WO2006117592A1 - Procedes de modulation de recepteurs nucleaires - Google Patents

Procedes de modulation de recepteurs nucleaires Download PDF

Info

Publication number
WO2006117592A1
WO2006117592A1 PCT/IB2005/001493 IB2005001493W WO2006117592A1 WO 2006117592 A1 WO2006117592 A1 WO 2006117592A1 IB 2005001493 W IB2005001493 W IB 2005001493W WO 2006117592 A1 WO2006117592 A1 WO 2006117592A1
Authority
WO
WIPO (PCT)
Prior art keywords
atom
leu
polypeptide
lbd
hetatm
Prior art date
Application number
PCT/IB2005/001493
Other languages
English (en)
Inventor
Jérôme FAGART
Marie-Edith Oblin
Jessica Huyet
Gregory Pinon
Original Assignee
Inserm
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inserm filed Critical Inserm
Priority to PCT/IB2005/001493 priority Critical patent/WO2006117592A1/fr
Publication of WO2006117592A1 publication Critical patent/WO2006117592A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes

Definitions

  • the present invention relates to novel compositions, methods and tools for modulating nuclear receptor function. More particularly, the invention discloses the identification of the crystal structure of nuclear receptors and the atomic interface with ligands thereof. The invention allows the design, identification or selection of novel candidate modulators of nuclear receptors, which maybe used in the pharmaceutical industry. The invention also discloses novel nuclear receptor constructs, recombinant vectors, cells and methods for producing the same in high amounts, as well as their use to produce antibodies, ligands or crystals thereof. The invention is particularly suited for developing modulators of mineralocorticoid receptors, which may be used for treating various disorders, including hypertension.
  • the human mineralocorticoid receptor belongs to a family of ligand-activated transcription factors that includes other steroid, retinoid and Vitamin D receptors, as well as orphan receptors. These receptors have a common modular structure, with three major functional domains : the N-terminal region contains a constitutive transactivation function, the central DNA-binding domain, composed of zinc-finger domains, is involved in DNA binding and receptor dimerization, and the C-terminal region, which contains the Ligand-Binding Domain (LBD) is involved in several important functions, including nuclear localization, interaction with heat-shock protein hsp90, and ligand- dependent activation (Pinon et al., MoI. Cell.
  • LBD Ligand-Binding Domain
  • MR receptor is involved in several important metabolic pathways, including the reabsorption of sodium and the control of blood pressure.
  • agonists or antagonists of the MR have been disclosed and studied in the art for their therapeutic activity, including aldosterone (the natural ligand), progesterone, spironolactone and cortisone.
  • MR antagonists are mainly used as antihypertensive agents in the treatment of essential hypertension. They improve survival in heart failure, and have beneficial effects in preventing the development of cardiac fibrosis and renal damage in patients with essential hypertension. These compounds are also used to treat primary aldosteronism.
  • the present invention discloses, for the first time, the crystal structures of the LBD of MR associated with various ligands thereof. These structures, the first to be reported for MR, identify the specific contacts between the LBD and MR ligands, clarify the mechanism of activation of this receptor and allow, for the first time, the design or screening or identification of specific ligands of the MR.
  • the invention also provides constructs and compounds suitable for screening a candidate MR modulator.
  • the invention also provides improved methods of producing MR LBD polypeptides, which may be used to generate antibodies, to screen ligands, or for further crystallization.
  • An object of the present invention thus resides in isolated or purified complexes comprising a MR LBD polypeptide and a ligand thereof.
  • Another object of this invention resides in a crystalline complex comprising a MR LBD polypeptide and a ligand thereof.
  • a further object of this invention relates to any polypeptide comprising a MR LBD polypeptide sequence fused to a tag.
  • the MR LBD polypeptide sequence and the tag may be fused directly or through a linker sequence, which preferably comprises a cleavage domain.
  • the MR LBD polypeptide is preferably a human wild-type or mutant MR LBD polypeptide.
  • An other object of this invention lies in a polypeptide comprising a mutated human MR LBD sequence, wherein the mutated MR LBD comprises a mutation selected from N770A, Q776A, S810L, S810M, R817A, M852A C910A, T945A and any combinations thereof.
  • An other object of this invention is an isolated polypeptide comprising a MR LBD polypeptide sequence comprising amino acid residues 737-984 of SEQ ID NO: 1 or a mutant thereof, more preferably amino acid residues 731-984 of SEQ ID NO: 1 or a mutant thereof, wherein said polypeptide does not contain amino acid residues 1-730 of a MR polypeptide sequence.
  • the invention also relates to any nucleic acid encoding a polypeptide as defined above, as well as any vector comprising such a nucleic acid and any recombinant cell comprising such a nucleic acid or vector.
  • a further aspect of this invention relates to methods of producing a MR LBD polypeptide, comprising:
  • this invention relates to methods of producing a MR LBD polypeptide, comprising:
  • the cell is cultured in the presence of a MR ligand, and a complex of the MR LBD polypeptide and the ligand is collected.
  • the cell is a prokaryotic cell, more preferably an E. coli strain.
  • a further object of this invention is a method for preparing a crystalline complex comprising a MR LBD polypeptide and a ligand thereof, the method comprising:
  • the invention also relates to the use of a polypeptide or of a complex as defined above for drug design or screening.
  • An other object of this invention resides in the use of a polypeptide or of a complex as defined above for the production of an anti MR antibody.
  • the invention also relates to any antibody that binds an epitope comprised in a polypeptide or in a complex as defined above.
  • the antibody may be a polyclonal antibody, a monoclonal antibody, or a fragment or derivative thereof.
  • Such antibodies may be used for instance for detecting or dosing the MR in any sample, in vitro, ex vivo or in vivo, for purification purposes, or as binding reagents in binding experiments.
  • a further object of this invention resides in methods for identifying, characterizing, screening or optimizing MR ligands, the method comprising contacting a candidate compound in vitro with a polypeptide or a complex as defined above, and determining the ability of said candidate compound to bind the MR LBD domain of said polypeptide or complex.
  • the invention relates to methods for identifying, characterizing, screening or optimizing MR ligands, the method comprising contacting a candidate compound in vitro with a recombinant cell as defined above, more preferably a comprising a recombinant nucleic acid encoding a MR LBD polypeptide fused to a tag, under conditions allowing expression of the MR LBD polypeptide in said cell, and assessing the production of a complex between the MR LBD polypeptide and the candidate compound.
  • the formation of said complex can be assessed by determining the presence of soluble MR LBD polypeptides in said culture.
  • the invention also relates to methods for identifying a MR modulator, comprising: (a) providing a computerized modeling system comprising atomic coordinates of a MR LBD polypeptide complex,
  • the invention also resides in methods for producing a candidate MR modulator, comprising:
  • the method may be used for identifying or producing specific MR modulators, including agonists or antagonists thereof.
  • the atomic coordinates preferably comprise the atomic coordinates of Table 1 or Table 2.
  • the invention also encompasses the use of a compound produced by a method as defined above, for the manufacture of a medicament for use in the treatment of a human subject, in particular for regulating blood pressure.
  • the invention also encompasses corresponding methods of treatment, comprising administering to a subject in need thereof an effective amount of a compound produced by a method as defined above.
  • MR antagonists compounds produced by the present invention can be used as anti-hypertensive agents, e.g., to treat, prevent or alleviate essential hypertension, heart failure (in particular to improve survival in heart failure), cardiac fibrosis, primary aldosteronism or renal damages in patients with hypertension.
  • MR agonists compounds produced by the present invention can be used to treat or prevent or alleviate for instance adrenal gland diseases (Addison's disease).
  • a further object of this invention resides in the use of a compound selected from 5 ⁇ - pregnan-20-one and a derivative thereof for the manufacture of an anti-progestin medicament.
  • the invention also encompasses corresponding methods of inducing anti- progestin activity in a subject, comprising administering to a subject in need thereof an effective amount of a compound selected from 5 ⁇ -pregnan-20-one or a derivative thereof.
  • the medicament or method may be used to treat, prevent or alleviate emergency contraception, long term estrogen-free contraception, and proliferative endometrium diseases such as myomas and endometriosis.
