WO2006112400A1

WO2006112400A1 - Method of examining metastatic property and infiltration ability of cancer

Info

Publication number: WO2006112400A1
Application number: PCT/JP2006/307949
Authority: WO
Inventors: Masatoshi Kitagawa; Yun Gao; Kyoko Kitagawa
Original assignee: National University Corporation Hamamatsu University School Of Medicine
Priority date: 2005-04-18
Filing date: 2006-04-14
Publication date: 2006-10-26
Also published as: JP4887505B2; JPWO2006112400A1

Abstract

[PROBLEMS] To provide a method for examining cancer with poor prognosis. [MEANS FOR SOLVING PROBLEMS] It is found out that the expression of a G protein-coupled receptor GPR48 gene (AF257182) is significantly accelerated in cancer with poor prognosis. As the results of the subsequent studies aiming at clarifying the relationship between GPR48 and cancer metastasis, it is found out that GPR48 has a function of accelerating the infiltration ability of cancer cells and the obtained results are applied to the diagnosis of cancer with poor prognosis. Namely, a method of examining the metastatic property of caner and a method of examining the infiltration ability of cancer comprising detecting the expression of the G protein-coupled receptor GPR48 in a cell or tissue to be examined.

Description

Specification

Cancer metastasis and invasion ability screening method

Technical field

[0001] The present invention relates to a method for examining cancer, particularly cancer with a poor prognosis, and more particularly, a gene involved in metastatic invasive ability in cells and tissues of a patient suspected of having cancer, particularly with a poor prognosis. The present invention relates to a method for examining metastasis and invasiveness of cancer by examining the expression of. Background art

[0002] In the treatment of cancer, treatment methods such as surgery, radiation therapy, immunotherapy, and chemotherapy are performed, and the progress of these treatments has increased the cure rate of cancer. However, these treatments are limited to primary cancers, and cancers with high metastases have a poor prognosis and overall cure rates are low. In addition, conventional prognostic methods represented by metastatic invasion lack reliability, sensitivity, and simplicity. On the other hand, in cancers such as colorectal cancer, breast cancer, gastric cancer, and lung cancer, the expression level of the CDK inhibitor protein p27 ^Kipl , which is a cell cycle regulator, was found to be low, and the prognosis is poor in cancers in which the expression level of p27 ^Kipl is low. (Non-Patent Documents 1 to 3). However, it was unclear why the expression of p27 ^Kipl was low and the prognosis was poor.

GPR48, which was found by the present inventors to be associated with cancer with poor prognosis and metastasis invasion of cancer cells, is a G protein binding containing a leucine-rich repeat belonging to a superfamily of proteins having 7-pass domains. Force known to be a receptor The function was unknown (Non-Patent Documents 4 and 5).

[0003] Non-Patent Document 1: Nature Medicine 1997 Feb; 3 (2): 222-5.

Non-Patent Document 2: Nature Medicine 1997 Feb; 3 (2): 227_30.

Non Patent Literature 3: Nature Medicine 1997 Feb; 3 (2): 231_4

Non-Patent Document 4: Mol Endocrinol. 2004 Sep; 18 (9): 2241-54. Epub 2004 Jun 10.

Non-Patent Document 5: Mol Endocrinol. 1998 Dec; 12 (12): 1830-45.

Disclosure of the invention

Problems to be solved by the invention

[0004] The present inventors have a poor prognosis in cancers in which the expression level of p27 ^Kipl is reduced (Non-Patent Documents 1 to 4). 3) To elucidate the cause, we analyzed the gene expression caused by the decreased expression of p27 ^Kipl , and elucidated the cause of the poor prognosis.

That is, the present invention provides a method for screening cancer, particularly cancer with poor prognosis.

Means for solving the problem

[0005] The present inventors created a model in which the expression level of p27 ^Kipl was reduced, and analyzed the fluctuating gene using a microarray. That is, a cell (HCT-hp27-hKO) in which the p27 ^Kipl gene of the human colorectal cancer cell line HCT116 was knocked out by gene targeting method was created, and it was confirmed that the expression level of p27 ^Kipl was reduced. did. Genes whose expression was changed in HCT-hp27-hKO compared to the parent strain HCT116 were analyzed using a microarray. As a result, it was revealed that the expression of the G protein-coupled receptor GPR48 gene (AF25 7182) was significantly increased in HCT-hp27-hKO.

