed polypeptide induces a senescent-like phenotype in the cell. In one aspect, the isolated nucleic acid encoding a Dl lied polypeptide comprises the sequence from nucleotide number 1704 to about nucleotide 2172 of SEQ ID NO:3.

Further, one skilled in the art would appreciate, based upon the instant disclosure, that angiogenesis can be affected not only by the addition of exogenous Dl lied polypeptide, but can also be affected by the introduction of an exogenous nucleic acid encoding Dl lied into a cell where it is expressed, and/or by the introduction into a mammal of cells which express the protein which is encoded by a Dl lied nucleic acid. Thus, the method of the present invention is not limited to any particular manner in which the Dl lied is provided to a cell or to a mammal; rather, the invention encompasses various methods whereby a Dl lied and/or a portion thereof, is introduced to a cell or into a mammal.

The present invention further includes a method of inhibiting angiogenesis in a system capable of angiogenesis, through the use of Jglicd. As more fully set forth elsewhere herein in discussing methods of using a Jglicd polypeptide or a functionally equivalent derivative or allelic or species variant thereof, a Jglicd polypeptide can be used to inhibit angiogenesis due to the apoptotic role of Jglicd. One skilled in the art would appreciate, based upon the disclosure provided herein, that the apoptotic effect of Jglicd can be used to prevent angiogenesis in cells with an angiogenic potential, including, but not limited to stem cells, fibroblast cells, and endothelial cells, among others.

More specifically, in one embodiment, the invention features a method of inducing apoptosis in a cell, comprising the step of administering to a cell a Jglicd polypeptide, wherein the Jglicd polypeptide induces apoptosis in the cell. In one aspect, the Jglicd polypeptide comprises the sequence from amino acid number 1088 to amino acid number 1218 of SEQ ID N0:2. In another embodiment, the invention features a method of inducing apoptosis in a cell, wherein the method comprises the steps of administering an isolated nucleic acid encoding a JgI icd polypeptide to a cell, and expressing a JgI icd polypeptide therefrom, further wherein the expressed polypeptide induces apoptosis in the cell. In one aspect, the isolated nucleic acid encoding a JgI icd polypeptide comprises the sequence from nucleotide number 3264 to about nucleotide 3657 of SEQ ID NO:1.

Further, one skilled in the art would appreciate, based upon the instant disclosure, that angiogenesis can be affected not only by the addition of exogenous JgI icd polypeptide, but can also be affected by the introduction of an exogenous nucleic acid encoding Jg lied into a cell where it is expressed, and/or by the introduction into a mammal of cells which express the protein which is encoded by a JgI icd nucleic acid. Thus, the method of the present invention is not limited to any particular manner in which the JgI icd is provided to a cell or to a mammal; rather, the invention encompasses various methods whereby a JgI icd and/or a portion thereof, is introduced to a cell or into a mammal.

As more fully set forth elsewhere herein, a polypeptide of the invention can be administered to a mammal via a variety of routes. Further, the dosage and amounts administered depend on numerous factors which are discussed more fully elsewhere herein. In one aspect, the polypeptide is a Dl lied. In another aspect, the polypeptide is a JgI icd.

The amount of polypeptide administered, whether it is administered as protein or as nucleic acid or as a cell expressing the polypeptide, is sufficient to elicit the respective biological activity of a polypeptide of the invention, as described in detail elsewhere herein. The pharmaceutical compositions useful for practicing the invention can be administered to deliver a dose of between about 1 nanogram per kilogram and about 100 milligrams per kilogram of polypeptide per patient body weight. Suitable amounts of the polypeptide for administration include doses which are high enough to have the desired effect without concomitant adverse effects. When the pharmaceutical is a protein or peptide, a preferred dosage range is from about 1 pg to about 100 mg of protein or peptide per kg of patient body weight.

A nucleic acid of the invention may also be administered, as a method of administering the polypeptide of the invention. In one aspect, a nucleic acid of the invention is a Dllicd nucleic acid. In another aspect, a nucleic acid is a Jglicd nucleic acid. When a nucleic acid of the invention is administered in the form of DNA encoding the same contained within a recombinant virus vector, a dosage of between about 10² and about 10ⁿ plaque forming units of virus per kilogram of patient body weight can be used. When naked DNA encoding a polypeptide of the invention is to be administered as the pharmaceutical composition, a dosage of between about 1 pg to about 100 mg of DNA per kilogram of patient body weight can be used. Further, when the polypeptide is administered in the form of a cell expressing a nucleic acid encoding the same, the dosage of cells per kilogram of patient body weight can be assessed depending on the amount of polypeptide expressed by the cells and the level desired as disclosed previously elsewhere herein.

When a polypeptide of the invention is administered by administering a nucleic acid encoding the protein, the nucleic acid can be administered naked (e.g., substantially free of any other substance with which a nucleic acid is typically associated such as protein, and the like). Alternatively, the nucleic acid can be encapsulated or otherwise associated with another substance capable of facilitating the introduction of the nucleic acid into a cell. Such nucleic acid delivery techniques are described elsewhere herein and are well- known in the art and are described in, for example, Sambrook et al., supra, and Ausubel et al., supra.

An angiogenic effective amount, as that term is used and defined elsewhere herein, can be readily determined using any of the angiogenesis assays disclosed herein as well as methods well-known in the art. That is, the angiogenic effect of a polypeptide of the invention administered to a cell and/or to an organism or assay system, can be assessed by, for example, measuring the effect of the polypeptide on expression of various genes (e.g., using differential display analyses such as SAGE analysis), migration of cells in culture, formation of chords by cells grown on plastic or on collagen matrices, assessing the level of repression of type I collagen expression, measuring the angiogenic potential using a CAM assay and/or measuring the in vivo growth of the cell using transplant studies in various murine models. The assay and analysis of a polypeptide of the invention is described in greater detail elsewhere herein. However, the present invention is not limited to these assays to detect effects of Dllicd or Jglicd on angiogenesis; rather, similar assays which are now known or which are developed in the future may be used to determine the effect of a polypeptide of the invention on angiogenesis.

The invention also includes a method of affecting differentiation of a cell. The method comprises contacting a cell with an effective amount of a substantially purified polypeptide of the invention. In one embodiment, one skilled in the art would appreciate, based upon the disclosure provided herein, that contacting a cell with a Dllicd polypeptide induces a senescent-like phenotype such that cell differentiation, angiogenesis, and other cellular processes, are affected as demonstrated by the data disclosed herein. In another embodiment, one skilled in the art would appreciate, based upon the disclosure provided herein, that contacting a cell with a JgI icd polypeptide induces a pro-apoptotic phenotype such that cell differentiation, angiogenesis, and other cellular processes, are affected as demonstrated by the data disclosed herein.

