WO2006102461A2 - Influenza therapeutic - Google Patents
Influenza therapeutic Download PDFInfo
- Publication number
- WO2006102461A2 WO2006102461A2 PCT/US2006/010491 US2006010491W WO2006102461A2 WO 2006102461 A2 WO2006102461 A2 WO 2006102461A2 US 2006010491 W US2006010491 W US 2006010491W WO 2006102461 A2 WO2006102461 A2 WO 2006102461A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rnai
- inducing agent
- virus
- gene
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/513—Organic macromolecular compounds; Dendrimers
- A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/513—Organic macromolecular compounds; Dendrimers
- A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
- A61K9/5153—Polyesters, e.g. poly(lactide-co-glycolide)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
Definitions
- Influenza is one of the most widely spread infections worldwide. In the United States between 20 and 40 thousand people die from influenza A virus infection or its complications each year. An estimated 20 to 40 million people died during the 1918 influenza A virus pandemic. During epidemics the number of influenza related hospitalizations may reach over 300,000 in a single winter season. [0004] Several properties contribute to the epidemiological success of influenza virus. First, it is spread easily from person to person by aerosol (droplet infection). Second, small changes in influenza virus antigens are frequent (antigenic drift) so that the virus readily escapes protective immunity induced by a previous exposure to a different variant of the virus. Third, new strains of influenza virus can be easily generated by reassortment or mixing of genetic material between different strains (antigenic shift).
- influenza A virus In the case of influenza A virus, such mixing can occur between subtypes or strains that affect different species.
- the 1918 pandemic is thought to have been caused by a hybrid strain of virus derived from reassortment between a swine and a human influenza A virus.
- existing vaccines are limited in value in part because of the properties of antigenic shift and drift described above. For these reasons, global surveillance of influenza A virus has been underway for many years, and the National Institutes of Health designates it as one of the top priority pathogens for biodefense.
- current vaccines based upon inactivated virus are able to prevent illness in approximately 70-80% of healthy individuals under age 65, this percentage is far lower in the elderly or immunocompromised.
- the present invention provides novel compositions and methods for the treatment of respiratory virus infections, e.g., influenza infection due to influenza virus types A, B, and/or C.
- the compositions and methods are based on RNA interference (RNAi).
- RNAi is a conserved cellular process in which the presence of double-stranded RNA containing a portion that is complementary to a target RNA inhibits expression of the target RNA in a sequence-specific manner. Inhibition can be caused by cleavage of the target or inhibition of its translation.
- the RNAi-inducing entities of the invention inhibit expression of influenza virus transcripts and thus prevent viral protein synthesis. This represents a fundamentally new approach to controlling influenza virus infection.
- the invention provides RNAi-inducing agents such as short interfering RNA (siRNA) and short hairpin RNA (shRNA) molecules targeted to one or more target transcripts involved in virus production, replication, infection, and/or transcription of viral RNA, etc.
- RNAi-inducing agents such as short interfering RNA (siRNA) and short hairpin RNA (shRNA) molecules targeted to one or more target transcripts involved in virus production, replication, infection, and/or transcription of viral RNA, etc.
- the invention provides vectors whose presence within a cell results in transcription of one or more RNAs that hybridize to each other or self-hybridize to form an siRNA or shRNA that inhibits expression of at least one target transcript involved in virus production, virus infection, virus replication, and/or transcription of viral mRNA, etc.
- the virus is a respiratory virus.
- Preferred viruses are RNA viruses.
- RNA viruses include positive-stranded viruses and negative-stranded RNA viruses such as influenza virus.
- the viral genome can be segmented or non-segmented.
- the target transcript encodes a protein selected from the group consisting of: a polymerase, a nucleocapsid protein, a neuraminidase, a hemagglutinin, a matrix protein, and a nonstructural protein.
- the target transcript encodes an influenza virus protein selected from the group consisting of hemagglutinin, neuraminidase, membrane protein 1, membrane protein 2, nonstructural protein 1, nonstructural protein 2, polymerase protein PBl, polymerase protein PB2, polymerase protein PA, nucleoproteinNP.
- the invention also provides compositions comprising RNAi-inducing agents and/or vectors, e.g., the RNAi-inducing agents and/or vectors described herein, wherein the composition further comprises a delivery agent that facilitates delivery of the RNAi- inducing agent or vector.
- Preferred delivery agents include cationic polymers.
- the invention further provides methods of treating or preventing viral diseases, particularly diseases caused by a respiratory virus such as influenza, by administering an inventive composition comprising an RNAi-inducing entity to a subject within an appropriate time window prior to exposure to the virus, while exposure is occurring, or following exposure, or at any point during which a subject exhibits symptoms of a disease caused by the virus.
- compositions may be administered by a variety of routes.
- Preferred routes include intravenous, or directly into the respiratory system by inhalation, intranasally, as an aerosol, etc.
- the invention provides nucleic acid sequences that represent portions of influenza virus transcripts that are preferred targets for RNAi. Certain of the preferred target portions are functionally preferred targets for RNAi. Certain of the preferred target portions are favorably conserved among multiple variants so that an RNAi-inducing agent designed based on the sequence of a specific variant will also inhibit variants whose corresponding target portion differs in sequence. Certain of the preferred target portions are highly conserved among multiple variants.
- the invention provides nucleic acids comprising one or more preferred target portions, complements thereof, and fragments of either.
- the invention further provides nucleic acids that are RNAi-inducing entities e.g., RNAi-inducing agents and RNAi- inducing vectors that are targeted to one or more of these target portions.
- the RNAi-inducing entities are targeted to the NP, PA, PB 1 , or PB2 gene.
- the invention provides highly effective RNAi-inducing entities targeted to certain preferred target portions. Such highly effective RNAi-inducing entities may be particularly useful for treatment or prevention of influenza virus infection.
- the invention provides an RNAi-inducing agent targeted to an influenza virus transcript, wherein the RNAi-inducing agent comprises a nucleic acid portion whose sequence comprises a sequence selected from the group consisting of: SEQ ID NOs: 272 - 380, its complement, or a fragment of either having a length of at least 15 nucleotides.
- the invention further provides an RNAi-inducing agent targeted to an influenza virus gene selected from the group consisting of the polymerase protein PBl gene, the polymerase protein PB2 gene, the polymerase protein PA gene, and the nucleoprotein NP gene.
- the invention also provides an isolated nucleic acid, or its complement, whose sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 272 - 380, or comprises a fragment of a sequence selected from the group consisting of SEQ ID NOs: 272 - 380 having a length of at least 15 nucleotides, wherein the nucleic acid has a length of 100 nucleotides or less. In certain embodiments the length is at least 16 nucleotides.
- the invention provides methods for diagnosis of virus infection and for determining whether a subject suspected of having a viral infection is infected with a virus of a particular type, strain, etc.
- the method comprises determining whether a subject is infected with an influenza virus that is susceptible to inhibition by one or more of the RNAi-inducing entities of the invention.
- a patient is diagnosed with influenza infection, and an RNAi-inducing entity targeted to the particular influenza strain infecting the subject is administered.
- the invention therefore provides integrated methods of influenza diagnosis and treatment.
- Certain of the diagnostic methods employ one or more nucleic acids of the invention.
- the invention also provides diagnostic kits for detecting influenza virus infection and/or determining whether an influenza virus is susceptible to inhibition by an RNAi-inducing entity.
- the kits may comprise one or more nucleic acids of the invention and/or a probe or primer for detecting a preferred target portion of an influenza virus transcript.
- the invention further provides methods of delivering RNAi-inducing entities to the respiratory tract of a mammalian subject.
- RNAi-inducing entities can effectively silence gene expression in the lung when delivered directly to the respiratory tract of a mammalian subject.
- RNAi-inducing agents such as siRNA can be delivered directly to the vascular system of a mammalian subject using conventional volumes and administration methods and can effectively silence gene expression in the respiratory system, e.g., in the lung.
- siRNA targeted to influenza virus transcripts inhibited influenza production in the lung when delivered to mice by either the intravenous or the inhalational route, indicating that therapeutically effective inhibition of gene expression in the respiratory system can be achieved by either method.
- siRNA targeted to a luciferase transcript silenced luciferase expression in the lung when administered by either the inhalational or intravenous route to mice that expressed luciferase, indicating that expression of essentially any gene can be inhibited using either of these methods.
- siRNA targeted to an endogenous gene was also effective in inhibiting expression in the lung when delivered by inhalation.
- the invention therefore provides methods that allow the use of RNAi for treating a wide range of diseases that affect the respiratory system including infections caused by respiratory viruses.
- the methods of intravascular delivery can also be employed to deliver effective amounts of an RNAi- inducing agent to organs or tissues other than the lung.
- the invention provides a method of inhibiting expression of a transcript in an organ or tissue of a mammalian subject comprising introducing an RNAi- inducing entity such as an RNAi-inducing agent targeted to the transcript directly into the respiratory system of the subject.
- an RNAi-inducing entity such as an RNAi-inducing agent targeted to the transcript directly into the respiratory system of the subject.
- the organ or tissue is part of the respiratory tract, e.g., the lung.
- the invention provides a method of inhibiting expression of a transcript in the respiratory system of a mammalian subject comprising introducing an RNAi-inducing entity such as an RNAi-inducing agent targeted to the transcript directly into the respiratory system of the subject.
- the RNAi-inducing entity is delivered directly to the respiratory system, enters a vessel, and is transported via the vascular system to a site of activity other than the respiratory system, i.e., the respiratory route is used for systemic delivery.
- the invention further provides a method of inhibiting expression of a transcript in the respiratory system of a mammalian subject comprising introducing an RNAi-inducing agent targeted to the transcript directly into the vascular system of a mammalian subject.
- the invention provides a method of inhibiting expression of a transcript in an organ or tissue of a mammalian subject comprising introducing an RNAi-inducing agent targeted to the transcript directly into the vascular system of a mammalian subject.
- the invention provides a method of inhibiting expression of a transcript in a solid organ or tissue of a mammalian subject comprising introducing an RNAi-inducing entity such as an RNAi-inducing agent targeted to the transcript into the respiratory system of the subject, wherein the RNAi- inducing agent enters the vascular system and is transported to a location elsewhere in the body.
- the RNAi-inducing agent is administered in an aqueous medium essentially free of lipids or delivery-enhancing polymers. In other embodiments of the invention the RNAi-inducing agent is administered in a composition that comprises a cationic polymer.
- the invention provides compositions suitable for delivery to the respiratory system.
- the invention provides respirable aerosol formulations containing liquid or solid particles (e.g., dry powders) that comprise one or more of the inventive
- RNAi-inducing agents and/or RNAi-inducing vectors may comprise a delivery agent and/or excipient.
- the invention also provides nasal sprays comprising the RNAi-inducing agents or RNAi-inducing vectors.
- the invention further provides a device for delivering a composition of the invention, e.g., a device such as an inhaler or nebulizer for delivery of a dry or liquid aerosol formulation to the respiratory system.
- the device may deliver single or multiple doses of the composition.
- An inventive composition may be provided inside the device and/or it may be provided separately (e.g. as a refill).
- the device may be disposable.
- the invention provides non-human transgenic animals that express an RNAi-inducing agent targeted to an influenza gene.
- This application refers to various patents, journal articles, and other publications, all of which are incorporated herein by reference.
- the following standard reference works are incorporated herein by reference: Ausubel, F., et al. (eds.) Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, John Wiley & Sons, N.
- Figure IA adapted from Julkunen, L, et at, infra, presents a schematic of the influenza virus.
- Figure IB adapted from Fields ' Virology, infra, shows the genome structure of the influenza virus and the transcripts derived from the influenza genome. Thin lines at the 5' and 3 '-termini of the mRNAs represent untranslated regions. Shaded or hatched areas represent coding regions in the 0 or +1 reading frames, respectively. Introns are depicted by V-shaped lines. Small rectangles at the 5' ends of the mRNAs represent heterogenous cellular RNAs covalently linked to the viral nucleic acids. A (n ) symbolizes the polyA tail.
- Figure 2 adapted from Julkunen, l., et al, infra, shows the influenza virus replication cycle.
- Figure 3 shows the structure of siRNAs observed in the Drosophila system.
- Figure 4 schematically represents of the steps involved in RNA interference in Drosophila.
- Figure 5 shows a variety of exemplary siRNA and shRNA structures useful in accordance with the present invention.
- Figure 6 represents an alternative inhibitory pathway, in which the DICER enzyme cleaves a substrate having a base mismatch in the stem to generate an inhibitory product that binds to the 3' UTR of a target transcript and inhibits translation.
- Figure 7 presents one example of a construct that may be used to direct transcription of both strands of an inventive siRNA.
- Figure 8 depicts one example of a construct that may be used to direct transcript of a single RNA molecule that hybridizes to form an shRNA in accordance with the present invention.
- Figure 9 shows a sequence comparison between six strains of influenza virus A that have a human host of origin. Dark shaded areas were used to design siRNAs that were tested as described in Example 2.
- the base sequence is the sequence of strain A/Puerto Rico/8/34. Lightly shaded letters indicate nucleotides that differ from the base sequence.
- Figure 10 shows a sequence comparison between two strains of influenza virus that have a human host of origin and five strains of influenza virus A that have an animal host of origin. Darkly shaded areas were used to design siRNAs that were tested as described in Example 2.
- the base sequence is the sequence of strain A/Puerto Rico/8/34. Lightly shaded letters indicate nucleotides that differ from the base sequence.
- Figures Il A — HF show the results of experiments indicating that siRNA inhibits influenza virus production in MDCK cells.
- Six different siRNAs that target various viral transcripts were introduced into MDCK cells by electroporation, and cells were infected with virus 8 hours later.
- Figure HA is a time course showing viral titer in culture supernatants as measured by hemagglutinin assay at various times following infection with viral strain A/PR/8/34 (HlNl) (PR8), at a multiplicity of infection (MOI) of 0.01 in the presence or absence of the various siRNAs or a control siRNA.
- Figure HB is a time course showing viral titer in culture supernatants as measured by hemagglutinin assay at various times following infection with influenza virus strain A/WSN/33 (HlNl) (WSN) at an MOI of 0.01 in the presence or absence of the various siRNAs or a control siRNA.
- Figure HC shows a plaque assay showing viral titer in culture supernatants from virus infected cells that were either mock transfected or transfected with siRNA NP- 1496.
- Figure HD shows inhibition of influenza virus production at different doses of siRNA. MDCK cells were transfected with the indicated amount of NP- 1496 siRNA followed by infection with PR8 virus at an MOI of 0.01. Virus titer was measured 48 hours after infection.
- Figure HE shows inhibition of influenza virus production by siRNA administered after virus infection.
- MDCK cells were infected with PR8 virus at an MOI of 0.01 for 2 lirs and then transfected with NP-1496 (2.5 nmol).
- Virus titer was measured at the indicated times after infection. Representative data from one of two experiments are shown.
- Figure 12 shows a sequence comparison between a portion of the 3' region of NP sequences among twelve influenza A virus subtypes or isolates that have either a human or animal host of origin. The shaded area was used to design siRNAs that were tested as described in Examples 2 and 3. The base sequence is the sequence of strain A/Puerto Rico/8/34. Shaded letters indicate nucleotides that differ from the base sequence.
- Figure 13 shows positions of various siRNAs relative to influenza virus gene segments, correlated with effectiveness in inhibiting influenza virus.
- Figure 14A is a schematic of a developing chicken embryo indicating the area for injection of siRNA and siRNA/delivery agent compositions.
- Figure 14B shows the ability of various siRNAs to inhibit influenza virus production in developing chicken embryos.
- Figure 15 is a schematic showing the interaction of nucleoprotein with viral RNA molecules.
- Figures 16A and 16B show schematic diagrams illustrating the differences between influenza virus vRNA, mRNA, and cRNA (template RNA) and the relationships between them. The conserved 12 nucleotides at the 3' end and 13 nucleotides at the 5' end of each influenza A virus vRNA segment are indicated in Figure 16B.
- the mRNAs contain an m 7 GpppN m cap structure and, on average, 10 to 13 nucleotides derived from a subset of host cell RNAs.
- Polyadenylation of the mRNAs occurs at a site in the mRNA corresponding to a location 15 to 22 nucleotides before the 5' end of the vRNA segment. Arrows indicate the positions of primers specific for each RNA species. (Adapted from ref. (I)).
- Figure 17 shows amounts of viral NP and NS RNA species at various times following infection with virus, in cells that were mock transfected or transfected with siRNA NP- 1496 6-8 hours prior to infection.
- Figure 18 A shows that inhibition of influenza virus production requires a wild type (wt) antisense strand in the duplex siRNA.
- MDCK cells were first transfected with siRNAs formed from wt and modified (m) strands and infected 8 hrs later with PR8 virus at MOI of 0.1.
- Virus titers in the culture supernatants were assayed 24 hrs after infection. Representative data from one of the two experiments are shown.
- Figure 18B shows that M-specific siRNA inhibits the accumulation of specific mRNA.
- MDCK cells were transfected with M-37, infected with PR8 virus at MOI of 0.01, and harvested for RNA isolation 1, 2, and 3 hrs after infection.
- RNA-specific mRNA, cRNA, and vRNA were measured by reverse transcription using RNA-specific primers, followed by real time PCR.
- the level of each viral RNA species is normalized to the level of ⁇ -actin mRNA (bottom panel) in the same sample.
- the relative levels of RNAs are shown as mean value ⁇ S. D. Representative data from one of the two experiments are shown.
- Figures 19 A-D show that NP-specific siRNA inhibits the accumulation of not only NP- but also M- and NS-specific mRNA, vRNA, and cRNA.
- MDCK (A-C) and Vero (D) cells were transfected with NP- 1496, infected with PR8 virus at MOI of 0.1 , and harvested for RNA isolation 1, 2, and 3 hrs after infection.
- the levels of mRNA, cRNA, and vRNA specific for NP, M, and NS were measured by reverse transcription using RNA-specific primers followed by real time PCR.
- the level of each viral RNA species is normalized to the level of ⁇ -actin mRNA (not shown) in the same sample. The relative levels of RNAs are shown. Representative data from one of three experiments are shown.
- FIGS 19E-G right side in each figure, show that PA-specific siRNA inhibits the accumulation of not only PA- but also M- and NS-specific mRNA, vRNA, and cRNA.
- MDCK cells were transfected with PA- 1496, infected with PR8 virus at MOI of 0.1, and harvested for RNA isolation 1, 2, and 3 hrs after infection.
- the levels of mRNA, cRNA, and vRNA specific for PA, M, and NS were measured by reverse transcription using RNA-specific primers followed by real time PCR.
- the level of each viral RNA species is normalized to the level of ⁇ -actin mRNA (not shown) in the same sample. The relative levels of RNAs are shown.
- Figure 19H shows that NP-specific siRNA inhibits the accumulation of PBl- (top panel), PB2- (middle panel) and PA- (lower panel) specific mRNA.
- MDCK cells were transfected with NP-1496, infected with PR8 virus at MOI of 0.1, and harvested for RNA isolation 1, 2, and 3 hrs after infection.
- the levels of mRNA specific for PBl, PB2, and PA mRNA were measured by reverse transcription using RNA-specific primers followed by real time PCR.
- the level of each viral RNA species is normalized to the level of ⁇ -actin mRNA (not shown) in the same sample. The relative levels of RNAs are shown..
- Figure 2OA shows sequences of siRNA CD8-61 and its hairpin derivative CD8-61F.
- Figure 2OB shows inhibition of CD8 ⁇ expression by CD8-61 and CD8-61F.
- a CD8 + CD4 + T cell line was transfected with either CD8-61 or CD8-61F by electroporation.
- CD8 ⁇ expression was assayed by flow cytometry 48 hrs later. Unlabeled line, mock transfection.
- Figure 2OC shows a schematic diagram of the pSLOOP III vector, in which expression of CD8-61F hairpin RNA is driven by Hl RNA pol III promoter. Terminator, termination signal sequence.
- Figure 2OD presents plots showing silencing of CD8 ⁇ in HeLa cells using pSLOOP III. Untransfected cells did not express CD8 ⁇ . Cells were transfected with the CD8 ⁇ expression vector and either a promoterless pSLOOP III-CD8-61F construct, synthetic siRNA, or a pSLOOP III-CD8-61F containing a promoter.
- Figure 21 A shows schematic diagrams of NP-1496 and GFP-949 siRNA and their hairpin derivatives/precursors.
- Figure 2 IB shows tandem arrays of NP- 1496H and GFP-949H in two different orders.
- Figure 21C shows pSLOOP III expression vectors. Hairpin precursors of siRNA are cloned in the pSLOOP III vector alone (top), in tandem arrays (middle), or simultaneously with independent promoter and termination sequence (bottom).
- Figure 22A is a plot showing that siRNA inhibits influenza virus production in mice when administered together with the cationic polymer PEI prior to infection with influenza virus. Filled squares (no treatment); Open squares (GFP siRNA); Open circles (30 ⁇ g NP siRNA); Filled circles (60 ⁇ g NP siRNA). Each symbol represents an individual animal, p values between different groups are shown.
- Figure 22B is a plot showing that siRNA inhibits influenza virus production in mice when administered together with the cationic polymer PLL prior to infection with influenza virus. Filled squares (no treatment); Open squares (GFP siRNA); Filled circles (60 ⁇ g NP siRNA). Each symbol represents an individual animal, p values between different groups are shown.
- Figure 22C is a plot showing that siRNA inhibits influenza virus production in mice when administered together with the cationic polymer jetPEI prior to infection with influenza virus significantly more effectively than when administered in PBS.
- Each symbol represents an individual animal, p values between different groups are shown.
- Figure 22D is a plot showing that siRNA targeted to NP inhibits influenza virus production in mice when administered intravenously together with a cationic poly(beta amino ester) (J28). Open circles (no treatment); Filled squares (NP siRNA with J28).
- Figure 22E is a plot showing that siRNA targeted to NP inhibits influenza virus production in mice when administered intraperitoneally together with a cationic poly(beta amino ester) (J28 or C32) while a control RNA (GFP) has no significant effect.
- a cationic poly(beta amino ester) J28 or C32
- GFP control RNA
- Figure 23 is a plot showing that siRNAs targeted to influenza virus NP and PA transcripts exhibit an additive effect when administered together prior to infection with influenza virus. Filled squares (no treatment); Open circles (60 ⁇ g NP siRNA);
- Figure 24 is a plot showing that siRNA inhibits influenza virus production in mice when administered following infection with influenza virus. Filled squares (no treatment); Open squares (60 ⁇ g GFP siRNA); Open triangles (60 ⁇ g PA siRNA); Open circles (60 ⁇ g NP siRNA); Filled circles (60 ⁇ g NP + 60 ⁇ g PA siRNA). Each symbol represents an individual animal, p values between different groups are shown.
