WO2006124358A2 - Methode de traitement d'une infection a coccidioides consistant a administrer un compose d'ambruticine - Google Patents

Methode de traitement d'une infection a coccidioides consistant a administrer un compose d'ambruticine Download PDF

Info

Publication number
WO2006124358A2
WO2006124358A2 PCT/US2006/017671 US2006017671W WO2006124358A2 WO 2006124358 A2 WO2006124358 A2 WO 2006124358A2 US 2006017671 W US2006017671 W US 2006017671W WO 2006124358 A2 WO2006124358 A2 WO 2006124358A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
ambruticin
formula
cycloalkyl
alkyl
Prior art date
Application number
PCT/US2006/017671
Other languages
English (en)
Other versions
WO2006124358A3 (fr
Inventor
Leonard Katz
C. Richard Hutchinson
Zong-Qiang Tian
David C. Myles
Zhan Wang
Original Assignee
Kosan Biosciences Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US11/305,802 external-priority patent/US20070015823A1/en
Application filed by Kosan Biosciences Incorporated filed Critical Kosan Biosciences Incorporated
Publication of WO2006124358A2 publication Critical patent/WO2006124358A2/fr
Publication of WO2006124358A3 publication Critical patent/WO2006124358A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone

Definitions

  • This invention relates to the treatment of diseases and conditions caused by Coccidioides spp. infection by the administration of ambruticin compounds.
  • Coccidioidomycosis also known as Valley Fever and Desert Fever
  • arthroconidia spores
  • Coccidioides immitis spores
  • Coccidioides posadasii spores
  • Approximately 100,000 infections occur annually in the United States (Chiller et ah, (2003) Coccidioidomycosis. Infect. Dis. Clin. N. Am. 17, 41-57, viii).
  • Coccidioidomycosis has a high morbidity rate as about 40% of infected individuals become symptomatic.
  • Ambruticin S (also referred to as Acid S, W 7783, (5S, ⁇ 5i?)-5,6-dihydroxypoly- angioic acid, or, sometimes, simply as ambruticin) is an antifungal compound isolated from cultures of Polyangium cellulosum var.fulvum and has the structure shown below. See Strandtmann et al, US 3,804,948 (1974); Barnes et al, Tetrahedron Letters 22 (18), 1751- 1754 (1981); Kende et al, J. Am. Chem. Soc. 112 (26), 9645-9646 (1990).
  • Ambruticin S is reportedly orally effective in the treatment of experimental acute pulmonary coccidioidomycosis in mice
  • the present invention provides methods for treating a Coccidioides infection using an ambruticin.
  • This invention provides a method for treating or reducing the probability of a Coccidioides infection in a subject in need of such treatment or reduction of probability, comprising administering to such subject a therapeutically effective amount of a compound represented by formula I:
  • R 10 and R 11 are independently H or CH 3 ;
  • X 1 is either a bond or O;
  • X 2 and X 3 are each H or together are a bond;
  • R 2 and R 3 are independently H, C 1 -C 5 alkyl, C 2 -C 5 alkenyl, C 2 -C 5 alkynyl, cycloalkyl,
  • R 4 is H, ⁇ Y , or ⁇ Y % R 9 ; or R 3 and R 4 combine to form ⁇ ; O O O
  • R 5 is, independently for each occurrence thereof, H, C 1 -C 5 alkyl, C 2 -C 5 alkenyl, C 2 -C 5 alkynyl, cycloalkyl, or aryl;
  • R 6 and R 7 are independently H, C 1 -C 5 alkyl, C 2 -C 5 alkenyl, C 2 -C 5 alkynyl, cycloalkyl, or aryl; or R 6 and R 7 and the nitrogen to which they are commonly bonded combine to form an aziridinyl, azetidinyl, pyrrolidinyl, or piperidinyl ring;
  • R is R or R 5 Y ; O
  • R 9 is, independently for each occurrence thereof, H, C 1 -C 5 alkyl, C 2 -C 5 alkenyl, C 2 -C 5 alkynyl, cycloalkyl, 8TyI(C 1 -C 5 alkyl), aryl(C 2 -C 5 alkenyl), aryl(C 2 -C 5 alkynyl), cycloalkyl(Ci-C 5 alkyl), cycloalkyl(C 2 -C 5 alkenyl), or cycloalkyl(C 2 -C 5 alkynyl), provided that R 9 is not H when Z is O; R 12 and R 13 together are O, or R 12 is H and R 13 is R 5 ; Y is O or N-OR 5 ; and Z is, independently for each occurrence thereof, O or NH. [0011 ] This invention also provides for the use of the compound of formula I for the preparation of a medicament for treating a Coccidioides infection.
  • This invention also provides for the method such that the growth of the Coccidioides spp. is inhibited.
  • the inhibition of the Coccidioides spp. includes the reduction in the growth of the Coccidioides spp.
  • the reduction of growth includes one or more of the following: a decrease in the growth of individual Coccidioides cells, a decrease in the rate of cell division of individual Coccidioides cells, and the killing of individual Coccidioides cells.
  • This invention also provides for the method such that the subject is cleared of a Coccidioides infection, or is relieved of a symptom caused by a Coccidioides infection.
  • This invention also provides for the method such that the subject, who but for the administering of the pharmaceutical composition to the subject avoids a Coccidioides infection.
  • Fig. 1 is an alignment map for two different ambrutin polyketide synthase (PKS) acyltransferase (AT) domains, used in homologous recombination experiments described in Example 23 hereinbelow.
  • PPS ambrutin polyketide synthase
  • AT acyltransferase
  • Alkyl means an optionally substituted straight or branched chain hydrocarbon moiety having the specified number of carbon atoms in its longest chain portion (e.g., as in “C 3 alkyl,” “C 1 -C 5 alkyl,” or “C 1 to C 5 alkyl,” the latter two phrases referring to an alkyl group having from 1 to 5 carbon atoms in the longest chain portion) or, where the number of carbon atoms is not specified, from 1 to 4 carbon atoms in the longest chain portion.
  • Alkenyl means an optionally substituted straight or branched chain hydrocarbon moiety having at least one carbon-carbon double bond and the specified number of carbon atoms in its longest chain portion (e.g., as in “C 3 alkenyl,” “C 2 -C 5 alkenyl,” or “C 2 to C 5 alkenyl,” the latter two phrases referring to an alkenyl group having from 2 to 5 carbon atoms in the longest chain portion) or, where the number of carbon atoms is not specified, from 2 to 4 carbon atoms in the longest chain portion.
  • Alkynyl means an optionally substituted straight or branched chain hydrocarbon moiety having at least one carbon-carbon triple bond and the specified number of carbon atoms in its longest chain portion (e.g., as in “C 3 alkenyl,” “C 2 -C 5 alkynyl,” or “C 2 to C 5 alkynyl,” the latter two phrases referring to an alkynyl group having from 2 to 5 carbon atoms in the longest chain portion) or, where the number of carbon atoms is not specified, from 2 to 4 carbon atoms in the longest chain portion.
  • Aryl means an aromatic monocyclic, fused bicyclic, or fused polycyclic hydrocarbon or heterocyclic group having 1 to 20 carbon atoms in the ring portion(s), such as phenyl, napthyl, pyrrolyl, indolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyridinyl, N-oxo-pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, tetrazinyl, triazinyl, triazolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, quinolinyl-N-oxide, isoquinolinyl, benz
  • Arylalkyl means an aryl, cycloalkyl, or biaryl group, as the case may be, bonded directly to an alkyl, alkenyl, or alkynyl moiety, as the case may be, with the open (unsatisfied) valence at the alkyl, alkenyl, or alkynyl group, for example as in benzyl, phenethyl, N-imidazoylethyl, N-morpholinoethyl, and the like.
