JPWO2006112400A1 - Method for examining metastasis and invasion ability of cancer - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for examining cancer with poor prognosis. [MEANS FOR SOLVING PROBLEMS] The present inventors have found that the expression of G protein-coupled receptor GPR48 gene (AF257182) is significantly increased in cancer with a poor prognosis, and further clarifies the relationship between GPR48 and metastasis. As a result, it was elucidated that GPR48 has a function of enhancing the invasive ability of cancer cells, and this result was applied to the diagnosis of cancer with poor prognosis. The present invention is a cancer metastasis test method and a cancer invasion ability test method comprising detecting the expression of G protein-coupled receptor GPR48 in a cell or tissue to be tested. [Selection figure] None

Description

  The present invention relates to a method for examining cancer, particularly cancer with a poor prognosis, and more particularly, to examine the expression of genes involved in metastasis invasion ability in cells and tissues of patients suspected of cancer, particularly cancer with poor prognosis Relates to a method for examining metastasis and invasiveness of cancer.

In the treatment of cancer, treatment methods such as surgery, radiation therapy, immunotherapy, and chemotherapy are performed, and the progress of these treatments has increased the cure rate of cancer. However, these treatments are limited to primary cancers, and cancers with high metastases have a poor prognosis and overall cure rates are low. Moreover, the prognostic diagnosis represented by conventional metastasis infiltration lacks reliability, sensitivity, and simplicity.
On the other hand, in cancers such as colorectal cancer, breast cancer, gastric cancer, and lung cancer, a decrease in the expression level of the CDK inhibitor protein p27 ^Kip1 that is a cell cycle regulator is found, and the prognosis is poor in cancers in which the expression level of p27 ^Kip1 is decreased (Non-patent documents 1 to 3). However, it was unclear why the prognosis was poor due to the decreased expression level of p27 ^Kip1 .
GPR48, which was elucidated by the present inventors as being associated with cancer with poor prognosis and metastasis invasion of cancer cells, is a G protein-coupled receptor containing a leucine-rich repeat belonging to a superfamily of proteins having 7-pass domains. It was known that there was, but its function was unknown (Non-Patent Documents 4 and 5).

Nature Medicine 1997 Feb; 3 (2): 222-5. Nature Medicine 1997 Feb; 3 (2): 227-30. Nature Medicine 1997 Feb; 3 (2): 231-4 Mol Endocrinol. 2004 Sep; 18 (9): 2241-54. Epub 2004 Jun 10. Mol Endocrinol. 1998 Dec; 12 (12): 1830-45.

In order to elucidate the cause of poor prognosis in cancers in which the expression level of p27 ^Kip1 is reduced (Non-patent Documents 1 to 3), the present inventors analyzed gene expression caused by the decrease in the expression level of p27 ^Kip1. However, if the cause of the poor prognosis was elucidated, it could be applied to the diagnosis of cancer.
That is, the present invention provides a method for examining cancer, particularly cancer with a poor prognosis.

The present inventors created a model in which the expression level of p27 ^Kip1 was reduced, and analyzed the fluctuating gene using a microarray. That is, a cell (HCT-hp27-hKO) in which the p27 ^Kip1 gene of the human colorectal cancer cell line HCT116 was knocked out by gene targeting method was created, and it was confirmed that the expression level of p27 ^Kip1 was reduced. did. Genes whose expression was changed in HCT-hp27-hKO compared to the parent strain HCT116 were analyzed using a microarray. As a result, it was revealed that the expression of the G protein-coupled receptor GPR48 gene (AF257182) was significantly increased in HCT-hp27-hKO.
As a result of further studies to elucidate the relationship between GPR48 and metastasis, the present inventors have found that GPR48 has a function of enhancing the invasion ability of cancer cells, and have completed the present invention.

That is, the present invention is a method for examining metastasis of cancer comprising detecting the expression of G protein-coupled receptor GPR48 in a cell or tissue to be examined, and G protein-coupled receptor in the cell or tissue to be examined. A method for examining the invasion ability of cancer comprising detecting the expression of body GPR48.
In addition, the present invention uses GRT48 expression level in cancer tissue samples of cancer patients by quantitative RT-PCR or immunohistological staining using an anti-GPR48 antibody or an immunological method such as enzyme immunoassay. It is a method of diagnosing the possibility.