- Figure 25 A is a schematic diagram of a lentiviral vector expressing a shRNA.
- CMV promoter CMV promoter.
- SIN-LTR, ⁇ , cPPT, and WRE are lentivirus components.
- the sequence of NP-1496 shRNA is shown.
- FIG. 25B presents plots of flow cytometry results demonstrating that Vero cells infected with the lentivirus depicted in Figure 25B express EGFP in a dose- dependent manner.
- Lentivirus was produced by co-transfecting DNA vector encoding NP-1496a shRNA and packaging vectors into 293T cells. Culture supernatants (0.25 ml or 1.0 ml) were used to infect Vero cells. The resulting Vero cell lines (Vero-NP-0.25 and Vero-NP-1.0) and control (uninfected) Vero cells were analyzed for GFP expression by flow cytometry. Mean fluorescence intensity of Vero-NP-0.25 (upper portion of figure) and Vero-NP-1,0 (lower portion of figure) cells are shown. The shaded curve represents mean fluorescence intensity of control (uninfected) Vero cells.
- Figure 25C is a plot showing inhibition of influenza virus production in Vero cells that express NP- 1496 shRNA.
- Parental and NP- 1496 shRNA expressing Vero cells were infected with PR8 virus at MOI of 0.04, 0.2 and 1.
- Virus titers in the supernatants were determined by hemagglutination (HA) assay 48 hrs after infection.
- Figure 26 is a plot showing that influenza virus production in mice is inhibited by administration of DNA vectors that express siRNA targeted to influenza virus transcripts. Sixty ⁇ g of DNA encoding RSV, NP-1496 (NP) or PB1-2257 (PBl) shRNA were mixed with 40 ⁇ l Infasurf and were administered into mice by instillation.
- FIG. 27 A shows results of an electrophoretic mobility shift assay for detecting complex formation between siRNA and poly-L-lysine (PLL).
- siRNA-polymer complexes were formed by mixing 150ng of NP-1496 siRNA with increasing amounts of polymer (0-1200 ng) for 30 min at room temperature.
- FIG. 27 B shows results of an electrophoretic mobility shift assay for detecting complex formation between siRNA and poly-L-arginine (PLA).
- SiRNA- polymer complexes were formed by mixing 150ng of NP-1496 siRNA with increasing amounts of polymer (0-1200 ng) for 30 min at room temperature. The reactive mixtures were then run on a 4% agarose gel and siRNAs were visualized with ethidium-bromide staining.
- Figure 28 A is a plot showing cytotoxicity of siRNA/PLL complexes.
- FIG. 28B is a plot showing cytotoxicity of siRNA/PLA complexes. Vero cells in 96-well plates were treated with siRNA (400 pmol)/polymer complexes for 6 hrs. The polymer-containing medium was then replaced with DMEM- 10% FCS. The metabolic activity of the cells was measured 24 h later by using the MTT assay.
- Figure 28B is a plot showing cytotoxicity of siRNA/PLA complexes. Vero cells in 96-well plates were treated with siRNA (400 pmol)/polymer complexes for 6 hrs. The polymer-containing medium was then replaced with DMEM- 10% FCS. The metabolic activity of the cells was measured 24 h later by using the MTT assay. The data are shown
- Figure 29 A is a plot showing that PLL stimulates cellular uptake of siRNA.
- Figure 29B is a plot showing that poly-L-arginine stimulates cellular uptake of siRNA.
- Figure 3OA is a bar graph showing that PEI mediates DNA transfection in the lungs after intravenous injection. Luc activities in relative light units in 0.5 mg of protein in different organs over 4 days are shown. Data are from one of two experiments.
- Figure 3OB is a bar graph showing that PEI mediates DNA transfection in the lungs after intratracheal administration. The figure shows average Luc activities in relative light units in 0.5 mg of protein in the indicated organs of three mice per group 24 hr after DNA administration. Error bars indicate standard deviation.
- Figure 3OC is a bar graph showing inhibition of luciferase activity in the lung by intravenous delivery of siRNA.
- FIG. 31 A and 3 IB are plots showing that administration of siRNA without a delivery agent inhibits influenza virus production in mice.
- Figures 32 A - 32 J show sequences of influenza virus strain PR8 transcripts that were used for selection of target portions for RNAi.
- Figure 33 is Table 17, which shows the sequences of functional target portions for RNAi to inhibit influenza virus.
- Figure 34 is Table 18, which shows the sequences of influenza virus target portions that are favorably conserved for RNAi among influenza virus strains derived from humans.
- Figure 35 is Table 20, which shows the sequences of influenza virus target portions that are favorably conserved for RNAi among influenza virus strains derived from humans and avians.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- vRNA virion RNA in the influenza virus genome
- cRNA complementary RNA, a direct transcript of vRNA, positive strand
- mRNA messenger RNA transcribed from vRNA or cellular genes, positive strand, a template for protein synthesis
- dsRNA double-stranded RNA
- siRNA short interfering RNA
- shRNA short hairpin RNA
- miRNA microRNA
- RNAi RNA interference
- bp base pair(s)
- nt nucleotide(s)
- avian as used herein is intended to refer to any species, subspecies or race of organism of the taxonomic class ava, e.g., chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, and crows.
- the term includes the various known strains of Gallus gallus, or chickens, (for example, White Leghorn, Brown Leghorn, Barred-Rock, Wales, New Hampshire, Rhode Island, Ausstralorp, Minorca, Amrox, Calif. Gray, Italian Partidge-colored), as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred.
- adenine (A) and uridine (U) are complementary; adenine (A) and thymidine (T) are complementary; and guanine (G) and cytosine (C), are complementary and are referred to in the art as Watson-Crick base pairings.
- nucleotide at a certain position of a first nucleic acid sequence is complementary to a nucleotide located opposite in a second nucleic acid sequence when the strands are aligned in anti-parallel orientation, the nucleotides form a complementary base pair, and the nucleic acids are complementary at that position.
- the percent complementarity of a first nucleic acid to a second nucleic acid may be evaluated by aligning them in antiparallel orientation for maximum complementarity over a window of evaluation along the second nucleic acid, determining the total number of nt in both strands that form complementary base pairs within the window, dividing by the total number of nt within the window, and multiplying by 100.
- AAAAAAAA and TTTGTTAT are 75% complementary since there are 12 nt in complementary base pairs out of a total of 16. Nucleic acids that are at least 70% complementary over a window of evaluation are considered substantially complementary over that window. When computing the number of complementary nt needed to achieve a particular % complementarity, fractions are rounded to the nearest whole number. A position occupied by non-complementary nucleotides constitutes a mismatch, i.e., the position is occupied by a non-complementary base pair. In order to achieve maximum complementarity gaps may be introduced into either or both of the nucleic acids within a window of evaluation.
- Nucleotide(s) opposite a gap is/are unpaired and constitute a bulge, i.e., there is no nucleotide located opposite in the other nucleic acid.
- a percent complementarity is determined over a window of evaluation of at least 15 nt in length, e.g., 19 nt, where the length does not include gaps.
- a 1 nt bulge is considered to be a single non-complementary nt; a bulge of between 2 and 5 nt is considered to be 2 non-complementary nt; a bulge of between 6 and 10 nt is considered to be 3 non-complementary nt.
- a bulge of length K nt, where K is greater than 10, is considered to be 3 + (K-10) non-complementary nt.
- "Directly into the respiratory system” refers to administration via the nose, mouth, or trachea, preferably the nose or mouth, such that a significant fraction of an active agent in the composition (e.g., more than 10%, preferably more than 25% of the active agent, by weight) enters the upper and/or lower respiratory tract.
- a significant fraction of an active agent in the composition e.g., more than 10%, preferably more than 25% of the active agent, by weight
- "Directly into the vascular system” refers to administration into a vessel (e.g., an artery or vein) by injection or catheter or any other method in which the vascular system is entered from outside the body, typically involving penetrating the wall of a vessel.
- “Indirectly into the vascular system” refers to a mode of administration in which the vascular system is not penetrated.
- a preferred example of indirect delivery of a substance to the vascular system is direct delivery of the substance to the respiratory system, followed by passage of the substance across a vessel wall. The substance may then be transported to a target tissue or organ elsewhere in the body (and may return to the lung).
- an “effective amount” of an active agent refers to the amount of the active agent sufficient to elicit a desired biological response.
- the absolute amount of a particular agent that is effective may vary depending on such factors as the desired biological endpoint, the agent to be delivered, the target tissue, etc.
- An “effective amount” may be administered in a single dose or multiple doses.
- an effective amount of an RNAi-inducing entity may be an amount sufficient to achieve one or more of the following: (i) reduce expression of a target transcript by at least 20%, preferably at least 40%; (ii) reduce virus titer by at least 25%; (iii) reduce virus titer by at least 2-fold; (iv) delay or prevent the development of clinically significant virus infection; (v) reduce the duration or severity of at least one symptom of a virus infection, etc.
- a composition is "essentially free” of a substance if the composition contains less than 1% of the substance by weight, preferably less than 0.5%, more preferably less than 0.1%. More preferably the substance is entirely absent from the composition.
- a composition is considered essentially free of delivery-enhancing polymers or lipids if no such polymer or lipid has been deliberately included in the composition.
- hybridize refers to the interaction between two nucleic acid sequences comprising or consisting of complementary portions such that a duplex structure is formed that is stable under the particular conditions of interest, e.g., in a eukaryotic cell, in a Drosophila lysate, etc.
- a first nucleic acid is considered to hybridize to a second nucleic acid if the Tm of a duplex formed by the first and second nucleic acids is less than 15°C below, preferably less than 10°C below the Tm of a duplex that would be formed by the second nucleic acid and a third nucleic acid that is the same length as, and 100% complementary to, the second nucleic acid and contains nucleosides and internucleosidic linkages of the same type.
- Hybridization conditions suitable for various applications are known in the art and/or found in standard reference Mi l yyzo
- stringent hybridization conditions comprise 6 X sodium chloride/sodium citrate (SSC) and 0.1% SDS at a temperature 10-15 0 C below the Tm of a perfectly complementary duplex, followed by washing 1-2 times for 30 minutes in 2 X SSC and 0.1% SDS at a temperature 25 °C below the Tm of a perfectly complementary duplex.
- SSC sodium chloride/sodium citrate
- Identity refers to the extent to which the sequence of two or more nucleic acids is the same.
- the percent identity between first and second nucleic acids over a window of evaluation may be computed by aligning the nucleic acids in parallel orientation, determining the number of nucleotides within the window of evaluation that are opposite an identical nucleotide, dividing by the total number of nucleotides in the window, and multiplying by 100.
- fractions are to be rounded to the nearest whole number. Nucleic acids that are at least 70% identical over a window of evaluation, e.g., at least 80%, at least 90%, of more, are considered substantially identical over that window.
- the window of evaluation is at least 15 nt in length along the second nucleic acid, e.g., 19 nt, where the length does not include gaps.
- a 1 nt gap is considered to be a single nt that is not opposite an identical nt; a gap of between 2 and 5 nt is considered to be 2 nt that are not opposite an identical nt; a gap of between 6 and 10 nt is considered to be 3 nt that are not opposite an identical nt.
- a gap of length K nt, where K is greater than 10, is considered to be 3 + (K- 10) nt that are not opposite an identical nt.
- influenza virus is used here to refer to any strain of influenza virus that is capable of causing disease in an animal or human subject, or that is an interesting candidate for experimental analysis. Influenza viruses are described in Fields, B., et ah, Fields ' Virology, 4 th . ed., Philadelphia: Lippincott Williams and Wilkins; ISBN:
- the term encompasses any strain of influenza A virus that is capable of causing disease in an animal or human subject, or that is an interesting candidate for experimental analysis.
- a large number of influenza A isolates have been partially or completely sequenced.
- Appendix A presents merely a partial list of complete sequences for influenza A genome segments that have been deposited in a public database (The Influenza Sequence Database (ISD), see Macken, C, Lu, H., Goodman, J., ivi 1 1 yy&O
- RNAi-inducing agent generally refers to events that occur within a cell as opposed to in a cell-free system. In general, the cell can be maintained in tissue culture or can be part of an intact organism.
- isolated means 1) separated from at least some of the components with which it is usually associated in nature; 2) prepared or purified by a process that involves the hand of man; and/or 3) not occurring in nature. Any of the nucleic acids and nucleic acid structures described herein may be in an isolated form.
- Ligand means a molecule that specifically binds to a second molecule through a mechanism other than an antigen-antibody interaction.
- the term encompasses, for example, polypeptides, peptides, and small molecules, either naturally occurring or synthesized, including molecules whose structure has been invented by man.
- Nucleic acid based assay refers to any assay or method in which the presence of a nucleic acid is detected and/or a nucleic acid is identified. The assay can be qualitative or quantitative.
- Nucleobase means a nitrogen-containing heterocyclic moiety capable of forming hydrogen bonds, preferably Watson-Crick hydrogen bonds, in pairing with a complementary nucleobase or nucleobase analog, e.g., a purine or a pyrimidine.
- Typical nucleobases are the naturally occurring nucleobases adenine, guanine, cytosine, uracil, thymine, and analogs of the naturally occurring nucleobases (Fasman, Practical Handbook of Biochemistry and Molecular Biology, pp. 385-394, CRC Press, Boca Raton, FIa., 1989).
- the terms “nucleobase” and “base” are used interchangeably herein.
- a "nucleotide” comprises a nitrogenous base, a sugar molecule, and a phosphate group.
- a nucleoside comprises a nitrogenous base (nucleobase) linked to a sugar molecule.
- phosphate groups covalently link adjacent nucleosides to form a polymer.
- a nucleic acid may include naturally occurring nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, C5- propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5- iodouridine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified
- a nucleoside can comprise a universal base, i.e., a base can that substitute for one, or preferably any, of the natural bases commonly found in nucleic acids when opposite them in a duplex (see, e.g., 142-149).
- a nucleic acid comprises an abasic residue.
- "Operably linked" refers to a relationship between two nucleic acids sequences wherein the expression of one of the nucleic acid sequences is controlled by, regulated by, modulated by, etc., the other nucleic acid sequence.
- the transcription of a nucleic acid sequence is directed by an operably linked promoter sequence; post-transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; the translation of a nucleic acid sequence is directed by an operably linked translational regulatory sequence; the transport or localization of a nucleic acid or polypeptide is directed by an operably linked transport or localization sequence; and the post-translational processing of a polypeptide is directed by an operably linked processing sequence.
- a nucleic acid sequence that is operably linked to a second nucleic acid sequence is covalently linked, either directly or indirectly, to such a sequence, although any effective three-dimensional association is acceptable.
- organ is used as in the art, to refer to a tissue or group of tissues that constitute a morphologically and functionally distinct part of an organism. Examples include lung, heart, liver, pancreas, breast, kidney, intestine, bladder, bone, skin, etc.
- tissue is used as in the art, to refer to a group of cells, usually of similar structure, typically organized to perform one or more identical or related functions. Red blood cells, white blood cells, and platelets are considered to be circulating tissues comprising individual cells or cell fragments.
- Preventing refers to causing a disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such, not to occur. Preventing includes reducing the risk that a disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such, will occur. Thus if a composition or method reduces the risk that a disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such will occur on an individual or population basis, the composition or method is said to prevent the disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such.
- primer refers to an oligonucleotide, whether natural or synthetic, that is capable of acting as a point of initiation of nucleic acid synthesis when hybridized to a nucleic acid template under conditions in which primer extension, e.g., polymerase-catalyzed primer extension, is initiated.
- the appropriate length of a primer depends on the intended use of the primer, but typically ranges from 15 to 35 nt. In some cases a primer may be longer, e.g., up to about 60 nt in length. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with a template.
- a primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template for primer elongation to occur.
- probe refers to a nucleic acid that can hybridize with and thereby detect the presence of a complementary nucleic acid
- the probe should be sufficiently complementary to the nucleic acid being detected so that specific hybridization can occur under the hybridization stringency conditions used.
- the probe may be modified with labels such as fluorescent moieites, biotin, etc.
- Purified as used herein, means separated from many other compounds or entities.
- a compound or entity may be partially purified, substantially purified, or pure, where it is pure when it is removed from substantially all other compounds or entities, i.e., is preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% pure.
- regulatory sequence is used herein to describe a region of nucleic acid sequence that directs, enhances, or inhibits the expression (particularly transcription, but in some cases other events such as splicing or other processing) of sequence(s) with which it is operatively linked.
- the term includes expression signals such as promoters, enhancers and other transcriptional control elements.
- regulatory sequences may direct constitutive expression of a nucleotide sequence; in other embodiments, regulatory sequences may direct tissue-specific and/or inducible expression.
- a regulatory sequence may direct expression of a nucleotide sequence only in cells that have been infected with an infectious agent.
- the regulatory sequence may comprise a promoter and/or enhancer such as a virus-specific promoter or enhancer that is recognized by a viral protein, e.g., a viral polymerase, transcription factor, etc.
- the regulatory sequence may comprise a promoter and/or enhancer that is active in epithelial cells, e.g., respiratory epithelial cells.
- a promoter for a gene that encodes a surfactant protein can be used.
- Respiratory system refers to any component upper respiratory tract (e.g., e.g., nasal passages, nasopharynx, oropharynx) or lower respiratory tract (e.g., trachea, bronchi, bronchioles, and/or alveoli).
- the larynx can be considered a component of either the upper or lower respiratory tract.
- the terms “respiratory system” and “respiratory tract” are used interchangeably herein.
- a "respiratory virus” is a virus that infects cells present in the upper and/or lower respiratory tract of a subject. Preferably the virus infects respiratory epithelial cells.
- RNAi-inducing agent is used to refer to siRNAs, shRNAs, and other double-stranded structures (e.g., dsRNA) that can be processed to yield an siRNA or shRNA or other small RNA species that inhibits expression of a target transcript by RNA interference.
- dsRNA double-stranded structures
- an RNAi-inducing agent inhibits expression of a target RNA via an RNA interference pathway that involves translational repression.
- RNAi-inducing entity encompasses RNA molecules and vectors whose presence within a cell results in RNAi and leads to reduced expression of a transcript to which the RNAi-inducing entity is targeted.
- the RNAi-inducing entity may be, for example, an RNAi-inducing agent such as an siRNA, shRNA, or an RNAi- inducing vector.
- RNAi-inducing entity is not intended to imply that the entity, agent, or vector upregulates or activates RNAi in general, though it may do so, but simply to indicate that presence of the entity, agent, or vector within the cell results in RNAi -mediated reduction in expression of a target transcript.
- An "RNAi-inducing entity” as used herein is an entity that has been modified or generated by the hand of man and/or whose presence in a cell is a result of human intervention as distinct, e.g., from endogenous RNA species or RNA species that are produced in a cell during the natural course of viral infection.
- RNAi-inducing vector is a vector whose presence within a cell results in transcription of one or more RNAs that hybridize to each other or self-hybridize to form an RNAi-inducing agent such as an siRNA or shRNA.
- this term encompasses plasmids or viruses whose presence within a cell results in production of one or more RNAs that self-hybridize or hybridize to each other to form an RNAi-inducing agent.
- the vector comprises a nucleic acid operably linked to expression signal(s) so that one or more RNA molecules that hybridize or self- hybridize to form an RNAi-inducing agent is transcribed when the vector is present in a cell.
- the vector provides a template for intracellular synthesis of the RNAi-inducing agent.
- presence of a viral genome in a cell constitutes presence of the virus within the cell.
- a vector is considered to be present within a cell if it is introduced into the cell, enters the cell, or is inherited from a parental cell, regardless of whether it is subsequently modified or processed within the cell.
- RNAi-inducing vector is considered to be targeted to a transcript if the vector comprises a template for transcription of an RNAi-inducing agent that is targeted to the transcript.
- Such vectors have a number of other uses in addition to transcript inhibition in a cell. For example, they may be used for in vitro production of an RNAi-inducing agent and/or for production of the agent in a cell that may or may not contain a transcript to which the vector is targeted.
- a "short, interfering RNA” comprises a double-stranded (duplex) RNA that is between 15 and approximately 29 nucleotides in length or any other subrange or specific value within the interval between 15 and 29, e.g., 16-18, 17-19, 21-23, 24-27, 27-29 nt long and optionally further comprises one or two single-stranded overhangs, e.g., a 3' overhang on one or both strands.
- the duplex is approximately 19 nt long.
- the overhang may be, e.g., 1 - 6 residues in length, e.g., 2 nt.
- An siRNA may be formed from two RNA molecules that hybridize together or may alternatively be generated from an shRNA.
- one or both of the 5' ends of an siRNA has a phosphate group while in other embodiments one or more of the 5' ends lacks a phosphate group.
- one or both of the 3' ends has a hydroxyl group while in other embodiments they do not.
- One strand of an siRNA, which is referred to as the "antisense strand" or "guide strand” includes a portion that hybridizes with a target transcript.
- the antisense strand of the siRNA is 100% complementary with a region of the target transcript, i.e., it hybridizes to the target transcript without a single mismatch or bulge over a target region between 15 and approximately 29 nt in length, preferably at least 16 nt in length, more preferably 18-20, e.g., 19 nt in length.
- the region of complementarity may be any subrange or specific value within the interval between 17 and 29, e.g., 17-18, 19-21, 21-23, 19-23, 24-27, 27-29.
- the antisense strand is substantially complementary to the target region, i.e., one or more mismatches and/or bulges exists in the duplex formed by the antisense strand and a target transcript.
- the two strands of an siRNA are substantially complementary, preferably 100% complementary to each other within the duplex portion.
- short hairpin RNA refers to an RNA molecule comprising at least two complementary portions hybridized or capable of hybridizing to form a double- stranded (duplex) structure sufficiently long to mediate RNAi (as described for siRNA duplexes), and at least one single-stranded portion that forms a loop connecting the regions of the shRNA that form the duplex.
- the structure is also referred to as a stem/loop structure, with the stem being the duplex portion.
- the structure may further comprise an overhang (e.g., as described for siRNA) on the 5' or 3' end.
- the loop is about 1-20, more preferably about 4 -10, and most preferably about 6 - 9 nt long and/or the overhang is about 1-20, and more preferably about 2-15 nt long.