  • the derivatives include 5 ⁇ -pregnan-20-one compounds comprising a side chain at one or several different positions of the steroid skeleton, namely at the position C7, CIl, Cl 5, Cl 8 or Cl 9.
  • Such side chains may be hydrophobic or polar, unsaturated or saturated, aromatic or aliphatic, linear or not, or a combination thereof.
  • the present invention now discloses and provides MR polypeptides, in purified or isolated form, either alone or in complexes with ligands, which may be used in many applications, such as to produce antibodies, to screen or validate MR ligands, and/or to produce MR crystals.
  • the invention relates to any polypeptide comprising a MR LBD polypeptide sequence fused to a tag.
  • the invention also relates to polypeptides comprising a mutated human MR LBD sequence, wherein the mutated MR LBD comprises a mutation selected from N770A, Q776A, S810L, S810M, R817A, M852A C910A, T945A and any combinations thereof.
  • a "MR LBD” polypeptide designates any amino acid molecule or sequence comprising a functional ligand-binding domain of a mineralocorticoid receptor, i.e., a LBD domain that retains the ability to bind MR ligands.
  • the MR LBD polypeptide is a human wild-type or mutant MR LBD polypeptide, i.e., comprises the amino acid sequence of a functional LBD of a human mineralocorticoid receptor.
  • a MR LBD polypeptide sequence of the present invention comprises amino acid residues 737-984 of SEQ ID NO: 1 or a variant and/or mutant thereof, more preferably amino acid residues 731-984 of SEQ ID NO: 1 or a variant and/or mutant thereof.
  • variant designates any naturally-occurring variants of a MR polypeptide, including SNPs, splicing variants, truncated forms, etc.
  • mutant designates any polypeptide comprising one or several amino acid modifications, including one or several amino acid substitution(s), deletion(s) or insertion(s).
  • mutant designates MR LBD sequences comprising between 1 and 5 amino acid modifications, more preferably between 1 and 4, even more preferably, 1, 2 or 3 amino acid modifications. Specific examples of such mutants include MR LBD polypeptides comprising a mutation selected from N770A, Q776A, S810L, S810M, R817A, M852A C910A, T945A and any combinations thereof.
  • the invention now discloses that the C910A mutation enables the crystallization of the MR LBD polypeptide, by increasing the stability and productivity of the polypeptide. Furthermore, the C910A mutation does not affect the ability of the mutated MR LBD polypeptide to bind MR ligands. Accordingly, the invention relates to any MR polypeptide or MR LBD comprising the mutation C91 OA or any other mutation resulting in the replacement of cysteine residue 910 by an other amino acid residue devoid of free SH group. The invention more specifically relates to a functional human MR polypeptide or MR LBD comprising a mutation resulting in the replacement of cysteine residue 910 by an other amino acid residue devoid of free SH group. As discussed above, the polypeptides of this invention may include a combination of mutations, such as S810L and C910X, X being any amino acid residue devoid of free SH group, preferably an alanine residue.
  • the invention relates to an isolated polypeptide comprising a MR LBD polypeptide sequence comprising amino acid residues 737-984 of SEQ ID NO: 1 or a variant or mutant thereof, more preferably amino acid residues 731-984 of SEQ ID NO: 1 or a variant or mutant thereof, wherein said polypeptide does not contain amino acid residues 1-730 of a MR polypeptide sequence.
  • the MR LBD polypeptide sequence comprises a mutation selected from N770A, Q776A, S810L, S810M, R817A, M852A C910A, T945A and any combinations thereof.
  • polypeptides of this invention may comprise additional amino acid residues, which may be heterologous to a MR polypeptide sequence (i.e., not found in a naturally-occurring MR polypeptide, or arranged in a different manner).
  • the invention provides polypeptides comprising a MR LBD polypeptide sequence fused to a tag.
  • the tag may be located at any end of the polypeptide, i.e., N- or
  • the tag is located at one (or both) terminal ends of the MR LBD polypeptide sequence.
  • LBD polypeptide sequence and the tag may be fused directly to each other, or, more preferably, through a linker sequence, which preferably comprises a cleavage domain.
  • the tag may be any amino acid domain conferring on the polypeptide additional property(ies), such as stability, solubility, conformation, ease of purification, etc.
  • tags include, for instance, GST, Thioredoxin, Maltose binding protein (MBP) and a polyHis (comprising e.g., from 3 to 8 consecutive histidine residues), which may be used in combination(s).
  • the invention relates to a polypeptide comprising a MR LBD polypeptide sequence and a GST sequence, the GST sequence being fused directly or through a linker to the N-terminus of the MR LBD polypeptide sequence.
  • the invention relates to a polypeptide comprising a MR LBD polypeptide sequence and a polyHis sequence, the polyHis sequence being fused directly or through a linker to the N- or C-terminus of the MR LBD polypeptide sequence.
  • the invention relates to a polypeptide comprising a MR LBD polypeptide sequence and a MBP sequence, the MBP sequence being fused directly or through a linker to the N- or C-terminus of the MR LBD polypeptide sequence.
  • the invention relates to a polypeptide comprising a MR LBD polypeptide sequence and a thioredoxin sequence, the thioredoxin sequence being fused directly or through a linker to the N- or C-terminus of the MR LBD polypeptide sequence.
  • the polypeptide further comprises a polyHis tag.
  • polypeptides may be produced by various techniques known per se in the art, such as by recombinant techniques, artificial synthesis or combinations thereof. Improved production methods using recombinant techniques will be disclosed below.
  • the invention also relates to any nucleic acid encoding a polypeptide as defined above.
  • the nucleic acid may be DNA (e.g., cDNA) or RNA (e.g., mRNA), and may be single- or double-stranded.
  • the nucleic acid may be in isolated form, or included in a cloning and/or expression vector.
  • the invention also relates to a recombinant vector comprising a nucleic acid molecule as defined above.
  • the vector may be a plasmid, cosmid, phage, viral vector, artificial chromosome, etc.
  • the vector may be either replicating or integrative.
  • telomeres examples include phages and plasmids, which are available in the art.
  • the vector may comprise any regulatory elements, such as a promoter, origin of replication, selection gene, etc. Specific examples of such vectors are disclosed in the experimental section, and represent particular objects of this invention. Production of MR LBD Polypeptides
  • a further aspect of this invention relates to methods of producing a MR LBD polypeptide as disclosed above.
  • a typical production method comprises: (a) culturing a recombinant cell as disclosed above under conditions allowing expression to occur, and
  • the MR LBD polypeptides are typically produced within the cell, and their collection preferably involves a prior step of releasing the polypeptides from the cell, e.g., by altering the cell membranes (e.g., cell lysis).
  • this invention relates to methods of producing a MR LBD polypeptide, comprising: (a) culturing a cell comprising a recombinant nucleic acid encoding a MR LBD polypeptide fused to a tag, under conditions allowing expression to occur,
  • the cell may be any eukaryotic or prokaryotic cell, such as a yeast cell, plant cell, insect cell, mammalian cell or a bacterial cell.
  • the cell is a prokaryotic cell, more preferably an E. coli strain.
  • the polypeptide may be collected by any suitable means or process, including centrifugation, filtration, affinity separation, chromatography, gel migration, etc. In a particular embodiment, the polypeptide is purified or collected based on the presence of the tag moiety, e.g., by affinity using a tag-specific ligand.
  • the MR LBD polypeptide may be separated from the tag by any convenient means, i.e., by chemical, enzymatic or physical cleavage. Where the polypeptide comprises a linker sequence containing a cleavage site, the MR LBD polypeptide is conveniently separated from the tag by use of a specific reagent that cleaves said site.
  • linker sequence to be used in the present invention is SerAspLeuValProArgGlySer, that contains the thrombin cleavage site (LeuValProArgGlySer).
  • SerAspLeuValProArgGlySer contains the thrombin cleavage site (LeuValProArgGlySer).
  • two fragments are generated, tag-SerAspLeuValProArg on the one hand and GlySer-MR LBD on the other hand.
  • Other linker sequences may be found in the literature, such as for instance Factor Xa (IleGluGlyAsp); prescission protease (LeuGluValLeuPheGlnGlyPro) and Enterokinase (AspAspAspAspLys).
  • the cell is cultured in the presence of a MR ligand.
  • a complex of the MR LBD polypeptide and the ligand is formed and collected.
  • the process is conducted by adding the ligand early in the culture, e.g., at the beginning of the production phase.
  • the ligand may be any MR agonist or antagonist.
  • an agonist has its general meaning in the art.
  • an agonist means an agent that supplements or potentiates the bioactivity of a functional protein or polypeptide.
  • an "agonist” is a compound that interacts with MR, mutated or not, to promote a transcriptional response.