A differentiation effective amount, as that term is defined elsewhere herein, of Dl lied polypeptide can be readily determined by assessing the effect(s) of contacting a cell with Dl lied or a fragment thereof. Such methods include, but are not limited to, those disclosed herein which include measuring the effect of Dl lied on expression of various genes (e.g., using differential display analyses such as SAGE analysis) including repression of type I collagen expression, growth of cells on plastic or on collagen matrices, formation of chords and/or tubes by cells grown on plastic or on collagen matrices, measuring the angiogenic potential using a CAM assay and/or measuring the in vivo growth of the cell using transplant studies in various murine models. However, the present invention is not limited to these assays to detect effects of Dl lied on cell differentiation; rather, similar assays which are now known or which are developed in the future may be used to determine the effect of Dl lied polypeptide on differentiation.

With respect to Jg lied, a differentiation effective amount, as the term is defined elsewhere herein, of a Jg lied polypeptide can be readily determined by assessing the effect(s) of contacting a cell with Jg lied or a fragment thereof. Such methods include, but are not limited to, those disclosed herein which include measuring the effect of Jg lied on expression of various genes (e.g., using differential display analyses such as SAGE analysis) including repression of type I collagen expression, growth of cells on plastic or on collagen matrices, formation of chords and/or tubes by cells grown on plastic or on collagen matrices, measuring the angiogenic potential using a CAM assay and/or measuring the in vivo growth of the cell using transplant studies in various murine models. However, the present invention is not limited to these assays to detect effects of Jg lied on cell differentiation; rather, similar assays which are now known or which are developed in the future may be used to determine the effect of Jg lied polypeptide on differentiation.

By the term "growth characteristics," as the term is used herein, is meant any change in growth kinetics, size, morphology, and/or association with other cells exhibited by a cell transfected with nucleic acid encoding a polypeptide of the invention which is not exhibited by an identical cell which is not transfected or which is transfected with an empty, insert-less vector. As disclosed herein, such growth characteristics include, but are not limited to, the ability to form chord-like structures when grown in vitro; the ability to form tissue masses when transplanted into nude mice; the ability to form angiogenic structures in CAM assays; and the expression of positive and negative regulators of the cell cycle.

By providing methods of affecting angiogenesis as set forth herein, the present invention provides methods and compositions which can affect a number of physiologic and pathologic conditions, including placental development, wound healing, rheumatoid arthritis, diabetic retinopathy and solid tumor growth and metastasis and motor neuron disorders. The referenced wound healing includes healing of any injury or lesion in the skin, tissue, vasculature, or nervous system of the subject, and includes cell migration and differentiation of cells comprising the mesoderm, endoderm, ectoderm and/or neuroderm. The wound or injury can be the result of surgery, trauma, and/or disease or condition. Such disease and/or conditions include ischemic lesions resulting from a lack of oxygen to the cell or tissue, e.g., cerebral or cardiac infarction or ischemia, malignant lesions, infectious lesions, e.g., abscess, degenerative lesions, lesions related to nutritional disorders, neurological lesions associated with systemic diseases, e.g., diabetic neuropathy and retinopathy, systemic lupus erythematosus, carcinoma or sarcoidosis, and lesions caused by toxins, e.g., alcohol, lead, etc. Motor neuron disorders may include, e.g., amyotrophic lateral sclerosis, progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and the post polio syndrome, and hereditary Motorsensory Neuropathy (Charcot-Marie-Tooth disease).

The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

EXPERIMENTAL EXAMPLES

The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Experimental Examples: Materials and Methods

Cell cultures. HUVEC (ATCC) were grown in EBM medium supplemented with EGM-2 growth factor cocktail (Cambrex). HUVEC at passages 7-12 were used in the experiments set forth herein. NIH 3T3 murine fibroblasts (ATCC) and human embryonic kidney (HEK) 293 cells (ATCC) were grown in Dulbecco's Modified Eagles Medium (DMEM; Life Technologies) supplemented with 10% bovine calf serum (Hyclone) or 10% fetal bovine serum (Hyclone), respectively.

DNA constructs, transfection, preparation of adenoviruses and adenoviral transduction. To study the physiological role of human JgI icd and Dl lied, nucleotide sequences coding for amino acids 569-723 for Deltal and 1088-1218 for Jaggedl (Small et al., 2001, J. Biol. Chem. 276:32022-30) were cloned in pcDNA 3.1-Zeo vector (Invitrogen) in restriction sites Xbal and HindIII for Deltal, and EcoRI and Xhol for Jaggedl. Additionally, the V5 tag was introduced in the N-termini of Dllicd and Jglicd. NIH 3T3 and HEK 293 cells were transfected using FuGene (Roche) transfection reagent according to the manufacturer's instructions. Selection of stably transfected NIH 3T3 cells was described earlier (Wessendorf et al., 1993, J. Biol. Chem. 268:22100-4). Dllicd and Jglicd were also cloned in the multiple cloning site of the pAdlox shuttle vector (Invitrogen). The corresponding adenoviruses were prepared as described (Small et al., 2003, J. Biol. Chem. 278:16405-13), and used to transduce HUVEC. In a series of experiments, an adenoviral construct expressing human Nl icd (Mandinova et al, 2003, J. Cell Sci. 116:2687-2696) was used to transduce HUVEC 16-24 hours before Dllicd or Jglicd transduction. The control β- galactosidase (LacZ) adenoviral construct was also described earlier (Mandinova et al, 2003, J. Cell Sci. 116:2687-2696).

Site directed mutagenesis. To mutate the NLS of Dllicd, a PCR-based strategy was used. Mutations were introduced with following primers: Dllicd-nlsl - (s) cagaagcacgccccagccgacccctg (SEQ ID NO: 17) and ggacggctggggcgtgcttctgcagcc (SEQ ID NO: 18) (as); Dllicd-nls2 - (s) gaagcatctgaacaaaggccggactcgggctgttc (SEQ ID NO: 19) and (as) cagccgagtccggcctttgttcagatgcttctccaccc (SEQ ID NO:20), using a Stratagene site-directed mutagenesis kit following the manufacturer's instructions. To generate a double mutant for both NLS of Dllicd (Dllicd-nlsDM), the Dllicd-nlsl construct was used as a template and introduced the second mutation with primers for Dllicd-nls2.