- the loop may be located at either the 5' or 3' end of the region that is complementary to the target transcript whose inhibition is desired (i.e., the antisense portion of the shRNA).
- the overhang comprises one or more U residues, e.g., between 1 and 5 Us.
- shRNAs are processed into siRNAs by the conserved cellular RNAi machinery.
- shRNAs are precursors of siRNAs and are, in general, similarly capable of inhibiting expression of a target transcript that is complementary to a portion of the shRNA (referred to as the antisense or guide strand of the shRNA).
- the features of the duplex formed between the antisense strand of the shRNA and a target transcript are similar to those of the duplex formed between the guide strand of an siRNA and a target transcript.
- the 5' end of an shRNA has a phosphate group while in other embodiments it does not.
- the 3' end of an shRNA has a hydroxyl group while in other embodiments it does not.
- subject refers to an individual susceptible to infection with a virus, e.g., influenza virus.
- a virus e.g., influenza virus.
- the term includes birds and animals, e.g., domesticated birds and animals (such as chickens, mammals, including swine, horse, dogs, cats, etc.), and wild animals, non-human primates, and humans.
- RNAi-inducing agent is considered to be "targeted" to a target transcript for the purposes described herein if (1) the RNAi-inducing agent comprises a strand that is at least 80%, preferably at least about 85%, more preferably at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary with the target transcript for a stretch of at least about 15, more preferably at least about 17, yet more preferably at least about 18 or 19 to about 21-23, or 24-29 nucleotides in length; and/or (2) one strand of the RNAi-inducing agent hybridizes to the target transcript.
- Suitable hybridization conditions are those typically found within the cytoplasm or nucleus of mammalian cells and/or in a Drosophila lysate as described, e.g., in US Pubs. 20020086356 and 20040229266 and in refs 21 and 28.
- a GU or UG base pair in a duplex formed by an antisense strand and a target transcript is not considered a mismatch for purposes of determining whether an RNAi- inducing agent is targeted to the transcript.
- An RNA-inducing vector whose presence within a cell results in production of an RNAi-inducing agent that is targeted to a transcript is also considered to be targeted to the transcript.
- RNAi-inducing agent targeted to a transcript is also considered to target the gene that directs synthesis of the transcript.
- An RNAi-inducing agent that inhibits expression of a target transcript involved in the production of, replication of, pathogenicity of, and/or infection by a virus is said to inhibit the virus.
- a “target portion” is a region of a target transcript that hybridizes with an antisense strand of an RNAi-inducing agent.
- target transcript refers to any RNA that is a target for RNAi.
- Messenger RNA is a preferred target.
- target RNA and “target transcript” are used interchangeably herein.
- treating includes reversing, alleviating, and/or inhibiting the progress of, the disease, disorder, or condition to which such term applies, and/or reversing, alleviating, and/or inhibiting one or more symptoms or manifestations of such disease, disorder or condition.
- vector refers to a nucleic acid molecule capable of mediating entry of, e.g., transferring, transporting, etc., a second nucleic acid molecule into a cell.
- the transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule.
- a vector may include sequences that direct autonomous replication, or may include sequences sufficient to allow integration into host cell DNA.
- Useful vectors include, for example, plasmids (typically DNA molecules although RNA plasmids are also known), cosmids, and viral vectors.
- viral vector may refer either to a nucleic acid molecule (e.g., a plasmid) that includes virus- derived nucleic acid elements that typically facilitate transfer or integration of the nucleic ⁇ acid molecule (examples include retroviral or lentiviral vectors) or to a virus or viral particle that mediates nucleic acid transfer (examples include retroviruses or lentiviruses).
- a nucleic acid molecule e.g., a plasmid
- virus- derived nucleic acid elements that typically facilitate transfer or integration of the nucleic ⁇ acid molecule
- examples include retroviral or lentiviral vectors
- virus or viral particle that mediates nucleic acid transfer examples include retroviruses or lentiviruses
- viral vectors may include various viral components in addition to nucleic acid(s).
- Influenza viruses are enveloped, negative-stranded RNA viruses of the Orthomyxoviridae family. They are classified as influenza types A, B, and C, of which influenza A is the most pathogenic and is believed to be the only type able to undergo reassortment with animal strains. Influenza types A, B, and C can be distinguished by differences in their nucleoprotein and matrix proteins (see Figure 1). As discussed further below, influenza A subtypes are defined by variation in their hemagglutinin (HA) and neuraminidase (NA) genes and usually distinguished by antibodies that bind to the corresponding proteins. [00130] The influenza A viral genome consists often genes distributed in eight RNA segments.
- HA hemagglutinin
- NA matrix protein
- NP nucleoprotein
- PBl, PB2, and PA three polymerases
- M2 ion channel protein
- NSl and NS2 nonstructural proteins
- Influenza A virus classification is based on the hemagglutinin (Hl - Hl 5) and neuraminidase (Nl -N9) genes.
- WWO World Health Organization
- A/Puerto Rico/8/34 designates strain A, isolate 8, that arose in humans in Puerto Rico in 1934 and has antigenic subtypes 1 of HA and NA.
- A/Chicken/Hong Kong/258/97 designates strain A, isolate 258, that arose in chickens in Hong Kong in 1997 and has antigenic subtype 5 of HA and 1 of NA.
- Human epidemics have been caused by viruses with HA types Hl, H2, and H3 and NA types Nl and N2.
- genetic variation occurs by two primary mechanisms in influenza virus A. Genetic drift occurs via point mutations, which often occur at antigenically significant positions due to selective pressure from host immune responses, and genetic shift (also referred to as reassortment), involving substitution of a whole viral genome segment of one subtype by another. Many different types of animal species including humans, swine, birds, horses, aquatic mammals, and others, may become infected with influenza A viruses. Some influenza A viruses are restricted to a particular species and will not normally infect a different species. However, some influenza A viruses may infect several different animal species, principally birds, swine, and humans. This capacity is considered to be responsible for major antigenic shifts in influenza A virus.
- a swine becomes infected with an influenza A virus from a human and at the same time becomes infected with a different influenza A virus from a duck.
- the genes of the human strain and duck strain may "mix," resulting in a new virus with a unique combination of RNA segments. This process is called genetic reassortment.
- influenza viruses replicate intracellularly.
- Influenza A viruses replicate in epithelial cells of the respiratory tract.
- monocytes/macrophages and other white blood cells can also be infected.
- Numerous other cell types with cell surface glycoproteins containing sialic acid, which acts as a viral receptor, are susceptible to infection in vitro.
- influenza A infection/replication cycle is depicted schematically in Figure 1.
- the influenza A virion 100 comprises genome 101, consisting of eight negative stranded RNA segments: PB2 (102), PBl (103), PA (104), HA (105), NP (106), NA (107), M (108), and NS (109).
- RNA segments 102 - 108 are covered with nucleoprotein MP 170 and contain the viral polymerase complex 180 consisting of polymerases PBl, PB2, and PA.
- Nonstructural protein NS2 190 is also found within virions.
- Nonstructural protein NSl (not shown) is found within infected cells.
- Figure IB shows the genome structure of the influenza virus and the transcripts generated from the influenza genome (not drawn to scale).
- Six of the eight genomic RNA segments (PBl (102), PB2 (103), PA (104), HA (105), NP (106), and NA (107)) each serve as template for a single, unspliced transcript that encodes the corresponding protein.
- Three mRNA transcripts have been identified as being derived from influenza virus A segment M (108): a colinear transcript 191 that encodes the M 1 protein, a spliced mRNA 192 that encodes the M 2 protein and contains a 689 nucleotide intron, and another alternatively spliced mRNA 193 that has the potential to encode a 9 amino acid peptide (M3) that has not been detected in virus-infected cells.
- Two mRNA transcripts are derived from influenza virus A segment NS: an unspliced mRNA 194 that encodes the NS 1 protein and a spliced mRNA 195 that encodes the NS 2 protein and includes a 473 nucleotide intron.
- the infective cycle begins when the virion 100 attaches via its hemagglutinin to the surface of a susceptible cell. Attached virus is endocytosed into coated vesicles 200 via clathrin-dependent endocytosis. Low pH in endosomes triggers fusion of viral and endosomal membranes, resulting in liberation of viral ribonucleoprotein (vRNP) complexes (nucleocapsids) 210 into the cytoplasm. Viral nucleocapsids are imported into the cell nucleus, following which primary viral mRNA synthesis is initiated by a viral RNA polymerase complex that consists of the PBl, PB2, and PA polymerases.
- vRNP viral ribonucleoprotein
- PBl protein catalyzes the synthesis of virus specific mRNAs 230, which are transported into the cytoplasm and translated.
- Newly synthesized polymerases are transported into the nucleus and regulate replication and secondary viral mRNA synthesis.
- Synthesis of complementary RNA (cRNA) 240 from viral RNA (vRNA) is initiated by PBl 5 PB2, PA, and NP, after which new vRNA molecules 250 are synthesized.
- the viral polymerase complex uses these vRNAs as templates for synthesis of secondary mRNA 260.
- vRNA RNA that serves as a template for synthesis of viral proteins and also produces complementary RNA (cRNA), which serves as a template for synthesizing more vRNA for new virion production.
- Viral mRNAs are transported into the cytoplasm, where viral structural proteins 270 are produced. Proteins PBl, PB2, PA, and NP are transported into the nucleus, the site of assembly of vRNP complexes (nucleocapsids) 280. Budding and release of viral particles occur at the plasma membrane.
- Influenza A virus replicates rapidly in cells, resulting in host cell death due to cytolytic effects or apoptosis. Infection causes changes in a wide variety of cellular activities and processes including inhibition of host cell gene expression.
- the viral polymerase complex binds to and cleaves newly synthesized cellular polymerase II transcripts in the nucleus.
- NSl protein blocks cellular pre-mRNA splicing and inhibits nuclear export of host mRNA. Translation of cellular mRNA is greatly inhibited, whereas viral mRNA is efficiently translated. Maintenance of efficient translation of viral mRNAs is achieved in part through viral downregulation of the cellular interferon (IFN) response, a host response which typically acts to inhibit translation in virally infected cells.
- IFN cellular interferon
- RNAi-Inducing Entities A. Selection and Design of RNAi-Inducing Entities
- the present invention provides RNAi-inducing entities targeted to one or more influenza virus transcripts.
- Various viral RNA transcripts primary and secondary vRNA, primary and secondary viral mRNA, and viral cRNA
- Any of these transcripts are appropriate targets for RNAi mediated inhibition by either a direct or an indirect mechanism in accordance with the present invention.
- Preferred RNAi-inducing entities that target any viral mRNA transcript will specifically reduce the level of the transcript itself in a direct manner, e.g., by causing degradation of the transcript.
- RNAi-inducing agents that target certain influenza virus transcripts e.g., NP, PA, PBl
- RNAi-inducing agents that target certain influenza virus transcripts e.g., NP, PA, PBl
- Viral transcripts that may serve as a target for RNAi based therapy include, for example, 1) any influenza virus genomic segment; 2) transcripts that encode any viral proteins including transcripts encoding the proteins PB 1 , PB2, PA, NP, NSl, NS2, Ml, M2, HA, or NA. Transcripts may be targeted in their vRNA, cRNA, and/or mRNA form(s) by a single RNAi-inducing agent, although the inventors have obtained data suggesting that viral mRNA is the sole or primary target of RNAi. In particularly preferred embodiments the target transcript encodes influenza virus protein NP, PA, PBl, or PB2.
- RNA interference was initially recognized as a phenomenon in which the presence of long dsRNA (typically hundreds of nt) in a cell leads to sequence-specific degradation of mRNA containing a region complementary to one strand of the dsRNA (U.S. Pat. No. 6,506,559).
- siRNAs were first discovered in studies of RNAi in Drosophila, as described in WO 01/75164 and U.S. Pub. Nos. 20020086356 and 20030108923.
- dsRNAs are processed by an RNase Ill-like enzyme called Dicer (Bernstein et al., Nature 409:363, 2001) into smaller dsRNAs comprised of two 21 nt strands, each of which has a 5' phosphate group and a 3' hydroxyl, and includes a 19 nt region precisely complementary with the other strand, so that there is a 19 nt duplex region flanked by 2 nt-3' overhangs.
- Figure 3 shows a schematic diagram of siRNAs found in Drosophila.
- the structure includes a 19 nucleotide double-stranded (DS) portion 300, comprising a sense strand 310 and an antisense strand 315. Each strand has a 2 nt 3' overhang 320.
- DS 19 nucleotide double-stranded
- siRNAs act to silence expression of any gene that includes a region complementary to one of the dsRNA strands, presumably because a helicase activity unwinds the 19 bp duplex in the siRNA, allowing an alternative duplex to form between one strand of the siRNA (the "antisense” or "guide” strand) and the target transcript.
- the antisense strand is incorporated into an endonuclease complex, RISC 5 which is guided to the complementary target RNA.
- microRNAs short RNA species
- Ruvkun G., Science, 294, 797-799, 2001
- Zeng, Y., et at., Molecular Cell, 9, 1-20, 2002 additional mechanisms of silencing mediated by short RNA species.
- Homologs of the Dicer enzyme are found in diverse species ranging from C. elegam to humans (Sharp, Genes Dev. 15;485, 2001 ; Zamore, Nat. Struct. Biol.
- RNAi-like mechanism might be able to silence gene expression in a variety of different cell types including mammalian, or even human, cells.
- long dsRNAs e.g., dsRNAs having a double-stranded region longer than about 30 - 50 nucleotides
- dsRNAs having a double-stranded region longer than about 30 - 50 nucleotides
- the presence of long dsRNAs in mammalian cells would be expected to lead to interferon-mediated non-specific suppression of translation, potentially resulting in cell death. Long dsRNAs are therefore not thought to be useful for inhibiting expression of particular genes in mammalian cells.
- siRNAs when introduced into mammalian cells, can effectively reduce the expression of target genes, including viral genes.
- target genes including viral genes.
- the inventors have found that a significant proportion of the sequences selected using a first set of design parameters described herein proved to be efficient suppressing sequences when included in an siRNA or shRNA and tested as described below and in co-pending patent application U. S. S.N. 10/674,159.
- siRNAs from an initially designed set showed a strong effect and potently inhibited virus production in cells infected with either PR8 or WSN strains of influenza virus; approximately 40% showed a significant effect (i.e., a statistically significant difference (p ⁇ 0.05) between virus production in the presence versus the absence of siRNA in cells infected with PR8 and/or in cells infected with WSN); approximately 45% showed no or minimal effect.
- RNAs targeted to genes that encode the RNA-dependent RNA transcriptase and nucleoprotein NP dramatically reduced the level of virus produced in infected mammalian cells (Examples 2, 4, 5, 6).
- the inventors have also shown that siRNAs targeted to influenza virus transcripts can inhibit influenza virus replication in vivo in intact organisms, namely chicken embryos infected with influenza virus (Example 3).
- the inventors have demonstrated that siRNAs targeted to influenza virus transcripts can inhibit virus production in mice when administered either before or after viral infection (Examples 12, 14, 16, 23-26, etc.).
- RNAi agents such as siRNA, shRNA, or with vectors whose presence within a cell leads to expression of such agents are effective strategies for inhibiting infection and/or replication by a respiratory virus, e.g., influenza virus.
- RNAi-inducing agents that inhibit virus production in cells infected with any of multiple different influenza virus strains.
- the inventors suggest that these findings are especially significant in view of the profound changes in cellular activities, e.g., metabolic and biosynthetic activities, that take place upon infection with influenza virus.
- RNAi-inducing agents targeted to influenza viral transcripts inhibits viral replication suggests that the cellular mechanisms underlying the RNAi-mediated inhibition of gene expression continue to _
- RNAi-inducing agents for use in accordance with the present invention will preferably follow certain guidelines.
- a database search may be performed to determine whether either strand is substantially complementary to any sequence in the genome of an organism (e.g., a human) to which the agent is to be delivered, and such sequences may be avoided.
- portions of the viral transcript that are conserved among multiple variants are preferred targets.
- RNAi-inducing agents for use in accordance with the present invention include a base-paired region between 15 and approximately 29 nt long, e.g., approximately 19 nt in length, and may optionally have one or more free or looped ends.
- Figure 5 presents various structures that could be utilized as an RNAi-inducing agent according to the present invention.
- Figure 5A shows the structure found to be active in the Drosophila system described above and in mammalian cells.
- the present invention encompasses administration of an siRNA having the structure depicted in Figure 5 A to mammalian cells in order to treat or prevent influenza infection. However, it is not required that the administered agent have this structure.
- the administered composition may include any structure capable of being processed in vivo to the structure of Figure 5 A, so long as the administered agent does not cause undesired or deleterious events such as induction of the interferon response.
- the invention may also comprise administration of agents that are not processed to precisely the structure depicted in Figure 5A, so long as administration of such agents reduces viral transcript levels sufficiently as discussed herein.
- the agent that is delivered to a cell according to the present invention may undergo one or more processing steps before becoming an active suppressing agent (see below for further discussion); in such cases, those of ordinary skill in the art will appreciate that the relevant agent will preferably be designed to include sequences that may be necessary for its processing.
- Figures 5B and 5C represent additional structures that may be used to mediate RNAi. These hairpin (stem-loop) structures may function directly as inhibitory RNAs or may be processed intracellulaiiy (e.g., by Dicer) to yield an siRNA structure such as that depicted in Figure 5A.
- Figure 5B shows an agent comprising an RNA molecule containing two complementary regions that hybridize to one another to form a duplex region represented as stem 400, a loop 410, and an overhang 320. Such molecules are said to self-hybridize, and a structure of this sort is referred to as an shRNA. See also Figures 20 and 21 for examples of shRNA structures.
- Figure 5C shows an agent comprising an RNA circle that includes complementary elements sufficient to form a stem 400 approximately 19 bp long. Such an agent may show improved stability as compared with various other siRNAs described herein.
- RNAi-inducing agents In describing RNAi-inducing agents and their activities it will frequently be convenient to refer to the agent as having two strands, as in the case of siRNAs.
- the sequence of the duplex portion of one strand of the RNAi-inducing agent is substantially complementary to the target transcript in this region.
- the sequence of the duplex portion of the other strand of the RNAi-inducing agent is typically substantially identical to the targeted portion of the target transcript.
- the strand comprising the portion complementary to the target is referred to as the "antisense strand", while the other strand is often referred to as the "sense strand”.
- the portion of the antisense strand that is complementary to the target may be referred to as the "inhibitory region".
- the duplex structure of an shRNA may be considered to comprise antisense and sense strands, where the antisense strand is a first portion of the molecule that forms or is capable of forming a duplex with a second portion of the molecule and is complementary to the targeted portion of the target transcript.
- the sense strand is the portion of the molecule which forms or is capable of forming a duplex with the first portion.
- an "antisense strand" that targets a vRNA strand from a negative-strand RNA virus will be antisense to the vRNA, but be a "sense strand" relative to the viral cRNA.
- an "antisense strand” that targets a cRNA strand from a negative-strand RNA virus will be antisense to the cRNA, but be a “sense strand” relative to the vRNA sequence.
- siRNA siRNA
- teachings relevant to the two strands of an siRNA are generally applicable to the sense and antisense strands of the stem portion of any RNAi-inducing agent, e.g., a corresponding shRNA that can be processed intracellularly to yield an siRNA.
- RNAi-inducing agents such as shRNAs that are processed intracellularly to yield RNAs that mediate target cleavage or translational repression.
- preferred siRNA antisense strands hybridize with a target site that comprises or consists of exonic sequences in the target transcript.
- the antisense strand hybridizes to a 5' or 3' untranslated region.
- any site that is available for hybridization with a antisense strand, resulting in slicing and degradation and/or translational repression of the transcript may be utilized.
- RNAi-inducing agents may be selected according to a variety of approaches.
- inventive RNAi-inducing agents preferably include a region (the "duplex region"), one strand of which contains an inhibitory region between 15-29 nt in length that is sufficiently complementary to a portion of the target transcript (the “target portion”), so that a hybrid can form in vivo between this strand and the target transcript.
- This duplex region also referred to as the "core region” is understood not to include overhangs. Overhangs, if present, may, but need not be, complementary to the target transcript.
- this duplex region includes most or all of the double- stranded structure depicted in Figures 3, 4, and 5.
- the inhibitory region is 100% complementary to the target.
- the inhibitory region need only be sufficiently complementary to the target such that hybridization can occur, e.g., under physiological conditions in a cell and/or in an in vitro system that supports RNAi, such as the Drosophila extract system mentioned above.
- the inhibitory region and the target are at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably 100% complementary to each other.
- the inhibitory region is 15-16 nt long, there may be 0-3 mismatches; if the inhibitory region is 17 nt long there may be 0-4 mismatches; if the inhibitory region is 18 nt long, there may be 0-5 mismatches; if the inhibitory region is 19 nt long, there may be 0-6 mismatches.
- the number of permissible mismatches increases by one nt for each additional nt present in the inhibitory region up to the upper limit of the inhibitory region of an RNAi-inducing agent, e.g., a length of approximately 30 nt. In certain embodiments the mismatches are not at continuous positions.
- a window of evaluation of 15-19 nt contains 0-1 mismatch (preferably 0), and a window of evaluation of 20-29 nt contains 0-2 mismatches (preferably 0-1, more preferably 0).
- 0-1 mismatch preferably 0
- 20-29 nt contains 0-2 mismatches (preferably 0-1, more preferably 0).
- duplex structures interrupted by bulges will typically allow a greater number of unpaired nt.
- it may be preferable to avoid mismatches in the central portion of the antisense strand/target RNA duplex see, e.g., Elbashir et al., EMBO J. 20:6877, 2001).
- the 3' nucleotides of the antisense strand of the siRNA often do not contribute significantly to specificity of the target recognition and may be less critical for target cleavage.
- the antisense strand and the target are complementary at position 10 of the inhibitory region of the antisense strand. In other embodiments they are not.
- Certain RNAi-inducing agents contain a strand that hybridizes to a target site that includes or consists entirely of 3' UTR sequences.
- the resulting duplexes may tolerate a larger number of mismatches and/or bulges, particularly mismatches within the central region of the duplex while still leading to effective silencing.
- one or both strands may include one or more "extra" nucleotides that form a bulge as shown in Figure 6.
- One or more bulges of, e.g., 5-10 nt long, may be present.
- the stretches of perfect complementarity are at least 5 nt in length, e.g., 6, 7, or more nt, while the regions of mismatch may be, for example, 1, 2, 3, or 4 nt in length.
- the duplexes frequently include two stretches of perfect complementarity separated by a region of mismatch.