The present invention relates to a cancer comprising detecting the expression of GPR48 based on the discovery that G protein-coupled receptor GPR48 has a function of promoting the invasion ability of cancer cells and serves as an indicator of cancer invasion and metastasis. This is a test method for metastasis and invasive ability.
The cancer to be examined may be any cancer, such as colon cancer, breast cancer, stomach cancer, lung cancer, biliary tract cancer (bile duct cancer, gallbladder cancer), pancreatic cancer, esophageal cancer, hepatocellular carcinoma, laryngeal cancer, pharyngeal cancer, thyroid gland. Examples include cancer, uterine cancer, ovarian cancer, renal cell cancer, prostate cancer, bladder cancer, malignant melanoma, and brain tumor.
The cell or tissue to be examined is preferably a cell or tissue collected from a subject, and a biopsy sample from a patient suspected of cancer or a cell collected from a patient suspected of cancer by a surgical technique Or it is more preferable that it is a structure | tissue.

  The method for detecting the expression of GPR48 is not particularly limited, and examples thereof include antigen-antibody reaction, RT-PCR, cDNA microarray, Northern blotting, mass spectrometry analysis, protein chip analysis and the like. These may be performed according to conventional methods in each field.

RT-PCR may be normal RT-PCR or real-time RT-PCR.
Primers that specifically amplify human GPR48 mRNA are designed from human GPR48 (SEQ ID NO: 1) according to a conventional method. The primer sequence is not particularly limited as long as it is a sequence in human GPR48 mRNA and exhibits specific amplification. The expression level of GPR48 in the cells can be examined by RT-PCR using two appropriate primers in the sequence of G protein-coupled receptor GPR48.

The method for detecting the antigen-antibody reaction is not particularly limited, and immunohistological staining (including fluorescent staining), FACS (flow cytometry), immunoblotting, dot blotting, ELISA, and the like can be used.
It is preferable to produce an antibody using a peptide corresponding to the extracellular domain of human GPR48 (SEQ ID NO: 2) as an antigen. This extracellular domain is amino acids No. 1 to 542 of human GPR48 (SEQ ID NO: 2), and may be an antibody against the entire extracellular domain or a part thereof. The antibody may be a polyclonal antibody or a monoclonal antibody. This antibody can be used as a diagnostic agent for cancer containing this antibody as a main component, particularly as a diagnostic agent for cancer with poor prognosis.
As an example of a test method, the antibody of the present invention is reacted with GPR48 present in a specimen, and a probe that recognizes the antibody is further reacted. Examples of the probe include anti-human IgG antibody, protein G, protein A, and protein L. This probe is usually labeled. Examples of the label include a radioisotope ( ¹²⁵ I), an enzyme (peroxidase, alkaline phosphatase), a fluorescent substance, a luminescent substance, and the like. When an enzyme antibody is used, the change (coloring or the like) may be observed by reacting the substrate.

In the case of a cDNA microarray, a DNA chip on which a large number of probes (DNA) corresponding to mRNA derived from human GPR48 (SEQ ID NO: 1) are immobilized is prepared. On the other hand, RNA fraction or mRNA is prepared from the cell or tissue to be examined, and DNA complementary thereto is labeled with a fluorescent dye and synthesized. The expression of GPR48 can be detected by measuring the fluorescence by pairing it with the DNA chip.
In the case of Northern blotting, after RNA fractionation or mRNA is prepared from a specimen, RNA fractionated by electrophoresis is immobilized from a gel to a nitrocellulose membrane or the like. This can be paired with a labeled DNA (probe) prepared from human GPR48 (SEQ ID NO: 1), and the expressed mRNA can be detected to know the expression of GPR48.
In mass spectrometry (mass spectrometry) analysis, the expression of GPR48 can be known by extracting a protein from a specimen, analyzing it with a mass spectrometer, and measuring the amount of a fragment having the amino acid sequence of GPR48.
In the case of protein chip analysis, it is possible to know the expression of GPR48 by extracting protein from a specimen, reacting with a chip to which GPR48 antibody or the like is immobilized, washing, developing color, and measuring the amount with a protein chip analyzer. it can.

The following examples illustrate the invention but are not intended to limit the invention.

In this Example and Reference Example, the quantitative RT-PCR (QRT-PCR) method was performed according to the following procedure.
Isogen (manufactured by Wako) reagent was added to the cultured cells (or frozen specimen), homogenized with a Polytron homogenizer, centrifuged, and ethanol precipitated to extract RNA. Using this RNA as a template, cDNA was synthesized by SuperScript Reverse Transcriptase (Invitrogen) using a random oligo primer.
Next, in order to quantify the expression level of GPR48, quantitative RT-PCR (Cyber Green method) was performed using CAGTACCCAGTGAAGCCATT (SEQ ID NO: 3) and TGTTGTCATCCAGCCACAGA (SEQ ID NO: 4) as a primer set for human GPR48. Other QRT-PCR methods such as the Taqman method may be used.
Primer set and sample cDNA are added to the reaction solution containing thermostable polymerase, set in a real-time PCR machine (Light Cycler, manufactured by Roche), heat denaturation at 94 ° C for 15 seconds, 54 ° C for 20 seconds and 72 ° C for 20 ° C The amount of GPR48 mRNA was quantified by performing a second cycle amplification.