Immunofluorescence Confocal Microscopy. Cells were plated on glass coverslips and fixed with 4% (w/v) paraformaldehyde. Actin stress fibers were visualized by fluorescein isothiocyanate (FITC)-conjugated phalloidin (Sigma). Monoclonal anti-vinculin (Sigma) or Anti-V5 (Invitrogen) antibodies followed by FITC-conjugated secondary antibody were used to visualize focal adhesion sites (Small et al., 2001, J. Biol. Chem. 276:32022-30) and Dl lied, respectively. TO-PRO3 (Molecular Probes) was used to stain DNA as described previously (Andreeva et al., 2004, Euro. J. of Cell Biol. 327-335). Immunofluorescently stained cells were analyzed using a TC-SP confocal microscope (Leica).

Immunoblot Analysis. Lysates of LacZ-, Dllicd- and Jglicd-transduced HUVEC were prepared and resolved by 12 or 15% SDS-PAGE as described previously (Small et al., 2001, J. Biol. Chem. 276:32022-30). Immunoblot analysis was performed as described previously (Small et al., 2001, J. Biol. Chem. 276:32022-30) using either an anti- p21 (BD Biosciences), anti-p27 (BD Biosciences), anti-cyclin A (Santa Cruz), anti-cyclin E (Santa Cruz), anti-cyclin Dl (Santa Cruz), or anti-activated MAP kinase 1/2 (Upstate) or anti β-actin (Sigma) antibody.

DNA Synthesis Assay: 3H-thymidine autoradiography was used to evaluate the levels of DNA synthesis in HUVEC or HEK 293 cells expressing Dllicd. Cells were plated at 50% confluency on fibronectin-coated glass coverslips for 24 hours. HUVEC were transduced with Dllicd adenovirus. HEK 293 cells were transiently transfected with Dllicd using FuGene (Roche); and after 24 hours, 3H-thymidine (NEN; 1 μCi/ml) was added to the cell culture medium for 16 hours. The cells were fixed and processed for autoradiography as described (Andreeva et al., 2004, Euro. J. of Cell Biol. 327-335). The percentage of 3H- labeled nuclei was calculated using an inverted Olympus microscope. In the experiments with Dllicd mutants, fixed cells were processed for anti-V5 immunoperoxidase staining as described (Prudovsky et al., 1991, Dev. Biol. 144:232-9). The percentage of labeled nuclei was counted in V5 positive (Dllicd-transfected) cells. Control LacZ-transfected cells underwent anti-βgalactosidase immunoperoxidase staining.

Acidic β-galactosidase staining. Cells transduced with Dllicd were washed in PBS, fixed for 5 minutes in 2% formaldehyde/0.2% glutaraldehyde, washed and stained for acidic β-galactosidase as described (Dimri et al., 1995, Proc. Natl. Acad. Sci. USA 92:9363-

7).

Detection of Apoptosis. Twenty-four hours after JgI icd adenoviral transduction of HUVEC, conditioned medium was collected. Attached HUVEC were trypsinized and combined with floating cells from conditioned medium, precipitated by centrifugation, and resuspended in 0.5 ml PBS. Either 7-amino-actinomycin D (7-AAD) at 20 μg/ml final concentration or FITC conjugated AnnexinV (BD Clontech) and propidium iodide at 20 μg/ml final concentration was added. Samples were analyzed by FACS (Becton- Dickinson FACSCalibur). As a positive control for apoptosis, HUVEC were UV irradiated (0.01 J/cm2) and collected 16 hours later. For TUNEL analysis, HUVEC were plated on glass coverslips coated with fibronectin (10 μg/cm2) and adenovirally transduced with LacZ or JgI icd. Cells were fixed in 4% formaldehyde 16 hours after transduction and ApoAlert DNA Fragmentation Assay Kit (BD Biosciences) was used to detect DNA breaks according to the manufacturer's instructions.

Dual Luciferase Assay. HEK 293 cells (5 x 104) were plated on 12-well plastic plates (Falcon) coated with fibronectin (10 μg/cm2). Cells were transiently co- transfected at 60% confluence with 500 ng of p53 -responsive luciferase constructs (Clontech), 500 ng JgI icd or insertless-vector control. One hundred ng of Renilla-SV40 construct (Promega), was utilized as an internal control for transfection efficiency. FuGene (Roche) was used as a transfection reagent. Three individual assays, each in triplicate, were performed. The ratio of luciferase to Renilla activity was determined using Dual-Luciferase Reporter Assay System (Promega) 36-48 hours following the transient transfection.

Experimental Example 1: Piled induces a senescent-like phenotype.

It was demonstrated that the Delta protein of Drosophila is cleaved in its extracellular domain at 58 IA, 593A and at a third unidentified site located in the transmembrane or icd domain. These cleavages were enhanced in cocultures of Delta- expressing cells with Notch-expressing cells (Bland et al., 2003, J. Biol. Chem. 278:13607- 10; Mishra-Gorur et al., 2002, J. Cell Biol. 159:313-24). Similar proteolytic cleavages were also reported for mammalian Deltal (Ikeuchi et al., 2003, J. Biol. Chem. 278:7751-4; LaVoie et al., 2003, J. Biol. Chem. 278:34427-37). Cleavage of human Deltal was demonstrated in its transmembrane domain at 565VVV567 site (Ikeuchi et al., 2003, J. Biol. Chem. 278:7751- 4). A search for functional domains in mammalian Dl lied revealed the presence of two potential NLS and a PDZ binding site (Pfister et al., 2003, J. MoI. Biol. 333:229-35; Six et al., 2004, J. Biol. Chem.). Moreover Dllicd, when fused to DNA binding domain of Gal4, upregulated the activity of the luciferase reporter 70 times (Ikeuchi et al., 2003, J. Biol. Chem. 278:7751-4), suggesting a potential role of Dllicd in nuclear signaling events. Intrigued by these findings, the biological effect of mammalian Dllicd was investigated. A fragment of human Deltal was cloned, encompassing amino acids 569-723 (NM__005618) in pcDNA3.1-Zeo vector (Invitrogen), and transfected NIH 3T3 cells for further selection of cells stably expressing Dllicd. Surprisingly unlike full length Deltal (flDll) and sDll transfectants (Trifonova et al., 2004, J. Biol. Chem. 279:13285-8), cells transfected with Dl lied failed to form colonies. Instead, Dl lied transfectants assumed morphology reminiscent of senescent fibroblasts: large, wellspread cells with hypertrophic cytoplasm (Fig. 1). Since clones of stable Dl lied transfectants did not arise and the efficiency of transient transfection was not high enough, the adenoviral construct was prepared for Dl lied expression. Transduction of NIH 3T3 and HUVEC with Dl lied adenovirus resulted in a morphologically senescentlike phenotype (Fig. IA).