- a variety of structures are possible. For example, there may be multiple areas of mismatch.
- Some mismatches may be desirable, as duplex formation in the 3' UTR or elsewhere may inhibit expression of a protein encoded by the transcript by a mechanism related to, but distinct from, the cleavage that is the hallmark of classic RNA inhibition.
- the Dicer enzyme that generates siRNAs in the Drosophila system discussed above and also in a variety of organisms is known to also process a small, temporal RNA (stRNA) substrate into an inhibitory agent that, when bound within the 3' UTR of a target transcript, blocks translation of the transcript (see Grishok, A., et al., Cell 106, 23-24, 2001; Hutvagner, G., et al., Science, 293, 834-838, 2001; Ketting, R., et al., Genes Dev., 15, 2654-2659).
- stRNA small, temporal RNA
- microRNAs short ( ⁇ 19-25 nucleotide) RNAs known as microRNAs (miRNAs) that inhibit translation of endogenous mRNAs to which they are partially complementary.
- miRNAs are discussed in Bartel, DP., Cell, 116(2):281-97, 2004; Novina, C. and Sharp, PA, Nature, 430:161-164, 2004; and US Pub. No. 20050059005.
- An miRNA binds to target mRNA transcripts at partially complementary sites and prevents their translation.
- RNAi- inducing agents having the structure of siRNAs (two individual short strands hybridized to one another) can act in a manner similar to miRNAs, i.e., by reducing translation of the transcript rather than decreasing its stability (Doench, JG, et al. Genes & Development, 17:438-442, 2003). It is believed that such siRNAs are processed intracellularly to give rise to single-stranded RNAs that act via the miRNA translational repression pathway.
- any partly or fully double-stranded short RNA as described herein, one strand of which binds to a target transcript and reduces its expression (i.e., reduces the level of the transcript and/or reduces synthesis of the polypeptide encoded by the transcript) is considered to be an RNAi-inducing agent, regardless of whether it acts by triggering degradation, inhibiting translation, or by other means.
- any precursor RNA structure that may be processed in vivo (i.e., within a cell or organism) to generate such an RNAi-inducing agent is useful in the present invention.
- the sequence of an RNAi-inducing agent is selected such that the entire antisense strand (including the 3 Overhang if present) is perfectly complementary to the target transcript. However, it is not necessary that overhang(s) are either complementary or identical to the target transcript. Any desired sequence (e.g., UU) may simply be appended to the 3' ends of antisense and/or sense core regions to generate 3' overhangs. In general, overhangs containing one or more pyrimidines, usually U, T, or dT, are employed. When synthesizing RNAi-inducing agents it may be more convenient to use T rather than U in the overhang(s). Use of dT rather than T may confer increased stability.
- UU pyrimidines
- the strands of an RNAi-inducing agent are 100% complementary to each other within the core region.
- mismatches and bulges may exist in a duplex formed by an antisense and sense strand.
- the strands need only be sufficiently complementary to one another such that hybridization can occur, e.g., under physiological conditions in a cell and/or in an in vitro system that supports RNAi, such as the Drosophila extract system mentioned above.
- the two strands of an RNAi-inducing agent are substantially complementary within the core region, e.g., at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably 100% complementary to each other within the core region.
- a core region 15-16 nt long may contain 0-3 mismatches
- a core region 17 nt long may contain 0-4 mismatches
- a core region 18 nt long may contain 0-5 mismatches
- a core region 19 nt long may contain 0-6 mismatches.
- the number of permissible mismatches increases by one nt for each additional nt present in the inhibitory region up to the upper limit of the core region of an RNAi-inducing agent, e.g., a length of approximately 30 nt.
- a core region of 15-19 nt contains 0-1 mismatch (preferably 0), and a core region of 20-29 nt contains 0-2 mismatches (preferably 0-1, more preferably 0).
- 0-1 mismatch preferably 0
- a core region of 20-29 nt contains 0-2 mismatches (preferably 0-1, more preferably 0).
- an RNAi-inducing agent may be designed by selecting a target portion and designing an RNAi-inducing agent comprising an antisense strand whose sequence is sufficiently complementary to hybridize to the target, e.g., substantially complementary or 100% complementary to the target transcript over 15-29 nucleotides, e.g., 19 nucleotides, and a sense strand whose sequence is sufficiently complementary to hybridize to the antisense strand, e.g., substantially or, preferably, 100% complementary to the antisense strand. 3 ' overhangs such as those described above may then be added to these sequences to generate an siRNA structure.
- RNAi-inducing agents such as siRNAs may exhibit a range of melting temperatures (Tm) in accordance with the foregoing principles.
- Tm is defined as the temperature at which 50% of a nucleic acid and its perfect complement are in duplex in solution.
- Representative examples of acceptable Tms may readily be determined using methods well known in the art, either experimentally or using appropriate empirically or theoretically derived equations, based on the siRNA sequences disclosed in the Examples herein.
- the calculated Tm of a duplex formed by an antisense strand and a target transcript is up to 5 0 C lower, up to 10°C lower, or up to 15 0 C lower than the calculated Tm of a duplex that would be formed between the target and an antisense strand having an inhibitory region that is perfectly complementary to the target.
- the calculated Tm of a duplex formed by the antisense strand and the sense strand of an RNAi-inducing agent is up to 5 0 C lower, or up to 10°C lower, or up to 15°C lower than the calculated Tm of a duplex that would be formed between antisense and sense strands that are perfectly complementary (optionally excluding overhangs).
- thermodynamic basis sets for nearest neighbor interactions are available in the literature.
- RNA see Freier, S.M., et al., Proc. Natl. Acad. Sci. 83, 9373-9377, 1986. Rychlik, W., et al., Nucl. Acids Res. 18(21), 6409-6412, 1990.
- the more recent values and methods in Walter, A.E., Proc. Natl. Acad. ScI, 91, 9218-9222, 1994, or more preferably those in Mathews, DH, J. MoI. Biol. , 288, 911 -940, 1999 are used.
- Computer programs for calculating Tm are widely available. See, e.g., the Web site having URL _
- One aspect of the present invention is the recognition that when multiple strains, subtypes, etc. (referred to collectively as variants), of an infectious agent exist, whose genomes vary in sequence, it will often be desirable to select and/or design RNAi- inducing agents that target regions that are highly conserved among different variants.
- RNAi-inducing agent targeted to such a highly conserved region, e.g., the antisense strand of the agent is substantially complementary to the highly conserved region over a sufficient length such that the RNAi-inducing agent mediates RNAi.
- a region is highly conserved among multiple variants if it is identical among the variants.
- a region targeted by the RNAi-inducing agent e.g., a region of 15-29 nucleotides, preferably 19 nucleotides, is highly conserved if it differs by at most one nucleotide (i.e., at 0 or 1 nucleotide positions) among the variants.
- such a region is highly conserved among multiple variants if it differs by at most two nucleotides (i.e., at 0, 1, or 2 nucleotide positions) among the variants.
- a region is highly conserved among multiple variants if it differs by at most three nucleotides or (i.e., at 0, 1, 2, or 3 nucleotide positions) among the variants.
- an RNAi-inducing agent is targeted to a region that is highly conserved among at least 5, 10, 15, 20, 25, 30, 40, 50, or more variants.
- the base sequence i.e., the sequence to which other sequences are to be compared.
- the base sequence may either be one of the sequences in the set being compared or may be a consensus sequence derived from sequences in the set, e.g., by determining for each position the most frequently found nucleotide at that position among the sequences in the set.
- the number of differences between the base sequence and any member of the set of multiple variants over a region of the sequence is used to determine whether the particular region of interest is highly conserved between the base sequence and the member of the set to which it is being compared.
- a region of the sequence e.g., a region of 15-29 nucleotides, such as 19 nucleotides
- the number of positions at which the sequence differs between two regions is either 0; 0 or 1; 0, 1, or 2; or 0, 1, 2, or 3, the regions are considered highly conserved.
- the antisense sequence of the RNAi-inducing agent may be selected to be complementary to the base sequence across a highly conserved region of 15-29 nucleotides, e.g., 19 nucleotides, or may be selected to be complementary to one of the other sequences across the highly conserved region.
- the sense strand sequence is selected to be identical to the base sequence or to one of the other sequences across the highly conserved region, such that the antisense strand and the sense strand are 100% complementary to each other within the duplex portion of the RNAi- inducing agent.
- the antisense strand sequence is selected with reference to the base sequence as described above.
- the antisense strand sequence may be selected with reference to the second sequence (e.g., 100% complementary to the highly conserved region present in the second sequence).
- the consensus nucleotide most commonly occurring nucleotide at the position where the difference occurs is different to that found in the base sequence, the consensus nucleotide may be used.
- Example 1 describes the selection of highly conserved target portions based on comparison of a set of sequences from six influenza A strains having a human host of origin and comparison of a set of sequences from seven influenza A strains having different animal hosts of origin (including human) and the design of siRNA sequences that target these portions. Different methods of selecting highly conserved regions may be used.
- the invention encompasses RNAi-inducing agents whose duplex portions (and, optionally, any overhangs) are selected based on highly conserved regions that meet the criteria provided herein, regardless of how the highly conserved regions are selected.
- RNAi-inducing agents targeted to portions of influenza virus transcripts that do not meet the criteria for preferred target regions described herein.
- RNAi-inducing agents that are not targeted to highly or favorably conserved target portions may still be effective inhibitors of influenza virus production for certain strains.
- Less effective RNAi-inducing entities may also be used for evaluating target specificity, identifying determinants of RNAi efficacy, improving RNAi design, etc.
- Table IA lists 21-nucleotide regions that are highly conserved among a set of influenza virus sequences for each of the viral gene segments.
- Each sequence listed in Table IA includes a 19 nt region (nt 3-21) and an initial 2 nt sequence that is not present in the sense strand of the corresponding siRNA but is complementary to the 3' overhang of the antisense strand of the siRNA.
- the 19 nt region may be used as the sense strand to design a variety of siRNA molecules having different 3' overhangs in either or both the sense and antisense strands.
- sense and antisense siRNA sequences may be obtained from each sequence listed in Table IA. Twenty such siRNA sequences are listed in Table 2.
- Table IB lists additional siRNAs designed based on highly conserved regions of influenza virus. Both strands are shown in a 5' to 3' direction. A dTdT 3' overhang is appended to each strand. Nucleotides 1 to 19 in each of the sense strand sequences listed in Table IB has an identical sequence to a highly conserved region of an influenza virus transcript. The corresponding antisense sequence is complementary to the sense strand.
- a "highly conserved region” refers to nt 3-21 in any of the sequences listed in Table IA or nt 1-19 of any of the sense strands listed in Table IB.
- RNAi-inducing regions are present in double-stranded form in certain of the inventive RNAi-inducing agents, so that the antisense strand of the agent is targeted to the highly conserved portion.
- the sequences of these regions are referred to as "highly conserved sequences" or "highly conserved target portions”.
- Selection of highly conserved target portions represents one approach to the design of RNAi-inducing entities that will successfully inhibit multiple different influenza virus strains.
- the present invention also provides alternative methods for selecting preferred target portions that are favorably conserved so as to enhance the likelihood that an RNAi-inducing agent targeted to the target portion will inhibit expression of a target transcript in a plurality of different strains that differ in sequence within the target portion.
- an RNAi-inducing agent whose antisense strand comprises an inhibitory region that is 100% complementary to the target portion as found in one or more strains (e.g., PR8), preferably inhibits expression of the corresponding transcript that is present in one or more other strains in which the corresponding target portion is less than 100% complementary to the inhibitory region of the antisense strand.
- the invention provides a variety of RNAi-inducing agents that target a favorably conserved portion of an influenza A virus transcript, wherein the favorably conserved target portion is selected according to the inventive methods.
- the target portions are favorably conserved across a plurality of influenza A virus strains isolated from humans.
- the portions are favorably conserved across a plurality of influenza A virus strains isolated from animals other than humans, e.g., avians. In certain embodiments of the invention the portions are favorably conserved across a plurality of influenza A virus strains isolated from humans and also across a plurality of influenza A virus strains isolated from non-human animals, e.g., avians. For example, the portions may be favorably conserved among at least 5, 10, 15, 20, or more variants of human and/or animal origin. In certain embodiments of the invention a target portion is both favorably and highly conserved.
- favorably conserved target portions may be identified by first aligning transcript sequences from a plurality of variants and comparing them with a selected base sequence to identify differences, i.e., positions at which the identity of a nucleotide in one or more of the sequences differs from that in the base sequence. The nature of the difference is evaluated to determine whether it is significant.
- differences i.e., positions at which the identity of a nucleotide in one or more of the sequences differs from that in the base sequence. The nature of the difference is evaluated to determine whether it is significant.
- a "difference" refers to a position at which one or more of the sequences differs from the base sequence, regardless of how many of the sequences differ from the base sequence.
- the base sequence can be selected in various ways.
- a sequence from a strain that is highly prevalent or that is readily usable in a laboratory setting may be convenient to select a sequence from a strain that is highly prevalent or that is readily usable in a laboratory setting.
- Favorably conserved target portions meet the following criteria when corresponding target portions present in the variants in the set are compared: (1) An A to G or C to U difference between the base sequence and a corresponding sequence is allowed at any position; (2) A G to A or C to A difference between the base sequence and a corresponding sequence is allowed only at one or more of positions 1, 18, and 19; (3) There are 0, 1 , 2, or 3 differences between the base sequence and a corresponding sequence between positions 1 and 9; (4) There are no more than 2 consecutive differences between the base sequence and a corresponding sequence; and (5) There is at most 1 difference between the base sequence and a corresponding sequence between positions 11 and 17. Any strain may be selected as the base strain. Preferably at least 5 variants are compared to identify a favorably conserved target portion.
- Influenza viruses circulating in avians and/or other animal hosts sometimes gain the capability of infecting humans. Such strains frequently result in a high mortality rate, possibly in part due to a lack of immunity among humans. Examples include the 1918 pandemic and deaths caused by infection of humans with avian influenza in Hong Kong (1997) and Vietnam (2004). Concern regarding the potential spread of strains with an avian or other animal host of origin into the human population is growing, and existing vaccines are not able to protect humans from avian or swine flu virus infection.
- the invention identifies favorably and/or highly conserved target portions across a plurality of strains originally isolated from humans (human derived strains) and strains originally isolated from non-human animals such as avians (avian derived strains) and provides RNAi-inducing agents targeted to such target portions.
- RNAi-inducing agents are capable of protecting against a wide variety of influenza virus strains, including both human-derived strains and strains derived from non-human animal hosts.
- Example 17 describes identification of influenza transcript target portions that are favorably conserved targets for RNAi. The first step was to identify all potential 19 nucleotide influenza virus target portions.
- each 19 nucleotide potential target portion as found in PR8 or in another influenza virus strain listed in Tables 15A- 15H or Tables 19A-19F is considered to be listed herein although they are are not specifically set forth. They may readily be identified by reference to the sequences of influenza virus segments in Figures 32A-32J.
- the next step was to identify preferred functional target portions for RNAi, i.e., regions of the gene whose sequence characteristics suggest that an RNAi-inducing agent having an antisense strand that hybridizes to the target will effectively inhibit its expression.
- the preferred functional target portions meet various criteria with respect to GC content and the absence of continuous stretches of G or C residues.
- Table 17 lists sequences of preferred functional target portions as present in base strain PR8.
- corresponding functional target portions as found in a large number of human-derived influenza virus strains were then aligned.
- "Corresponding target portions" in different strains are generally present at about the same position in the genome of the different strains when the genomic sequences are aligned to achieve maximum identity and/or are homologous, e.g., at least 50% identical in the different strains.
- the degree of identity of corresponding target portions when two strains are compared is at least 60%, 70%, 80%, or more.
- a corresponding target portion may differ from a target portion found in a base strain at 1, 2, 3, or 4 positions.
- sequences of these preferred homologous target portions are readily identified by accessing the relevant influenza virus segment sequence in a database such as GenBank, aligning it with the base strain sequence, and locating a portion that is at about the same nucleotide position and/or at least 80% identical, preferably at least 90% identical to a target portion that is found in a base strain, e.g., PR8.
- Homologous target portions are an aspect of this invention. The criteria described above were used to select favorably conserved target portions.
- Table 18 Figure 34 lists sequences of target portions that are favorably conserved among influenza strains derived from humans, as present in base strain PR8.
- strains isolated from avian hosts were aligned and compared in order to identify target portions that are favorably and/or highly conserved both among isolates from human hosts and isolates from avian hosts. Isolates from one or more other animal hosts could also be used for such comparisons.
- the favorably conserved target portions of the base sequence were compared with the aligned avian sequences, and favorably conserved target portions were selected using the same criteria that were used to identify favorably conserved target portions among the human isolates.
- Table 20 ( Figure 35) lists sequences of target portions that are favorably conserved among influenza strains derived from humans and avians, as present in base strain PR8.
- Each 19 nucleotide potential target portion as found in PR8 or in another influenza virus strain listed in Tables 15A-15H or Tables 19A-19F is an aspect of this invention.
- Each preferred functional target portion as found in PR8 or in another influenza virus strain listed in Tables 15A-15H or Tables 19A-19F is an aspect of this invention.
- Each favorably and/or highly conserved target portion as found in PR8 or in another influenza virus strain listed in Tables 15A-15H or Tables 19A-19F is an aspect of this invention.
- each such sequence i.e., potential, preferred functional, favorably conserved among human derived strains, favorably conserved among human derived strains and avian derived strains, and/or highly conserved among humans or avians or both
- RNAi-inducing agents having antisense strands that comprise each of these sequences, or fragments of them at least 15 nucleotides in length, are an aspect of this invention.
- RNAi-inducing agents containing antisense strands that display less than perfect complementarity to the target portion or that are shorter or longer can also be used, as described herein.
- the sequence of a target portion can serve as the sense strand of an RNAi-inducing agent.
- Sense strands that are not perfectly complementary to the antisense strand can also be used as described herein.
- the target portions listed in Tables 17, 18, and 20 are identical to portions of influenza A virus PR8 transcripts.
- Corresponding target portions for each transcript, which are either identical to or highly homologous to the target portions listed in Tables 17, 18, and 20 are found in other influenza virus A strains.
- the inhibitory region of an antisense strand strand of an RNAi-inducing agent targeted to a potential influenza virus target portion e.g., a target portion listed in Table 17, 18, or 20 is not 100% complementary to a PR8 sequence but is 100% complementary to a corresponding target portion found in one or more of the other strains listed in Tables 15A-15H or Tables 19A-19F.
- RNAi-inducing entities e.g., RNAi-inducing agents such as siRNA or shRNA targeted to each of the potential target portions, functional target portions, favorably conserved portions, and highly conserved target portions described herein.
- the invention also provides RNAi-inducing entities, e.g., RNAi-inducing agents such as siRNA or shRNA, targeted to target portions that comprise at least 15 continuous nt of a potential target portion, functional target portion, favorably conserved portion, or highly conserved target portion described herein.
- RNAi-inducing entities e.g., RNAi-inducing agents such as siRNA or shRNA, targeted to target portions up to approximately 29 nt in length that comprise a potential target portion, functional target portion, favorably conserved portion, or highly conserved target portion described herein.
- the additional nucleotides of the target portion are preferably located immediately 5' and/or or 3' from a 19 nt target portion listed herein.
- inventions provide RNAi-inducing agents that have been tested in cell culture and/or in animal models to verify their effectiveness and to identify portions of influenza virus transcripts that can be targeted in a highly effective manner.
- Example 18 describes a high throughput screen (HTS) that was used to identify siRNAs that effectively reduce levels of a targeted influenza virus transcript.
- Examples 19-22 describe high throughput screens that were used to identify siRNAs that effectively reduce influenza virus production in cells.
- Certain preferred effective siRNAs reduced influenza A virus titer by at least 4-fold when contacted with cells at a concentration of 100 nM.
- Certain preferred highly effective siRNAs reduced influenza virus titer by at least 8-fold, or to an even greater extent when contacted with cells at a concentration of 100 nM.
- Certain preferred effective siRNAs reduced influenza A virus titer by at least A- fold when contacted with cells at a concentration of 1 nM.
- Certain preferred effective siRNAs reduced influenza A virus titer by at least 4-fold, at least 8-fold, or at least 16- fold when contacted with cells at a concentration of 100 nM. Certain highly effective siRNAs reduced influenza A virus titer by at least 2-fold when contacted with cells at concentrations of 5 nM or less. Certain even more highly effective siRNAs reduced influenza A virus titer by at least 2-fold when contacted with cells at concentrations of 1 nM or less. Yet more highly effective siRNAs reduce influenza A virus titer by at least 2-fold when contacted with cells at concentrations of 0.8 pM or less. Concentrations refer to concentrations at which the siRNA was present in a medium external to the cells at the time of introduction.
- an RNAi-inducing agent is targeted to a target portion within 200 nt from the 3 ' end of a gene, e.g., the NP, PA 5 PB 1 , or PB2 gene.
- a gene e.g., the NP, PA 5 PB 1 , or PB2 gene.
- Seven highly effective siRNAs were found to target portions within this region. The inventors observed that the 5' and 3' ends of influenza gene segments contain ⁇ 10 bases that are highly conserved both across different gene segments and across different influenza virus strains. Notably, 3 siRNAs that target the 5' UTR of the PBl transcript showed a 4-fold reduction in virus titer at 100 nM.
- RNAi-inducing agents may be prepared according to any available technique including, but not limited to chemical synthesis, enzymatic or chemical cleavage in vivo or in vitro, or template transcription in vivo or in vitro.
- RNA may be produced enzymatically or by partial/total organic synthesis, and a modified nucleotide can be introduced by in vitro enzymatic or organic synthesis.
- a siRNA is prepared chemically. Methods of synthesizing RNA molecules are known in the art, in particular, the chemical synthesis methods as de scribed in Verma and Eckstein, Anna. Rev. Biochem, 67:99-134 (1998).
- an siRNA is prepared enzymatically.
- an siRNA can be prepared by enzymatic processing of a long dsRNA having sufficient complementarity to the desired target RNA. Processing of long dsRNA can be accomplished in vitro, for example, using appropriate cellular lysates and siRNAs can be subsequently purified by gel electrophoresis or gel filtration.
- RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no or minimum purification to avoid losses due to sample processing.
- Inventive RNAi-inducing agents may be delivered as a single shRNA molecule or as two strands hybridized to one another. For instance, two separate 21 nt RNA strands may be generated, each of which contains a 19 nt region complementary to the other, and the individual strands may be hybridized together to generate a structure such as that depicted in Figure 5A.