In this example and reference examples, the infiltration ability of cells was examined by the following method.
Using a Matrigel invasion chamber (BD Bioscience, 24-well plate size), these cells are placed on a matrigel-coated PET membrane (PET membrane, pore size 8.0-μm) chamber. The cells were seeded at 5 × 10 ⁴ cells / well. In the well below the chamber, 750 μl of a medium containing 10 μg / ml fibronectin (manufactured by Roche) as chemo-attractant was placed. After 36 hours, remove the cells above the chamber with a cotton swab from the 37 ° C CO ₂ incubator, pass through Matrigel, and stain the cells that have infiltrated under the chamber with a Diff-Quik kit (International Reagents Corporation). The cells were observed with a microscope at a magnification of 100 times, and the cells in all fields were counted. The experiment was performed three times, and three wells were performed for each sample in each experiment.

Reference example 1
In order to investigate the function of GPR48 in cancer cells, GPR48 expression plasmid (pcDNA4-HisMax-hGPR48) or empty vector (pcDNA4-HisMax) is transfected into human colon cancer cell HCT116, and the introduced cells are selected with Zeocin and stable. Expression cell lines (GPR48-19, GPR48-33, Vector 2 and Vector 6) were obtained. GPR48 expression in these cells was examined by quantitative RT-PCR. The result is shown in FIG. It was confirmed that GPR48 mRNA was highly expressed in GPR48-19 and GPR48-33 introduced with pcDNA4-HisMax-hGPR48.
Next, the invasive ability of the cultured cells was examined. FIG. 2 is a photograph of stained infiltrated cells. FIG. 3 is a graph showing the result, and shows a result of statistical processing. * Indicates that GPR48-19 and GPR48-33 are significantly more invasive than control vectors at a risk rate of 0.01 or less.
As a result, it was found that GPR48-19 and GPR48-33 cells expressing GPR48 mRNA at a high level were clearly more invasive than Vector 2 and Vector 6 in the control group.
That is, it can be said that GPR48 promotes invasion of cancer cells.

In this example, expression analysis of GPR48 in human colorectal cancer specimens was performed by quantitative RT-PCR.
GPR48 expression was analyzed by quantitative RT-PCR for 29 human colorectal cancer specimens with informed consent. FIG. 4 shows the expression level of GPR48 mRNA in 29 cancerous and normal parts.
In 14 cases, there was no significant difference in expression between the cancerous part and the normal part. On the other hand, 15 cases of Case No 1, 2, 3, 4, 5, 7, 11, 12, 15, 18, 21, 24, 26, 27, 28 indicated by * are in the cancer part compared to the normal part. The expression level of GPR48 mRNA was increased more than twice.

The expression level of GPR48 in human colorectal cancer specimens was examined, and the correlation with pathological findings was examined. The results are shown in Table 1. The P value (risk rate) in the table is significant at the risk rate after statistical processing (for example, 2% if this value is 0.02). Generally, 0.05 or less is significant, and the lower the value, the higher the significance (high reliability, low risk factor).
As a result, the degree of differentiation (medium), lymphatic invasion (existing), and lymph node metastasis (existing) were significantly correlated with increased expression of GPR48. Considering that GPR48 has a function of promoting invasion of cancer cells (Reference Example 1), it is considered that the enhanced expression of GPR48 leads to the enhanced metastasis invasion of human cancer.