  • An agonist can induce changes in a receptor that place the receptor in an active conformation, allowing the receptor to influence transcription, either positively or negatively. There can be several different ligand-induced changes in the receptor's conformation.
  • the term "agonist” specifically encompasses partial agonists.
  • partial agonist means an entity that can bind to a receptor and induce only part of the changes in the receptor or other target that are induced by agonists. The differences can be qualitative or quantitative. Thus, a partial agonist can induce some of the conformation changes induced by agonists, but not others, or it can only induce certain changes to a limited extent.
  • an "antagonist” has its general meaning in the art.
  • an "antagonist” means an agent that decreases or inhibits the bioactivity of a functional protein or polypeptide.
  • an “antagonist” is a compound that interacts with MR, mutated or not, to inhibit a transcriptional response.
  • An antagonist can bind to a receptor but fails to induce conformational changes that alter the receptor's transcriptional regulatory properties or physiologically relevant conformations. Binding of an antagonist can also block the binding, and therefore the actions, of an agonist.
  • the term "antagonist” specifically encompasses partial antagonists.
  • partial antagonist means an entity that can bind to a receptor or other target and inhibit only part of the changes in the receptor or other target that are induced by antagonists. The differences can be qualitative or quantitative. Thus, a partial antagonist can inhibit some of the conformation changes induced by an antagonist, but not others, or it can inhibit certain changes to a limited extent.
  • MR agonists include, for instance aldosterone, Cortisol and deoxycorticosterone.
  • MR antagonist include for instance progesterone, spironolactone and cortisone.
  • the ligand may by any known or selected MR ligand, for which a complex with the MR LBD is sought.
  • the ligand may be a candidate ligand, whose ability to form a complex with the MR LBD is to be assessed. Such embodiment will be disclosed later.
  • polypeptides or complexes of the present invention may be efficiently used to produce MR crystals, anti-MR antibodies or MR ligands.
  • a further object of this invention is a method for preparing a crystalline complex comprising a MR LBD polypeptide and a ligand thereof, the method comprising:
  • the MR LBD polypeptide of step (a) is preferably a recombinant polypeptide, even more preferably produced by a method as disclosed above. Most preferably, step (a) uses a complex of a MR LBD polypeptide and a ligand as produced by a method as disclosed above.
  • the complex is preferably crystallized using the vapor diffusion method.
  • a reservoir solution comprising HEPES or PIPES, pH 6.5 to 7.5, 200-300 mM NaCl and 15 to 30% PEG4000.
  • the complex preferably crystallizes in the space group of P3 1 or P3 2 and diffracts X-ray to a resolution of about 2.5 A or better, most preferably about 2 ⁇ or better.
  • An other object of this invention resides in a crystalline complex comprising a MR LBD polypeptide and a ligand thereof.
  • the crystalline complex preferably has a space group of P3 1 or P3 2 and/or a resolution of about 2.5 A or better.
  • the ligand may be any MR ligand as discussed above.
  • the invention provides a crystalline MR LBD-S810L-C910A complexed with DOC, progesterone or with spironolactone and a crystalline MR LBD- C910A complexed with DOC, which are characterized by any one of the features of Table 3 and 4, or a combination thereof.
  • the invention provides a crystalline MR LBD-S810L- C910A complexed with DOC or with progesterone, which is characterized by the atomic structural coordinates of Table 1 or Table 2, respectively.
  • Aldosterone the main mineralocorticoid hormone, plays a key role in the reabsorption of sodium, and is involved in controlling blood pressure (Bonvalet et al., Kidney Int. Suppl., 1998, 65, S49-56). Its effects are mediated by the mineralocorticoid receptor (MR), a ligand-activated transcription factor belonging to the nuclear receptor superfamily (Evans et al., Science, 1988, 240, 889-895).
  • MR mineralocorticoid receptor
  • the MR LBD-S810L-C910A was crystallized in complexes with progesterone and with DOC, an agonist of both WT and mutant receptors, that differs from progesterone by having a hydroxyl group at the 21 position (Table 1-3, Fig. 1-3).
  • the structures of both MR-S 81OL complexes, the first MR structures to be reported, contain 11 ⁇ -helices and 4 small ⁇ -strands assembled into the canonical 3 layers ⁇ -helical structure of nuclear receptors (Nagy et al., Trends Biochem. Sci., 2004, 29, 317-324) (Fig. 4).
  • the crystal structures reported here clearly identify the contacts involved in the interaction between MR LBD-S810L-C910A and progesterone.
  • the C3 -ketone function at the A-ring of progesterone is hydrogen bonded to the highly conserved residues Gln776 and Arg817 (Fig. 2).
  • the C20-ketone group at the D-ring is C- H-O hydrogen- bonded to the Ca atom of Cys942.
  • the structure unambiguously shows that the C ⁇ - methyl groups of Leu810 form short contacts with the C19-methyl group of progesterone (3.6 A) and with Gln776 (3.0 A) (Fig. 2).
  • the structure also reveals a distance of 4.3 A between Ala773 and Leu810, ruling out the hypothesis based on homology modeling that the stabilizing contact between H3 and H5 helices occurs via these two amino acids (Geller et al., Science, 2000, 289, 119-123).
  • the structure also revealed that progesterone does not establish the hydrogen bond with Asn770, proposed by Pinon et al. (Pinon et al., MoI. Cell. Endocrinol., 2004, 217, 181-188).
  • the network of contacts created by Leu810 at the A-ring is sufficient to stabilize the progesterone/MR LBD-S810L-C910A complex in its active state.
  • DOC adopts a position very similar to that of progesterone, as revealed when the structures are superimposed (Fig. 2).
  • AU the contacts observed in the progesterone/MR LBD-S810L-C910A complex are present in the DOC/MR LBD-S810L-C910A complex.
  • the network of contacts at the A-ring created by Leu810 is present, as well as the hydrogen bond between the C20-ketone function and Cys942.
  • an additional network of hydrogen bonds has been identified in the DOC/MR LBD-S810L-C910A complex.
  • the C21-hydroxyl group of DOC establishes two strong hydrogen bonds with Asn770 and Thr945 (Fig. 1 and 2).
  • the contact between the C21-hydroxyl group and Asn770 has been shown to be determinant for MR activation (Fagart et al., EMBO J., 1998, 17, 3317-3325). This contact must also be of crucial importance in stabilizing the aldosterone/MR-S810L complex in its active state. Indeed, despite a slight lower affinity (Fig. 5b), aldosterone retains its agonist character when Gln776 or Arg817 are replaced by an alanine within MR-S810L (Fig. 6a).
  • the invention also relates to any antibody that binds an epitope comprised in a polypeptide or in a complex as defined above.
  • Such antibodies may be used for instance for detecting or dosing the MR in any sample, in vitro, ex vivo or in vivo, for purification purposes, or as binding reagents in binding experiments.
  • the antibody may be a polyclonal or a monoclonal antibody.
  • the term antibody also includes fragments and derivatives thereof, in particular fragments and derivatives of said monoclonal or polyclonal antibodies having substantially the same antigenic specificity. These include antibody fragments (e.g., Fab, Fab'2, CDRs, etc), humanized antibodies, poly-functional antibodies, Single Chain antibodies (ScFv), etc. These may be produced according to conventional methods, including immunization of an animal and collection of serum (polyclonal) or spleen cells (to produce hybridomas by fusion with appropriate cell lines).
  • the antigen is generally combined with an adjuvant (e.g., Freund's adjuvant) and administered to an animal, typically by sub-cutaneous injection. Repeated injections may be performed. Blood samples are collected and immunoglobulins or serum are separated. Monoclonal antibodies may be produced from various species as described for instance in Harlow et al (Antibodies: A laboratory Manual, CSH Press, 1988). Briefly, these methods comprise immunizing an animal with the antigen, followed by a recovery of spleen cells, which are then fused with immortalized cells, such as myeloma cells. The resulting hybridomas produce the monoclonal antibodies and can be selected by limit dilutions to isolate individual clones.
  • an adjuvant e.g., Freund's adjuvant
  • Antibodies may also be produced by selection of combinatorial libraries of immunoglobulins, as disclosed for instance in Ward et al (Nature 341 (1989) 544).
  • Fab or F(ab')2 fragments may be produced by protease digestion, according to conventional techniques.
  • Humanized antibodies can be prepared as previously described (Jones 1986; Riechmann 1988).
  • Preferred antibodies of this invention are prepared by immunization with a MR LBD polypeptide or complex of this invention.
  • the antibodies may be coupled to heterologous moieties, such as toxins, labels, drugs or other therapeutic agents, covalently or not, either directly or through the use of coupling agents or linkers.
  • heterologous moieties such as toxins, labels, drugs or other therapeutic agents