  • Cycloalkyl means an optionally substituted, saturated or unsaturated, non- aromatic cyclic hydrocarbon ring system, preferably containing 1 to 3 rings and 3 to 7 carbons per ring which may be further fused with a saturated or unsaturated C 3 -C 7 carbocyclic ring.
  • exemplary cycloalkyl ring systems include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl, cyclododecyl, and adamantyl, especially the first four listed.
  • “Halogen” or “halo” means fluorine, chlorine, bromine or iodine.
  • Pharmaceutically acceptable ester means an ester that hydrolyzes in vivo (for example in the human body) to produce the parent compound or a salt thereof or has per se activity similar to that of the parent compound.
  • Suitable ester groups include, without limitation, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl or alkenyl moiety preferably has no more than six carbon atoms.
  • Illustrative esters include formates, acetates, propionates, butyrates, acrylates, citrates, succinates, and ethylsuccinates.
  • “Pharmaceutically acceptable salt” means a salt of a compound suitable for the pharmaceutical formulation.
  • the salt can be an acid addition salt, such as a sulfate, hydrobromide, tartrate, mesylate, maleate, citrate, phosphate, acetate, pamoate (embonate), hydroiodide, nitrate, hydrochloride, lactate, methylsulfate, fumarate, benzoate, succinate, mesylate, lactobionate, suberate, tosylate, and the like.
  • an acid addition salt such as a sulfate, hydrobromide, tartrate, mesylate, maleate, citrate, phosphate, acetate, pamoate (embonate), hydroiodide, nitrate, hydrochloride, lactate, methylsulfate, fumarate, benzoate, succinate, mesylate, lactobionate, suberate, tosylate, and the
  • the salt can be a salt such as a calcium salt, potassium salt, magnesium salt, meglumine salt, ammonium salt, zinc salt, piperazine salt, tromethamine salt, lithium salt, choline salt, diethylamine salt, 4-phenyl- cyclohexylamine salt, benzathine salt, sodium salt, tetramethylammoniuni salt, and the like.
  • a group may be substituted, for example by use of "substituted or unsubstituted” or “optionally substituted” phrasing, such group may have one or more independently selected substituents, preferably one to five in number, more preferably one or two in number.
  • substituents and substitution patterns can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be synthesized by techniques known in the art as well as the methods set forth herein.
  • suitable substituents include alkyl, alkenyl, alkynyl, aryl, halo, trifluoro- methoxy, trifluoromethyl, hydroxy, alkoxy, cycloalkyloxy, heterocyclooxy, alkanoyl, alkanoyloxy, amino, alkylamino quarternary ammonium, aralkylamino, cycloalkylamino, heterocycloamino, dialkylamino, alkanoylamino, thio, alkylthio, cycloalkylthio, heterocyclo- thio, ureido, nitro, cyano, carboxy, caroboxylalkyl, carbamyl, alkoxycarbonyl, alkylthiono, aryl
  • the substituent(s) for alkyl, alkenyl, and alkynyl moieties are from one to three in number and are independently selected from N-pyrrolidinyl, N-morpholinyl, N- azetidinyl, hydroxyl, halo, alkoxyl, cyano, amino, alkylamino, and dialkylamino, especially hydroxyl, halo, amino, and alkoxyl.
  • the substituent(s) for aryl, cycloalkyl, and heterocycloalkyl moieties are from one to three in number and are independently selected from alkyl, alkenyl, alkynyl, hydroxyalkyl, haloalkyl, hydroxyl, halo, alkoxyl, cyano, amino- alkyl, alkylaminoalkyl, dialkylaminoalkyl, amino, alkylamino, and dialkylamino.
  • “Therapeutically effective amount” means that amount of active compound(s) or pharmaceutical agent(s) that elicit the biological or medicinal response in a tissue system, animal or human sought by a researcher, veterinarian, medical doctor or other clinician, which response includes alleviation of the symptoms of the disease or disorder being treated.
  • the specific amount of active compound(s) or pharmaceutical agent(s) needed to elicit the biological or medicinal response will depend on a number of factors, including but not limited to the disease or disorder being treated, the active compound(s) or pharmaceutical agent(s) being administered, the method of administration, and the condition of the patient.
  • the stereochemistry at C5 is S.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula II
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula III:
  • R 2 , R ⁇ R , 1 i 0 ⁇ , T R, 1 1 1 1 , X vl 1 , X V 2 z and X 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 2 and R 3 are each CH 3 .
  • R 1 is
  • R 10 and R 11 are each CH 3 , X 1 is a bond, and X 2 and X 3 together are a bond, corresponding to a compound represented by formula I-A
  • the stereochemistry at C5 is S.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula H-A
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula i ⁇ -A: where R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 2 and R 3 are each CH 3 .
  • R 1 is
  • R 2 , R 3 and R 4 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 10 is H
  • R 11 is CH 3
  • X 1 is a bond
  • X 2 and X 3 together are a bond, corresponding to a compound represented by formula I-B
  • the stereochemistry at C5 is S.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula H-B where R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula III-B:
  • R 2 and R J are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R and R are each CH 3 .
  • R 1 is
  • O and C5 has S stereochemistry, corresponding to a compound represented by formula TV-B
  • R 2 , R 3 and R 4 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 10 is CH 3 , R 11 is H, X 1 is a bond, and X 2 and X 3 together are a bond, corresponding to a compound represented by formula I-C [0040]
  • the stereochemistry at C5 is S.
  • R 1 is
  • R is H, and C5 has S stereochemistry, corresponding to a compound represented by formula II-C
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula III-C:
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 2 and R 3 are each CH 3 .
  • R 1 is H 2 N ⁇ A
  • O and C5 has S stereochemistry, corresponding to a compound represented by formula IV-C
  • R 2 , R 3 and R 4 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 10 and R 11 are both CH 3 , X 1 is a bond, and X 2 and X 3 are each H, corresponding to a compound represented by formula I-D
  • the stereochemistry at C5 is S.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula H-D
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 1 is
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 2 and R 3 are each CH 3 .
  • R 1 is
  • O and C5 has S stereochemistry, corresponding to a compound represented by formula IV-D
  • R 2 , R 3 and R 4 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 10 and R 11 are both CH 3 , X 1 is O, and X 2 and X 3 together are a bond, corresponding to a compound represented by formula I-E
  • the stereochemistry at C5 is S.
  • R 1 is
  • R is H, and C5 has S stereochemistry, corresponding to a compound represented by formula H-E
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove.
  • R 1 is
  • R 4 is H, and C5 has S stereochemistry, corresponding to a compound represented by formula III-E:
  • R 2 and R 3 are as defined in the BRIEF SUMMARY OF THE INVENTION section hereinabove. hi a preferred embodiment of compounds of formula III-E, R 2 and R 3 are each CH 3 .
  • R 1 is
  • O and C5 has S stereochemistry, corresponding to a compound represented by formula IV-E
  • R 3 is other than H or CH 3 - that is, a non-naturally occurring ambruticin VS analog.
  • R is CH 3
  • X 1 is a bond