- each strand of an siRNA is generated by transcription from a promoter, either in vitro or in vivo.
- a construct may contain two separate transcribable regions, each of which generates a 21 nt transcript containing a 19 nt region complementary with the other.
- a single construct may be utilized that contains opposing promoters Pl and P2 and terminators tl and t2 positioned so that two different transcripts, each of which is at least partly complementary to the other, are generated ( Figure 7).
- an shRNA is generated as a single transcript, e.g., by transcription of a single transcription unit encoding self- complementary regions.
- Figure 8 depicts one such embodiment.
- a template is employed that includes first and second complementary regions, and optionally includes a loop region.
- the present invention encompasses constructs encoding one or more siRNA and/or shRNA strands.
- the construct optionally includes one or more other regulatory elements, e.g., terminator.
- In vitro transcription may be performed using a variety of available systems including the T7, SP6, and T3 promoter/polymerase systems (e.g., those available from Promega, Clontech, New England Biolabs, etc.). When siRNAs are synthesized in vitro they may be allowed to hybridize before transfection or delivery to a subject.
- inventive siRNA compositions need not consist entirely of double- stranded (hybridized) molecules.
- siRNA compositions may include a small proportion of single-stranded RNA.
- preferred compositions comprise at least approximately 80% dsRNA, at least approximately 90% dsRNA, at least approximately 95% dsRNA, or even at least approximately 99-100% dsRNA.
- the siRNA compositions may contain less than 80% hybridized RNA provided that they contain sufficient dsRNA to be effective.
- inventive siRNA or shRNA agents are generated in vivo, it is generally preferable that they be produced via transcription of one or more transcription units.
- the primary transcript may optionally be processed (e.g., by one or more cellular enzymes) in order to generate the final agent that accomplishes gene inhibition.
- appropriate promoter and/or regulatory elements can readily be selected to allow expression of the relevant transcription units in mammalian cells.
- expression as used herein in reference to synthesis (transcription) of siRNA or siRNA precursors does not imply translation of the transcribed RNA.
- the promoter utilized to direct in vivo expression of one or more siRNA or shRNA transcription units is a promoter for RNA polymerase III (Pol III).
- Pol III directs synthesis of small transcripts that terminate upon encountering a stretch of 4-5 T residues in the template.
- Certain Pol III promoters such as the U6 or Hl promoters do not require cw-acting regulatory elements (other than the first transcribed nt) within the transcribed region and thus are preferred according to certain embodiments of the invention since they readily permit the selection of desired siRNA sequences. See, e.g., Yu, J., et al., Proc. Natl. Acad.
- Promoters for Pol II may also be used as described, for example, in Xia, H., et al, Nat. Biotechnol, 20, pp. 1006-1010, 2002.
- constructs in which a hairpin sequence is juxtaposed within close proximity to a transcription start site and followed by a polyA cassette, resulting in minimal to no overhangs in the transcribed hairpin may be employed.
- tissue-specific, cell-specific, or inducible Pol II promoters may be used, provided the foregoing requirements are met.
- Pol I promoters may also be used in various embodiments (McCown 2003).
- in vivo expression of constructs that provide templates for synthesis of siRNA or shRNA can desirably be accomplished by introducing the constructs into a vector, such as, for example, a DNA plasmid or viral vector, and introducing the vector into mammalian cells.
- inventive vectors are gene therapy vectors appropriate for the delivery of an siRNA or shRNA expressing construct to mammalian cells, most preferably human cells. Such vectors may be administered to a subject before or after exposure to an influenza virus, to provide prophylaxis or treatment for diseases and conditions caused by infection with the virus.
- the invention therefore provides a variety of viral and nonviral vectors whose presence within a cell results in transcription of one or more RNAs that self-hybridize or hybridize to each other to form an RNAi agent that inhibits expression of at least one influenza virus transcript in the cell.
- two separate, complementary siRNA strands are transcribed using a single vector containing two promoters, each of which directs transcription of a single siRNA strand, i.e., is operably linked to a template for the siRNA so that transcription occurs.
- the two promoters may be in the same orientation, in which case each is operably linked to a template for one of the siRNA strands. Alternately, the promoters may be in opposite orientation flanking a single template so that transcription from the promoters results in synthesis of two complementary RNA strands.
- a vector containing a promoter that drives transcription of a single RNA molecule comprising two complementary regions is employed.
- a vector containing multiple promoters, each of which drives transcription of a single RNA molecule comprising two complementary regions is used.
- multiple different shRNAs may be transcribed, either from a single promoter or from multiple promoters.
- a single promoter may direct synthesis of a single RNA transcript containing multiple self-complementary regions, each of which may hybridize to generate a plurality of stem-loop structures.
- the vector includes multiple promoters, each of which directs synthesis of a self-complementary RNA molecule that hybridizes to form an shRNA.
- the multiple shRNAs may all target the same transcript, or they may target different transcripts. Any combination of viral transcripts may be targeted. See Example 11 and Figure 21.
- RNAi-inducing agents may allow the production of cells that produce the agent over long periods of time (e.g., greater than a few days, preferably at least several weeks to months, more preferably at least a year or longer, possibly a lifetime). Such cells may be protected from influenza virus indefinitely.
- Preferred viral vectors for use in the compositions to provide intracellular expression of RNAi-inducing agents include, for example, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated virus vectors, herpes virus vectors, etc.
- agents such as the nucleic acids described herein including but not limited to, nucleic acids having any of the structures depicted in Figure 5, or any other effective structure described herein, may be comprised entirely of nucleotides such as those found in naturally occurring nucleic acids, or may instead include one or more analogs of such nucleotides or may otherwise differ from a naturally occurring nucleic acid.
- Nucleic acids containing modified backbones or non-naturally occurring internucleoside linkages can be used in the present invention.
- Modified nucleic acids need not be uniformly modified along the entire length of the molecule.
- different nucleotide modifications and/or backbone structures may exist at various positions in the nucleic acid.
- it may be desirable to stabilize the siRNA structure e.g., by including nucleotide analogs at one or more free strand ends in order to reduce digestion, e.g., by exonucleases.
- Including deoxynucleotides, e.g., pyrimidines such as deoxythymidines at one or more free ends may serve this purpose.
- nucleotide analogs may be located at any position(s) where the target-specific activity, e.g., the RNAi mediating activity is not substantially affected, e.g., in a region at the 5 '-end and/or the 3 '-end of the RNA molecule.
- the target-specific activity e.g., the RNAi mediating activity is not substantially affected, e.g., in a region at the 5 '-end and/or the 3 '-end of the RNA molecule.
- the target-specific activity e.g., the RNAi mediating activity is not substantially affected, e.g., in a region at the 5 '-end and/or the 3 '-end of the RNA molecule.
- between 1-5 residues at the 5' and/or 3' end of an siRNA or shRNA strand is a nucleotide analog.
- one or more of the nucleic acids in an inventive RNAi-inducing agent comprises at least 50% unmodified RNA, at least 80% modified RNA, at least 90% unmodified RNA, or 100% unmodified RNA. In certain embodiments of the invention one or more of the nucleic acids in an inventive RNAi-inducing agent comprises 100% unmodified RNA within the portion that participates in duplex formation in the RNAi- inducing agent.
- nucleotide modifications are used selectively in either the sense or antisense strand of an siRNA, shRNA, or microRNA precursor, For example, it may be preferable to utilize unmodified ribonucleotides in the antisense strand while employing modified ribonucleotides and/or modified or unmodified deoxyribonucleotides at some or all positions in the sense strand.
- ribonucleotides are used in the duplex portion of the antisense and/or the sense strand while the overhang(s) of the antisense and/or sense strand may include modified ribonucleotides and/or deoxyribonucleotides.
- one or both siRNA strands comprises one or more O-methylated ribonucleotides.
- nucleotide analogs and nucleotide modifications are known in the art, and their effect on properties such as hybridization and nuclease resistance has been explored.
- a number of modifications have been shown to alter one or more aspects of the oligonucleotide such as its ability to hybridize to a complementary nucleic acid, its stability, bioavailability, nuclease resistance, etc .
- 2'-modifications include halo, alkoxy and allyloxy groups.
- the 2'-OH group is replaced by a group selected from H, OR, R, halo, SH, SR], NH 2 , NH R , NR 2 or CN, wherein R is Ci-C 6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
- modified linkages include phosphorothioate and 5'-N-phosphoramidite linkages.
- RNAi-inducing agent comprises one or more modifications to a sugar, nucleoside, or internucleoside linkage such as any
- the modification results in a nucleic acid with increased absorbability (e.g., increased absorbability across a mucus layer, increased oral absorption, etc.), increased stability in the blood stream or within cells, decreased clearance via the renal system, increased ability to cross cell membranes, increased ability to escape from an intracellular compartment such as an endosome, etc.
- absorbability e.g., increased absorbability across a mucus layer, increased oral absorption, etc.
- stability in the blood stream or within cells decreased clearance via the renal system, increased ability to cross cell membranes, increased ability to escape from an intracellular compartment such as an endosome, etc.
- analogs or modifications may result in altered Tm, which may result in increased tolerance of mismatches between the , guide sequence and the target while still achieving effective suppression or may result in increased or decreased specificity for desired target transcripts.
- RNAi-inducing agents for use in accordance with the present invention may comprise one or more moieties that is/are not nucleotides or nucleotide analogs.
- the nucleic acid comprises primarily nucleotide residues but comprises one or more residues that are not nucleotides.
- 1, 2, 3, 4, 5, or more of the residues in either strand of an effective silencing agent is not a nucleoside.
- the portion of the RNAi-inducing agent that participates in duplex formation and/or is complementary to a target transcript consists of nucleosides while the overhang(s) consist of non-nucleoside residues.
- sense and antisense strands of an RNAi-inducing agent are attached to one another by a non-nucleoside containing linker.
- the invention provides a variety of nucleic acids based on identification of potential target portions, functional target portions, favorably conserved target portions, and highly conserved target portions.
- the invention provides nucleic acids whose sequences comprise or consist of any of the potential target portions described above, including influenza sequences listed in Tables IA, IB, 17, 18, 20, and/or 34, or subsequences thereof that are at least 15 nucleotides in length (fragments). SiRNAs targeted to certain target portions showed unexpectedly high potency.
- siRNAs were administered to cells 6 hours prior to infection with influenza virus, and influenza virus production was tested 24 hours post-infection.
- the sequence is selected from SEQ ID NOs: 272-380, SiRNAs targeted to these target portions (comprising an antisense strand 100% complementary to the target portion) showed a 4-fold reduction (75% decrease) in virus production in cells at 100 nM.
- the sequence is selected from SEQ ID NOs: 274, 286, 287, 292, 297, 298, 304, 305, 309, 310, 311, 319, 324, 327, 334, 346, 347, 360, 361, 364, and 366.
- SiRNAs targeted to these target portions showed a 2-fold reduction (50% decrease) in virus production in cells at 5 nM.
- the sequence is selected from SEQ ID NOs: 297, 309, 310, 311, 346, 347, 364, and 366.
- SiRNAs targeted to these target portions showed a 2-fold reduction (50% decrease) in virus production in cells at 5 nM, even when the target portion differed from the corresponding target portion in PR8 at up to two positions, i.e., there were up to two mismatches between the antisense siRNA strand and the target portion. Complements of these nucleic acids and fragments are also provided.
- the fragment is 16, 17, or 18 nt in length.
- the nucleic acids may be single stranded or double stranded and may be unmodified RNA or DNA, or modified versions thereof.
- the sequences may further include a 3' overhang, e.g., a dTdT overhang.
- the invention also provides nucleic acids that are substantially identical to (e.g., at least 70%, at least 80% identical, at least 90% identical, 100% identical),
- the invention further provides vectors comprising one or more of the foregoing nucleic acids.
- the nucleic acids include RNAi-inducing agents such as (i) siRNA; (ii) shRNA; (iii) single-stranded RNAs that hybridize with complementary single-stranded RNAs to form siRNAs; and (iv) vectors that comprise templates for transcription of any of the aforesaid nucleic acids.
- RNAi-inducing agents such as (i) siRNA; (ii) shRNA; (iii) single-stranded RNAs that hybridize with complementary single-stranded RNAs to form siRNAs; and (iv) vectors that comprise templates for transcription of any of the aforesaid nucleic acids.
- siRNA siRNA
- shRNA single-stranded RNAs that hybridize with complementary single-stranded RNAs to form siRNAs
- vectors that comprise templates for transcription of any of the aforesaid nucleic acids.
- nucleic acids of the invention may be limited in size.
- the length of a nucleic acid may be 19 nt or less, 29 or 30 nt or less, 35 nt or less, 50 nt or less, or 100 nt or less.
- the invention encompasses any nucleobase-containing structure in which residues, e.g., nucleotides, are linked together in an ordered manner, typically in a linear fashion, so that a nucleobase sequence can be assigned to the structure, wherein the sequence is any of the sequences disclosed herein.
- Various nucleobases and modified nucleotides and backbones are described above, any of which can be used.
- the structure is a nucleic acid, peptide nucleic acid (PNA), locked nucleic acid (LNA), or chimeric molecules, etc. See, e.g., WO92/20702, U.S. Pat. Nos. 6,316,230, and references therein.
- the invention also encompasses a structure comprising alternate nucleobases that have the same base pairing specificity or can otherwise substitute for a nucleobase present in the sequence.
- the single-stranded nucleic acids may be used as antisense or sense strands of an RNAi-inducing agent such as an siRNA or shRNA (optionally with the addition of one or more nucleotides at the 3' end to form an overhang).
- Nucleic acids of the invention may also be used, for example, as conventional antisense reagents, as probes (e.g., to detect influenza virus infection), etc.
- Conventional antisense refers to methods of inhibiting expression of a transcript by administering single-stranded oligonucleotides in vitro or to a subject. Such inhibition is believed to operate by mechanisms distinct from those of RNAi and does not require a double-stranded RNA molecule (other than the duplex formed between the antisense oligonucleotide and a target transcript). See, e.g., Crooke, S., infra.
- the invention therefore provides a nucleic acid comprising a target portion of an influenza A virus transcript wherein the sequence of the nucleic acid comprises at least 15, 16, 17, 18, or 19 contiguous nt of a sequence listed in one or more of Tables IA, IB, 17, 18, 20, and 34. In certain embodiments the sequence consists of or is contained within a sequence listed in one or more of Tables IA, IB, 17, 18, 20, and 34.
- the invention further provides a nucleic acid comprising a target portion of an influenza A virus mRNA transcript wherein the sequence of the nucleic acid comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides of any potential influenza virus target portion.
- nucleotides at the 5' and 3' ends are considered to be contained within a sequence.
- the length of the sequence is 30 nt or less, 35 nt or less, 50 nt or less, or 100 nt or less.
- the invention further provides nucleic acids comprising a portion whose sequence is substantially identical (at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical) to any potential influenza virus target portion, e.g., any of the target portions listed in Tables IA, IB, 17, 18, 20 and/or 34. Certain of these portions contain differences at 1, 2, 3, 4, or 5 positions with respect to a potential influenza virus target portion, e.g., a target portion listed in any of Tables IA, IB, 17, 18, 20, and/or 34.
- the difference at 1, 2, 3, 4, or 5 of the positions is a replacement of C in a target portion by U in the substantially identical sequence, or a replacement of A in the target portion by G in the substantially identical sequence.
- the sequence of certain nucleic acids of the invention comprises a sequence that is found in a target transcript adjacent to the sequence of a potential influenza virus target portion, e.g., a target portion listed in Table IA, IB, 17, 18, 20, and/or 34, i.e., is located 5' or 3' of the target portion.
- the invention provides RNAi-inducing agents having antisense strands that are complementary to a potential influenza virus target portion, e.g., a target portion listed in Table IA, IB, 17, 18, 20 and/or 34 over a window of at least 15 nt, at least 16, at least 17 nt, at least 18 nt, preferably over 19 nt.
- a potential influenza virus target portion e.g., a target portion listed in Table IA, IB, 17, 18, 20 and/or 34 over a window of at least 15 nt, at least 16, at least 17 nt, at least 18 nt, preferably over 19 nt.
- the antisense strand may be 100% complementary to the listed highly conserved target portion over 15, 16, 17, 18, or 19 nt or may be substantially complementary, e.g., having between 1 and 5 mismatches with respect to the target portion.
- one or more, e.g., all, mismatches between the inhibitory region of an antisense strand and the target is a U-G mismatch.
- the sense strand of an RNAi-inducing agent may be 100% complementary to or substantially complementary to the antisense strand.
- the invention also provides RNAi-inducing agents having sense strands with sequences that are 100% identical to or substantially identical to a highly and/or favorably conserved sequence listed in one or more of Tables IA, IB, 17, 18, 20, and/or 34 over 15, 16, 17, 18, or 19 nt.
- the invention provides an RNAi-inducing agent targeted to an influenza virus transcript, wherein the RNAi-inducing agent comprises: a nucleic acid portion whose sequence comprises a sequence selected from the group consisting of: SEQ ID NOs: 272 - 380, its complement, or a fragment of either having a length of at least 15 nucleotides.
- the RNAi-inducing agent preferably comprises a second nucleic acid portion that forms a duplex structure with the first nucleic acid portion.
- the first and second nucleic acid portions are each 50 nt or less in length, e.g., 35 nt or less in length, e.g., 21-23 nt in length, etc.
- sequence is selected from the group consisting of: SEQ ID NOs: 274, 286, 287, 292, 297, 298, 304, 305, 309, 310, 311, 319, 324, 327, 334, 346, 347, 360, 361, 364, and 366, its complement, or a fragment of either having a length of at least 15 nucleotides.
- sequence is selected from the group consisting of: SEQ ID NOs: 297, 309, 310, 311, 346, 347, 364, and 366, its complement, or a fragment of either having a length of at least 15 nucleotides.
- the sequence of the antisense strand of an RNAi-inducing agent designed based on a potential influenza virus target portion e.g., a target portion whose sequence is listed in Table IA, IB, 17, 18, 20, and/or 34 includes at least 10, at least 12, at least 15, at least 17, or at least 19 consecutive nt that are 100% complementary to the listed sequence.
- the sense strand of such RNAi-inducing agents may be 100% complementary to or substantially complementary to the antisense strand.
- the sequence of the sense strand of an RNAi-inducing agent designed based on a potential influenza virus target portion includes least 10, at least 12, at least 15, at least 17, and/or at least 19 consecutive nt of a listed sequence .
- the sequence of the antisense strand of an RNAi-inducing agent designed based on a potential influenza virus target portion e.g., a target portion presented in Table IA, IB, 17, 20, and/or 34 includes at least 10, at least 12, at least 15, at least 17, and/or at least 19 consecutive nt that are 100% complementary to the listed sequence, except that 1 or 2 mismatches may exist.
- the sense strand of such RNAi-inducing agents may be 100% complementary to or substantially complementary to the antisense strand.
- the sequence of the sense strand of an RNAi-inducing agent designed based on a potential influenza virus target portion includes at least 10 consecutive nucleotides, more preferably at least 12 consecutive nt, more preferably at least 15 consecutive nt, more preferably at least 17 consecutive nt, and yet more preferably 19 consecutive nt of a listed sequence except that 1 or 2 nt may differ from the listed sequence.
- the remaining portion of the antisense strand may be, and preferably is, substantially complementary to or 100% complementary to influenza sequences that lie outside of and adjacent to the listed target portion.
- the invention encompasses RNAi-inducing agents with antisense strands whose sequences are complementary to influenza sequences that are
- nt e.g, up to 9 nt
- Adjacent sequences are found in Figs. 32.
- the RNAi-inducing agent is targeted to a region that is favorably and/or highly conserved among influenza variants that naturally infect organisms of at least 2, 3, 4, 5, or more different species.
- the species may include human, equine (horse), avian, swine and others. In certain preferred embodiments of the invention the species include humans.
- the invention also provides vectors from which the inventive RNAi-inducing agents can be transcribed, cells containing the vectors, and methods of use for the treatment and/or prevention of influenza A virus infection.
- the invention provides variants of a potential influenza virus target portion, e.g., variants of any of the nucleic acids listed in Tables IA, IB, 17, 18, 20, and/or 34, and nucleic acids comprising such variants (e.g., RNAi-inducing agents comprising such variants), wherein the sequence of a variant differs from the listed sequence at 1, 2, 3, 4, 5, or 6 positions.
- a variant of a listed sequence is identical or substantially identical to a portion of the sequence of a transcript from an influenza virus strain other than PR8, such as any of the influenza A virus strains listed in Tables 15A-15H and/or Tables 19A-19F.
- subsequences of the various sequences disclosed herein are also encompassed. Preferred subsequences are between 15-18 nt in length, e.g., 15, 16, 17, or 18 nt in length. Sequences related to the specific sequences listed herein by deletion and/or addition of nucleotide(s) are also encompassed. For example, nucleic acid sequences in which 1, 2, 3, 4, 5, or 6 nt are deleted from or added to any of the sequences listed herein are encompassed. In addition, sequences in which 1, 2, 3, 4, 5, or 6 nt are deleted from or added to a variant (as described above) of any of the sequences listed herein are encompassed.
- nucleotides that are deleted or added may be located contiguously or noncontiguously with respect to the original sequence. They may be located internally or at one or both ends. The nucleotides that are added may be positioned anywhere within the sequence or may be appended at one or both ends.
- Inventive nucleic acids e.g., RNAi-inducing agents or vectors may be introduced into cells by any available method. For instance, nucleic acids or vectors encoding them can be introduced into cells via conventional transformation or transfection techniques.
- the terms "transformation” and “transfection” refer to a variety of art-recognized techniques for introducing foreign nucleic acids (e.g., DNA or RNA) into a cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, injection, or electroporation. Delivery agents such as those described below can be used.
- inventive nucleic acid e.g., an RNAi-inducing agent such as an siRNA, shRNA, or vector that provides a template for synthesis of an inventive RNAi-inducing agent.
- the cell can be a mammalian cell, e.g., a human cell or a non-human mammalian cell, or a non-mammalian cell.
- the cell is one found in the nasal and/or respiratory passages or lungs of a mammalian subject and is susceptible to infection by an influenza virus.
- the cell is a respiratory epithelial cell.
- such cells also contain influenza virus RNA.
- RNAi-based therapy of infectious diseases can desirably incorporate a diagnostic step that determines whether a subject in need of treatment is infected with an infectious agent that is susceptible to inhibition by one or more RNAi- inducing entities.