  • a further object of this invention resides in methods for identifying, characterizing, screening or optimizing MR ligands, using the constructs and methods as disclosed above. More particularly, these screening or validating methods use the polypeptides, complexes or recombinant cells as disclosed above to evaluate the ability of a candidate molecule to bind a MR polypeptide, or use the atomic coordinates obtained from MR crystals to design and produce ligands.
  • the method comprises contacting a candidate compound in vitro with a polypeptide as defined above, and determining the ability of said candidate compound to bind the MR LBD domain of said polypeptide.
  • the polypeptide may be in solution, or immobilized on a support.
  • the binding of a candidate molecule to such polypeptide may be assessed by any technique known per se in the art, such as immunoenzymatic or fluorescent or isotopic techniques, the use of a labeled reference ligand, competition assays, gel migration, etc.
  • the method comprises contacting a candidate compound in vitro with a complex as defined above and determining the ability of said candidate compound to displace the binding of the ligand in the MR LBD domain of said complex.
  • Well known techniques in the art can be used for measuring the displacement of said ligand.
  • the dosage of the ligand can be carried out by High
  • the complex may be in solution, or immobilized on a support.
  • the invention relates to methods for identifying, characterizing, screening or optimizing MR ligands, the method comprising contacting a candidate compound in vitro with a recombinant cell as defined above, more preferably comprising a recombinant nucleic acid encoding a MR LBD polypeptide fused to a tag, under conditions allowing expression of the MR LBD polypeptide in said cell, and assessing the production of a complex between the MR LBD polypeptide and the candidate compound.
  • the formation of said complex can be assessed by determining the presence of soluble MR LBD polypeptides in said culture.
  • the invention also relates to methods for identifying a candidate MR modulator, comprising:
  • a "MR modulator” designates any compound, natural or not (e.g., synthetic), that is able to interact with a MR (mutated or not) to modulate a transcriptional response.
  • said MR modulator is an MR agonist or an MR antagonist.
  • the compound is a steroid compound.
  • binding pocket of MR LBD refers to the cavity within the MR LBD where a ligand of a MR can bind. This cavity can be empty, or can contain water molecules or other molecules from the solvent.
  • the binding pocket generally comprises the region of space encompassed by residues shown in Figure 1. Depending on the structure of the ligand, the "binding pocket of MR LBD” can also include other residues that are unmasked by ligand binding to the MR LBD.
  • the invention also resides in methods for producing a candidate MR modulator, comprising:
  • the method may be used for identifying or producing specific MR modulators, including agonists or antagonists thereof.
  • the atomic coordinates preferably comprise the atomic coordinates of Table 1 or Table 2.
  • the invention also relates to any data carrier (e.g., hardware, software, floppy disc, etc.) comprising atomic coordinates of a MR LBD polypeptide complex.
  • the invention also relates to the use of a crystallized complex as defined above to obtain atomic coordinates of a MR LBD polypeptide complex.
  • the invention allows the design, screening, identification, synthesis or optimisation of MR modulators. More particularly, the invention provides improved methods of producing MR ligands having increased selectivity.
  • PR Progesterone Receptor
  • MR LBD-S810L-C910A the crystal structures of the LBD of the Progesterone Receptor (PR) and of the MR LBD-S810L-C910A, and can therefore allow the design of novel anti-progestin compounds.
  • PR is characterized by having a methionine residue at the position corresponding to Leu ⁇ lO in MR-S810L (Met759 in hPR), and MR Asn770 is conserved in PRs (Asn719 in hPR).
  • the Met759 in PR creates a network of contacts at the progesterone A-ring similar to that of Leu810 in MR-S810L and Asn719 does not form any hydrogen bond with the ligand as it occurs in MR-S 81OL complexed with progesterone (Fig. 7).
  • 5 ⁇ -pregnan-20-one compound Pl
  • 5 ⁇ -pregnan-20-one is commercially-available from Steraloids (Newport, RI USA) under reference P4230-000 and has the following formula:
  • Such a compound, as well as derivatives thereof, shall be superior to existing PR antagonists due to the absence of the ketone function at the C3 position, which should increase the selectivity towards the PR. Furthermore, the affinity of this compound for
  • PR could easily be increased, if necessary, by introducing one or several side chain(s) at different positions of the steroid skeleton, namely at the position C7, C11, C15, C18 or C 19.
  • These side chains are preferably hydrophobic or polar, unsaturated or saturated, aromatic or aliphatic, linear or not, or a combination thereof.
  • RU486 mimethyroxine
  • the potential clinical applications of progesterone receptor antagonists cover a broad field and are very promising in major public health areas, including emergency contraception, long term estrogen-free contraception, myomas and endometriosis (progesterone receptor antagonists displaying direct antiproliferative effects in the endometrium).
  • An object of this invention thus resides in the use of a MR modulating compound produced by a method as defined above, for the manufacture of a medicament for use in the treatment of a human subject, in particular for regulating blood pressure.
  • the invention also encompasses corresponding methods of treatment, comprising administering to a subject in need thereof an effective amount of a MR modulating compound produced by a method as defined above.
  • MR antagonists compounds produced by the present invention can be used as anti-hypertensive agents, e.g., to treat, prevent or alleviate essential hypertension, heart failure (in particular to improve survival in heart failure), cardiac fibrosis, primary aldosteronism or renal damages in patients with hypertension.
  • MR agonists compounds produced by the present invention can be used to treat or prevent or alleviate for instance adrenal gland diseases (Addison's disease).
  • a further object of this invention resides in the use of a compound selected from 5 ⁇ - pregnan-20-one having the following formula:
  • the invention also encompasses corresponding methods of inducing anti-progestin activity in a subject, comprising administering to a subject in need thereof an effective amount of a compound selected from 5 ⁇ -pregnan-20-one and a derivative thereof. More preferably, the medicament or method may be used for emergency contraception and long term estrogen-free contraception, and to treat, prevent or alleviate proliferative endometrium diseases such as myomas and endometriosis.
  • the derivatives include 5 ⁇ - pregnan-20-one compounds comprising a side chain at one or several different positions of the steroid skeleton, namely at the position C7, CIl, C15, C18 or C19. These side chains could be hydrophobic or polar, unsaturated or saturated, aromatic or aliphatic, linear or not, or a combination of them.
  • the above compounds may be administered according to conventional routes, such as systemic or oral administrations. They may be used at dosages similar to those reported for commercial MR or PR antagonists.
  • the above compounds can be administered in several dosages or as a single dose until a desired response has been achieved.
  • the treatment is typically monitored and repeated dosages can be administered as necessary.
  • Compounds of the invention may be administered according to dosage regimens established whenever activation or inactivation of MR or PR is required.
  • the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day.
  • the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient.
  • An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • compositions containing a pharmaceutically acceptable carrier can be administered in a variety of different ways. Examples include administering a composition containing a pharmaceutically acceptable carrier via oral, intranasal, rectal, topical, intraperitoneal, intravenous, intramuscular, subcutaneous, subdermal, transdermal, and intrathecal methods.
  • the active ingredient can be administered in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as elixirs, syrups, and suspensions.
  • the active component(s) can be encapsulated in gelatin capsules together with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate.
  • inactive ingredients and powdered carriers such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate.
  • additional inactive ingredients that may be added to provide desirable color, taste, stability, buffering capacity, dispersion or other known desirable features are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, and edible white ink.
  • Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric-coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
  • solid or liquid formulations in an enteric-coated or otherwise protected form.
  • the formulation can be mixed or simply coadministered with a protectant, such as a liquid mixture of medium chain triglycerides, or the formulation can be filled into enteric capsules (e.g., of soft or hard gelatin, which are themselves optionally additionally enteric coated).
  • enteric capsules e.g., of soft or hard gelatin, which are themselves optionally additionally enteric coated.
  • solid formulations comprising above mentioned compounds can be coated with enteric materials to form tablets.