  • X 2 and X 3 form a bond
  • NR 2 R 3 is N(CH 3 ) 2 , NH(CH 3 ), or NH 2 , corresponding to the naturally occurring ambruticins VS-3, VS-4, and VS-5, respectively.
  • R 1 is
  • R 2 is H, CH 3 , aryl(CH 2 ), cycloalkyl(CH 2 ), or cycloalkyl; and R 3 is C 2 -C 5 alkyl, aryl(CH 2 ), cycloalkyl(CH 2 ), or cycloalkyl.
  • R 2 is H, CH 3 , CH 3 CH 2 , HOCH 2 CH 2 ,
  • R 3 is CH 3 CH 2 , CH 2 CH 2 OH, (CH 3 ) 2 CH, CH 3 CH 2 CH 2 , CH 3 CH 2 CH 2 CH 2 , COCF 3 , CH 2 CH 2 F 9 CH 2 CHF 2 , CH 2 CF 3 ,
  • R 3 is CH 3 CH 2 , CH 2 CH 2 OH, (CH 3 ) 2 CH, CH 3 CH 2 CH 2 , CH 3 CH 2 CH 2 CH 2 ,
  • R 2 and R 3 together are CH 2 CH 2 CH 2 .
  • R 2 and R 3 are the same but each is
  • O and X 3 are a bond, and R 2 is H or CH 3 , then R 3 is other than H or CH 3 .
  • R 1 is CO 2 H
  • R 2 is CH 3 or CH 3 CH 2
  • R 4 is H
  • R 3 is selected from the group consisting OfCH 3 CH 2 , HOCH 2 CH 2 , (CH 3 ) 2 CH,
  • the present invention includes within its scope prodrugs of the compounds of this invention.
  • prodrugs are in general functional derivatives of the compounds that are readily convertible in vivo into the required compound.
  • the term “administering” shall encompass the treatment of the various disorders described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to a subject in need thereof.
  • Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in Wermuth, "Designing Prodrugs and Bioprecursors," in Wermuth, ed., The Practice of Medicinal Chemistry, 2nd Ed., pp. 561-586 (Academic Press 2003).
  • Prodrugs include esters that hydrolyze in vivo (for example in the human body) to produce a compound of this invention or a salt thereof.
  • Suitable ester groups include, without limitation, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl or alkenyl moiety preferably has no more than six carbon atoms.
  • Illustrative esters include formates, acetates, propionates, butyrates, acrylates, citrates, succinates, and ethylsuccinates.
  • R 2 and R 3 together are CH 2 CH 2 CH 2 H
  • a Coccidioides infection treatable in accordance with this invention is caused by a fungus of the genus Coccidioides, especially C. immitis or C. posadasii.
  • C. immitis strains include Silveira, 46, ATCC 7366, K9-71X, 98-449, 98-571, Kr, DA, Ma, Mc, Co, Si, hi, La, Sy, and Ro (Gonzalez et al. Antimicrob. Agents Chemother. 45(6):1854-1859 (2001); Rifkind et al., Antimicrob. Agents Chemother. 6(6):783-784 (1974); Ward et al., Infect Immun. 12(5):1093-1097 (1975)).
  • the Coccidioides infection can be coccidioidomycosis (also known as Valley Fever or Desert Fever).
  • the site of Coccidioides infection can be in the subject's respiratory system (especially the lungs), kidneys, spleen, lymph nodes, brain, blood, and/or thyroid gland.
  • the subject can be suffering from coccidioidomycosis that is asymptomatic, acute symptomatic, or chronic pulmonary.
  • Acute symptomatic coccidioidomycosis can have one or more of the following symptoms: pulmonary syndrome combined with cough, chest pain, shortness of breath, fever, and/or fatigue; diffuse pneumonia; skin manifestations (such as fine papular rash, erythema nodosum, and erythema multiforme); migratory arthralgias; and, fever.
  • Chronic pulmonary coccidioidomycosis can have one or more of the following symptoms: pulmonary nodules and peripheral thin-walled cavities.
  • the subject can be suffering from coccidioidomycosis that is extrapulmonary or disseminated.
  • Coccidioidomycosis that is extrapulmonary or disseminated has one or more of the following symptoms: keratotic ulcers; verrucose ulcers; subcutaneous fluctuant abscesses; synovitis and effusion affecting the knees, wrists, feet, ankles, and/or pelvis; lytic lesions affecting the axial skeleton; meningeal disease; and, infection of the thyroid, gastrointestinal tract, adrenal glands, genitourinary tract, pericardium, and/or peritoneum.
  • the subject can be suffering from coccidioidal meningitis.
  • Especially susceptible subject are those who are immunocompromised, such as patients infected with HIV, organ transplant recipients, cancer patients undergoing chemotherapy, and patients on high dosages of corticosteroids.
  • the subject can also be a person who has a high chance of acquiring Coccidioides infection, such as a person planning to travel to or through an area where coccidioidomycosis is endemic.
  • the subject is typically a human, although the methods of the invention can be practiced for veterinary purposes, with suitable adjustment of the unit dose for the particular mammal of interest (including cats, cattle, dogs, horses, and the like).
  • suitable adjustment of the unit dose for the particular mammal of interest including cats, cattle, dogs, horses, and the like.
  • Suitable modes of administration of the pharmaceutical composition include, but are not limited to, oral, topical, aerosol, inhalation by spray, parenteral, subcutaneous, intravenous, intramuscular, interperitoneal, rectal, and vaginal administration.
  • parenteral as used herein, includes subcutaneous injections, and intravenous, intrathecal, intramuscular, and intrasternal injection or infusion techniques.
  • a preferred mode of administration is one that brings the compound of formula I to the actual or potential site(s) of Coccidioides infection in the subject.
  • the pharmaceutical composition can be in a solid, semi-solid, or liquid form
  • the pharmaceutically acceptable carriers include, vehicles, adjuvants, excipients, and diluents, are well known to those who are skilled in the art and are readily available.
  • the carrier is chemically inert to ambruticins and has no detrimental side effects or toxicity under the conditions of use.
  • the pharmaceutically acceptable carrier is free of pyrogen.
  • the pharmaceutically acceptable carriers which can be used include, but are not limited to, water, glucose, lactose, gum acacia, gelatin, mannitol, starch paste, magnesium trisilicate, talc, corn starch, keratin, colloidal silica, potato starch, and urea.
  • the amount of the compound of formula I that may be combined with the pharmaceutically acceptable carrier to produce a single dosage form will vary depending upon the subject treated and the particular mode of administration. Suitable dosage levels of the active ingredient are on the order from about 0.01 mg to about 100 mg per kg body weight per day, preferably from about 0.1 mg to about 50 mg per kg body weight per day. Dosage unit forms will generally contain from about 0.1 mg to about 500 mg of the active ingredient.
  • the active ingredient may be formulated within the range of, for example, 0.00001% to 60% by weight, and preferably from 0.001% to 10% by weight, hi addition, the pharmaceutical composition can be administered on an intermittent basis, i.e., at daily, semi-weekly, or weekly intervals.
  • the pharmaceutical compositions for oral administration include (a) liquid formulations; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions; and (e) emulsions.
  • Liquid formulations may include diluents, such as water and alcohols, and optionally a pharmaceutically acceptable surfactant.
  • Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and the like.
  • the tablet can further comprise one or more colorants, diluents, buffering agents, disintegrants, moistening agents, preservatives, or flavoring agents.
  • the pharmaceutical composition can be made into aerosol formulations to be administered via inhalation.