To further evaluate the status of Dllicd-transduced cells, the expression of β- galactosidase was assessed active at pH 6, a common biomarker of senescent cells (Dimri et al., 1995, Proc. Natl. Acad. Sci. USA 92:9363-7). Dllicd transduction induced the activity of acidic β-galactosidase in HUVEC. Four days after transduction, most of the cells were acidic β-galactosidase positive (Fig. IB). The growth of Dllicd-transduced HUVEC stopped; and cells remained viable and non-proliferating for at least 2 months (data not shown).

To investigate the effect of Dllicd expression on the proliferation of endothelial cells, the ability of Dllicd to inhibit DNA synthesis in HUVEC was assessed. To this end, Dllicd-transduced and control LacZ-transduced HUVEC were labeled with 3H- thymidine 48 hours after transduction for a period of 16 hours. The expression of Dllicd resulted in the inhibition of DNA synthesis. Only 20% of the transduced cells were labeled in contrast to 85% of LacZ-transduced cells (Fig. 1C).

Progression through the cell cycle is controlled by a group of cyclin dependent kinases (cdk). Their activities are negatively regulated by specific inhibitory proteins (Miele, 2004, Methods MoI. Biol. 285:3-21). It was demonstrated that the levels of cdk inhibitors p21 and p27 were strongly increased in senescent HUVEC, which results in the disappearance of cyclin A (Wagner et al., 2001, Exp. Gerontol. 36:1327-47). At the same time, normal levels of cyclins E and Dl were observed in senescent HUVEC (Wagner et al., 2001, Exp. Gerontol. 36:1327-47). To further study the molecular basis of Dllicd induced cell growth arrest, the expression of p21 and p27 was assayed. Western blot analysis revealed significant induction of p21 and p27 expression in HUVEC transduced with Dllicd (Fig. 2).

Proliferating cells in the Gl phase contain increased levels of cyclin Dl and cyclin E. On the other hand, cells in the late Gl, S, and G2 phases contain increased levels of cyclin A, which is essential for both S phase entry and the G2/M transition (Sherr et al., 2004, Genes Dev. 18:2699-711). Significant decreases in cyclin A and cyclin E expressions were detected in Dllicd-expressing cells 48 hours after adenoviral transduction (Fig. 2). At the same time, the expression of cyclin Dl in Dllicd-transduced cells was not changed. Interestingly, lower molecular weight bands were observed for cyclin A at 25 IdDa (in addition to the expected 55 IcDa band), and for cyclin E at 48 IcDa (in addition to the 57 IcDa band). Both were not detected in insertless vector-transduced cells, suggesting that Dl lied expression induced proteolytic degradation of cyclin A and cyclin E.

MAP kinase signaling is crucial for regulation of endothelial cell differentiation, proliferation and survival. Moreover, growth factor stimulation induces the expression of Notch and Jagged in an ERK-dependent fashion (Matsumoto et al., 2002, J. Cell Biol. 156:149-60). Therefore, the effect of DI lied on ERK1/2 phosphorylation was examined. As demonstrated in Fig. 2, no difference in the levels of phosphorylated ERK1/2 was observed between DIl icd- and LacZ-expressing endothelial cells.

To summarize, Dllicd-expressing cells exhibit a biochemical phenotype reminiscent of senescent HUVEC (Andreeva et al., 2004, Euro. J. of Cell Biol. 327-335; Garfinkel et al., 1996, J. Cell Biol. 134:783-91; Wagner et al., 2001, Exp. Gerontol. 36:1327- 47) as illustrated by the upregulation of p21 and p27, downregulation of cyclins A and E, normal levels of ERKl/2 phosphorylation, cyclin Dl expression, and induction of acidic β-galactosidase activity. The downregulation of cyclins A and E in Dllicdexpressing cells is apparently due to the proteolytic cleavage of these proteins. Interestingly, senescent HUVEC exhibit cleavage of cyclin A but not cleavage of cyclin E (Andreeva et al., 2004, Euro. J. of Cell Biol. 327-335).

Unlike Dllicd-transduced HUVEC, which drastically decrease proliferation 2 days after transduction, senescent HUVEC become growth arrested after 50-60 replicative doublings in vitro. It is generally accepted that cells senesce because they acquire one or more short dysfunctional telomeres (Bodnar et al., 1998, Science 279:349-52). Telomere shortening is an inevitable consequence of the biochemistry of DNA replication and the lack of telomerase expression in most somatic cells. Indeed, ectopic expression of telomerase confers an indefinite replicative life span (replicative immortality) to a variety of normal human cells without inducing significant genomic instability (Bodnar et al., 1998, Science 279:349-52). Recently the transcriptional repressor, Bmil, was demonstrated to activate telomerase in human epithelial cells (Dimri et al., 2002, Cancer Res. 62:4736-45) and fibroblasts (Itahana et al., 2003, MoI. Cell. Biol. 23:389-401), thus extending their replicative life spans. The expression of Bmil was demonstrated to be necessary for self-renewal of stem cells (Park et al., 2004, J. Clin. Invest. 113:175-9). Rapid telomere shortening was reported to occur with some forms of cell stress such as oxidative stress and metabolic perturbations (Ben-Porath et al., 2004, J. Clin. Invest. 113:8-13). Therefore, the TRAP method (Roche kit) and RT-PCR were used to compare respectively telomere length and the expression of Bmil in HUVEC transduced with Dl lied and LacZ. No significant difference in telomere length or expression of Bmil was observed between Dl lied- and LacZ-transduced cells.

Experimental Example 2: Inactivation of Dl lied NLS does not abolish its anti-proliferative effect.