  • the thickness of enteric coating on tablets or capsules can vary. Typical thickness range from 0.5 to 4 microns in thickness.
  • the enteric coating may comprise any of the enteric materials conventionally utilized in orally administrable pharmaceutical formulations.
  • Suitable enteric coating materials are known, for example, from Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, 17th ed. (1985); and Hagars Handbuch der Pharmazeutica Praxie, Springer Verlag, 4th ed., Vol. 7a (1971).
  • compositions prepared for intravenous administration typically contain 100 to 500 ml of sterile 0.9% NaCl or 5% glucose optionally supplemented with a 20% albumin solution and 100 to 500 mg of a polypeptide of the invention.
  • Methods for preparing parenterally administrable compositions are well-known in the art and described in more detail in various sources, including, for example, Remington's Pharmaceutical Science, Mack Publishing, Philadelphia, PA, 17th ed., (1985).
  • compositions are to be used in vivo
  • the components used to formulate the pharmaceutical compositions of the present invention are preferably of high purity and are substantially free of potentially harmful contaminants (e.g., at least National Food (NF) grade, generally at least analytical grade, and more typically at least pharmaceutical grade).
  • compositions intended for in vivo use are usually sterile.
  • the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxins, which may be present during the synthesis or purification process.
  • Compositions for parental administration are also sterile, substantially isotonic and made under GMP conditions.
  • FIG. 1 Crystal structures of the MR LBD-S810L-C910A. Diagram showing LBD/DOC interactions. Hydrogen bonds and van der Waals interactions are indicated as solid arrows and dashed lines, respectively. The colors of the residue names are based on the LBD structural elements from which they originate. W indicates a water molecule.
  • FIG. 2 Superimposition of the DOC/ and progesterone/MR LBD-S810L-C910A crystal structures. Stereo view showing the superimposition of the ligand-binding pockets of MR LBD-S810L-C910A associated with DOC and with progesterone. The carbon atoms are depicted in light blue and white in the DOC- and progesterone-MR LBD-S810L-C910A complexes, respectively. Only polar and charged residues, and two critical hydrophobic residues are shown. The panel b of the figure was produced using Dino (DINO : Visualizing Structural Biology ( 2002 ) http : //www . dino3d. org) .
  • DINO Visualizing Structural Biology
  • FIG. 3 Stereo view of the 2Fo-Fc electron density map showing DOC and the surrounding residues in the MR LBD-S810L-C910A binding pocket. The map was calculated at 1.96 A and contoured at Is .
  • FIG. 5 Scatchard plot of [ 3 H]progesterone (a) and [ 3 H] aldosterone (b) binding. Mutant MRs were synthesized in-vitro in rabbit reticulocyte lysate. After a three-fold dilution, the lysate was incubated for 4 h at 4°C with increasing concentration of labeled steroid. Bound and Unbound steroids were separated by the dextran-charcoal method.
  • FIG. 6 Transcriptional activation of luciferase activity by mutant MRs in response to aldosterone and progesterone.
  • Transfected HEK-293T cells were exposed for 24 h to increasing concentrations of aldosterone (a, full lines), progesterone alone (a, dashed dotted) or 10 "7 M aldosterone plus increasing concentrations of progesterone (b).
  • Transactivations were determined by luciferase activity, normalized to the internal ⁇ - galactosidase control, and expressed as a percentage of the MR-S810L activity at 10 -6 M aldosterone. Each point is the mean ⁇ SEM of three separate experiments.
  • Figure 7 Superimposition of the ligand-binding pocket of MR LBD-S810L-C910A and PR complexed with progesterone. Only polar and charged residues, and a critical hydrophobic residue are showed. The carbon atoms are depicted in light blue and white for the progesterone/PR LBD and progesterone/MR LBD-S810L-C910A complexes, respectively. The figure was produced using DINO (DINO: Visualizing Structural Biology (2002) http://www.dino3d.org)
  • the expression plasmid pchMR contains the entire coding sequence of the human MR (Fagart et al., EMBO J., 1998, 17, 3317-3325).
  • the plasmid pchMR-C910A encoding for MR-C910A was constructed from pchMR using the quick-change, site-directed mutagenesis procedure from Stratagene (Amsterdam, The Netherlands) and the primers 5'-ATGGTAACTAAGGCTCCCAACAATTCT-3' (SEQ ID NO: 2) and 5'-CCCAGAATTGTTGGGAGCCTTAGTACCAT-3' (SEQ ID NO: 3) (MWG BIOTECH, Ebersberg, Germany).
  • the Bpu1102I-Afl lI fragment of the resulting MR construct was subcloned into pchMR.
  • the S810L mutation was introduced in the plasmid pchMR-Q776A, pchMR-R817A (Fagart et al., EMBO J., 1998, 17, 3317-3325) and pchMR-C910A using the primers 5'- TCTTGGATGTGTCTATTATCATTTGCC TTGAGCTGG-3' (SEQ ID NO: 4) and 5'- CCAGCTCAAGGCAAATGATAATAGACACATCCAAGA-3' (SEQ ID NO: 5) using the same procedure as above.
  • Sequence 731-984 from pchMR-S810L-C910A or pchMR-C910A was amplified by PCR using the primers 5'-GCGTGGATCCTCACGAGCGCTCACACCTTCCCCCG-3' (SEQ ID NO: 6) and 5'-
  • the pMRLBDA852 vector containing the M852A and C910A mutations was constructed from the pMRLBD vector using the quick-change, site-directed mutagenesis procedure from Stratagene (Amsterdam, The Netherlands) and the primers 5'-GAACTATGCCAGGGGGCGCACCAAATCAGCCTTC-3' (SEQ ID NO: 8) and 5'-GAAGGCTGATTTGGTGCGCCCCCTGGCATAGTTC-3' (SEQ ID NO: 9) (MWG BIOTECH, Ebersberg, Germany). After sequencing, the Bam ⁇ l- HindIIl fragment of the resulting construct was subcloned into pMRLBD.
  • the pMRLBD, pMRLBDL810 and pMRLBD A852 vectors code for the fusion proteins in which the LBD harboring the C910A mutation (pMRLBD), the S810L and C910A mutations (pMRLBDL810) or the M852A and C910A mutations (pMRLBD A852) was fused at the C-terminus of the Glutathione S-transferase (GST) from Schistosoma Japonicum through the 8 amino acids linker (SerAspLeuValProArgGlySer) that contains the thrombin cleavage site (LeuValProArgGlySer).
  • GST Glutathione S-transferase
  • the plasmid pFC31Luc contains the mouse mammary tumor virus (MMTV) promoter that drives the luciferase gene (Gouilleux et al., Nucleic Acids Res., 1991, 19, 1563- 1669).
  • the plasmid pc ⁇ gal codes for ⁇ -galactosidase (Pinon et al., MoI. Cell. Endocrinol., 2004, 217, 181-188).
  • Bound and free steroids were separated by the dextran-charcoal method (Fagart et al., EMBO J., 1998, 17, 3317-3325).
  • the change in Bound as a function of Unbound steroid was analyzed as previously described (Claire et al., FEBS Lett., 1978, 88, 295-299), and the dissociation constant at equilibrium, Kd, was calculated. Cultured cells and transfection procedures.
  • HEK-293T cells were cultured and transfected in high glucose containing Dulbecco's modified essential medium supplemented with 10% (v/v) charcoal stripped and heat- inactivated fetal calf serum (FCS), 25 mM HEPES, 2x non-essential amino acids, 2 mM glutamine, 100 IU/ml penicillin and 100 ⁇ g/ml streptomycin at 37°C in a humidified atmosphere with 5% CO 2 . Transfection was carried out using the phosphate calcium precipitation method.
  • FCS fetal calf serum
  • the phosphate solution prepared for one T75 flask, contained 2 ⁇ g of one of the MR expression vectors, 7 ⁇ g pFC31Luc and 1 ⁇ g pc ⁇ gal in HBS supplemented with 160 mM CaCl 2 . Twelve hours after transfection, the cells were replated in twelve-well plates. The steroids (Sigma) were added 24 h after seeding, and the plates then incubated for 24 h. The ⁇ -galactosidase (Herbomel et al., Cell, 1984, 39, 653-662) and luciferase (de Wet et al., MoI. Cell. Biol., 1987, 7, 725-737) activities of cell extracts were assayed. To standardize transfection efficiency, the relative light units obtained in the luciferase assay, were divided by the optical density obtained in the ⁇ - galactosidase assay. Each point is the mean ⁇ SEM of three separate experiments.
  • S810L, MR-C910A and MR-S810L-C910A are activated by aldosterone in a dose dependent manner and that the aldosterone concentration required to induce 50% of the maximal receptor response was nearly the same (0.1 nM).
  • the cells were disrupted by sonication in a TENGDO buffer (50 mM Tris-HCl, pH 7.5, 5 niM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n-octyl- ⁇ -glucoside).
  • TENGDO buffer 50 mM Tris-HCl, pH 7.5, 5 niM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n-octyl- ⁇ -glucoside).
  • the lysate was centrifuged at 105,000 g for 1 h at 4°C, and the supernatant was loaded onto a 5 ml GSTrap column (Amersham) equilibrated in TENGDO buffer. After washing, the fusion protein was eluted using the loading buffer supplemented with 15 mM reduced
  • TENGDO buffer was added to the eluate to give a protein concentration of 1 mg/ml, and thrombin cleavage (20 units/mg fusion protein) was performed overnight at 4° C.
  • the protein mixture was then diluted 5-fold in HGDO buffer (HEPES 10 mM, pH 6.8, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n- octyl- ⁇ -glucoside) loaded onto a UnoSl column (Biorad) and eluted with a NaCl gradient (0 - 500 mM) in HGDO buffer.
  • the fractions containing the LBD were pooled, and concentrated onto a vivaspin concentrator (Vivascience, 6 ml, 10,000 Da of molecular weight cut-off) to a protein content of 8.5 mg/ml.
  • BL21 codon-plus (DE3) RIL stains (Stratagene) transformed using the expression vector pMRLBDL810 were grown at 37 0 C in 2x LB supplemented with ampicillin (100 ⁇ g/ml), choramphenicol (50 ⁇ g/ml) and 100 ⁇ M progesterone, and the expression was induced for 14-16 hours at 15°C by adding 100 ⁇ M IPTG.