- a diagnostic step determines whether a subject in need of treatment is infected with an infectious agent that is susceptible to inhibition by one or more RNAi- inducing entities.
- susceptible to inhibition is meant that one or more biological activities of the infectious agent can be effectively inhibited by administration of the RNAi-inducing entity to a subject.
- replication, pathogenicity, spread, and/or production of the infectious agent is inhibited.
- replication, pathogenicity, spread, and/or production of the agent is inhibited by at least 25% when the RNAi-inducing entity is administered to a subject at a tolerated dose.
- the inhibition is sufficient to produce a therapeutically useful effect.
- Influenza virus is used as an example to illustrate the diagnostic methods of the invention, which are tailored to allow the selection of an RNAi-inducing entity that is suitable for a subject suffering from an infection.
- the selected RNAi-inducing entity may, of course, also be administered for prophylaxis, e.g., to individuals who have come in contact with the infected individual, regardless of whether those individuals have developed symptoms of infection.
- the invention therefore provides methods for diagnosing influenza virus infection and for determining whether a subject is infected with an influenza virus.
- the method comprises determining whether a subject is infected with an influenza virus that is inhibited by one or more of the RNAi-inducing entities of the invention.
- a sample e.g., sputum, saliva, nasal washings, nasal swab, throat swab, bronchial washings, broncheal alveolar lavage (BAL) fluid, biopsy specimens, etc.
- BAL broncheal alveolar lavage
- the sample can be subjected to one or more processing steps.
- any such processed sample is considered to be obtained from the subject.
- the sample is analyzed to determine whether it contains an influenza virus-specific nucleic acid.
- An "influenza virus-specific nucleic acid” is any nucleic acid, or its complement, that originates from or is derived from an influenza virus and can serve as an indication of the presence of an influenza virus in a sample and, optionally, be used to identify the influenza strain and/or the sequence of an influenza gene.
- the nucleic acid may have been subjected to processing steps following its isolation. For example, it may be reverse transcribed, amplified, cleaved, etc.
- the sequence is at least 15 nt in length, e.g., 20-25 nt, 25-30 nt, or longer.
- sequence is distinct from sequences found in other viruses, so that its presence is specifically indicative of the presence of an influenza virus.
- sequence of an influenza virus-specific nucleic acid present in the sample, or its complement is compared with the sequence of the antisense or sense strand of an RNAi-inducing agent such as an siRNA or shRNA.
- RNAi-inducing agent such as an siRNA or shRNA.
- the word "comparison” is used in a broad sense to refer to any method by which a sequence can be evaluated, e.g., which it can be determined whether the sequence is the same as or different to a reference sequence at one or more positions, or by which the extent of difference can be assessed.
- nucleic acid-based assays Any of a wide variety of nucleic acid-based assays can be used.
- the diagnostic assay utilizes a nucleic acid comprising a favorably and/or highly conserved target portion or its complement, or a fragment of the favorably and/or highly conserved portion or its complement.
- the nucleic acid serves as an amplification primer or a hybridization probe, e.g., in an assay such as those described below.
- an influenza-specific nucleic acid in the sample is amplified. Any suitable amplification method can be used, including exponential amplification, linked linear amplification, ligation-based amplification, and transcription- based amplification.
- PCR polymerase chain reaction
- Linked linear amplification is disclosed by Wallace et al. in U.S. Pat. No. 6,027,923.
- Examples of ligation-based amplification are the ligation amplification reaction (LAR), taught by Wu et al. (Genomics 4:560 (1989)) and the ligase chain reaction (EP Application No. 0320308 Bl).
- Hampson et al. (Nucl. Acids Res. 24(23):4832-4835, 1996) describe a directional random oligonucleotide primed (DROP) method.
- DROP directional random oligonucleotide primed
- Isothermal target amplification methods include transcription mediated amplification (TMA), self-sustained sequence replication (3SR), Nucleic Acid Sequence Based Amplification (NASBA), and variations thereof.
- TMA transcription mediated amplification
- SR self-sustained sequence replication
- NASBA Nucleic Acid Sequence Based Amplification
- others e.g., as described in Malek et al., U.S. Pat. No. 5,130,238; Kacian and Fultz, U.S. Pat. No. 5,399,491; Burg et al., U.S. Pat. No.
- Detection or comparison can be performed using any of a variety of methods known in the art, e.g., amplification-based assays, hybridization assays, primer extension assays (e.g., allele-specific primer extension in which the corresponding target portions of different influenza virus strains are analogous to different alleles of a gene), oligonucleotide ligation assays (U.S. Pat. Nos. 5,185,243, 5,679,524 and 5,573,907), cleavage assays , heteroduplex tracking analysis (HTA) assays, etc. Examples include the Taqman ® assay, Applied Biosystems (U.S. Pat. No.
- CPT Cycling probe technology
- Invasive cleavage assays e.g., Invader ® assays (Third Wave Technologies), described in Eis, P. S. et al., Nat. Biotechnol. 19:673, 2001, can also be used to detect influenza-specific nucleic acids.
- Assays based on molecular beacons U.S. Pat. Nos. 6,277,607; 6,150,097; 6,037,130
- FRET fluorescence energy transfer
- Molecular beacons are oligonucleotide hairpins which undergo a conformational change upon binding to a perfectly matched template.
- the conformational change of the oligonucleotide increases the physical distance between a fluorophore moiety and a quencher moiety present on the oligonucleotide. This increase in physical distance causes the effect of the quencher to be diminished, thus increasing the signal derived from the fluorophore.
- U.S. Pub. No. 20050069908 and references therein describe a variety of other methods that can be used for the detection of nucleic acids. Probes of the invention may thus comprise one or more portions that hybridize to an influenza-specific sequence and one or more portions designed according to the specific assay.
- 6,239,150 describe compositions and a method for amplification of and multiplex detection of molecules of interest involving rolling circle replication.
- the method is useful for simultaneously detecting multiple specific nucleic acids in a sample. For example, it may be used for determining the presence of one or more influenza-specific nucleic acids in the sample.
- the nucleic acids are sequenced.
- U.S. Pub. No. 20050026180 describes methods for multiplexing nucleic acid reactions, including amplification, detection and genotyping, which can be adapted for detection of influenza- specific sequences and for determining the sequence at specific locations of interest for purposes of determining susceptibility to an RNAi-inducing entity.
- the assay determines whether an influenza-specific nucleic acid in the sample comprises a portion that is identical to or different from a sense or antisense strand of an RNAi-inducing entity. Optionally the exact differences, if any, are identified. This information is used to determine whether the influenza virus is susceptible to inhibition by the RNAi-inducing entity.
- suitable assays for detection and/or genotyping of infectious agents are described in Molecular Microbiology: Diagnostic Principles and Practice, Persing, D.H., et al., (eds.) Washington, D. C: ASM Press, 2004. Any of the assays can be performed using an automated system.
- nucleic acids from a sample are applied to a microarray (also referred to as a "chip") to which a multiplicity of nucleic acids complementary to various different influenza virus transcripts or portions thereof are attached.
- the hybridization pattern is detected and provides sufficient information to determine whether the influenza virus is susceptible to inhibition by an RNAi-inducing entity.
- an influenza-specific nucleic acid present in the sample is sequenced (typically following amplification). Multiple different assays can be used.
- the diagnostic assays may employ any of the nucleic acids described in section III.
- the nucleic acid comprises a nucleic acid portion that is not substantially complementary or substantially identical to an influenza virus transcript.
- the nucleic acid may comprise a primer binding site (e.g., a binding site for a universal sequencing primer or amplification primer), a hybridization tag (which may, for example, be used to isolate the nucleic acid from a sample comprising other nucleic acids), etc.
- the nucleic acid comprises a non-nucleotide moiety.
- the non-nucleotide moiety may be attached to a terminal nucleotide of the nucleic acid, e.g., at the 3' end. The moiety may protect the nucleic acid from degradation.
- the non-nucleotide moiety is a detectable moiety such as a fluorescent dye, radioactive atom, member of a fluorescence energy transfer (FRET) pair, quencher, etc.
- the non-nucleotide moiety is a binding moiety, e.g. biotin or avidin.
- the non-nucleotide moiety is a hapten such as digoxygenin, 2,4-Dinitrophenyl (TEG), etc.
- the non-nucleotide moiety is a tag usable for isolation of the nucleic acid.
- a nucleic acid is attached to a support, e.g., a microparticle such as a bead, which is optionally magnetic.
- the invention further provides an array comprising a multiplicity of nucleic acids of the invention, e.g., at least 10, 20, 50, etc.
- the nucleic acids are covalently or noncovalently attached to a support, e.g., a substantially planar support such as a glass slide. See, e.g., U.S. Pat. Nos. 5,744,305; 5,800,992; 6,646,243.
- Susceptibility information can include quantitative information regarding the degree of susceptibility.
- an influenza virus is considered susceptible to inhibition by an RNAi-inducing entity such as an siRNA or shRNA if the RNAi-inducing entity reduces virus production in infected cells by at least 25% when contacted with the cells or administered to a subject at a tolerated dose.
- an influenza virus transcript comprises a target portion that is 100% identical to any of SEQ ID NOs: 272 - 380, preferably 100% identical to any of SEQ ID NOs: 274, 286, 287, 292, 297, 298, 304, 305, 309, 310, 311, 319, 324, 327, 334, 346, 347, 360, 361, 364, and 366, yet more preferably 100% identical to any of SEQ ID NOs: 297, 309, 310, 311, 346, 347, 364, and 366, the influenza virus is considered susceptible to an RNAi-inducing entity that comprises an antisense strand that is 100% complementary to the target portion.
- an influenza virus transcript comprises a target portion that differs at 1, 2, or 3 positions, preferably 1 or 2 positions, more preferably only 1 position from any of SEQ ID NOs: 272 - 380, the influenza virus is considered susceptible to an RNAi-inducing entity that comprises an antisense strand that is 100% complementary to the target portion.
- an influenza virus transcript comprises a target portion that differs at 1 , 2, or 3 positions, preferably 1 or 2 positions, more preferably only 1 position from any of SEQ ID NOs: 274, 286, 287, 292, 297, 298, 304, 305, 309, 310, 311, 319, 324, 327, 334, 346, 347, 360, 361, 364, and 366, the influenza virus is considered susceptible to an
- RNAi-inducing entity that comprises an antisense strand that is 100% complementary to the target portion.
- an influenza virus transcript comprises a target portion that differs at 1, 2, or 3 positions, preferably 1 or 2 positions, more preferably only 1 position from any of SEQ ID NOs: 297, 309, 310, 311, 346, 347, 364, and 366, the influenza virus is considered susceptible to an RNAi-inducing entity that comprises an antisense strand that is 100% complementary to the target portion.
- Information obtained from experiments or from previous experience in treating an influenza virus having a particular sequence within the target portion can also be used to decide whether the virus is susceptible to inhibition by a given RNAi-inducing entity or combination thereof.
- Susceptibility information can also include theoretical predictions based, for example, on the expected effect of any mismatches that exist between the influenza virus sequence and the antisense strand of an inhibitory agent.
- Susceptibility information can be stored in a computer-readable form on a computer-readable medium, e.g., in an organized manner in a database. The results of a diagnostic test performed on a sample obtained from a subject are provided to a computerized system that accesses the information and determines the susceptibility profile of an influenza virus that infects the subject. In certain embodiments the system recommends a particular RNAi-inducing agent or combination thereof and/or a dose.
- the invention therefore provides a computerized system for determining susceptibility of a virus, e.g., an influenza virus, to an RNAi-inducing entity.
- the invention further provides a database containing susceptibility information.
- the computerized system and an automated system for performing the assay may be part of a single integrated automatic system or may be provided separately.
- kits for detecting influenza virus infection comprise one or more nucleic acids of the invention.
- Certain of the kits comprise one or more nucleic acids that can be used to detect a portion of an influenza virus transcript that comprises a preferred target portion for RNAi.
- the kits may comprise one or more items selected from the group consisting of: a probe, a primer, a sequence-specific oligonucleotide, an enzyme, a substrate, an antibody, a population of nucleotides, a buffer, a positive control, and a negative control.
- the nucleotides may be labeled. For example, one or more populations of fluorescently labeled nucleotides such as dNTPs, ddNTPs, etc. may be provided.
- the probe can be a nucleic acid that includes all or part of a target portion, e.g., a highly or favorably conserved target portion, or its complement, or is at least 80% identical or complementary to a target portion, e.g., 100% identical or complementary.
- a plurality of probes are provided.
- the probes differ at one or more positions and can be used for determining the exact sequence of an influenza virus transcript at such positions. For example, the probes may differentially hybridize to the transcript (e.g., hybridization occurs only if the probe is 100% complementary to a target portion of the transcript).
- the primers can be complementary to sites located upstream and downstream of a target portion and can be used to amplify a region of influenza virus nucleic acid comprising the target portion, which can then be sequenced or subjected to additional processes.
- the length of the amplified region may be, e.g., 100-200 nt, 200-300 nt, or more.
- Primers that bind to sites a sufficient distance away from the target portion to amplify a region of a desired length are selected. Methods for selecting amplification primers are well known in the art.
- the kits can comprise sequence-specific oligonucleotides.
- the oligonucleotides are sequence-specific in that they will only support polymerase-mediated extension or ligation when hybridized to a substantially complementary nucleic acid (e.g., an influenza virus-specific nucleic acid) if the 3' terminal nucleotide of the oligonucleotide is perfectly complementary to the nucleic acid.
- a substantially complementary nucleic acid e.g., an influenza virus-specific nucleic acid
- a plurality of sequence-specific oligonucleotides are provided.
- the oligonucleotides differ at the 3' terminal position and can therefore be used to establish the identity of a nucleotide that is located opposite that position when the oligonucleotide is hybridized to a nucleic acid of interest (e.g., an influenza virus-specific nucleic acid).
- Kits of the invention can comprise specimen collection materials, e.g., a swab, a tube, etc.
- the components of the kit may be packaged in individual vessels or tubes which will generally be provided in a container, e.g., a plastic or styrofoam container suitable for commercial sale, together with instructions for use of the kit.
- V. Transgenic Animals [00240] The present invention encompasses transgenic animals engineered to contain or express an inventive RNAi-inducing agent. Such animals are useful for studying the function and/or activity of inventive RNAi agents, and/or for studying the influenza virus infection/replication system.
- a transgenic animal is a non-human animal in which one or more of the cells of the animal, preferably most or all of the cells, includes a transgene.
- a transgene is exogenous DNA or a rearrangement, e.g., a deletion of endogenous chromosomal DNA, which preferably is integrated into or occurs in the genome of the cells of a transgenic animal.
- the transgene comprises a promoter operably linked to a nucleic acid such that expression of the nucleic acid occurs in the cell.
- a transgene can direct the expression of an RNAi-inducing agent in one or more cell types or tissues of the transgenic animal.
- transgenic animals are non-human mammals, e.g., rodents such as rats or mice.
- Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, birds such as chickens, amphibians, and the like.
- the transgenic animal is of a variety used as an animal model (e.g., murine, ferret, or primate) for testing potential influenza therapeutics.
- Other non-human animals contemplated within the invention include domesticated animals, including but not limited to livestock and pets, or any animal used or kept for profit. Such animals are partly or fully resistant to influenza virus infection.
- the RNAi-inducing agent may be, for example, an siRNA or shRNA.
- the RNAi-inducing agent can be targeted to any potential influenza virus target portion, e.g., a target portion listed in any of Tables IA, IB, 17, 18, 20, and/or 34.
- the RNAi-inducing agent is targeted to a target portion whose sequence is selected from SEQ ID NOs: 274, 286, 287, 292, 297, 298, 304, 305, 309, 310, 311, 319, 324, 327, 334, 346, 347, 360, 361, 364, and 366, e.g., any of SEQ ID NOs: 297, 309, 310, 311, 346, 347, 364, and 366.
- the RNAi-inducing agent has an antisense strand that is complementary to any of the foregoing target portions and a sense strand that forms a duplex with the antisense strand.
- these methods include (i) introducing an appropriate vector comprising the transgene into nuclei of fertilized eggs by microinjection, followed by transfer of the egg into the genital tract of a pseudopregnant female; and (ii) introducing an appropriate vector comprising a transgene into a cultured somatic cell (e.g., using any convenient technique such as transection, electroporation, etc.), selecting cells in which the transgene has integrated into genomic DNA, transferring the nucleus from a selected cell into an oocyte or zygote, optionally culturing the oocyte or zygote in vitro to the morula or blastula stage, and transferring the embryo into a recipient female.
- a cultured somatic cell e.g., using any convenient technique such as transection, electroporation, etc.
- a retroviral vector comprising the transgene is used.
- the retroviral vector is introduced into cells either as DNA plasmid or as a viral particle, by infection. Cytoplasmic microinjection of an appropriate vector into an oocyte or embryonic cell can also be used. Sperm-mediated transgenesis is also encompassed. Heterozygous or chimeric animals obtained using these methods are identified and bred to produce homozygotes.
- the vector is preferably an RNAi-inducing vector targeted to an influenza virus transcript.
- the vector comprises a template for transcription of an RNAi-inducing agent such as an siRNA or shRNA targeted to a target portion that is favorably and/or highly conserved among influenza viruses that are derived from organisms of the species of the transgenic animal and, optionally also among influenza viruses derived from another species such as humans.
- the vector comprises a promoter operably linked to a template for transcription of the RNAi- inducing agent.
- the RNAi-inducing agent may be produced as a single RNA molecule comprising complementary portions or as two RNA molecules that hybridize within the cell, as described above.
- the promoter may, but need not be, derived from the species of the transgenic animal.
- RNA Pol I, H 5 or III promoters can be used.
- the promoter can be constitutive or inducible.
- the transgenic animals are avians, e.g., chickens.
- Methods for making transgenic avians are known in the art and include those described above and variations thereof.
- Vectors and methods suitable for production of transgenic avians and other transgenic animals are described, for example, in U.S. Pat. No. 6,730,822, U.S. Pub. Nos. 20020108132 and 20030126629, and references in these.
- the transgenic avian is produced using a retroviral vector, e.g., an avian leukosis virus vector.
- the transgenic avian is produced using a eukaryotic vector other than a retroviral vector, although the vector may comprise one or more sequences derived from a retrovirus.
- the transgenic avian expresses a plurality of RNAi-inducing agents each having an antisense strand with a different inhibitory region sequence.
- the RNAi-inducing agents may each be targeted to a different influenza virus strain.
- the invention provides flocks of transgenic avians in which different members of the flock express one or more different RNAi-inducing agents each having an antisense strand with a different inhibitory region sequence.
- a first fraction of the flock expresses a first RNAi-inducing agent comprising an antisense strand that is 100% complementary to a target portion of a first avian influenza strain
- a second fraction of the flock expresses a first RNAi-inducing agent comprising an antisense strand that is 100% complementary to a target portion of a second avian influenza strain
- a third fraction of the flock expresses a third RNAi-inducing agent comprising an antisense strand that is 100% complementary to a target portion of a third avian influenza strain, etc.
- transgenic animals are mammals, e.g., pigs (swine), bovines, etc. Methods suitable for making transgenic mammals include those discussed above, aspects of which are further described in Gordon et al., Proc. Natl. Acad.
- transgenic animals are rodents, e.g., mice.
- RNAi-inducing entities may be administered according to a variety of approaches. In one embodiment of the invention, a single species of RNAi-inducing agent is administered to a subject.
- a nonlimiting example is a single siRNA species comprising an antisense strand complementary to a favorably and/or highly conserved target portion from a variety of influenza virus strains.
- a population of two or more different RNAi-inducing agents are administered to a subject.
- the population of two or more RNAi-inducing agents include agents that contain antisense strands whose sequences are substantially complementary (preferably 100% complementary) to the same favorably and/or highly conserved region from a variety of strains of a particular virus, e.g., an influenza virus.
- the population of two or more RNAi-inducing agents includes agents that contain antisense strands whose sequences are substantially complementary (preferably 100% complementary) to different conserved regions from the same virus strain.
- the population of two or more RNAi-inducing agents include agents that contain antisense strands whose sequences are substantially complementary (preferably 100% complementary) to the same favorably and/or highly conserved region from a variety of strains of a particular virus, e.g., an influenza virus and RNAi-inducing agents includes agents that contain antisense strands whose sequences are substantially complementary (preferably 100% complementary) to different highly conserved regions from the same virus strain.
- RNAi therapy in general, including prevention and therapy of influenza virus infection, will be enhanced by efficient delivery of RNAi-inducing agents and/or RNAi-inducing vectors into cells in intact organisms.
- RNAi-inducing agents In the case of influenza virus, such agents must be introduced into cells in the respiratory tract, where influenza infection normally occurs.
- non-viral methods that facilitate intracellular uptake of RNAi-inducing agents.
- the invention therefore provides compositions comprising any of a variety of non- viral delivery agents for enhanced delivery of RNAi-inducing agents and/or vectors to cells in intact organisms, e.g., mammals and avians.
- the concept of "delivery” includes transport of an RNAi-inducing agent or RNAi-inducing vector from its site of entry into the body to the location of the cells in which it is to function, cellular uptake, and/or any subsequent steps involved in making the agent or available to the intracellular RNAi machinery (e.g., release of siRNA or shRNA from endosomes).
- Components that stabilize the RNAi-inducing agent either once it is in the body or during the process of formulating the agent for delivery, inhibit its degradation e.g., RNase inhibiting agents such as RNasin
- any agent that inhibits the activity of an RNase either fully or partially can be used.
- the delivery agents include RNase inhibitors purified from human placenta or recombinant versions thereof. While the delivery agents are primarily of use for enhancing delivery of RNAi-inducing agents, they may also be used to enhance delivery of RNAi-inducing vectors. [00251] In certain embodiments of the invention the delivery agent enhances stability, inhibits clearance, promotes cellular uptake of the composition, promotes release of the RNAi-inducing entity within the cell, reduces cytotoxicity, or directs the composition to a particular cell type, tissue, or organ. To "inhibit clearance" means to reduce the rate of removal of the composition from the body by the renal system. The delivery agent may inhibit uptake by cells of the reticulo-endothelial system such as macrophages.
- RNAi-inducing entity itself may be modified (e.g., covalently modified) to enhance stability, inhibit clearance, promote cellular uptake, promote release of the RNAi agent and/or vector from an intracellular compartment such as an endosome, reduce cytotoxicity, or direct the composition to a particular cell type, tissue, or organ.
- an RNAi-inducing agent may be pegylated, and/or an arginine-rich peptide may be conjugated to the RNAi-inducing agent.