Recent studies demonstrated nuclear localization of Drosophila Delta icd (Bland et al., 2003, J. Biol. Chem. 278:13607-10). To evaluate the ability of mammalian Dl lied to localize into the nucleus, HEK 293 cells were transiently transfected with C- terminally Myc-tagged human flDll and N-terminally V5-tagged Dl lied. Confocal microscopy analysis using the anti-Myc antibody demonstrated cytoplasmic distribution of flDll. Conversely, Dl lied was found both in the nuclei and cytoplasm of transduced cells. Analysis of the amino acid sequence of Dl lied reveals two potential NLS domains - 575KHRPP579 and 689RKRPP692. To investigate the functionality of Dl lied NLS sequences and their importance for Dl lied biological effect, a series of mutants were prepared: in Dllicd-nlsl, amino acids 575KHRPP579 were mutated to KHAP; and in Dllicd- nls2, amino acids 689RKRPP692 were mutated to QRP. In DllicdnlsDM (double mutant), both hypothetical NLS in Delta 1 were mutated as described above. While both Dllicd-nlsl and Dllicd-nls2 exhibited nuclear and cytoplasmic localization similarly to wild type Dl lied, Dllicd-nlsDM was detected exclusively in the cytoplasm of transfected cells (Fig. 3B). The autoradiographic studies of DNA synthesis in transiently transfected HEK 293 cells demonstrated that when one or both of the Delta's NLSs were mutated, the percentage of labeled nuclei was similar to that in the cells transduced with wild type Dl lied, approximately 25-35% (Fig. 3C), i.e., 3 times lower than in cells transfected with LacZ.

Experimental Example 3: Jg lied induces apoptosis.

Since (i) Jaggedl and Deltal are both reported to undergo a cleavage resulting in production of a membrane unbound icd (LaVoie et al., 2003, J. Biol. Chem. 278:34427- 37); (ii) previous experiments demonstrated differences between phenotypes induced by the extracellular domains of Jaggedl and Deltal ligands in NIH 3T3 cells (Small et al., 2001, J. Biol. Chem. 276:32022-30; Trifonova et al., 2004, J. Biol. Chem. 279:13285-8) #1226}; and (iii) Jaggedl and Deltal display considerable differences in their expression patterns during embryonic and postnatal development (Irvin et al., 2004, J. Neurosci. Res. 75:330-43), the biological effect of Jg lied expression on cell phenotype was investigated. To this end, an adenoviral construct was prepared for the expression of Jglicd, comprising amino acids 1088-1218 (NM_000214), and infected HUVEC and NIH 3T3 cells. In contrast to Dllicd, it was found that both cell types, which normally grew as a tightly adherent monolayer, assumed a rounded shape and became detached 16-24 hours after Jglicd transduction. These morphological changes were not observed in control LacZ-transduced cells, which led us to suggest that the expression of Jglicd results in apoptosis.

One of the earliest indications of apoptosis is the translocation of phosphatidylserine from the inner to the outer leaflet of the plasma membrane where it binds the Annexin V-FITC conjugate (Vermes et al., 1995, J. Immunol. Methods 184:39-51). To detect apoptotic cell death, flow cytometry of AnnexinV-stained Jglicd or LacZ adenovirally transduced HUVEC was used. Sixteen hours after transduction, 29% of Jglicd-expressing cells and only 1% of LacZ control stained positively with AnnexinV-FITC (Fig. 4A). Not surprisingly, when cells were stained with a DNA-specific fluorochrome, propidium iodide, 18.9% of the cells were detected as late apoptotic cells or debris (Fig. 4B). In addition, the ability of Jglicd and LacZ-transduced cells to intake 7-amino-actinomycin D (7- AAD) was examined. As shown in Fig. 4A, 43% of cells expressing Jglicd, and only 5% of control LacZ cells became permeable to 7-AAD 16 hours after transduction.

Programmed cell death is accompanied by cardinal morphological changes including cellular shrinkage and membrane blebbing, while organelle structures are usually preserved intact except for the nucleus which undergoes a characteristic condensation of chromatin (Bianchi et al., 2004, Biochim. Biophys. Acta. 1677:181-6). To further study the proapoptotic effect of Jglicd, Jglicd-transduced HUVEC were stained with DNA-binding dye TO-PRO-3 and visualized morphological changes in the nuclei of apoptotic cells using confocal fluorescence microscopy. In contrast to control cells, the nuclei of Jglicd- transduced cells possessed highly condensed chromatin that was uniformly stained or took the form of crescents at the periphery of the nucleus, or the entire nucleus appeared as a group of featureless bright spherical beads (Fig. 4D). Since the expression of Jglicd resulted in cell detachment, the status of the actin cytoskeleton and cell adhesions by using specific staining for F-actin and vinculin, a component of focal adhesion sites (FAS). A prominent reduction of FAS was demonstrated in Jglicd-expressing cells (Fig. 4D). In addition, fluorescent staining of F-actin fibers with FITC conjugate of phalloidin revealed a significant reduction of these structures. While normal HUVEC displayed well-oriented actin stress fibers typical for adherent cells, apoptotic cells had disorganized actin cytoskeletal fibers concentrated at the cell periphery (Fig. 4D). Apoptosis involves complex molecular cascades; and dysfunction of a variety of genes may lead to the onset and progression of apoptosis. The tumor suppressor protein, p53, is one of the major components of cellular response to genotoxic stress. Its activation is related to apoptosis or Gl cell cycle arrest (Sigal et al., 2000, Cancer Res. 60:6788-93). To evaluate the participation of p53 in Jglicd-induced apoptosis, the ability of Jglicd to activate the transcription of a reporter gene driven by a p53-responsive promoter was examined. To this end, easily transfectable HEK 293 cells were transiently co-transfected with Jglicd in pcDNA vector and a p53 -responsive element luciferase construct. As shown in Fig. 4C, transient expression of Jlicd in HEK 293 cells increased the levels of p53 reporter expression more than two times. These data demonstrate that Jglicd may induce a p53-dependent mechanism of apoptosis. During apoptosis, cellular endonucleases cleave nuclear DNA between nucleosomes producing a mixture of DNA fragments. To detect DNA fragmentation, the TUNEL approach was used (Gavrieli et al., 1992, J. Cell Biol. 119:493- 501). Jglicd transduction in HUVEC resulted in labeling of a vast majority of nuclei (more than 70%), while less than 10% positive nuclei were found in LacZ-transduced cells (Fig. 4E).

Experimental Example 4: Constitutively Active Notchl abrogates Jglicd- and Dllicd- induced phenotypes.