  • the cells were disrupted by sonication in a TENGPO buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M progesterone and 0.1% (w/v) n- octyl- ⁇ -glucoside).
  • TENGPO buffer 50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M progesterone and 0.1% (w/v) n- octyl- ⁇ -glucoside).
  • the lysate was centrifuged at 105,000 g for 1 h at 4°C, and the supernatant was loaded onto a 5 ml GSTrap column (Amersham) equilibrated in TENGPO buffer. After washing, the fusion protein was eluted using the loading buffer supplemented with 15
  • TENGPO buffer was added to the eluate to give a protein concentration of 1 mg/ml, and thrombin cleavage (20 units/mg fusion protein) was performed overnight at 4° C.
  • the protein mixture was then diluted 5-fold in HGPO buffer (HEPES 10 mM, pH 6.8, 10% (v/v) glycerol, 100 ⁇ M progesterone and 0.1% (w/v) n-octyl- ⁇ -glucoside) loaded onto a UnoSl column (Biorad) and eluted with a NaCl gradient (0 - 500 mM) in HGPO buffer.
  • the fractions containing the LBD were pooled.
  • the eluate was concentrated onto a vivaspin concentrator (Vivascience, 6 ml, 10,000 Da of molecular weight cut-off) to a protein content of 8.5 mg/ml.
  • BL21 codon-plus (DE3) RIL stains (Stratagene) transformed using the expression vector pMRLBDL810 were grown at 37 0 C in 2x LB supplemented with ampicillin (100 ⁇ g/ml), choramphenicol (50 ⁇ g/ml) and 100 ⁇ M spironolactone, and the expression was induced for 14-16 hours at 15°C by adding 100 ⁇ M IPTG.
  • the cells were disrupted by sonication in a TENGSO buffer (50 mM Tris-HCl, pH 7.5, 5 niM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M spironolactone and 0.1% (w/v) n- octyl- ⁇ -glucoside).
  • TENGSO buffer 50 mM Tris-HCl, pH 7.5, 5 niM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M spironolactone and 0.1% (w/v) n- octyl- ⁇ -glucoside).
  • the lysate was centrifuged at 105,000 g for 1 h at 4°C, and the supernatant was loaded onto a 5 ml GSTrap column (Amersham) equilibrated in TENGSO buffer. After washing, the fusion protein was eluted using
  • TENGSO buffer was added to the eluate to give a protein concentration of 1 mg/ml, and thrombin cleavage (20 units/mg fusion protein) was performed overnight at 4° C.
  • the protein mixture was then diluted 5-fold in HGSO buffer (HEPES 10 mM, pH 6.8, 10% (v/v) glycerol, 100 ⁇ M spironolactone and 0.1% (w/v) n-octyl- ⁇ -glucoside) loaded onto a UnoSl column (Biorad) and eluted with a NaCl gradient (0 - 500 mM) in HGSO buffer.
  • the fractions containing the LBD were pooled.
  • the eluate was concentrated onto a vivaspin concentrator (Vivascience, 6 ml, 10,000 Da of molecular weight cut-off) to a protein content of 8.5 mg/ml.
  • BL21 codon-plus (DE3) RIL stains (Stratagene) transformed using the expression vector pMRLBD were grown at 37 0 C in 2x LB supplemented with ampicillin (100 ⁇ g/ml), choramphenicol (50 ⁇ g/ml) and 100 ⁇ M DOC, and the expression was induced for 14-16 hours at 15°C by adding 100 ⁇ M IPTG.
  • the cells were disrupted by sonication in a TENGDO buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n-octyl- ⁇ -glucoside).
  • TENGDO buffer 50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n-octyl- ⁇ -glucoside).
  • the lysate was centrifuged at 105,000 g for 1 h at 4°C, and the supernatant was loaded onto a 5 ml GSTrap column (Amersham) equilibrated in TENGDO buffer. After washing, the fusion protein was eluted using the loading buffer supplemented with 15 mM reduced gluta
  • TENGDO buffer was added to the eluate to give a protein concentration of 1 mg/ml, and thrombin cleavage (20 units/mg fusion protein) was performed overnight at 4° C.
  • the protein mixture was then diluted 5-fold in HGDO buffer (HEPES 10 mM, pH 6.8, 10% (v/v) glycerol, 100 ⁇ M DOC and 0.1% (w/v) n- octyl- ⁇ -glucoside) loaded onto a UnoSl column (Biorad) and eluted with a NaCl gradient (0 - 500 mM) in HGDO buffer.
  • the fractions containing the LBD were pooled.
  • the eluate was concentrated onto a vivaspin concentrator (Vivascience, 6 ml, 10,000 Da of molecular weight cut-off) to a protein content of 8.5 mg/ml.
  • the crystals of the MR LBD-S810L-C910A associated with DOC or progesterone were grown at room temperature using the vapor diffusion method in 2 ⁇ l hanging drops containing 1 ⁇ l protein solution and 1 ⁇ l reservoir solution.
  • the reservoir solution for the DOC/MR LBD-S810L-C910A complex contained 100 mM HEPES, pH 7.0, 230 mM NaCl, 17.5% PEG 4000 and that for the progesterone/MR LBD-S810L-C910A complex contained 100 mM PIPES, pH 6.8, 230 mM NaCl, 27.5% PEG 4000. Crystals grew within a few days to 200 x 200 x 20 ⁇ m 3 .
  • the DOC/MR LBD-S810L-C910A crystal was flash frozen in the mother liquor supplemented with 30% PEG300, whereas the progesterone/MR LBD-S810L-C910A crystal was flash frozen without adding cryoprotecting agent.
  • the crystals of the MR LBD-S810L-C910A associated with spironolactone was grown at room temperature using the vapor diffusion method in 2 ⁇ l hanging drops containing 1 ⁇ l protein solution and 1 ⁇ l reservoir solution.
  • the reservoir solution contained 100 mM HEPES, pH 6.8, 230 mM NaCl, 25% PEG 4000. Crystals grew within a few days to 200 x 200 x 20 ⁇ m .
  • the crystal was flash frozen without adding cryoprotecting agent.
  • the crystals of the MR LBD-C910A associated with DOC was grown at room temperature using the vapor diffusion method in 2 ⁇ l hanging drops containing 1 ⁇ l protein solution and 1 ⁇ l reservoir solution.
  • the reservoir solution contained 100 mM HEPES, pH 7.1, 460 mM NaCl, 20% PEG 4000. Crystals grew within a few days to 200 x 200 x 20 ⁇ m 3 .
  • the crystal was flash frozen in 100 mM HEPES, pH 7.1, 230 mM NaCl, 20% PEG 4000 and 30% PEG300.
  • Diffraction data were collected at 69°K on FIP-BM30A beamline at the European Synchrotron Radiation Facility (Grenoble, France) using a MAR CCD detector.
  • the wavelengths used during data collection were 0.9796 and 0.9798 A for the DOC/MR LBD-S810L-C910A and progesterone/MR LBD-S810L-C910A crystals, respectively. These crystals diffracted up to 1.96 and 2.34 A, respectively.
  • the data were processed using MOSFLM (Powell et al., Acta Crystallogr. D Biol. Crystallogr., 1999, 55, 1690- 1695) and SCALA from the CCP4 program suite (Collaborative Computational Project, N.
  • the CCP4 suite programs for protein crystallography., Acta Crystallogr. D Biol. Crystallogr., 1994, 50, 760-763). Data collection statistics are summarized in Table 3. The wavelengths used during data collection were 0.9799 and 0.9797 A for the DOC/MR LBD-C910A and spironolactone/MR LBD-S810L-C910A crystals, respectively. These crystals diffracted up to 2.46 and 2.31 A, respectively. The data were processed using XDS (Kabsch, J., Appl. Cryst., 1993, 26, 795-800). Data collection statistics are summarized in Table 4.
  • HEK-293T cells are cultured and transfected in high glucose containing Dulbecco's modified essential medium supplemented with 10% (v/v) charcoal stripped and heat-inactivated fetal calf serum (FCS), 25 mM HEPES, 2x non-essential amino acids, 2 mM glutamine, 100 IU/ml penicillin and 100 mg/ml streptomycin at 37°C in a humidified atmosphere with 5% CO 2 .
  • Transfections are carried out using the phosphate calcium precipitation method.
  • the phosphate solution prepared for one T75 flask (20ml), contains 4 ⁇ g of the PR expression vectors (pSG5PR), 14 ⁇ g pFC31Luc and 2 mg pSV ⁇ gal (Promega) in HBS supplemented with 125 mM CaC12. Twelve hours after transfection, the transfected cells are replated in twelve-well plates (lml/well). 5 ⁇ -pregnan-20-one (Pl) is added 24 h after seeding, and the plates then incubated for 24 h. The ⁇ -galactosidase and luciferase activities of cell extracts are assayed. To standardize transfection efficiency, the relative light units obtained in the luciferase assay are divided by the optical density obtained in the ⁇ - galactosidase assay.
  • rabbits Two weeks after the fourth injection, rabbits were bled. The serums were prepared and frozen.
  • the ability of the serums to recognize the MR LBD-S810L-C910A was tested by Western Blot. At a 1/500 dilution, the antibodies from rabbit 2 recognized 0.1 ng of purified MR LBD-S810L-C910A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne de nouvelles compositions, des procédés et des outils destinés à moduler une fonction de récepteur nucléaire. Plus particulièrement, l'invention concerne l'identification de la structure cristalline de récepteurs nucléaires et leur interface atomique avec des ligands. L'invention permet la conception, l'identification ou la sélection de nouveaux modulateurs candidats de récepteurs nucléaires, pouvant être utilisés dans l'industrie pharmaceutique. L'invention concerne également de nouvelles constructions de récepteurs nucléaires, des vecteurs recombinants, des cellules et des procédés destinés à produire ces éléments en grande quantité, ainsi que leur utilisation afin de produire des anticorps, des ligands ou des cristaux de ceux-ci. L'invention est particulièrement adaptée au développement de modulateurs de récepteurs minéralocorticoïdes, pouvant être utilisés afin de traiter divers troubles, notamment l'hypertension.
PCT/IB2005/001493 2005-04-29 2005-04-29 Procedes de modulation de recepteurs nucleaires WO2006117592A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/IB2005/001493 WO2006117592A1 (fr) 2005-04-29 2005-04-29 Procedes de modulation de recepteurs nucleaires