As a result of further studies to elucidate the relationship between GPR48 and metastasis, the present inventors have found that GPR48 has a function of enhancing the invasion ability of cancer cells, and have completed the present invention.

[0006] That is, the present invention is a method for detecting cancer metastasis comprising detecting the expression of G protein-coupled receptor GPR48 in a cell or tissue to be examined. Is a method for examining the invasion ability of cancer, comprising detecting the expression of GPR48 in the tissue.

In addition, the present invention uses GRT48 expression levels in cancer tissue samples of cancer patients by quantitative RT-PCR or immunohistochemical methods such as immunohistochemical staining using enzyme-immunoantibody methods such as anti-GPR48 antibodies. It is a method of diagnosing the possibility.

BEST MODE FOR CARRYING OUT THE INVENTION

[0007] The present invention detects the expression of GPR48 based on the finding that the G protein-coupled receptor GPR48 has a function of promoting the invasive ability of cancer cells and serves as an indicator of cancer invasive metastasis. This is a screening method for metastasis and invasion ability of cancer.

The cancer to be examined may be any cancer, for example, colon cancer, breast cancer, stomach cancer, lung cancer, biliary tract cancer (bile duct cancer, gallbladder cancer), knee cancer, esophageal cancer, hepatocellular carcinoma, laryngeal cancer, pharyngeal cancer. , Thyroid cancer, uterine cancer, ovarian cancer, renal cell cancer, prostate cancer, bladder cancer, malignant melanoma, brain tumor, etc. It is done.

The cell or tissue to be examined is also a biopsy sample from a suspected cancer patient or a patient suspected of cancer by a surgical technique, preferably a cell or tissue collected from a subject. More preferably, it is a cell or tissue.

[0008] The method for detecting the expression of GPR48 is not particularly limited, but includes antigen-antibody reaction, RT-PCR, cDNA microarray, Northern blotting, mass spectrometry analysis, protein chip analysis, and the like. These may be performed according to conventional methods in each field.

[0009] RT-PCR may be normal RT-PCR or real-time RT-PCR.

Primers that specifically amplify human GPR48 mRNA are designed from human GPR48 (SEQ ID NO: 1) according to conventional methods. The primer sequence is not particularly limited as long as it is a sequence in human GPR48 mRNA and exhibits specific amplification. The expression level of GPR48 in the cells can be examined by RT-PCR using two appropriate primers in the sequence of G protein-coupled receptor GPR48.

[0010] There are no particular limitations on the method for detecting the antigen-antibody reaction, but immunohistological staining (including fluorescent staining), FACS (flow cytometry), immunoblotting, dot blotting, ELISA, etc. may be used. it can.

It is preferable to produce an antibody using a peptide corresponding to the extracellular domain of human GPR48 (SEQ ID NO: 2) as an antigen. This extracellular domain is amino acids Nol to 542 of human GPR48 (SEQ ID NO: 2), and may be an antibody against the entire extracellular domain or a part thereof. The antibody may be a polyclonal antibody or a monoclonal antibody. As an example of a screening method that can be used as a diagnostic agent for cancer comprising this antibody as a main component, particularly as a diagnostic agent for cancer with a poor prognosis, the antibody of the present invention reacts with GPR48 present in a specimen. Further, a probe that recognizes this antibody is reacted. Examples of this probe include anti-human IgG antibody, protein G, protein A, and protein L. This probe is usually labeled. These labels include radioisotopes ( ¹²⁵ ι), enzymes (peroxidase)

, Alkaline phosphatase), fluorescent materials, luminescent materials, and the like. When an enzyme antibody is used, the substrate is reacted and its change (coloring, etc.) is observed. [0011] In the case of a cDNA microarray, a DNA chip on which a number of probes (DNA) corresponding to mRNA derived from human GPR48 (SEQ ID NO: 1) are immobilized is prepared. On the other hand, a cell fraction or tissue force to be examined or RNA fraction or mRNA is prepared, and DNA complementary thereto is labeled with a fluorescent dye and synthesized. The expression of GPR48 can be detected by measuring the fluorescence by pairing this with the above DNA chip.