  • aerosol formulations can be placed into pressurized acceptable propellants (such as dichlorodifluoromethane, propane, nitrogen, and the like) or non-pressured preparations (such as in a nebulizer or an atomizer).
  • pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen, and the like
  • non-pressured preparations such as in a nebulizer or an atomizer.
  • the aerosol formulation comprises particles of a respirable size, including, but not limited to, mean particle sizes of 5 ⁇ m to 500 ⁇ m.
  • the pharmaceutical composition can be an injectable formulation.
  • injectable compositions are well known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J. B. Lippincott Company, Philadelphia, Pa., Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)).
  • injectable compositions are administered intravenously.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the pharmaceutical composition can further comprise an excipient.
  • Excipients that may be used include one or more carriers, surface active agents, thickening or emulsifying agents, solid binders, dispersion or suspension aids, solubilizers, colorants, flavoring agents, coatings, disintegrating agents, lubricants, sweeteners, preservatives, isotonic agents, and combinations thereof.
  • the selection and use of suitable excipients is taught in Gennaro, ed., Remington: The Science and Practice of Pharmacy, 20th Ed. (Lippincott Williams & Wilkins 2003), the disclosure of which is incorporated herein by reference.
  • Certain compounds of this invention can be made using an isolated or recombinant cell comprising the genes of the ambruticin biosynthetic gene cluster and producing one or more ambruticins, wherein the activity the ambP, ambO, ⁇ nbS, or ambM gene product is reduced or disrupted.
  • the ambruticin gene cluster is described in Reeeves et al, US 2005/0266434 Al (2005).
  • the reduction of activity can be due to the reduced expression of the gene encoding a gene product, or the gene can be modified so that the resulting gene product has less or no activity.
  • the gene of interest can be disrupted or deleted by transposon insertion, homologous recombination, mutagenesis using a mutagen, or the like.
  • the ambruticin biosynthetic gene cluster is described in
  • An isolated or recombinant cell wherein the activity of the ambM gene product is reduced or disrupted can be used to produce an ambruticin in which R 10 is H.
  • an isolated or recombinant cell wherein the activity of the ambP and/or ambO gene product(s) is/are reduced or disrupted can be used to produce an ambruticin analog in which X 2 and X 3 are each H.
  • an isolated or recombinant cell wherein the activity of the ambS gene product is reduced or disrupted can be used to produces elevated amounts of ambruticin VS-5 and ambruticin S and does not produce ambruticin VS-I, ambruticin VS-2, ambruticin VS-3 and ambruticin VS-4.
  • the isolated or recombinant cell is disrupted for the ambP or ambO gene, or both genes; and, when cultured, the cell produces 20,21-dihydro analogs of the ambruticin, for example, compounds IV-a and IV-b, and compound H-D wherein R 2 is CH 3 and R 3 is H.
  • the isolated or recombinant cell is disrupted for the ambM gene and when cultured, the cell produces ambruticin lacking the C27 methyl group, for example, compound III-a and compound H-B wherein R 2 is H or CH 3 and R 3 is H.
  • the cell has the ambM gene deleted and the malonate specific AT domain from module 7 is replaced or engineered into a loading domain, the cell produces ambruticin S that lacks the C24 and C27 methyl groups.
  • Such compounds are represented by compound (II), wherein R 10 and R 11 are each H, X 1 is a bond, X 2 and X 3 are together a bond, and R 2 and R 3 are independtly H or CH 3 .
  • the cell is native to the ambruticin biosynthetic gene cluster.
  • the cell is a host cell that is heterologous to the ambruticin gene cluster, wherein the ambruticin biosynthetic genes are present either on a vector or integrated into the chromosome of the cell.
  • a cell native to the ambruticin biosynthetic gene cluster is a cell of the genus Sorangium.
  • the cell is a Sorangium cellulosum, more preferably of the So celO, NCIMB 12601 or So ce307 strains.
  • a host cell heterologous to the ambruticin gene cluster includes, but is not limited to, eubacterial cells such as Escherichia coli, yeast cells such as Saccharomyces cerevisiae, or myxobacterial cells such as Myxococcus xanthus.
  • eubacterial cells such as Escherichia coli
  • yeast cells such as Saccharomyces cerevisiae
  • myxobacterial cells such as Myxococcus xanthus.
  • Compounds IV-a (20,21 -dihydro ambruticin VS-5), IV-b (20,21 -dihydro ambruticin VS-3) and IV-e (20,21 -dihydro ambruticin VS-4) are produced by the cell described above that lack the activity of the ambO and/or ambP gene product(s).
  • the cell is deleted for the ambO and/or ambP genes.
  • the cell is Sorangium cellulosum So ce 10.
  • the cell is cultured and the compounds of interest are isolated or purified using methods previously described (see Examples 22 and 23 hereinbelow and Reeves et al., cited supra.
  • the cell is deleted for the ambO and/or ambP genes, and is also deleted for the ambS gene.
  • the cell produces compound IV-a and 20,21 -dihydro ambruticin S.
  • the cell has the ambO and/or ambP genes and the ambM gene deleted.
  • the cell produces 20,21 -dihydro ambruticin S which lacks the C27 methyl group, and the compounds as represented by compound (II), wherein R 10 is H, R 11 is CH 3 , X 1 is a bond, X 2 and X 3 are each H, and R 2 and R 3 are independently H or CH 3 .
  • the cell is deleted for the ambO and/or ambP genes, and the malonate specific AT domain from module 7 is replaced or engineered into a loading domain.
  • the cell produces 20,21 -dihydro ambruticin S which lacks the C24 methyl, and the compounds as represented by compound (II), wherein R 10 is CH 3 , R 11 is H, X 1 is a bond, X 2 and X 3 are each H, and R 2 and R 3 are independently H or CH 3 .
  • the cell is deleted for the ambM and ambO and/or ambP genes, and the malonate specific AT domain from module 7 is replaced or engineered into a loading domain.
  • the cell produces 20,21 -dihydro ambruticin S which lacks the C24 methyl, and the compounds as represented by compound (II), wherein R 10 and R 11 are each H, X 1 is a bond, X 2 and X 3 are each H, and R 2 and R 3 are independtly H or CH 3 .
  • Additional details on the preparation of ambruticin compounds are disclosed in Julien et al, WO 2005/086907 Al (2005) and Tian et al, US Pat. Appl'n No. 11/305,802, filed Dec. 16, 2005, the disclosures of which are incorporated herein by reference.
  • Ambruticin VS-4 R 3 alkyl, cycloalkyl, etc.
  • This general procedure was used: To a solution of ambruticin VS-4 ((5S, 6R)S- (methylamino)-6-hydroxypolyangioic acid, 0.1 mmol) in methanol (1 niL) was added the aldehyde or ketone (0.2 mmol) and acetic acid (0.4 mmol), followed by sodium cyanoboro- hydride (0.2 mmol). The solution was stirred at 20 to 25 0 C (for reactive aldehydes) or 50 to 60 0 C (for less reactive aldehydes and ketones) until all of the ambruticin VS-4 was con- sumed.
  • Compound I-b (( 5S, ⁇ 5i?)-5-(iV-cyclopropylmethyl-methylamino)-6-hydroxy- polyangioic acid) was synthesized using cyclopropanecarboxaldehyde at room temperature.
  • Compound I-c ((5S, (5i?)-5-(N-cyclopentyl-methylammo)-6-hydroxypolyangioic acid) was synthesized using cyclopentanone at 50 0 C.