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2005/001493 WO2006117592A1 (fr) 2005-04-29 2005-04-29 Procedes de modulation de recepteurs nucleaires

Publications (1)

Publication Number Publication Date
WO2006117592A1 true WO2006117592A1 (fr) 2006-11-09

Family

ID=35431760

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2005/001493 WO2006117592A1 (fr) 2005-04-29 2005-04-29 Procedes de modulation de recepteurs nucleaires

Country Status (1)

Country Link
WO (1) WO2006117592A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988003168A1 (fr) * 1986-10-24 1988-05-05 The Salk Institute For Biological Studies Compositions receptrices d'hormones et procedes
WO1998050042A1 (fr) * 1997-05-02 1998-11-12 American Home Products Corporation Pregnan-3-ol-20-ones
WO2001066599A1 (fr) * 2000-03-09 2001-09-13 Schering Ag Cristal
WO2003015692A2 (fr) * 2001-07-17 2003-02-27 Smithkline Beecham Corporation Domaine de fixation aux ligands du recepteur du glucocorticoide cristallise et procedes de criblage l'utilisant

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988003168A1 (fr) * 1986-10-24 1988-05-05 The Salk Institute For Biological Studies Compositions receptrices d'hormones et procedes
WO1998050042A1 (fr) * 1997-05-02 1998-11-12 American Home Products Corporation Pregnan-3-ol-20-ones
WO2001066599A1 (fr) * 2000-03-09 2001-09-13 Schering Ag Cristal
WO2003015692A2 (fr) * 2001-07-17 2003-02-27 Smithkline Beecham Corporation Domaine de fixation aux ligands du recepteur du glucocorticoide cristallise et procedes de criblage l'utilisant