- compositions comprising (i) an RNAi- inducing agent targeted to a transcript, and/or an RNAi-inducing vector whose presence within a cell results in production of an RNAi-inducing agent targeted to a transcript; and (ii) any of a variety of delivery agents including, but not limited to, cationic polymers, modified cationic polymers, peptide molecular transporters (including arginine or histidine-rich peptides), carbohydrates, lipids (including cationic lipids, neutral lipids, and combinations thereof), liposomes, lipopolyplexes, non-cationic polymers, surfactants suitable for introduction into the lung, or mixtures of any of the foregoing, etc.
- delivery agents including, but not limited to, cationic polymers, modified cationic polymers, peptide molecular transporters (including arginine or histidine-rich peptides), carbohydrates, lipids (including cationic lipids, neutral lipids, and combinations
- the delivery agents incorporate a moiety that increases delivery or increases the selective delivery of the RNAi-inducing agent or vector to cells in which it is desired to inhibit the transcript.
- the transcript is a respiratory virus transcript, e.g., an influenza virus transcript.
- an RNAi-inducing entity such as an RNAi- inducing agent is administered in "naked" form, i.e., in the absence of any delivery agent that enhances transfection, cellular entry, etc.
- an RNAi-inducing agent can be administered in an aqueous medium that is essentially free of lipids and is essentially free of delivery-enhancing polymers, e.g., cationic or noncationic polymers such as those described below.
- RNAi-inducing agents can be administered in naked form intravenously or directly to the respiratory system (e.g., by inhalation through the nose or mouth and into the lungs).
- RNAi-inducing agent is administered in an amount effective to treat or prevent a respiratory virus infection while resulting in minimal absorption into the blood and thus minimal systemic delivery of the RNAi-inducing agent.
- the invention provides a variety of methods for delivering a composition comprising an RNAi-inducing entity to a mammalian subject.
- the composition is delivered directly to the vascular system and achieves inhibition of a target transcript in an organ or tissue of the subject, e.g., the lung.
- the composition is delivered directly to the respiratoiy system.
- Certain of the methods are employed in Examples 16, 22, 23, and 24, in which influenza virus production and luciferase or cyclophilin B expression are inhibited in a target organ of a mammalian subject using the methods. These results indicate that the methods are widely applicable to the inhibition of virtually any desired target transcript.
- the invention provides a method of inhibiting expression of a gene in a tissue or organ of a mammalian subject comprising the step of: introducing a composition comprising an effective amount of an RNAi-inducing agent targeted to the gene directly into the vascular system of the subject without using a hydrodynamic transfection technique.
- a composition comprising an effective amount of an RNAi-inducing agent targeted to the gene directly into the vascular system of the subject without using a hydrodynamic transfection technique.
- the RNAi-inducing agent inhibits expression of a target transcript in the lung.
- the tissue may be a non-circulating tissue, i.e., a tissue other than blood.
- the invention further provides a method of method of inhibiting production of a virus in the respiratory system of a mammalian subject, wherein the virus infects respiratory epithelial cells, the method comprising the step of: introducing a composition comprising an effective amount of an RNAi-inducing agent targeted to a gene of the virus into the vascular system of the subject by injection without using a hydrodynamic transfection technique.
- the invention further provides a method of inhibiting expression of a gene in the lung of a mammalian subject comprising the step of: introducing a composition comprising an effective amount of an RNAi-inducing agent targeted to the gene and a delivery agent directly into the respiratory system of the subject.
- the gene is a respiratory virus gene, e.g., an influenza virus gene.
- the effective amount inhibits production of influenza virus in the respiratory system of the subject.
- the virus is a respiratory virus other than RSV.
- the composition may, for example, be administered via the nose or mouth, typically followed by inhalation.
- the composition may comprise particles that remain primarily in the upper respiratory tract, e.g., nose, pharynx, etc., as in a typical nasal or oral spray. In other embodiments the particles are inhaled into the lower respiratory tract. Respirable formulations that may be used to directly deliver a composition to the respiratory system are discussed below. In certain embodiments delivery directly to the respiratory system results in systemic delivery, e.g., the RNAi-inducing agent enters the vascular system from the lung and is transported to a target organ or tissue elsewhere in the body.
- RNAi-inducing agents targeted to appropriate transcripts can also be administered using the inventive methods for prevention and/or treatment of a variety of other diseases and conditions that affect the respiratory system. Examples include cancer, e.g., lung cancer, cystic fibrosis (See, e.g., U.S.S.N. 10/200,607), asthma (See, e.g., U.S.S.N. 11/069,611), pulmonary hypertension, pulmonary fibrosis, emphysema, etc.
- cancer e.g., lung cancer, cystic fibrosis (See, e.g., U.S.S.N. 10/200,607), asthma (See, e.g., U.S.S.N. 11/069,611), pulmonary hypertension, pulmonary fibrosis, emphysema, etc.
- Suitable target genes include, for example, oncogenes, genes that encode pro-angiogenic molecules and/or growth factors such as vascular endothelial growth factor, pro-inflammatory molecules, etc.
- oncogenes genes that encode pro-angiogenic molecules and/or growth factors such as vascular endothelial growth factor, pro-inflammatory molecules, etc.
- transcripts that play a role in diseases affecting any part of the body can be targeted when the RNAi-inducing agent is delivered systemically.
- the effective amount is between 0.1 mg/kg and 5 mg/kg of the subject's body weight. In other embodiments the effective amount is between 0.1 mg/kg and 10 mg/kg of the subject's body weight, or between 0.5 mg/kg and 20 mg/kg of the subject's body weight.
- compositions comprising RNAi-inducing entities may or may not include a delivery agent.
- Delivery agents suitable for use in the present invention include those described below and in co-pending U.S.S.N. 10/674,087. The delivery agents may be used in combination.
- compositions comprising (i) an RNAi-inducing entity targeted to a target transcript and (ii) a cationic polymer.
- the invention further provides methods of inhibiting target gene expression comprising administering a composition comprising an RNAi-inducing agent targeted to a target transcript to a mammalian subject.
- the invention provides methods of treating and/or preventing influenza virus infection comprising administering a composition comprising an RNAi-inducing agent that targets an influenza virus transcript and a cationic polymer to a mammalian subject.
- a cationic polymer is a polymer that is positively charged at approximately physiological pH, e.g., a pH ranging from approximately 7.0 to 7.6, preferably approximately 7.2 to 7.6, more preferably approximately 7.4.
- cationic polymers include, but are not limited to, polylysine (PLL), polyarginine (PLA), polyhistidine, polyethyleneimine (PEI) (37), including linear or branched PEI and low molecular weight PEI as described, for example, in (76), polyvinylpyrrolidone (PVP) (38), chitosan (39, 40), protamine, polyphosphates, polyphosphoesters (such as those described in US Publication No.
- Certain of these polymers comprise primary amine groups, imine groups, guanidine groups, and/or imidazole groups.
- Preferred cationic polymers have relatively low toxicity.
- References 85-87; U.S.S.N. 6,013,240; WO9602655; and U.S. Pub. Nos. 20040167087 and 20030157030 provide further information on PEI and other polymers useful in the practice of the invention.
- the commercially available PEI reagent known as jetPEITM (Qbiogene, Carlsbad, CA), a linear form of PEI (U.S.S.N. 6,013,240) can be used.
- Suitable cationic polymers also include blends of polymers of different molecular weight, copolymers comprising subunits of any of the foregoing polymers (or others), e.g., lysine-histidine copolymers, etc.
- the percentage of the various subunits need not be equal in the copolymers but may be selected, e.g., to optimize such properties as ability to form complexes with nucleic acids while minimizing cytotoxicity.
- the subunits need not alternate in a regular fashion.
- Appropriate assays to evaluate various polymers with respect to desirable properties are described in the Examples.
- Preferred cationic polymers also include polymers such as the foregoing, further incorporating any of various modifications. Appropriate modifications are IVH l VV ⁇ O
- compositions comprising PEI, PLL, or PLA and an siRNA that targets an influenza virus RNA significantly inhibit production of influenza virus in mice when administered intravenously either before or after influenza virus infection. The inhibition is dose-dependent and exhibits additive effects when two siRNAs targeted to different influenza virus RNAs were used.
- siRNA when combined with a cationic polymer such as PEI, PLL, or PLA, is able to reach the lung, to enter cells, and to effectively inhibit the viral replication cycle. While the presence of PEI significantly enhanced delivery to the lung, effective delivery occurred even in its absence (Examples 12; Figures 22C), indicating that effective siRNA delivery to the respiratory system can be achieved using "naked" siRNA. It is believed that these findings represent the first report of efficacy in inhibiting production of infectious virus in a mammal using siRNA (as opposed, for example, to inhibiting production of viral transcripts or intermediates in a viral replicative cycle). As described in Example 16, pulmonary administration of a mixture of siRNA and a cationic polymer effectively inhibited a target transcript in lung cells.
- a cationic polymer such as PEI, PLL, or PLA
- Examples 23 and 24 and Figure 31 provide further evidence that naked siRNA delivered to the respiratory system of a mammalian subject effectively inhibits expression of a target transcript therein.
- Other efforts to deliver siRNA intravenously to solid organs and tissues within the body have employed the technique known as hydrodynamic transfection, which involves rapid delivery of large volumes of fluid into the tail vein of mice and has been shown to result in accumulation of significant amounts of plasmid DNA in solid organs, particularly the liver (Liu 1999; Zhang 1999; Zhang 2000). This technique involves delivery of fluid volumes that are almost equivalent to the total blood volume of the animal, e.g., 1.6 ml for mice with a body weight of 18-20 grams, equivalent to approximately 8-12% of body ra n ywo
- siRNA has also been delivered intravenously to subcutaneously implanted tumor cells in nude mice (Filleur 2003), but the relevance of this finding for intravenous delivery of RNAi-inducing agents to native organs and tissues is unclear given the distinctive features of this system.
- the present invention demonstrates effective intravenous delivery of an RNAi-inducing agent at doses of 5 mg/kg or less, e.g., 0.1 - 5 mg/kg of the body weight of a subject.
- an RNAi-inducing agent at doses of 5 mg/kg or less, e.g., 0.1 - 5 mg/kg of the body weight of a subject.
- the inventors in contrast, have used conventional volumes of fluid (e.g., 200 ⁇ l) and have demonstrated effective delivery of siRNA to the lung under conditions that would be expected to lead to minimal expression of injected transgenes even in the liver, the site at which expression is most readily achieved using hydrodynamic transfection.
- conventional volumes of fluid e.g. 200 ⁇ l
- the invention therefore provides a method of inhibiting expression of a transcript, e.g., a viral transcript such as an influenza virus transcript, in a cell within a mammalian subject comprising the step of introducing a composition comprising an RNAi-inducing agent such as an siRNA or shRNA targeted to the target transcript into the vascular system of the subject using a conventional injection technique, e.g., a technique using conventional pressures and/or conventional volumes of fluid.
- a conventional injection technique e.g., a technique using conventional pressures and/or conventional volumes of fluid.
- the intravenous administration results in a therapeutically effective dose of the agent within a target organ, e.g., the lung.
- the composition comprises a cationic polymer.
- the composition is introduced in a fluid volume equivalent to less than 10% of the subject's body weight. In certain embodiments of the invention the fluid volume is equivalent to less than 5%, less than 2%, less than 1%, or less than .1% of the subject's body weight. In certain embodiments of the invention the _
- the method achieves delivery of effective amounts of an RNAi-inducing agent in a cell in a body tissue or organ other than the liver, for example, the lung.
- the composition is introduced into a vein, e.g., by intravenous injection.
- the composition may also be administered into an artery, delivered using a device such as a catheter, indwelling intravenous line, etc.
- the RNAi-inducing agent inhibits production of a virus, e.g., in the lung.
- Example 15 As described in Example 15, the inventors have also shown that the cationic polymers PLL and PLA form complexes with siRNAs and promote uptake of functional siRNA in cultured cells. Transfection with complexes of PLL and NP- 1496 or complexes of PLA and NP- 1496 siRNA inhibited production of influenza virus in cells. These results and the results in mice discussed above demonstrate the advantages of using mixtures of cationic polymers and siRNA for delivery of siRNA to mammalian cells in the body of a subject.
- Example 15 may be employed to test additional polymers, e.g., polymers modified by addition of groups (e.g., acyl, succinyl, acetyl, or imidazole groups) to reduce cytotoxicity, and to optimize those that are initially effective. Certain preferred modifications result in a reduction in the positive charge of the cationic polymer. Certain preferred modifications convert a primary amine into a secondary amine. Methods for modifying cationic polymers to incorporate such additional groups are well known in the art. (See, e.g., ref. 32). For example, the ⁇ - amino group of various residues may be substituted, e.g., by conjugation with a desired modifying group after synthesis of the polymer.
- groups e.g., acyl, succinyl, acetyl, or imidazole groups
- a %substitution sufficient to achieve an appropriate reduction in cytotoxicity relative to the unsubstituted polymer while not causing too great a reduction in the ability of the polymer to enhance delivery of the RNAi-inducing agent. Accordingly, in certain embodiments of the invention between 5% and 75%, e.g., approximately 50% of the residues in the polymer are substituted. Similar effects may be achieved by initially forming copolymers of appropriately selected monomeric subunits, i.e., subunits some of which already incorporate the desired modification. Cationic polymers for use to facilitate delivery of RNAi-inducing agents may be modified so that they incorporate one or more residues other than the major monomeric subunit of which the polymer is comprised. For example, one or more alternate residues may be added to the end of a polymer, or polymers may be joined by a residue other than the major monomer of which the polymer is comprised.
- a variety of additional cationic polymers may also be used. Examples include oly( ⁇ -amino ester) (PAE) polymers (such as those described in U.S. S.N. 09/969,431 ; 10/446,444; US Pub. 20020131951 and in refs. 34 and 93). While some poly( ⁇ -amino ester) (PAE) polymers have been shown to facilitate DNA plasmid transfection, given the considerable differences in structure and size between siRNA and shRNA molecules and DNA plasmids, whether cationic polymers would prove useful in enhancing uptake of siRNA was highly uncertain.
- PAE oly( ⁇ -amino ester)
- siRNA targeted to NP inhibited influenza virus production in mice when administered intravenously together with a poly(beta amino ester).
- this siRNA inhibited influenza virus production in mice when administered intraperitoneally together with a second poly(beta amino ester).
- Additional cationic polymers that may also be used to enhance delivery of inventive RNAi-inducing agents include polyamidoamine (PAMAM) dendrimers, poly(2-dimethylamino)ethyl methacrylate (pDMAEMA), and its quaternary amine analog poly(2-triemethylamino)ethyl methacrylate (pTMAEMA), poly [a-(4-aminobutyl)-L- glycolic acid (PAGA), and poly (4-hydroxy-l -proline ester). See Han (2000) for further description.
- PAMAM polyamidoamine
- pDMAEMA poly(2-dimethylamino)ethyl methacrylate
- pTMAEMA quaternary amine analog poly(2-triemethylamino)ethyl methacrylate
- PAGA poly [a-(4-aminobutyl)-L- glycolic acid
- PAGA poly (4-hydroxy-l -proline ester
- Modified cationic polymers e.g., poly(L-histidine)-graft-poly(L-lysine) polymers (Benns 2000), polyhistidine-PEG (Putnam 2003), folate-PEG-graft- polyethyleneimine (Benns 2002), polyethylenimine-dextran sulfate (Tiyaboonchai 2003), etc.
- the polymers may be branched or linear and may be grafted or ungrafted.
- the polymers form complexes with inventive RNAi- inducing entities, which are then administered to a subject. Any of the polymers may be modified to incorporate PEG or other hydrophilic polymers.
- Cationic polymers may be multiply modified.
- the invention encompasses modification of any of the delivery agents described herein to incorporate a moiety that enhances delivery of the agent to cells and/or enhances the selective delivery of the agent to specific cells. Any of a variety of mi l yyzo
- moieties may be used, e.g., (i) antibodies or antibody fragments that specifically bind to a molecule expressed by a cell in which inhibition is desired, (e.g., a respiratory epithelial cell); (ii) ligands that specifically bind to a molecule expressed by a cell in which inhibition is desired.
- a cell in which inhibition e.g., a respiratory epithelial cell
- ligands that specifically bind to a molecule expressed by a cell in which inhibition is desired.
- compositions comprising any of a variety of additional agents and an RNAi-inducing entity, wherein the agent enhances delivery of the RNAi-inducing entity, e.g., to respiratory epithelial cells.
- peptide molecular transporters which are peptides that can penetrate the plasma membrane from the cell surface, are included in a composition. They generally consist of 11-34 amino acid residues, are highly enriched for arginine, and are often referred to as arginine rich peptides (ARPs) or penetratins (see references 42-51, 120, 134-36).
- ARPs arginine rich peptides
- penetratins see references 42-51, 120, 134-36.
- a composition comprises a surfactant suitable for introduction into the lung.
- a surfactant suitable for introduction into the lung.
- examples include commercially available formulations Infasurf ® (ONY, Inc., Amherst, NY); Survanta ® (Ross Labs, Abbott Park, IL), and Exosurf Neonatal ® (GlaxoSmithKline, Research Triangle Park, NC).
- U.S.S.N. 4,312,860; 4,826,821; and 5,110,806 describe additional surfactant compositions.
- any lipid- containing material that does not cause substantial injury to the lung can be used as a surfactant.
- Administration with detergents and thixotrophic solutions may also be used.
- Perfluorochemical liquids e.g., heptacosafluorotributylamine (Fluorinert), and related molecules, may also be used. See (74, 126, 150) and U.S. Patent 6,638,767 for further discussion.
- the invention encompasses the use of protein/polyethylenimine complexes incorporating inventive RNAi-inducing entities, for delivery, e.g., to the respiratory system, e.g., the lung.
- Other delivery agents that can be used include natural and synthetic cyclodextrins and mixtures of these with other delivery agents. See Singh, M, et al., Biotechnol Adv. 20(5-6):341-59, 2002; Eastburn, SD and Tao, BY, Biotechnol Adv., 12(2):325-39, 1994) and U.S. Pub. No. 20030157030 for further information.
- non-cationic polymers such as poly(lactide) (PLA), poly(glycolide) (PLG), and poly(DL-lactide-co-glycolide) (PLGA) (Panyam 2002), polyvinyl alcohol, poly(N-ethyl- 4-vinylpyridium bromide, Pluronics, poly(ether-anhydride) may be used.
- PVA poly(lactide)
- PLA poly(glycolide)
- PLGA poly(DL-lactide-co-glycolide)
- Pluronics poly(ether-anhydride)
- Block copolymers which may comprise cationic and/or non-cationic monomers, may also be used. Examples are described in U.S. Patent Nos. 6,800,663; 6,692,770; 6,669,959; 6,616,941; 6,592,899; and 6,517,869.
- compositions for Inhalational Delivery of RNAi-inducing Entities comprising RNAi-inducing entities, for administration by inhalation.
- RNAi-inducing entity is an RNAi-inducing entioty such as an siRNA or shRNA.
- RNAi-inducing agents can be administered directly to the respiratory system either in naked form or with a delivery agent by inhalation through the nose or mouth and into the lungs.
- the RNAi-inducing agent is administered in an amount effective to treat or prevent a condition that affects the respiratory system, such as a respiratory virus infection, while resulting in minimal absorption into the blood and thus minimal systemic delivery of the RNAi-inducing agent.
- the extent of absorption into the blood is such that no clinically significant effects are observed in an organ or tissue outside the respiratory system when the RNAi agent is administered at a dose that is effective in the lung.
- the invention provides dry powder compositions comprising RNAi-inducing entities, preferably RNAi-inducing agents.
- inventive agents are preferably delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
- a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
- the delivery system is suitable for delivering the composition into major airways (trachea and bronchi) of a subject and/or deeper into the lung (bronchioles and/or alveoli).
- compositions comprising an RNAi-inducing entity are delivered using a nasal spray. Delivery agents may be included in the pharmaceutical composition.
- RNAi-inducing agents can effectively inhibit influenza virus when delivered to the respiratory system via the respiratory passages in the absence of specific delivery agents (Example 23).
- RNAi-inducing agents are delivered to the lungs as a composition that consists essentially of the RNAi-inducing agent in dry form (e.g., diy powder) or in an aqueous medium that consists essentially of water, optionally also including a salt (e.g., NaCl, a phosphate salt), buffer, and/or an alcohol, e.g., as naked siRNA or shRNA.
- Aerosol formulations for delivery to the airways and lung may comprise liquid or dry particles of various dimensions and properties.
- a dry particle composition containing particles smaller than about 1 mm in diameter is also referred to herein as a dry powder.
- dry is meant that the composition has a relatively low liquid content, sothat the particles are readily dispersible, e.g., in a dry powder inhalation device to form an aerosol or spray.
- binder is meant a composition that consists largely or entirely of finely dispersed solid particles that are relatively free flowing and capable of being readily dispersed in an inhalation device and subsequently inhaled by a subject, e.g., a patient, preferably so that the particles can reach the alveoli of the lung, i.e., they are suitable for pulmonary delivery.
- Powder compositions may be characterized on the basis of various parameters such as the fine particle fraction (FPF), the emitted dose, the average particle density, and the mass median aerodynamic diameter (MMAD).
- FPF fine particle fraction
- MMAD mass median aerodynamic diameter
- Suitable methods are known in the art and are found, for example, in references 31 and 58 and in U.S. Publication Nos. 20020146373, 20030012742, and 20040092470.
- particles having a mass mean aerodynamic diameter of between 1 ⁇ m and 25 ⁇ m, preferably between 1 ⁇ m and 10 ⁇ m, are used.
- large porous particles having mean geometric diameters ranging between 3 and 15 ⁇ m and tap density between 0.04 and 0.6 g/cm 3 are used (31, 58).
- Methods for making dry particles are known in the art.
- Suitable methods include spray drying, spray-freeze drying, phase separation, single or double emulsion solvent evaporation, solvent extraction, and simple and complex coacervation.
- Particulate compositions can also be made using granulation, extrusion, and/or spheronization.
- Methods suitable for preparing dry powder oligonucleotide formulations are known in the art. See, e.g., U.S. Publication No. 20040092470.
- the methods employed preferably do not greatly reduce the physical integrity and ability of the nucleic acid to inhibit a target transcript. It is desirable to avoid extremes of temperature or pH that are known to result in significant degradation of nucleic acids.
- compositions can be tested to determine whether the method selected is appropriate in terms of retaining sufficient efficacy.