Because many cells co-express Notch receptor with Jagged 1 or/and Deltal ligands, and ligand-activated Notch cleavage results in the production of the soluble intracellular fragment of Notch, it was examined whether Nlicd interferes with the biological effects of Dl lied and Jglicd. To this end, HUVEC were transduced with Nlicd-adenovirus 16 hours prior to Dllicd or Jglicd adenoviral transductions. Expression of Nlicd abrogated the Dllicd-induced senescence-like phenotype. The abrogation was manifested by prevention of the expression of acidic β-galactosidase and proliferation blockage (Fig. 5A and B). Nlicd was also able to halt apoptosis in Jglicd-expressing cells (Fig. 5C). Interestingly, HUVEC express Notchl, Jaggedl, Deltal, and glycosyltransferase Lunatic Fringe (LFng) that is known to potentiate the interaction between Notchl and Deltal and to prevent Notchl interaction with Jaggedl (Haines et al., 2003, Nat. Rev. MoI. Cell Biol. 4:786-97). Apparently the ability of HUVEC to proliferate is maintained due to the simultaneous production of Nlicd and Dllicd, which is a result of the efficient interaction promoted by LFng activity. According to the present model of Notch signaling, Delta or Jagged ligands activate Notch receptor in the neighboring cell (Radtke et al., 2003, Nat. Rev. Cancer 3:756- 67). Recent publications suggest that Notch ligands exhibit bidirectional signaling (Ikeuchi et al., 2003, J. Biol. Chem. 278:7751-4; LaVoie et al., 2003, J. Biol. Chem. 278:34427-37). To elucidate a possible intracrine function of Deltal and Jaggedl ligands, adenoviral constructs coding for their icd domains were prepared and transduced into HUVEC. This approach revealed that Dl lied caused a senescent-like phenotype and Jglicd-induced apoptosis.

As a result of telomere shortening, HUVEC adopt the senescent phenotype after 60-70 population doublings in culture and stain positively for acidic β-galactosidase, a common senescence biomarker (Dimri et al., 1995, Proc. Natl. Acad. Sci. USA 92:9363-7). Dl lied promptly induced the expression of acidic β-galactosidase and a remarkable increase in cell size without interfering with telomere length. Expression of Dl lied also elevated the expression of cdk inhibitors p21 and p27. p21 was isolated initially from senescent cells where its expression levels were high, paralleling their loss of proliferative capacity (Nakanishi et al., 1995, J. Biol. Chem. 270:17060-3). In mice, p21 expression correlates with differentiation of various tissues including muscle and intestine epithelium (el-Deiry, 1998, Curr. Top Microbiol. Immunol. 227:121-37). The p27 protein accumulates in quiescent cells; and its expression levels increase in response to contact inhibition and treatment with TGFβ and cAMP, implying that p27 may be a critical component controlling the cell cycle in response to extracellular signals (Sherr et al., 2004, Genes Dev. 18:2699-711). These results suggest that Dl lied can transcriptionally regulate the expression of p21 and p27, thus inducing a senescent-like phenotype in HUVEC. Interestingly, the expression of constitutively active Notch 1 prevented the Dllicd-induced phenotype in HUVEC.

Unlike Dl lied, Jg lied causes programmed cell death, as reported by AnnexinV binding and intake of 7-AAD. Jglicd-expressing cells also displayed other phenotypic changes characteristic for apoptosis, such as nuclear fragmentation, attenuation of actin cytoskeleton and FAS, as well as DNA damage. Nl icd co-expression abolished the proapoptotic effect of Jg lied.

Dl lied and Jg lied contain respectively two and one hypothetical NLS and functional PDZ binding sites. It was demonstrated that mammalian Deltal bound the PDZ proteins, Acvrinpl, Dlgl, and MAGI (Pfister et al., 2003, J. MoI. Biol. 333:229-35; Six et al., 2004, J. Biol. Chem.). PDZ proteins usually contain 3 or more PDZ domains that bind several different proteins, thus serving as docking sites for multiprotein interactions. These results suggest that the interaction of Delta with PDZ proteins is important for the formation of multiprotein complexes, which is important for Delta signaling function(s). These complexes may also include proteins that are able to modify Delta by cleavage or phosphorylation. The ability of Dl lied to increase the activity of the DNA-binding domain of GaW (Ikeuchi et al., 2003, J. Biol. Chem. 278:7751-4) indicates that Dl lied possesses transcriptional activation properties; and this also indicates that the induction of the senescent-like phenotype is connected to its nuclear localization. Through the use of point mutants, the existence of two functional NLSs in Dl lied was demonstrated herein. The presence of two NLSs in Deltal is not surprising. Very often proteins with nuclear function possess more than one NLS, for instance Notchl has two NLSs vital for its function (Kopan et al., 1994, Development 120:2385-96). Surprisingly, the double NLS mutant of Dllicd still blocked DNA synthesis in HEK 293 cells. This observation suggests that Dllicd-induced senescent-like phenotype is probably mediated through an unknown cytoplasmic partner of Deltal . To date, there is no data in the literature suggesting a DNA-binding function of Dllicd or Jglicd. Moreover Jg lied' s ability to activate an API responsive element is not related to its nuclear localization (LaVoie et al., 2003, J. Biol. Chem. 278:34427-37).