In Northern blotting, after RNA fractionation or mRNA is prepared from a sample, RNA fractionated by electrophoresis is immobilized on a nitrocellulose membrane or the like from a gel. This can be paired with a labeled DNA (probe) prepared from human GPR48 (SEQ ID NO: 1), and the expressed mRNA can be detected to know the expression of GPR48.

In mass spectrometry analysis, protein expression can be extracted from a sample, analyzed with a mass spectrometer, and the amount of fragments having the amino acid sequence of GPR48 can be measured to determine the expression of GPR48.

In the case of protein chip analysis, it is possible to know the expression of GPR48 by extracting the protein from the sample, reacting with the chip to which GPR48 antibody etc. is fixed, washing, coloring, and measuring the amount with a protein chip analyzer. it can.

The following examples illustrate the invention, but are not intended to limit the invention.

[0012] In this Example and Reference Example, the quantitative RT-PCR (QRT-PCR) method was performed according to the following procedure.

Isogen (manufactured by Wako) reagent was added to cultured cells (or frozen specimens), homogenized with a polytron homogenizer, centrifuged, and ethanol precipitated to extract RNA. This RNA was converted into a vertical form, and then used for hundamorikovima ¹ ~; cDNA was synthesized with supenscript Reverse ranscnptase (Invitrogen).

Next, in order to quantify the expression level of GPR48, quantitative RT-PCR (Cyber Green method) was performed using CAGTACCCAGTGAAGCCATT (Cat No. 3) and TGTTGTCATCCAGCCACAGA (Cat 1J No. 4) as a primer set for human GPR48. Other QRT-PCR methods such as the Taqman method may be used.

Primer set and sample cDNA are stored in a reaction solution containing thermostable polymerase. Set on a PCR machine (Light Cycler, Roche), 94. The amount of GPR48 mRNA was quantified by performing cyclic amplification at 54 ° C. for 20 seconds and 72 ° C. for 20 seconds after heat denaturation for C 15 seconds.

[0013] Further, in this example and the reference example, the invasive ability of cells was examined by the following method.

Matrigel invasion chamber (Matrigel invasion chamber, manufactured by BD Bioscience, 24-wel 1 plate size), Matrigel coated PET membrane (PET membrane, pore size 8.0-μm) chamber These cells were seeded at 5 × 10 ⁴ cells / well. In a well at the bottom of the chamber 1, 750 μl of a medium containing 10 μg / ml fibronectin (manufactured by Roche) was added as a chemo-attractant. After 36 hours, remove from the 37 ° C CO incubator, remove cells above chamber 1 with a cotton swab, pass through Matrigenore, and infiltrate cells below chamber 1 with Diff-Quik kit (International Reagents Co 卬). oration) and observed with a microscope at 100 times magnification, and the cells in all fields were counted. The experiment was performed three times, and three wells were conducted for each sump nore in each experiment.

[0014] Reference Example 1

In order to investigate the function of GPR48 in cancer cells, GPR48 expression plasmid (pcDNA4-HisMax_hGPR48) or empty vector (pcDNA4_HisMax) is transfected into human colon cancer cell HCT116, the introduced cells are selected with Zeocin, and stable expression cell lines (GPR48-19, GPR48-33, Vector 2 and Vector 6) were obtained. GPR48 expression in these cells was examined by quantitative RT-PCR method. The results are shown in Fig. 1. It was confirmed that GPR48 mRNA was highly expressed in GPR48-19 and GPR48-33 introduced with pcDNA4_HisMax_hGPR48. Next, the invasive ability of the cultured cells was examined. Figure 2 is a photograph of stained infiltrated cells. Figure 3 shows the results in a graph and statistical processing. * Indicates that GPR48-19 and GPR48-33 are significantly more invasive than control vectors at a risk rate of 0.01 or less. As a result, it was found that GPR48-19 and GPR48-33 cells expressing GPR48 mRNA at a high level were clearly more invasive than the control group Vector 2 and Vector 6.