  • Ambruticin VS-5 R 2 H, alkyl, etc.
  • R 3 alkyl [0112] The following general procedure was used: To a solution of ambruticin VS-5 ((5S,6R)-5-amino-6-hydroxypolyangioic acid, 0.1 mmol) in methanol (1 mL) was added the aldehyde or ketone (0.2 mmol) and acetic acid (0.4 mmol), followed by sodium cyanoboro- hydride (0.2 mmol). The solution was stirred at 20 to 25 0 C until all of the ambruticin VS-5 was consumed.
  • reaction mixture was concentrated on a rotary evaporator, re-dissolved in a mixture of water- AcCN, filtered through a one-gram plug of C- 18 silica gel, and purified by reversed-phase HPLC, eluted using a gradient of AcCN in water containing 0.1% acetic acid.
  • the product was obtained as a white solid after lyophilization of desired fractions.
  • Compound I-ggg ((5S, 6i-)-5-(2,2-difluoroethyl)amino-6-hydroxypolyangioic acid) was synthesized using difluoroacetaldehyde ethyl hemiacetal.
  • ESI-TOF-MS m/z 538.3337, calcd for C 30 H 46 F 2 NO 5 ([M + H] + ) 538.3339.
  • Ambruticin VS-5 R 3 R 5 CO [0126] The general procedure of Example 3 was followed, except that ambruticin VS-5 was used instead of ambruticin VS-4.
  • Compound I-j (J ⁇ tf ⁇ -S-acetarmdo- ⁇ -hydroxypolyangioic acid) was synthesized using acetic anhydride.
  • ESI-TOF-MS m/z 516.3339 calcd for C 30 H 46 NO 6 ([M + H] + ) 516.3320.
  • Compound 1-1 ((5S, ⁇ 5i?)-5-propionamido-6-hydroxypolyangioic acid) was synthesized using propionic anhydride.
  • ESI-TOF-MS m/z 530.3457 calcd for C 31 H 48 NO 6 ([M + H] + ) 530.3476.
  • Ambruticin VS-4 or R 3 R 9 OCO ambruticin VS-5 [0131] This general procedure was used: To a suspension of ambruticin VS-4 or VS-5 (0.1 mmol) in dry tetrahydrofuran (THF, 1 mL) was added ⁇ N-diisopropylethylamine (DIEA, 0.3 mmol), followed by the alkyl chloroformate (0.2 mmol). After stirred at 20 to 25 0 C for 20 h, the reaction mixture was concentrated on a rotary evaporator. The residue was re- dissolved in EtOAc. The solution was washed with 0.1 M HCl (aq) and brine, and dried over Na 2 SO 4 .
  • DIEA ⁇ N-diisopropylethylamine
  • the salt was removed by filtration and the filtrate was evaporated to dryness.
  • the crude product was purified by reversed-phase HPLC, eluted using a gradient of AcCN in water containing 0.1% acetic acid. The product was obtained as a white solid after lyophilization of desired fractions.
  • Ambruticin VS-4 or R 3 R 9 NHCO ambruticin VS-5
  • R 4 H or R 9 NHCO
  • the following general procedure was used: To a suspension of ambruticin VS-4 or ambruticin VS-5 (0.1 mmol) in dry THF (1 mL) was added the isocyanate (0.5 mmol). After the mixture was stirred at 50 0 C for 20 h, 300 mg OfPS-TsNHNH 2 resin (Argonaut, CA) was added, and the mixture was stirred at room temperature overnight. The mixture was then diluted in methanol and filtered to remove the resin. The filtrate was concentrated on a rotary evaporator. The residue was re-dissolved EtOAc.
  • the solution was washed with 0.1 M HCl (aq) and brine, and dried over Na 2 SO 4 .
  • the salt was removed by filtration and the filtrate was evaporated to dryness.
  • the crude product was purified by reversed-phase HPLC, eluted using a gradient of AcCN in water containing 0.1% acetic acid. The product was obtained as a white solid after lyophilization of desired fractions.
  • Compound I-cc ((5 ⁇ S',(5i-)-5-(3-allyl-l-methylureido)-6-(allylcarbamoyl)poly- angioic acid) was a side product from the preparation of compound I-q, above.
  • ESI-TOF-MS m/z 676.3905, calcd for C 37 H 55 N 3 O 7 Na ([M + Na] + ) 676.3932.
  • Compound I-dd ((5S, ⁇ 5i?)-5-(3-benzyl-l-methylureido)-6-(benzylcarbamoyl)- polyangioic acid) was a side product from synthesis of compound I-p, above.
  • ESI-TOF-MS m/z 776.4254, calcd for C 45 H 59 N 3 O 7 Na ([M + Na] + ) 776.4245.
  • Compound I-s ((5iS' ) di?)-5-(3-benzylureido)-6-hydroxypolyangioic acid) was synthesized from ambruticin VS-5 and benzyl isocyanate.
  • ESI-TOF-MS m/z 629.3567 calcd for C 36 H 50 N 2 O 6 Na ([M + Na] + ) 629.3561.
  • Compound I-ff ((5S, (5i?)-5-(dimethylamino)polyangi- 1 ,6-diol) was synthesized from ambruticin VS-3. ESI-TOF-MS m/z 488.3737, calcd for C 30 H 50 NO 4 ([M + H] + ) 488.3734. [0146] Compound I-iii ((5»S r ,6i?)-5-(2,2,2-trifluroethyl)aminopolyangi-l,6-diol) was synthesized from compound I-fff. ESI-TOF-MS m/z 542.3430, calcd for C 30 H 47 F 3 NO 4 ([M + H] + ) 542.2452.
  • Polyangiamide (ambruticin amide) compounds can be prepared according to the following illustrative procedure for compound I-hh ((5iS',6i-)-5-(dimethylamino)poly- angiamide).
  • Ambruticin VS compounds having an inverted (Ji?) stereochemistry at position C5 can be made from ambruticin S.
  • ambruticin S is oxidized directly to 5- keto ambruticin S using Dess-Martin periodinane, although it appears that the yield is rather low. Reductive amination followed by separation of epimers affords 5R ambruticin VS compound.
  • ambruticin S is first converted to the methyl ester and then oxidized to 5-keto ambruticin S methyl ester, as disclosed in Conner et al, US RE 30,339 (1980). The keto ester is then reductively aminated, the epimers are separated, and the 5R ester is hydrolyzed to afford the 5R ambruticin VS compound.
  • Ambruticin VS-5 R 3 alkyl, cycloalkyl, etc.
  • Example 11 [0160] Compounds I wherein R 1 is CH 2 OH; R 2 is CH 3 ; R 3 is alkyl, etc.; and R 4 is H ((5 ⁇ S,6i?)-5-(alkylamino)polyangi-l,6-diol) were prepared from ambruticin VS-4 per the following series of equations:
  • Compound I-ee was prepared using the method of Example 7. To a solution of compound I-ee (0.1 mmol) in methanol (1 mL) was added the aldehyde or ketone (0.2 mmol) and acetic acid (0.4 mmol), followed by sodium cyanoborohydride (0.2 mmol). The solution was stirred at 20 to 25 0 C (for reactive aldehydes) or 50 to 60 0 C (for less reactive aldehydes and ketones) until all of Compound I-ee was consumed.
  • reaction mixture was concentrated on a rotary evaporator, re-dissolved in a mixture of water- AcCN, filtered through a one-gram plug of C- 18 silica gel, and purified by reversed-phase HPLC, eluted using a gradient of AcCN in water containing 0.1% acetic acid.
  • the product was obtained as a white solid after lyophilization of desired fractions.
  • Ambruticin VS-3 [0165] To a solution of ambruticin VS-3 (0.1 mmol) in iV ⁇ -dimethylformamide (DMF, 1 mL) was added the amine (0.2 mmol) and DIEA (0.3 mmol), followed by (9-(7-azabenzo- triazol-l-y ⁇ - ⁇ iV'.iV'-tetramethyluronium hexafluorophosphate (HATU, 0.12 mmol). After being stirred at 20 to 25 0 C for 20 h, the reaction mixture was diluted with EtOAc (ca. 30 mL).
  • EtOAc ca. 30 mL
  • the crude product was purified by reversed-phase HPLC, eluted using a 30 min-gradient of 25 to 75% AcCN in water containing 0.1% acetic acid. (6i?)-5-Oxo-6-hydroxypolyangioic acid was obtained as a white solid after lyophilization of desired fractions as determined by HPLC/MS. Yield -10%.
  • Methyl (5S,6i?)- 5-(9-fluorenyl)methyloxycarbonylamino-6-hydroxypolyangioate (2) was obtained as a solid (0.11 g).
  • [0201 ] To a solution of 2 (0.11 g, 0.15 mmol) in DCM (2 mL) cooled at 0 0 C was added 3-chloroperbenzoic acid (r ⁇ CPBA) in three 26 mg portions over 5 h. HPLC analysis showed that most of the starting material had been consumed. The mixture was stirred with aqueous sodium thiosulfate for 20 minutes and was extracted with DCM.
  • Compound IV-e was synthesized from compound IV-d using the scheme above. ESI-TOF-MS m/z 532.3998, calcd for C 32 H 54 NO 5 ([M + H] + ) 532.3997.