Notch signaling determines the fate of many cell types through regulation of cell proliferation, differentiation, or apoptosis (Artavanis-Tsakonas et al., 1999, Science 284:770-6); and this regulation depends on tissue context. Kornblum and co-authors (Irvin et al., 2004, J. Neurosci. Res. 75:330-43) demonstrated that Notchl is expressed exclusively within zones of cellular proliferation in the developing central nervous system, particularly in the ventricular and subventricular germinal zones. In contrast, Jagged 1 and Deltal were found primarily in the periventricular zones. In the developing Drosophila wing, activation of Notch results in direct up-regulation of cell proliferation without affecting cell fate determination (Baonza et al., 2000, Proc. Natl. Acad. Sci. USA 97:2609-14). In contrast, activated Notch in neural crest stem cells specifically skews stem cell differentiation toward glial lineage without affecting cell proliferation and cell renewal (Morrison et al., 2000, Cell 101:499-510). In hematopoietic cells, the expression of Notch icd results in delays of cell differentiation and diminishes the number of cells in the G0/G1 phase of the cell cycle, which suggests induction of cell proliferation (Carlesso et al., 1999, Blood 93:838-48). Interestingly, the expression of Notchl, Deltal and Jaggedl diminishes throughout development. Notch signaling plays a role at multiple steps of morphogenesis, including an early role in cell fate determination and late role in the regulation of cell proliferation and differentiation. Forced activation of Notch in injured muscles, using anti-Notch antibody, resulted in a significant increase of cell proliferation and inhibition of myogenic differentiation (Conboy et al., 2003, Science 302: 1575-7). Additionally, elevated expression of Delta in satellite muscle cells was observed at the sites of skeletal muscle injury (Conboy et al., 2003, Science 302:1575-7). The results set forth herein for the first time suggest that in damaged muscle the signaling through Notch is essential for cell proliferation and renewal; and signaling through Delta plays a role in subsequent cell differentiation. Although Jagged and Delta ligands may be expressed in the same cell type, for instance in neuroprogenitor cells (Irvin et al., 2004, J. Neurosci. Res. 75:330-43) and mouse embryonic endothelial cells (Itoh et al., 2004, Embo. J. 23:541-51), there is also evidence of their differential expression (Lindner et al., 2001, Am. J. Pathol. 159:875-83). Interestingly, the expression of Notchl overlaps the expression patterns of Jaggedl and Deltal (Artavanis-Tsakonas et al., 1995, Science 268:225-32; Kimble et al., 1997, Annu. Rev. Cell. Dev. Biol. 13:333-61; Muskavitch, 1994, Dev. Biol. 166:415-30; Weinmaster et al., 1997, MoI. Cell Neurosci. 9:91-102). In the experiments detailed herein, the co-expression of N lied rescued the cells from apoptosis and senescent-like phenotype induced respectively by Jglicd and Dl lied, which strengthens the hypothesis that Notch signaling is bidirectional; and the cleavage of Delta and Jagged is not simply a mechanism for their downregulation (Mishra-Gorur et al., 2002, J. Cell Biol. 159:313-24). In order for proper signaling to occur, there must be a distinction between a signaling cell versus a receiving cell. It appears also that a precise equilibrium between Notch and Jagged or Delta signaling is necessary. In addition, Notch signaling is moderated by Fringe fucosyltransferase, which is one of the major players in the process of tissue boundary formation during embryonic development (Haines et al., 2003, Nat. Rev. MoI. Cell Biol. 4:786-97). Fringe highly potentiates the interaction between Notch and Delta; and Fringe perturbs Notch - Jagged interaction (Haines et al., 2003, Nat. Rev. MoI. Cell Biol. 4:786-97). Based on the observations that Jglicd induces cell death and Dl lied - a senescent-like phenotype, the data suggests that Jglicd and Dl lied play a role in developing organisms is related to cell synchronization, tissue sculpting and repair. In this scenario, at least three hypothetical situations may exist: i) when a cell expressing Jagged or Delta and Notch is surrounded by similar cells, the signals conducted through ligand and receptor are balanced and normal tissue homeostasis is maintained; ii) when signaling through Notch is downregulated, e.g., by Numb (Pece et al., 2004, J. Cell Biol. 167:215-21), ligand signaling dominates over Notch signaling and cells stop proliferating (Dl lied) or undergo apoptosis (Jglicd); iii) when Notch activation by Delta from a neighbouring cell is potentiated by Fringe, the balance of signaling through Notch receptors and ligands is skewed and cell proliferation is upregulated. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.

While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMSWhat is claimed:

1. An isolated nucleic acid encoding a Jagged 1 intracellular domain (JgI icd) polypeptide comprising the sequence from nucleotide 3264 to nucleotide 3657 of SEQ ID NO:1, wherein said isolated nucleic acid does not comprise full-length Jaggedl.

2. A vector comprising the isolated nucleic acid of claim 1.

3. An isolated nucleic acid encoding a Jg lied polypeptide consisting of the sequence from nucleotide number 3264 to nucleotide 3657 of SEQ ID NO:1.

4. A vector comprising the isolated nucleic acid of claim 3.

5. An isolated chimeric nucleic acid encoding a tag polypeptide covalently linked to a Jglicd polypeptide, wherein said Jglicd polypeptide is encoded by a nucleic acid sequence comprising the sequence from nucleotide number 3264 to nucleotide number 3657 of SEQ ID NO:1, wherein said isolated nucleic acid does not comprise full- length Jaggedl.

6. The isolated nucleic acid of claim 5, wherein said tag polypeptide is selected from the group consisting of a myc tag polypeptide, a myc-pyruvate kinase tag polypeptide, a glutathione-S-transferase tag polypeptide, a maltose binding tag polypeptide, green fluorescence protein tag polypeptide, an alkaline phosphatase tag polypeptide, a His6 tag polypeptide, an influenza virus hemagglutinin tag polypeptide, and a maltose binding protein tag polypeptide.

7. The isolated nucleic acid of claim 6, wherein said tag polypeptide is a myc tag polypeptide.

8. An isolated nucleic acid comprising a promoter/regulatory sequence operably linked to a nucleic acid encoding a Jglicd polypeptide, wherein said Jglicd polypeptide is encoded by a nucleic acid sequence comprising the sequence from nucleotide number 3264 to nucleotide number 3657 of SEQ ID NO:1, wherein said isolated nucleic acid does not comprise full-length Jaggedl.

9. A recombinant cell comprising the isolated nucleic acid of claim 1.

10. A recombinant cell comprising the isolated nucleic acid of claim 3.

11. A pharmaceutical composition comprising a therapeutically effective amount of an isolated nucleic acid encoding a JgI icd polypeptide, wherein said isolated nucleic acid comprises the sequence from nucleotide number 3264 to nucleotide number 3657 of SEQ ID NO:1, wherein said isolated nucleic acid does not comprise full-length Jaggedl, in a pharmaceutically acceptable carrier.

12. An isolated Jglicd polypeptide comprising the sequence from amino acid residue 1088 to amino acid residue 1218 of SEQ ID NO:2, wherein said isolated polypeptide does not comprise full-length Jaggedl.

13. The isolated Jglicd polypeptide of claim 12, wherein said polypeptide further comprises a tag polypeptide covalently linked to said Jglicd polypeptide.

14. An isolated Jglicd polypeptide consisting of the sequence from amino acid residue 1088 to amino acid residue 1218 of SEQ ID NO:2.

15. An isolated nucleic acid encoding a Deltal intracellular domain (Dl lied) polypeptide comprising the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3, wherein said isolated nucleic acid does not comprise full- length Deltal .

16. A vector comprising the isolated nucleic acid of claim 15.

17. An isolated nucleic acid encoding a Dl lied polypeptide consisting of the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3.