In this example, expression analysis of GPR48 in human colorectal cancer specimens was performed by immunohistological analysis.
A peptide (CQEQKMLRTLDL) having a sequence of amino acids 339 to 350 at the extracellular position of human GPR48 (SEQ ID NO: 2) was chemically synthesized, conjugated with KLH, and then immunized with a rabbit four times. After confirming that the antibody titer had increased, whole blood was collected to obtain antiserum. A resin covalently bound to this peptide, which is an antigen, was prepared, adsorbed with antiserum, washed, and then neutralized by elution with a low pH eluate to obtain a purified anti-human GPR48 antibody. Extracts of 293 cells or HCT116 cells transfected with a GPR48 expression vector (pcDNA4-HisMax-hGPR48) were separated by SDS polyacrylamide electrophoresis and analyzed by Western blot. As a result, a human GPR48 band was detected at a molecular weight of 104 kD.
Simultaneously, immunofluorescence staining was performed to confirm the reactivity corresponding to the expression of GPR48, and it was confirmed that this antibody was a specific antibody against GPR48.
Immunohistological staining was performed using a Histofine SAB kit (Nichirei). Specifically, paraffin-embedded tissue sections were deparaffinized and then treated in a microwave oven in 10 mM citrate buffer to eliminate endogenous peroxidase with 0.3% hydrogen peroxide. Next, it was immersed in a purified anti-GPR48 antibody diluted 1: 200 and allowed to react overnight at 4 ° C. Subsequently, it was reacted with a biotin-conjugated secondary antibody (anti-rabbit IgG), then reacted with streptavidin-conjugated horseradish peroxidase, washed, and immersed in a coloring solution containing diaminobenzidine to develop a color. Furthermore, the nucleus was dyed blue with hematoxylin, mounted with cover glass, and observed with a microscope.

FIG. 5 shows a staining example obtained by analyzing the same colorectal cancer specimen as in Example 1 using this immunohistological staining method.
In strongly positive cases, cancer cells were strongly stained brown, and normal cells were hardly stained. On the other hand, in the negative cases, both cancer cells and normal cells were weakly stained. Case No 1, 2, 3, 4, 6, 7, 8, 9 10, 11, 12, 13, 14, 15, 16, 24, 28 , 11, 12, 15, 24, 28 showed moderate to strong positive, and other cases No 6, 8, 9, 10, 13, 14, 16, were weak positive to negative.
As shown in Table 2, the result of this immunohistological staining coincided with the measurement result of the expression level of GPR48 mRNA of Example 1.

It is a figure which shows the expression level of GPR48mRNA in the human colon cancer cell which introduce | transduced the GPR48 expression plasmid. It is a photograph which shows that the cell has infiltrated in the human colon cancer cell which introduce | transduced the GPR48 expression plasmid. The width of each photo is 0.34mm. Gray dots indicate pores (holes) in the matrigel-coated PET membrane, and black dots indicate cells that have infiltrated and passed through. (1) shows the infiltrated cells of the control group in which the pcDNA4-His Max vector was introduced into HCT116 cells, and (2) shows the infiltrated cells of GPR48 highly expressing cells in which pcDNA4-His Max-GPR48 was introduced into HCT116 cells. It is a figure which shows the cell number which infiltrated in the human colon cancer cell which introduce | transduced the GPR48 expression plasmid. The vertical axis indicates the number of cells (the total number of infiltrating cells per chamber) that infiltrated and passed through the pores (holes) of a matrigel-coated PET membrane (pore size 8.0-μm). It is a figure which shows the expression analysis (quantitative RT-PCR) of GPR48 in a human colon cancer specimen. The horizontal axis shows the value corrected by dividing the expression level of GPR48 in each specimen by the expression level of GAPDH. It is a figure which shows the expression analysis (immunological tissue dyeing | staining) of GPR48 in a human colon cancer specimen. In the figure, black circles (blue in color, due to hematoxylin-eosin staining) indicate nuclei. In the positive example, the part of the cytoplasm around the nucleus that is gray (gray near black, dark brown in color) is GPR48, indicating a cancerous part. The unstained part (white) in the meantime is stromal cells (normal). In the negative example, the response of GPR48 shown in gray (brown in color) is very weak.

Claims (7)

A method for examining metastasis of cancer, comprising detecting the expression of G protein-coupled receptor GPR48 in a cell or tissue to be examined. A method for examining the invasion ability of cancer, comprising detecting the expression of G protein-coupled receptor GPR48 in a cell or tissue to be examined. The method according to claim 1 or 2, wherein the detection method is an antigen-antibody reaction, RT-PCR, cDNA microarray, Northern blotting, mass spectrometry analysis, or protein chip analysis. 4. The cell or tissue according to any one of claims 1 to 3, wherein the cell or tissue is a biopsy sample from a patient suspected of cancer or a cell or tissue collected from a patient suspected of cancer by a surgical technique. Method. The method according to any one of claims 1 to 4, which comprises examining the reactivity of the cell to this antibody using an antibody against a peptide corresponding to the extracellular domain of the G protein-coupled receptor GPR48. A diagnostic agent for cancer comprising an antibody against a peptide corresponding to the extracellular domain of G protein-coupled receptor GPR48 as a main component. The method according to any one of claims 1 to 4, comprising examining the expression level of GPR48 in the cells by RT-PCR using two appropriate primers in the sequence of G protein-coupled receptor GPR48. Method.