  • Compound IV-b (20,21-Dihydroambruticin VS-3) is also isolated from a side stream in a large scale production of ambruticin VS-3. A mixture obtained from the wild- type strain that produces ambruticins VS-3, VS-4, and VS-5 are treated with excess formaldehyde, sodium cyanoborohydride, and acetic acid in methanol to convert all NH 2 and MeNH groups to Me 2 N groups. Conversion a 19-g mixture yields ⁇ 14 g of purified ambruticin VS-3 and 280 mg of 20,21 -dihydroambruticin VS-3, together with other compounds.
  • C-I secondary alcohol analogs can be synthesized from ambruticin VS-3 using the following procedure.
  • compound I-nnn ((5S, 6i?)-l-methyl-5-(dimethylammo)polyangi-l,6- diol, a mixture of Ii? and IS isomers) was synthesized from ambruticin VS-3 using the following procedure. To a suspension of ambruticin VS-3 (25 mg, 0.05 mmol) in ethyl ether (3 mL) was added 1.5 M methyllithium lithium bromide solution in ether (0.8 niL, 1.2 mmol). After the mixture was stirred at 20 0 C for 16 h, it was poured on ice- water.
  • compound I-ooo ((5S, 6i?)-l,l-dimethyl-5-(dimethylamino)polyangi- 1,6-diol) was synthesized from ambruticin VS-3 methyl ester using the following procedure.
  • Compound 1-111 ((5S, 6i?)-2-ethoxycarbonylamino-5-(dimethylamino)-l- norpolyangi-6-ol) can be synthesized from ambruticin VS-3 using the following procedure.
  • ambS, ambO, ambP and ambM mutants in Sorangium cellulosum So ce 10 and the analysis of ambruticin compounds so produced.
  • the construction of the ambS, ambO, ambP and ambM mutants in Sorangium cellulosum So celO was peformed using the following method.
  • the nucleotide sequence of the ambO, ambP, and ambM genes are disclosed in Reeves et al, US 2005/0266434 Al (2005), incorporated herein by reference.
  • Primer sequences and plasmid names were as follows: ambM, TGATACAACGACGCTTACACG (SEQ ID NO:1) and CTAGCGGAACGACATGGTGAA (SEQ ID NO:2) to give pKOS546-28M; ambS, TAGGCCAGGTTGAGCCATGAG (SEQ ID NO:3) and CTATTGCTCTCTGGCCAGGAG (SEQ ID NO:4) to give pKOS375-155; ambO, TGAGCGGTCGGCGCCAGCTGG (SEQ ID NO:5) and TCACGTGAAGCGCGCCGCGTC (SEQ ID NO:6) to give pKOS375-189O ; ambP, TGACACCCGGTACTCCTCAGC (SEQ ID NO:7) and TCAGCGCTTGTCCGCCAGACG (SEQ ID NO:8) to give ⁇ KOS375-189P.
  • Each resulting plasmid was introduced by transformation into E. coli strain C- 2420 containing the helper conjugative plasmid pKOS 111-47. Development of a mariner- based transposon for use in Sorangium cellulosum. Appl Environ Microbiol 69, 6299-6301). The procedure for conjugation of the plasmid from E. coli to So celO was previously described (Jaoua et al.
  • Plasmid 28, 157-165 "Transfer of mobilizable plasmids to Soran- gium cellulosum and evidence for their integration into the chromosome" and transconju- gants were selected on S42 agar containing kanamycin (50 ⁇ g/mL) and phleomycin (50 ⁇ g/mL) to give strains K546-40M2, K375-167.4, K546-32O2, and K546-5P3, respectively.
  • the Sorangium cellulosum cells were maintained using the method of Hofle et al. (1991, Liebigs Ann Chem 1991, 941-945) and Gerth et al. (1996, JAntibiot (Tokyo) 49, 71-75.
  • Production medium (10 g/L maltodextrin, 5 g/L Pharmamedia, 4 g/L nonfat dry milk, 4 g/L soy peptone, 4 mL/L glycerol, 1 g/L CaCl 2 -2H 2 O, 1 g/L MgSO 4 -7H 2 O, 120 mg/L FeCl 3 » 6H 2 O, 50 mM HEPES, pH 7.6) containing 40 g/L XADl 180 was inoculated with 10% seed culture and incubated at 32°C for 8 days. After washing the XAD resin twice with water, the ambruticin compounds were eluted with a volume of methanol equal to half the original culture volume.
  • Ambruticin S and other ambruticins not containing an amino group were quantitated by the S method: Agilent Eclipse XDB-C8 column (4.6 x 150 mm), isocratic, 64% AcCN, 0.1% acetic acid, 1 mLnr ⁇ T 1 , detection at 220 nm.
  • Agilent Eclipse XDB-C8 column 4 x 150 mm
  • isocratic 64% AcCN
  • 0.1% acetic acid 1 mLnr ⁇ T 1
  • detection at 220 nm detection at 220 nm.
  • the separation method used a MetaChem Inertsil ODS-3 column (4 x 100 mm) with a gradient from 30% to 100% AcCN in 0.1% acetic acid at 1 mL'rnirT 1 on an Agilent 1100 system with a diode array detector connected to a Perseptive Biosystems Mariner biospectrometry workstation.
  • FIG. 1 shows HPLC-UV analysis of extracts from the ambS ⁇ mutant and the wild type strain. The extracts were also analyzed by LC-MS, which verified the absence of the VS-4, VS-3 and VS-I compounds, and indicated that the small peak eluting after VS-5 had the mass of VS-5 plus two hydrogens.
  • the amount of ambruticin VS-5 produced by the mutant was approximately equal to the sum of ambruticins VS-I, VS-3, VS-4 and VS-5 produced by the wild type strain under the same conditions, indicating that the AmbS protein catalyzes, as the final steps in the pathway, sequential N- methylations of VS-5 to give VS-4, VS-3 and VS-I.
  • Ambruticin VS-5 and the compound two hydrogen atoms heavier were purified from a large scale fermentation of the ambST strain and the heavier compound was shown by NMR analysis to be 20,21-dihydroambruticin VS-5. Upon careful inspection of LC-MS data from cultures of the wild-type strain, very small amounts of all the 20,21-dihydroambruticins could be detected.
  • ambruticin gene clusters has a pair of adjacent genes in the same operon encoding a flavin monooxygenase (ambO) and a Rieske iron-sulfur cluster protein (ambP).
  • ambO flavin monooxygenase
  • ambP Rieske iron-sulfur cluster protein
  • the putative 20,21 -dihydroarnbruticin VS-5 peak co-eluted with a purified standard of this compound. Disruption of either ambP or ambO prevents formation of the 20,21-double bond.
  • the relative level (and estimated absolute level) of each 20,21-dihydroambruticin was similar to that of each corresponding ambruticin produced by the wild type.
  • Analysis of the arnbM mutant An ambM mutant was constructed using the same procedure described above. The extract from four 500ml cultures of K546-40M2 was adjusted to 50% methanol, 50 mM ammonium acetate and loaded onto a 2.5 x 28 cm column of BakerBond C18.
  • the AmbM protein is a C-methyltransferase, and the ambM mutant produces the set of ambruticins corresponding to those produced by the wild type strain, except that each is missing the C27 methyl group (for example, 27-norambruticin VS-3, 27-norambruticin VS-4, and 27-norambruticin VS-5).
  • Example 23
  • Fig. 1 shows the boundaries at the amino and carboxy terminal of the 2 ATs. Alignment of the boundaries between the KS and AT domains of modules 0 and 7 from the ambruticin PKS.
  • the top box shows the KS domain and the bottom box shows the AT domain.
  • the arrows show the boundaries chosen for AT swaps: #1 is between KS and AT domains, and #2 is at the end of the ATs.
  • Plasmid pKOS396- 185A contains the malonate specific AT from module 7 engineered into the loading module. The plasmid was integrated by homologous recombination that creates an inactive native ambA that allows for expression of the downstream ambruticin genes and expresses the engineered ambA. [0231] Plasmid pKOS396-185A was constructed in several steps. To engineer the AT from module 7 into the loading module, 2 PCR fragments were generated to produce the right and left boundaries of the swap; the left contains the KS-AT boundary and the right contains the AT-ACP boundary.
  • the right fragment was amplified using plasmid pKOS344-l 12E and the oligo pair 5'-TTTTAATTAAGAGGAGCATATGGATCCGCAGC (SEQ ID NO: 9) (Pad restriction sites underlined) and 5'-GCCCGCGGCGGTTCCGGGGCCTCCTCGGACACCACATGC (SEQ ID NO: 10).