18. A vector comprising the isolated nucleic acid of claim 17.

19. An isolated chimeric nucleic acid encoding a tag polypeptide covalently linked to a Dl lied polypeptide, wherein said Dl lied polypeptide is encoded by a nucleic acid sequence comprising the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO.3, wherein said isolated nucleic acid does not comprise full- length Delta 1.

20. The isolated nucleic acid of claim 19, wherein said tag polypeptide is selected from the group consisting of a myc tag polypeptide, a myc-pyruvate kinase tag polypeptide, a glutathione-S -transferase tag polypeptide, a maltose binding tag polypeptide, green fluorescence protein tag polypeptide, an alkaline phosphatase tag polypeptide, a His6 tag polypeptide, an influenza virus hemagglutinin tag polypeptide, and a maltose binding protein tag polypeptide.

21. The isolated nucleic acid of claim 20, wherein said tag polypeptide is a myc tag polypeptide.

22. An isolated nucleic acid comprising a promoter/regulatory sequence operably linked to a nucleic acid encoding a Dl lied polypeptide, wherein said Dl lied polypeptide is encoded by a nucleic acid sequence comprising the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3, wherein said isolated nucleic acid does not comprise full-length Deltal.

23. A recombinant cell comprising the isolated nucleic acid of claim 15.

24. A recombinant cell comprising the isolated nucleic acid of claim 17.

25. A pharmaceutical composition comprising a therapeutically effective amount of an isolated nucleic acid encoding a Dl lied polypeptide, wherein said isolated nucleic acid comprises the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3, wherein said isolated nucleic acid does not comprise full-length Deltal, in a pharmaceutically acceptable carrier.

26. An isolated Dl lied polypeptide comprising the sequence from amino acid residue 569 to amino acid residue 723 of SEQ ID NO.4, wherein said isolated polypeptide does not comprise full-length Deltal.

27. The isolated Dl lied polypeptide of claim 26, wherein said polypeptide further comprises a tag polypeptide covalently linked to said Dl lied polypeptide.

28. An isolated Dl lied polypeptide consisting of the sequence from amino acid residue 569 to amino acid residue 723 of SEQ ID NO.4.

29. A method of inhibiting or preventing angiogenesis in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a Jglicd polypeptide, wherein said polypeptide inhibits or prevents angiogenesis.

30. A method of inhibiting or preventing angiogenesis in a subject in need thereof, said method comprising the steps of: a. administering to said subject a therapeutically effective amount of an isolated nucleic acid encoding a Jglicd polypeptide to a cell, said isolated nucleic acid comprising the sequence from nucleotide number 3264 to nucleotide number 3657 of SEQ ID NO.l, wherein said isolated nucleic acid does not comprise full-length Jaggedl; and b. expressing Jglicd polypeptide therefrom; wherein the expression of said polypeptide inhibits or prevents angiogenesis.

31. A method of inhibiting or preventing angiogenesis in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a Dl lied polypeptide, wherein said polypeptide inhibits or prevents angiogenesis.

32. A method of inhibiting or preventing angiogenesis in a subject in need thereof, said method comprising the steps of: a. administering to said subject a therapeutically effective amount of an isolated nucleic acid encoding a Dl lied polypeptide to a cell, said isolated nucleic acid comprising the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3, wherein said isolated nucleic acid does not comprise full-length Deltal; and b. expressing Dllicd polypeptide therefrom; wherein the expression of said polypeptide inhibits or prevents angiogenesis.

33. A method of inducing apoptosis in a cell, said method comprising the step of administering to said cell a JgI icd polypeptide, wherein said JgI icd polypeptide induces apoptosis in said cell.

34. A method of inducing apoptosis in a cell, said method comprising the steps of: a. administering an isolated nucleic acid encoding a JgI icd polypeptide to a cell, said isolated nucleic acid comprising the sequence from nucleotide number 3264 to nucleotide number 3657 of SEQ ID NO:1, wherein said isolated nucleic acid does not comprise full-length Jagged 1; and b. expressing said polypeptide therefrom; further wherein said expressed polypeptide induces apoptosis in said cell.

35. A method of inducing senescent-like phenotype in a cell, said method comprising the step of administering to said cell a Dl lied polypeptide, wherein said Dl lied polypeptide induces senescent-like phenotype in said cell.

36. A method of inducing a senescent-like phenotype in a cell, said method comprising the steps of: a. administering an isolated nucleic acid encoding a Dl lied polypeptide to a cell, said isolated nucleic acid comprising the sequence from nucleotide number 1704 to nucleotide number 2172 of SEQ ID NO:3, wherein said isolated nucleic acid does not comprise full-length Deltal; and b. expressing said polypeptide therefrom; further wherein said expressed polypeptide induces a senescent-like phenotype in said cell.

37. A method of inhibiting or preventing a Dllicd-induced senescent-like cell phenotype, said method comprising the step of administering to said cell a Notch Intracellular Domain (N lied) polypeptide, wherein said Nl icd polypeptide modulates the antiproliferative activity of Dl lied, thereby inhibiting or preventing a senescent-like phenotype in a cell.

38. A method of inhibiting or preventing a senescent-like phenotype in a cell, said method comprising the steps of: a. administering to a subject in need of such inhibition or prevention a therapeutically effective amount of an isolated nucleic acid encoding a Nlicd polypeptide to a cell; and b. expressing N 1 icd polypeptide therefrom; wherein said expressed polypeptide interacts with a Dl lied, thereby inhibiting or preventing a senescent-like phenotype in said cell.

39. A method of inhibiting or preventing Jglicd-induced apoptosis in a cell, said method comprising the step of administering to said cell a Notch Intracellular Domain (Nlicd) polypeptide, wherein said polypeptide modulates said Jglicd-induced apoptosis, thereby inhibiting or preventing apoptosis in said cell.

40. A method of inhibiting or preventing a senescent-like phenotype in a cell, said method comprising the steps of: a. administering to a subject in need of such inhibition or prevention a therapeutically effective amount of an isolated nucleic acid encoding a Nlicd polypeptide to a cell (, said isolated nucleic acid comprising the sequence from nucleotide number XX to nucleotide number YY of SEQ ID NO: 5, wherein said isolated nucleic acid does not comprise full-length Notch); and b. expressing N 1 icd polypeptide therefrom; wherein said expressed polypeptide interacts with a Jg lied, thereby inhibiting or preventing apoptosis in said cell.