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
ARICI A ET AL: "Progesterone Metabolism in Human Endometrial Stromal and Gland Cells in Culture - mediation by progesterone and gamma amino butyric acid A receptor systems", STEROIDS, vol. 64, no. 8, August 1999 (1999-08-01), pages 530 - 534, XP004183591, ISSN: 0039-128X *
BAXTER J D ET AL: "Towards selectively modulating mineralocorticoid receptor function: lessons from other systems.", MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 217, no. 1-2, 31 March 2004 (2004-03-31), pages 151 - 165, XP002358628, ISSN: 0303-7207 *
BLEDSOE R K ET AL: "A ligand-mediated hydrogen bond network required for the activation of the mineralocorticoid receptor.", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, no. 35, 2 September 2005 (2005-09-02), pages 31283 - 31293, XP002358634, ISSN: 0021-9258 *
BUREIK M ET AL: "The human mineralocorticoid receptor only partially differentiates between different ligands after expression in fission yeast", FEMS YEAST RESEARCH, vol. 5, no. 6-7, April 2005 (2005-04-01), pages 627 - 633, XP004789312, ISSN: 1567-1356 *
DEY R ET AL: "Homology modelling of the ligand binding domain of mineralocorticoid receptor: Close structural kinship with glucocorticoid receptor ligand binding domain and their similar binding mode with DOC (de-oxy corticosterone)", JOURNAL OF BIOMOLECULAR STRUCTURE AND DYNAMICS, vol. 20, no. 1, August 2002 (2002-08-01), pages 21 - 29, XP008057098, ISSN: 0739-1102 *
FAGART J ET AL: "Agonists and antagonists of mineralocorticoids. The relation between structure and activity. Original Title: Agonistes et antagonistes mineralocorticoides. Relation structure-activity.", ANNALES DE CARDIOLOGIE ET D'ANGEIOLOGIE, vol. 53, no. 3, June 2004 (2004-06-01), pages 154 - 157, XP002358624 *
FAGART J ET AL: "Antagonism in the human mineralocorticoid receptor", EMBO JOURNAL, vol. 17, no. 12, June 1998 (1998-06-01), pages 3317 - 3325, XP002970326, ISSN: 0261-4189 *
FAGART J ET AL: "Crystal structure of a mutant mineralocorticoid receptor responsible for hypertension.", NATURE STRUCTURAL & MOLECULAR BIOLOGY, vol. 12, no. 6, June 2005 (2005-06-01), pages 554 - 555, XP002358632, ISSN: 1545-9993 *
GELLER D S ET AL: "Activating mineralocorticoid receptor mutation in hypertension exacerbated by pregnancy", SCIENCE, vol. 289, no. 5476, 7 July 2000 (2000-07-07), pages 119 - 123, XP002358623, ISSN: 0036-8075 *
ITO T ET AL: "In vitro and in vivo immunocytochemistry for the distribution of mineralocorticoid receptor with the use of specific antibody.", NEUROSCIENCE RESEARCH, vol. 37, no. 3, July 2000 (2000-07-01), pages 173 - 182, XP002358622, ISSN: 0168-0102 *
JALAGUIER S ET AL: "Putative steroid binding domain of the human mineralocorticoid receptor, expressed in E. coli in the presence of heat shock proteins shows typical native receptor characteristics", JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 57, no. 1-2, 1996, pages 43 - 50, XP002358618, ISSN: 0960-0760 *
LI YONG ET AL: "Structural and biochemical mechanisms for the specificity of hormone binding and coactivator assembly by mineralocorticoid receptor.", MOLECULAR CELL. 5 AUG 2005, vol. 19, no. 3, 5 August 2005 (2005-08-05), pages 367 - 380, XP002358633, ISSN: 1097-2765 *
MAHESH V B ET AL: "Diverse modes of action of progesterone and its metabolites.", THE JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 56, no. 1-6 Spec No, January 1996 (1996-01-01), pages 209 - 219, XP002368231, ISSN: 0960-0760 *
NAGY L ET AL: "Mechanism of the nuclear receptor molecular switch", TRENDS IN BIOCHEMICAL SCIENCES, vol. 29, no. 6, 1 June 2004 (2004-06-01), pages 317 - 324, XP004522842, ISSN: 0968-0004 *
PINON G M ET AL: "Identification of steroid ligands able to inactivate the mineralocorticoid receptor harboring the S810L mutation responsible for a severe form of hypertension.", MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 217, no. 1-2, 31 March 2004 (2004-03-31), pages 181 - 188, XP002358620, ISSN: 0303-7207 *
ROBERTSON N M ET AL: "Demonstration of nuclear translocation of the mineralocorticoid receptor (MR) using an anti-MR antibody and confocal laser scanning microscopy", MOLECULAR ENDOCRINOLOGY, vol. 7, no. 9, 1993, pages 1226 - 1239, XP002358621, ISSN: 0888-8809 *
ROGERSON F M ET AL: "Determinants of spironolactone binding specificity in the mineralocorticoid receptor.", JOURNAL OF MOLECULAR ENDOCRINOLOGY, vol. 31, no. 3, December 2003 (2003-12-01), pages 573 - 582, XP002358626, ISSN: 0952-5041 *
ROGERSON F M ET AL: "Differences in the determinants of eplerenone, spironolactone and aldosterone binding to the mineralocorticoid receptor", CLINICAL AND EXPERIMENTAL PHARMACOLOGY AND PHYSIOLOGY, vol. 31, no. 10, October 2004 (2004-10-01), pages 704 - 709, XP002358627, ISSN: 0305-1870 *
SARTORATO P ET AL: "New naturally occurring missense mutations of the human mineralocorticoid receptor disclose important residues involved in dynamic interactions with deoxyribonucleic acid, intracellular trafficking, and ligand binding.", MOLECULAR ENDOCRINOLOGY, vol. 18, no. 9, June 2004 (2004-06-01), pages 2151 - 2165, XP002358619 *
SPITZ I M: "Progesterone antagonists and progesterone receptor modulators: an overview", STEROIDS, vol. 68, no. 10-13, November 2003 (2003-11-01), pages 981 - 993, XP004479948, ISSN: 0039-128X *
SPITZ I M: "Progesterone antagonists and progesterone receptor modulators: An overview.", EXPERT OPIN INVESTIG DRUGS, vol. 12, no. 10, 2003, pages 1693 - 1707, XP002358812, ISSN: 1354-3784 *
TOGASHI M ET AL: "Conformational adaptation of nuclear receptor ligand binding domains to agonists: Potential for novel approaches to ligand design", JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 93, no. 2-5, February 2005 (2005-02-01), pages 127 - 137, XP004862803, ISSN: 0960-0760 *
WILLIAMS S P ET AL: "Atomic structure of progesterone complexed with its receptor", NATURE, vol. 393, no. 6683, 28 May 1998 (1998-05-28), pages 392 - 396, XP002173773, ISSN: 0028-0836 *

Similar Documents

Publication Publication Date Title
AU775928B2 (en) Crystallographic structure of the androgen receptor ligand binding domain
AU2008229687B2 (en) Binding moieties based on shark IgNAR domains
Hoerer et al. Crystal structure of the human liver X receptor β ligand-binding domain in complex with a synthetic agonist
Korndörfer et al. Structural mechanism of specific ligand recognition by a lipocalin tailored for the complexation of digoxigenin
Solomon et al. Crystal structure of the human LRH-1 DBD–DNA complex reveals Ftz-F1 domain positioning is required for receptor activity
CA2569095A1 (fr) Structure cristalline de dipeptidyl peptidase iv (dpp-iv) et ses utilisations
EP1375517A1 (fr) Structure du domaine de liaison du ligand du récepteur de glucocorticoides comportant une poche de liaison expansée et procédé d'emploi
US9147036B2 (en) Crystal structure
EP1575502A2 (fr) Compositions et procedes impliquant le site ii des recepteurs nucleaires d'hormones (nhr)
MXPA05006937A (es) Proteina del receptor beta del higado x cristalina.
WO2003093312A1 (fr) Structure cristalline du domaine de liaison aux ligands du recepteur alpha orphelin apparente a l'acide retinoique (ror alpha)
WO2006117592A1 (fr) Procedes de modulation de recepteurs nucleaires
EP1904629A2 (fr) Structure cristalline d'adenylate cyclase humaine soluble
EP1301536B1 (fr) Modulation de la fonction de la tetraspanine
WO2003000732A2 (fr) Polypeptides derives du recepteur orphelin (ror) apparente aux recepteurs de l'acide retinoique et application de ceux-ci
EP1265927B1 (fr) Cristal
EP1470158A2 (fr) Fragment peptidique comprenant une poche de liaison au ligand du recepteur 3 des oestrogenes (err3), sa structure cristalline, et utilisations associees
US7199219B1 (en) Polypeptides derived from vitamin D nuclear receptor, and their uses in particular for screening vitamin D analogues
WO2012037150A1 (fr) Structures cristallines de la o-glcnac transférase et utilisations associées

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

NENP Non-entry into the national phase

Ref country code: RU

WWW Wipo information: withdrawn in national office

Country of ref document: RU

122 Ep: pct application non-entry in european phase

Ref document number: 05742530

Country of ref document: EP

Kind code of ref document: A1