In other words, GPR48 can promote cancer cell invasion.

Example 1

[0015] In this example, the expression solution of GPR48 in human colorectal cancer specimens by quantitative RT-PCR. Analysis was performed.

GPR48 expression was analyzed by quantitative RT-PCR in 29 human colorectal cancer specimens with informed consent. Figure 4 shows the expression level of GPR 48 mRNA in 29 cancerous and normal areas.

In 14 cases, there was a great difference in expression between the cancerous part and the normal part. On the other hand, 15 cases of Case No 1, 2, 3, 4, 5, 7, 11, 12, 15, 18, 21, 24, 26, 27, 28 indicated by * are in the cancer part compared to the normal part. The expression level of GPR48 mRNA increased more than twice.

Example 2

The expression level of GPR48 in human colorectal cancer specimens was examined and the correlation with pathological findings was examined. The results are shown in Table 1. Note that the P value (risk rate) in the table is significant at the risk rate after statistical processing (for example, 2% if this value is 0.02). Generally, 0.05 or less is significant. The lower the value, the higher the significance (high reliability, low risk rate).

[table 1]

Number of pathological cases GPR48 expression level (cancerous / normal)

Age

<65 2.659

> 65 4.129 0.15 Gender

Male 2.854

Female 4.534 0.16 Size of cancer (cm)

<5 4.248

> 5 2.597 0.18 degree of differentiation

Well-differentiated 2.383

Moderate 6.283 0.004 Vascular invasion

None 3.369

Yes 3.417 0.972 Lymphatic vessel invasion

None 2.199

Yes 5.348 0.020 Lymph node metastasis

2.111

5.603 0.013 As a result, there was a significant correlation between the degree of differentiation (medium), lymphatic invasion (existing) and lymph node metastasis (existing) and increased expression of GPR48. Considering that GPR48 has a function of promoting cancer cell invasion (Reference Example 1), it is considered that the increased expression of GPR48 leads to the enhanced metastasis invasion of human cancer.

Example 3

In this example, the expression of GPR48 in human colorectal cancer specimens by immunohistological analysis. Analysis was performed.

A peptide (CQEQKMLRTLDL) having a sequence of amino acids 339 to 350 at the extracellular position of human GPR48 (SEQ ID NO: 2) was chemically synthesized, conjugated with KLH, and then immunized with a rabbit. After confirming that the antibody titer had increased, whole blood was collected to obtain antiserum. A resin in which this peptide, which is an antigen, was covalently bound, was prepared, adsorbed with antiserum, washed and then neutralized by elution with a low pH eluate to obtain a purified anti-human GPR48 antibody. Extracts of 293 cells or HCT116 cells transfected with a GPR48 expression vector (pcDNA4-HisMax-hGPR48) were separated by SDS polyacrylamide electrophoresis and subjected to Western plot analysis. As a result, a human GPR48 band was detected at a molecular weight of 104 kD.

Simultaneously, immunofluorescence staining was performed to confirm the reactivity corresponding to the expression of GPR48, and it was confirmed that this antibody was a specific antibody against GPR48.

Immunohistological staining was performed using the Histofme SAB kit (Nichirei). Specifically, paraffin-embedded tissue sections were deparaffinized and then treated with a microwave oven in 10 mM citrate buffer to remove endogenous peroxidase with 0.3% hydrogen peroxide. Next, it was immersed in a purified anti-GPR48 antibody diluted 1: 200 and allowed to react overnight at 4 ° C. Subsequently, it was reacted with a piotine-conjugated secondary antibody (anti-rabbit IgG), then reacted with streptavidin-conjugated horseradish peroxidase, and after washing, it was immersed in a coloring solution containing diaminobenzidine for color development. Furthermore, the nucleus was dyed blue with hematoxylin, mounted with cover glass, and observed with a microscope.

FIG. 5 shows a staining example in which the same colon cancer specimen as in Example 1 was analyzed using this immunohistological staining method.