  • the left fragment was amplified using the same plasmid and oligo pair 5'-GCCATGTGGTGCTCGAGGAGGCCCCGGAACCGCCGCGGGC (SEQ ID NO: 11) and 5 '-TTTCTAGACCTAGGGCCATTGAGCGCCG (SEQ ID NO: 12)
  • pKOS396- 185A also contains truncation in the 5' region of ambA and has the promoter for the epothilone biosynthetic gene positioned just upstream of the engineered ambA.
  • a 10% v/v inoculum was diluted into 50 mL production media (per liter 5 g maltodextrin DEl 8 (Cerestar), 2.5 g soy peptone (Marcor), 0.5 g MgSO 4 » 7H 2 O, 0.25 g K 2 HPO 4 , 50 mM HEPES pH 7.6, 1 g ferric citrate and 10 g XAD 1180) seven days at 32°C. After the fermentation, products were eluted from the XAD using 5 mL methanol. [0236] A method for producing and purifying compound III-a is as follows: Seed cultures were inoculated from cells spread on S42 plates containing 200 mg/L hygromycin.
  • a 25-mL tube with five mL of CF9 medium (Fructose 6 g/L, Casitone (Difco) 9 g/L, MgSO 4 -7H 2 O g/L, CaCl 2 -2H 2 O 0.5 g/L, and HEPES (1.0 M, pH 7.6, KOH) 25 mL/L) containing hygromycin (200 ⁇ g/mL) was inoculated with a 1 cm 2 patch from S42 plates. A ten percent inoculum was used to expand the seed into a 250-mL unbaffled Erlenmeyer flask containing 50 mL of CF9 medium with hygromycin.
  • CF9 medium Fertose 6 g/L, Casitone (Difco) 9 g/L, MgSO 4 -7H 2 O g/L, CaCl 2 -2H 2 O 0.5 g/L, and HEPES (1.0 M, pH 7.6, KOH) 25
  • the flasks were incubated at 32°C and 190 rpm on a 2-inch throw shaker for three days.
  • the secondary seed culture was transferred (10% v/v) into a 2.8-L unbaffled Fernbach flask containing 500 mL of CF9-H medium.
  • the Fernbach flasks were incubated at 32°C and 190 rpm on a 2-inch throw shaker for three days.
  • the cultures at all seed stages grew as dispersed cultures.
  • Airflow was set at 4 L/min, agitation rate at 100 rpm, and overhead pressure at 3 psi. Dissolved oxygen was controlled at 40%. Temperature was controlled at 32.O 0 C. Cognis Clerol FBA 5059 antifoam was added to prevent foam formation as needed. The culture was fed 3.0 g/L/D fructose and 1.5 g/L/D soytone starting at 48 hours after inoculation and continuing until the end of the fermentation.
  • Testing involved a total of 14 clinical isolates, distributed as follows: Candida albicans (1), Aspergillus fumigatus (2), A.flavus (2), Blastomyces derniatididis (3), Histoplasma capsulatum (3), and (3).
  • NCLS National Committee for Clinical Laboratory Standards
  • M-27A2 "Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standard
  • M38-A "Reference Method for Broth Dilution Antifungal Susceptibility Testing of Conidium-Forming Filamentous Fungi; Approved Standard.”
  • the methodology included testing in RPMI- 1640 with glutamine and without bicarbonate, an inoculum size of 0.5-2.5 x 10 3 for yeasts and 0.4-5 x 10 4 for moulds, and incubation at 35 °C for 48 h for most isolates.
  • capsulatum were incubated at 30 °C for 96 h.
  • the minimum inhibitory concentration (MIC) was defined as the lowest concentration that resulted in an 80% reduction in turbidity as compared to a drug-free control tube.
  • Drug concentrations were 0.15-10 ⁇ g/mL for all compounds.
  • the test medium was the NCCLS-recommended medium of RPMI-1640 (Hardy Diagnostics, Santa Monica, CA).
  • Sample preparations were as follows: For Ambruticin VS-4, a 5 mg sample was weighed out and added to 0.5 mL of dimethylsulfoxide (DMSO) containing 0.5% trifluoroacetic acid (TFA).
  • DMSO dimethylsulfoxide
  • TFA trifluoroacetic acid
  • the resulting solution having a concentration of 10,000 ⁇ g/mL, was diluted to a working concentration of 1,000 ⁇ g/mL in the same DMSO/TFA solvent. Subsequent dilutions were then made in the same solvent. Final testing concentrations ranged from 0.15 to 10 g/mL.
  • a 4.3 mg sample was weighed out and added to 0.43 mL of the same DMSO/TFA solvent. Dilution as before again yielded final testing concentrations of 0.15-10 ⁇ g/mL.
  • MICs were determined at the first 24 h interval where growth could be determined in the drug-free control tube and again 24 h following the first reading, with the second reading being the reported one, as prescribed by NCCLS.
  • the MIC endpoint used was the lowest concentration that exhibited an 80% reduction in turbidity as compared to the drug- free, diluent-positive, growth control. Results are presented in Table F.
  • Table F Antifungal MICs for Ambruticins
  • Fungus (isolate no.) ( ⁇ g/mL) ( ⁇ g/mL)
  • Candida albicans (05-1422) ⁇ 0.15 ⁇ 0.15
  • Histoplasma capsulatum (05-959) ⁇ 0.15 ⁇ 0.15
  • Histoplasma capsulatum (05-1097) ⁇ 0.15 ⁇ 0.15
  • Histoplasma capsulatum (05-1159) ⁇ 0.15 ⁇ 0.15
  • mice Female mice (C57BL/6 females, 8-10 weeks old, from Harlan-Sprague-Dawley) were each infected intranasally with 54 arthrocondia of C. posadasii (strain Silveira), under anesthesia with ketamine-xylazine. The target dose was 50 arthrospores, which is a lethal dose for this strain of mice.
  • Treatment with the compounds began on day 6 after infection. The compounds were administered in a vehicle of 10% 2-hydroxypropyl- ⁇ -cyclodextrin in ethanol. The mice were gavaged with 0.2 mL of compound solution (or vehicle as control) twice daily from Monday through Friday and once on weekends for a total of 19 days of treatment. The mice were observed for an additional 24 days after completion of the treatment cycle and then sacrificed, making it a total of 49 days from infection to sacrifice. A total of 48 mice were used, grouped as shown in Table H:
  • mice treated with compound I-v or I-ff died while receiving treatment except two that died from the gavaging procedure.
  • Weights of mice treated with compound I-v were stable during the treatment period but began to fall when the drug was withdrawn. These mice began to die within 10 days of discontinuation of treatment, with 40% of the mice treated with a 20 mg/kg dose and 50% of the mice treated with a 50 mg/kg dose dieing before the scheduled sacrifice on day 49. All the mice treated with compound I-ff survived until the scheduled sacrifice. Of the control mice, only two survived to the scheduled sacrifice.
  • mice At sacrifice, most mice exhibited gross evidence of disease. Two control mice, two compound I-ff treated mice (at 50 mg/kg), and one compound I-v treated mouse (at 20 mg/kg) had no obvious granulomas and their organ cultures were negative, indicating that they had not been infected. These mice were removed from the data set for organ culture and survival analysis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne une méthode de traitement d'une infection à coccidioides ou de réduction de l'apparition possible de celle-ci chez un sujet nécessitant un tel traitement ou une telle réduction, consistant à administrer au sujet une composition pharmaceutique renfermant un composé représenté par la formule (I) dans laquelle R1 R2, R3 R4, R10, R11, X1, X2 et X3 sont tels que définis dans la description.
PCT/US2006/017671 2005-05-19 2006-05-08 Methode de traitement d'une infection a coccidioides consistant a administrer un compose d'ambruticine WO2006124358A2 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US68328305P 2005-05-19 2005-05-19
US68336805P 2005-05-19 2005-05-19
US60/683,283 2005-05-19
US60/683,368 2005-05-19
US11/305,802 2005-12-16
US11/305,802 US20070015823A1 (en) 2004-12-16 2005-12-16 Ambruticin VS compounds