In strongly positive cases, cancer cells were strongly stained brown, and normal cells were hardly stained. On the other hand, in the negative cases, both cancer cells and normal cells were weakly stained. Case No 1, 2, 3, 4, 6, 7, 8, 9 10, 11, 12, 13, 14, 15, 16, 24, 28 Analysis results for Case No 1, 2, 3, 4, 7 , 11, 12, 15, 24, 28 showed moderate to strong positive, and other cases N 0 6, 8, 9 10, 13, 14, 16 were weak positive to negative.

As shown in Table 2, the result of this immunohistological staining coincided with the measurement result of the expression level of GPR48 mRNA in Example 1. [Table 2] Quantitative RT-PCR immunohistochemical staining

Case No. GPRmRNA (cancer part 1 normal part) GPR protein

1 5.94 +++

2 3.70 ++

3 4.30 ++

4 3.18 ++

6 1.03 +

7 0.88 +

8 1.28-

9 1.32 +

10 1.34 +

11 1.00-

12 1.10-

13 1.58 +

14 1.20-

15 3.22 +++

16 1.41-

24 8.83 ++++

28 4.35 +++ Brief description of drawings

FIG. 1 is a graph showing the expression level of GPR48 mRNA in human colon cancer cells into which a GPR48 expression plasmid has been introduced.

2] Photographs showing that cells infiltrated in human colon cancer cells into which a GPR48 expression plasmid was introduced. The width of each photo is 0.34mm. The gray dots indicate the pores (holes) in the PET membrane coated with Matrigel, and the black dots indicate cells that have infiltrated and passed through. (1) shows the infiltrated cells of the control group in which the pcDNA4-His Max vector was introduced into HCT116 cells, and (2) shows the infiltrated cells of GPR48 highly expressing cells in which pcDNA4-His Max_GPR48 was introduced into HCT116 cells.

Fig. 3] A graph showing the number of cells infiltrated in human colon cancer cells into which a GPR48 expression plasmid was introduced. The vertical axis shows the number of cells that infiltrated and passed through the pores (holes) of a Matrigel-coated PET membrane (pore size 8 · 0 μm) (total number of infiltrated cells per chamber). Number).

[4] GPR48 expression analysis (quantitative RT-PCR) in human colon cancer specimens. The horizontal axis shows the value corrected by dividing the expression level of GPR48 in each sample by the expression level of GAPDH. FIG. 5 is a diagram showing expression analysis (immunohistological staining) of GPR48 in human colon cancer specimens. In the figure, black circles (blue in color, and due to hematoxylin-eosin staining) indicate nuclei. In the positive example, the part of the cytoplasm around the nucleus that is stained gray (gray near black, dark brown in color) is GPR48, indicating a cancerous part. The unstained part (white) in the meantime is stromal cells (normal). In the negative example, the response of GPR48 shown in gray (brown in color) is very weak.

Claims

The scope of the claims

[1] A method for examining metastasis of cancer, comprising detecting expression of a G protein-coupled receptor GPR48 in a cell or tissue to be examined.

[2] A method for examining the invasion ability of cancer, comprising detecting the expression of a G protein-coupled receptor GPR48 in a cell or tissue to be examined.

[3] The method according to claim 1 or 2, wherein the detection method is an antigen-antibody reaction, RT-PCR, cDNA microarray, Northern blotting, mass spectrometry analysis, or protein chip analysis.

[4] The cell or tissue according to any one of claims 1 to 3, wherein the cell or tissue is a biopsy sample from a patient suspected of cancer or a cell or tissue collected from a patient suspected of cancer by a surgical technique. The method according to claim 1.

[5] The method according to any one of claims 1 to 4, which comprises examining the reactivity of the cell to this antibody using an antibody against a peptide corresponding to the extracellular domain of the G protein-coupled receptor GPR48. The method described.

[6] G protein-coupled receptor GPR48, a cancer testing agent mainly composed of antibodies to peptides corresponding to the extracellular domain.

[7] RT_ using two appropriate primers in the sequence of GPR48

The method comprises examining the expression level of GPR48 in the cells by PCR.

5. The method according to any one of 4.