Publications (2)

Publication Number Publication Date
WO2006124358A2 true WO2006124358A2 (fr) 2006-11-23
WO2006124358A3 WO2006124358A3 (fr) 2009-04-30

Family

ID=37431807

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/017671 WO2006124358A2 (fr) 2005-05-19 2006-05-08 Methode de traitement d'une infection a coccidioides consistant a administrer un compose d'ambruticine

Country Status (1)

Country Link
WO (1) WO2006124358A2 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991000860A1 (fr) * 1989-07-06 1991-01-24 GESELLSCHAFT FüR BIOTECHNOLOGISCHE FORSCHUNG MBH (GBF) Ambruticines azotees, leur procede de production et leur utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991000860A1 (fr) * 1989-07-06 1991-01-24 GESELLSCHAFT FüR BIOTECHNOLOGISCHE FORSCHUNG MBH (GBF) Ambruticines azotees, leur procede de production et leur utilisation

Also Published As

Publication number Publication date
WO2006124358A3 (fr) 2009-04-30

Similar Documents

Publication Publication Date Title
US7026322B2 (en) Phenylahistin and the phenylahistin analogs, a new class of anti-tumor compounds
KR101285695B1 (ko) 신규한 생리 활성 물질
Chen et al. Streptopyrazinones A− D, rare metabolites from marine-derived Streptomyces sp. ZZ446
AU2004206046A1 (en) Farnesyl dibenzodiazepinones, processes for their production and their use as pharmaceuticals
US20070015823A1 (en) Ambruticin VS compounds
US20060004079A1 (en) Anti-bacterial and anti-cancer spiro beta-lactone/gamma-lactams
WO2009113660A1 (fr) Microorganisme produisant un composé cyclique
CN105777870B (zh) 新型硫链丝菌素类似物及其制法和用途
JP5387567B2 (ja) 環状化合物およびその塩
WO2006124358A2 (fr) Methode de traitement d'une infection a coccidioides consistant a administrer un compose d'ambruticine
US20190127313A1 (en) Antimicrobial agents
CN111278985B (zh) 具有针对鸟分枝杆菌复合体感染疾病治疗活性的新型化合物及其制造方法
EP2593112A2 (fr) Nouveaux composés antibactériens, procédés de fabrication de ceux-ci, et utilisations de ceux-ci
US20100279861A1 (en) Antifungal Agents
EP2890697B1 (fr) Pseudo-uridimycine (pum) et ses dérivés
EP1740566B1 (fr) Nouvel antibiotique hki10311129, procede de production et utilisation dudit antibiotique
AU767250B2 (en) Novel compound F-15078
JP3124373B2 (ja) 免疫抑制物質
CA2439853A1 (fr) Utilisation de dioxyde de thiolutine et de ses derives dans la fabrication d'un medicament, et procede de preparation dudit medicament
US20130130992A1 (en) Dipeptide derivative for the treatment of cancer
AU2002250997A1 (en) Use of thiolutin dioxide and its derivatives in the manufacture of a medicament for the treatment of CNS disorders and a process for the preparation thereof
WO2011136174A1 (fr) Composé de depsipeptide
US6835736B1 (en) Discorhabdin compounds and methods of use
CA3055304A1 (fr) Composes 16-methyl-oxacyclohexadecan-2-one et derives 16-methyl-azacyclohexadecan-2-one utiles en tant qu'agents antimicrobiens
JP2002326952A (ja) 新規化合物ｆ−１５０７８を含有する真菌感染症治療剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06759287

Country of ref document: EP

Kind code of ref document: A2