- a selected formulation method results in a composition in which the portion consisting of the nucleic acid has at least 10% preferably at least 20%, 50%, or more of the level of activity of the input nucleic acid.
- the conditions used in preparing the particles may be selected to yield particles of a desired size or property (e.g., hydrophobicity, hydrophilicity, external morphology, "stickiness", shape, etc.).
- the method of preparing the particle and the conditions (e.g., solvent, temperature, concentration, air flow rate, etc.) used may also depend on the particular active agents and other components included in the composition. If the particles prepared by any of the above methods have a size range outside of the desired range, the particles can be sized, for example, using a sieve, by milling, etc. Combinations of methods may be employed.
- the dry powders may consist essentially of one or more RNAi-inducing agents.
- the formulation includes one or more additional agents, e.g., stabilizing agents, delivery-enhancing agents such as those described above, excipients, etc.
- excipient refers to a substance that is present in a formulation of the invention other than an active agent or delivery-enhancing agent. Suitable excipients for pulmonary delivery are known in the art. Any of a large number of art-recognized compounds may be included in the inventive formulations. In general, compositions having concentrations of between 0.1% and 100% active agent (i.e., RNAi- inducing agent) by weight may be used.
- Example 10 Methods for testing particles, e.g., for ability to reduce target transcript levels and/or inhibit influenza virus production are described in Example 10. Similar methods may be used for any of the inventive aerosol formulations. Dry particle compositions may be dissolved in a suitable solvent and delivered as liquid aerosols or by other suitable delivery means.
- Liquid particles can also be delivered, e.g., as aerosol formulations. In general, size ranges for such particles may be similar to those described above for dry particles. In certain embodiments the liquid particles are between approximately 0.5-5 ⁇ m for respiratory delivery, though smaller or larger particles could also be used.
- Suitable aqueous vehicles include water or saline, optionally including an alcohol.
- RNAi-inducing agents can also be administered intravenously, if desired.
- sizes of approximately 10 nm - 50 ⁇ m are generally preferred.
- compositions comprising the RNAi-inducing entites of the present invention may be used to inhibit or reduce respiratory virus infection or replication.
- an effective amount of an inventive composition is delivered to a cell or organism prior to, simultaneously with, or after exposure to a virus, e.g., an influenza virus.
- a virus e.g., an influenza virus.
- the amount of the RNAi-inducing entity is sufficient to reduce or delay one or more symptoms of infection.
- this section will often refer to inventive siRNAs, but the invention encompasses similar applications for other RNAi-inducing entities targeted to viral transcripts.
- influenza virus is used herein as an example, but the methods may be applied to any of a wide range of other respiratory viruses.
- compositions may comprise a single species of RNAi-inducing agents targeted to a single site in a single influenza transcript, or may comprise a plurality of different species, targeted to one or more sites in one or more influenza transcripts.
- RNAi-inducing agents e.g., multiple different siRNAs
- the composition contains an siRNAi targeted to each segment.
- the composition comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 different RNAi-inducing agent species, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 different siRNAs.
- the RNAi-inducing agents are targeted to portions of the influenza virus genome having sequences selected from the group consisting of SEQ ID NOs: 272-380.
- the RNAi- inducing agents are targeted portions of the influenza virus genome having sequences selected from the group consisting of any selected subset of SEQ ID NOs: 272-380. All such subsets are included herein for any and all purposes, even if not explicitly set forth.
- the composition comprises at least one RNAi-inducing agent targeted to PA and at least one RNAi-inducing agent targeted to another influenza virus gene, e.g., NP, PBl, or PB2.
- the composition comprises at least one RNAi-inducing agent targeted to PB 1 and at least one RNAi-inducing agent targeted to another influenza virus gene, e.g., NP, PA, or PB2.
- the composition comprises at least one RNAi-inducing agent targeted to PB2 and at least one RNAi-inducing agent targeted to another influenza virus gene, e.g., NP, PBl, or PA.
- the composition comprises at least one RNAi agent targeted to NP and at least one RNAi-inducing agent targeted to another influenza virus gene, e.g., PA, PBl, or PB2.
- inventive siRNA compositions may contain more than one siRNA species targeted to a single viral lvn i yy/D
- transcript may be desirable to include at least one siRNA targeted to coding regions of a target transcript and at least one siRNA targeted to the 3' UTR. This strategy may provide extra assurance that products encoded by the relevant transcript will not be generated because at least one siRNA in the composition will target the transcript for degradation while at least one other inhibits the translation of any transcripts that avoid degradation.
- the invention encompasses combinations of inventive RNAi-inducing entities including, but not limited to, approaches in which multiple RNAi-inducing agents, e.g., multiple siRNAs or shRNAs are administered and approaches in which a single vector directs synthesis of siRNAs that inhibit multiple influenza virus transcripts or of RNAs that may be processed to yield a plurality of siRNAs. See Example 11 for further details.
- the composition includes an RNAi-inducing agent targeted to at least one influenza virus A transcript and an RNAi-inducing agent targeted to at least one influenza virus B transcript.
- the composition comprises an RNAi-inducing agent targeted to both an influenza A virus transcript and an influenza B virus transcript.
- the composition comprises multiple siRNAs having different sequences that target the same portion of a particular segment.
- the composition comprises multiple RNAi-inducing agents that inhibit different influenza virus strains or subtypes
- Influenza viruses undergo both antigenic shift and antigenic drift, and resistance to therapeutic agents may arise. It may expected that, after an inventive composition has been in use for some time, mutation and/or reassortment may occur so that a variant that is not inhibited by the particular RNAi-inducing agents provided may emerge.
- the present invention therefore contemplates evolving therapeutic regimes.
- one or more new RNAi-inducing agents can be selected in a particular case in response to a particular mutation or reassortment. For instance, it would often be possible to design a new RNAi-inducing agent identical to the original except incorporating whatever mutation had occurred or targeting a newly acquired RNA segment; in other cases, it will be desirable to target a new sequence within the same transcript; in yet other cases, it will be desirable to target a new transcript entirely. ivi 1 1 yyjLV
- inventive RNAi-inducing agents are combined with one or more other anti-viral agents in order to inhibit, reduce, or prevent one or more symptoms or characteristics of infection.
- inventive RNAi-inducing agents are combined with one or more other antiviral agents such as NA inhibitors, M inhibitors, etc.
- other antiviral agents such as NA inhibitors, M inhibitors, etc. Examples include amantadine or rimantadine and/or zanamivir, oseltamivir, peramivir (BCX-1812, RWJ-270201) Ro64-0796 (GS 4104) or RWJ-270201.
- RNAi-inducing agent compositions may also be combined with one or more of any of a variety of agents including, for example, influenza vaccines (e.g., conventional vaccines employing influenza viruses or viral antigens as well as DNA vaccines) of which a variety are known. See Palese, P. and Garcfa-Sastre, 2002; Cheung and Lieberman, 2002, Leuscher-Mattli, 2000; and Stiver, 2003, for further information.
- influenza vaccines e.g., conventional vaccines employing influenza viruses or viral antigens as well as DNA vaccines
- the RNAi-inducing agents are present in the same mixture as the other agent(s) or the treatment regimen for an individual includes both RNAi-inducing agents and the other agent(s), not necessarily delivered in the same mixture or at the same time.
- the term "combination" is not intended to indicate that compounds must be present in, or administered to a subject as, a single composition of matter, e.g., as part of the same dosage unit (e.g., in the same aerosol formulation, particle composition, tablet, capsule, pill, solution, etc.) although they may be.
- the agents are administered individually but concurrently.
- coadministered or administered concurrently if they are present within the body at the same time in less than de minimis quantities. Accordingly, the compounds may, but need not be, administered together as part of a single composition. In addition, the compounds may, but need not be, administered simultaneously (e.g., within less than 5 minutes, or within less than one minute) or within a short time of one another (e.g., less than an hour, less than 30 minutes, less than 10 minutes, approximately 5 minutes apart). According to various embodiments of the invention compounds administered within such time intervals may be considered to be
- RNAi-inducing agents and vectors offer a complementary strategy to vaccination and may be administered to individuals who have or have not been vaccinated with any of the various vaccines currently available or under development (reviewed in Palese, P. and Garcia-Sastre, A., J. Clin. Invest., 110(1): 9-13, 2002).
- Current vaccine formulations in the United States contain inactivated virus and must be administered by intramuscular injection.
- the vaccine is tripartite and contains representative strains from both subtypes of influenza A that are presently circulating (H3N2 and HlNl), in addition to an influenza B type. Each season specific recommendations identify particular strains for use in that season's vaccines.
- Other vaccine approaches include cold-adapted live influenza virus, which can be administered by nasal spray; genetically engineered live influenza virus vaccines containing deletions or other mutations in the viral genome; replication-defective influenza viruses, and DNA vaccines, in which plasmid DNA encoding one or more of the viral proteins is administered either intramuscularly or topically (see, e.g., Macklin, M.D., et al., J Virol, 72(2): 1491-6, 1998; Ilium, L., et al., Adv Drug Deliv Rev, 51 (l-3):81-96, 2001; Ulmer, J., Vaccine, 20:S74-S76, 2002).
- RNAi-based therapeutics may gain particular benefit from RNAi-based therapeutics since they may experience reduced efficacy of influenza virus vaccines.
- inventive therapeutic protocols involve administering an effective amount of an RNAi-inducing agent or vector prior to, simultaneously with, or after exposure to influenza virus.
- an RNAi-inducing agent or vector prior to, simultaneously with, or after exposure to influenza virus.
- uninfected individuals may be administered
- immunocompromised with an inventive composition prior to exposure to influenza; at risk individuals (e.g., the elderly, immunocompromised individuals, persons who have recently been in contact with someone who is suspected, likely, or known to be infected with influenza virus, etc.) can be treated substantially contemporaneously with exposure, e.g., within 2 hours or less following exposure. In other embodiments a subject is treated at a later time, e.g., within 2-12, 12-24, 24-36, or 36-48 hours, following a suspected or known exposure. The subject may be symptomatic or asymptomatic.
- the subject is protected by administration of an RNAi-inducing agent or vector up to 48 hours, up to 24 hours, up to 12 hours, up to 3 hours, etc., before an exposure.
- an RNAi-inducing agent or vector up to 48 hours, up to 24 hours, up to 12 hours, up to 3 hours, etc., before an exposure.
- individuals suspected or known to be infected may receive inventive treatment at any time.
- Certain preferred influenza virus inhibitors inhibit viral replication, so that the level of replication is lower in a cell containing the inhibitor than in a control cell not containing the inhibitor by at least about 2 fold, preferably at least about 4 fold, more preferably at least about 8 fold, 16 fold, 64 fold, 100 fold, 200 fold, or to an even greater degree.
- Certain preferred influenza virus inhibitors prevent (e.g., reduce to undetectable levels) or significantly reduce viral replication (e.g., 10% or less, 25% of less, 50% or less, 75%, or less, relative to the level that would occur in the absence of the RNAi- inducing agent) for at least 24 hours, at least 36 hours, at least 48 hours, or about 60 hours following administration of the agent and/or infection.
- a sustained release preparation is used for prophylactic purposes, e.g., a formulation that releases a sufficient amount of active agent to protect a subject from influenza virus infection, or to lessen the symptoms of such infection over a period of time.
- the formulation may release an effective amount of agent over a period of several days, a week, 1-2 weeks, or longer.
- Biodegradable polymeric delivery systems comprising the RNAi-inducing agent or vector can be used.
- RNAi-inducing entities of the invention are therapeutically useful in at least 3 distinct situations: (i) An RNAi-inducing entity may be administered to a subject who is not suspected or known to have been exposed to influenza virus. In such a situation the RNAi-inducing entity preferably prevents the development of a clinically significant infection, or lessens its severity; (ii) An RNAi-inducing entity may be administered to a subject who is suspected or known to have been exposed to influenza virus, e.g., within a preceding time interval of up to a week.
- the RNAi-inducing entity preferably prevents the development of a clinically significant infection, or lessens its severity, (iii)
- An RNAi-inducing entity may be administered to a subject who has become clinically ill.
- the RNAi-inducing entity inhibits influenza virus replication and preferably lessens the severity and/or duration of at least one symptom of influenza virus infection.
- Subjects who have an infection of the upper respiratory tract, lower respiratory tract, or both, can be treated.
- the subject has viral pneumonia as a result of influenza virus infection.
- gene therapy is used to prevent influenza or to treat an individual who is already ill.
- Gene therapy protocols may involve administering an effective amount of a gene therapy vector capable of directing expression of an inhibitory RNAi-inducing agent to a subject either before, substantially contemporaneously, with, or after influenza virus infection.
- influenza viruses infect a wide variety of species in addition to humans.
- the present invention includes the use of the inventive compositions for the treatment of nonhuman species, particularly species such as chickens, swine, and horses.
- inhalational delivery of the RNAi-inducing entities is preferred in certain embodiments of the invention, while intravenous delivery is preferred in other embodiments of the invention. While inhalational delivery may be more suitable for patients who are in relatively good health, intravenous delivery may be more suitable for individuals who are unable to mount an adequate inspiratory effort and/or suffer from conditions that may impede effective delivery via the respiratory route (e.g., excessive mucus production; situations in which portions of the lung are consolidated due to bacterial infection or occluded by scar tissue, etc.) or in which it is desired to maintain a relatively constant concentration of the agent.
- respiratory route e.g., excessive mucus production; situations in which portions of the lung are consolidated due to bacterial infection or occluded by scar tissue, etc.
- inventive compositions may be formulated for delivery by any available route including, but not limited to parenteral (e.g., intravenous), intradermal, subcutaneous, oral, nasal, bronchial, ophthalmic, transdermal (topical), transmucosal, rectal, and vaginal routes.
- parenteral e.g., intravenous
- intradermal subcutaneous
- oral nasal
- bronchial ophthalmic
- transdermal topical
- transmucosal rectal
- vaginal routes include parenteral, transmucosal, nasal, bronchial, and oral.
- Inventive pharmaceutical compositions typically include an RNAi-inducing agent or a vector that will result in production of an RNAi-inducing agent after delivery, in combination with a pharmaceutically acceptable carrier.
- compositions are formulated to be compatible with its intended route of administration.
- Solutions or suspensions used for parenteral (e.g., intravenous), intramuscular, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
- a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
- antibacterial agents such as benzyl alcohol or methyl parabens
- antioxidants such as ascorbic acid or sodium bis
- compositions suitable for injectable use typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
- the composition should be sterile and should be fluid to the extent that easy syringability exists.
- Preferred pharmaceutical formulations are stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the relevant carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- solutions for injection are free of endotoxin.
- dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- Oral compositions generally include an inert diluent or an edible carrier.
- the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
- Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
- Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
- a binder such as microcrystalline cellulose, gum tragacanth or gelatin
- an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
- a lubricant such as magnesium stearate or Sterotes
- a glidant such as colloidal silicon dioxide
- RNAi-inducing entities of the invention can also be by transmucosal or transdermal means.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
- Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
- the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
- the compounds can also be prepared in the form of suppositories ⁇ e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
- the active entities are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
- Sustained release formulations which may release active agents over a period of hours, days, weeks, or even longer, may be particularly useful for prophylactic purposes. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. [00317] It is advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 5O (the dose lethal to 50% of the population) and the ED 5O (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 / ED 5 o.
- Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
- a therapeutically effective amount of a pharmaceutical composition typically ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
- the pharmaceutical composition can be administered at various intervals and over different periods of time as required, e.g., multiple times per day, daily, every other day, once a week for between about 1 to 10 weeks, between 2 to 8 weeks, between about 3 to 7 weeks, about 4, 5, or 6 weeks, etc.
- treatment of a subject with an RNAi-inducing entity as described herein can include a single treatment or, in many cases, can include a series of treatments.
- Exemplary doses include milligram or microgram amounts of the inventive nucleic acid, e.g., siRNA, per kg of subject or sample weight (e.g., about 1 ⁇ g/kg per kilogram to about 500 mg/kg per kilogram, about 100 mg/kg to about 5 mg/kg, or about 1 mg/kg to about 50 mg/kg)
- inventive nucleic acid e.g., siRNA
- sample weight e.g., about 1 ⁇ g/kg per kilogram to about 500 mg/kg per kilogram, about 100 mg/kg to about 5 mg/kg, or about 1 mg/kg to about 50 mg/kg
- doses much smaller than these may be used.
- RNAi-inducing agent depend upon the potency of the agent and may optionally be tailored to the particular recipient, for example, through administration of increasing doses until a preselected desired response is achieved. It is understood that the specific dose level for any particular animal subject may depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
- the present invention includes the use of inventive nucleic acids, e.g., siRNA or shRNA-containing compositions for treatment of nonhuman animals including, but not limited to, horses, swine, and birds. Accordingly, doses and methods of administration may be selected in accordance with known principles of veterinary pharmacology and medicine. Guidance may be found, for example, in Adams, R. (ed.), Veterinary Pharmacology and Therapeutics, 8 th edition, Iowa State University Press; ISBN: 0813817439; 2001.
- compositions can be included in a container, pack, or dispenser together with instructions for administration.
- Example 1 Design ofsiRNAs to Inhibit Influenza A Virus
- Genomic sequences from a set of influenza virus strains were compared in their positive sense form, and regions of each segment that were most conserved were identified. This group of viruses included viruses derived from bird, swine, horse, and human. To perform the comparison the sequences of individual segments from 12 to 15 strains of influenza A virus from different animal (nonnhuman) species isolated in different years and from 12 to 15 strains from humans isolated in different years were aligned. The strains were selected to encompass a wide variety of HA and NA subtypes. Regions that differed either by 0, 1 , or 2 nucleotides among the different strains were selected. For example, the following strains were used for selection of siRNAs that target the NP transcript, accession number before each strain name refers to the accession number of the NP sequence and the lengths of the sequence that were compared are indicated by nucleotide number.
- accession number accession number
- strain name accession number
- length of sequence compared year
- subtype accession numbers for the other genome segments differ but may be found readily in databases mentioned above.
- Strains compared were:
- ISDNl 3443 A/Sydney/274/2000 1503 2000 H3N2
- Figure 9 shows an example of the selection of certain regions of the PA transcript that are highly conserved among six influenza A variants (all of which have a human host of origin), in which regions are considered highly conserved if they differ by either 0, 1, or 2 nucleotides. (Note that the sequences are listed as DNA rather than RNA and therefore contain T rather than U.) The sequence of strain A/Puerto Rico/8/34 (HlNl) was selected as the base sequence, i.e., the sequence with which the other sequences were compared.
- the other members of the set were A/WSN/33 (HlNl), A/Leningrad/I 34/17/57 (H2N2), A/Hong Kong/1/68 (H3N2), A/Hong Kong/481/97 (H5N1), and A/Hong Kong/1073/99 (H9N2).
- the figure presents a multiple sequence alignment produced by the computer program CLUSTAL W (1.4). Nucleotides that differ from the base sequence are shaded.
- Figure 10 shows an example of the selection of certain regions of the PA transcript that are highly conserved among five influenza A variants (all of which have different animal hosts of origin) and also among two strains that have a human host of origin, in which regions are considered highly conserved if they differ by either 0, 1, or 2 nucleotides. (Note that the sequences are listed as DNA rather than RNA and therefore contain T rather than U.) The sequence of strain A/Puerto Rico/8/34 (HlNl) was selected as the base sequence, i.e., the sequence with which the other sequences were compared.
- the other members of the set were A/WSN/33 (HlNl), A/chicken/FPV/Rostock/34 (H7N1), A/turkey/California/189/66 (H9M2), A/Equine/London/1416/73 (H7N7), A/gull/Maryland/704/77 (H13N6), and A/s wine/Hong Kong/9/98 (H9N2). Nucleotides that differ from the base sequence are shaded. [00357] Note that in the sequence comparisons in Figures 9 and 10 many different highly conserved regions can be selected since large portions of the sequence meet the criteria for being highly conserved.
- sequences that have AA at the 5' end provide for a 19 nucleotide core sequence and a 2 nucleotide 3' UU overhang in the complementary (antisense) siRNA strand. Therefore regions that were highly conserved were scanned to identify 21 nucleotide portions that had AA at their 5' end so that the complementary nucleotides, which are present in the antisense strand of the siRNA, are UU. For example, each of the shaded sequences has AA at its 5' end. Note that the UU 3' overhang in the antisense strand of the resulting siRNA molecule may be replaced by TT or dTdT as shown in Table 2.
- Figure 12 shows a sequence comparison between a portion of the 3' region of NP sequences among twelve influenza A virus subtypes or isolates that have either a human or animal host of origin.
- the underlined sequence and the corresponding portions of the sequences below the underlined sequence were used to design siRNA NP- 1496 (see below). These sequences are indicated in Figure 12.
- the base sequence is the sequence of strain A/Puerto Rico/8/34. Shaded letters indicate nucleotides that differ from the base sequence.
- Table IA lists 21 -nucleotide regions that are highly conserved among a set of influenza virus sequences for each of the viral gene segments.
- the sequences in Table IA are listed in 5' to 3' direction according to the sequence present in viral mRNA except that T is used instead of U.
- the numbers indicate the locations of the sequences in the viral genome.
- PB2-117/137 denotes a sequence extending from position 117 to position 137 in segment PB2.
- Many of the sequences meet the additional criterion that they have AA at their 5' end so as to result in a 3' UU overhang in the complementary strand.
- the sequences of the siRNAs were based on the A/PR8/34 (HlNl) strain except for sequence PA-2087/2107 AAGCAATTGAGGAGTGCCTGA (SEQ ID NO: 30), which was based on the A/WSN/33(H1N1) strain. Note that at position 20 five of the six sequences contain a G while the base sequence (accession number NC_002019) contains an A. Thus in this case the sequence of the base sequence was not used for siRNA design.
- the terms PA-2087 and PA-2087(G) are used interchangeably herein.
- nucleotides 3- 21 were selected as the core regions of siRNA sense strand sequences, and a two nt 3' overhang consisting of dTdT was added to each resulting sequence.
- a sequence complementary to nucleotides 1-21 of each sequence was selected as the corresponding antisense strand.
- a 19 nt core region having the sequence TGCTTC AATCCGATG ATTG was selected.
- a two nt 3' overhang consisting of dTdT was added, resulting (after replacement of T by U) in the sequence 5' - UGCUUCAAUCCGAUGAUUGdTdT- 3' (SEQ ID NO: 79), which was the sequence of the siRNA sense strand.
- the sequence of the corresponding antisense siRNA strand sequence is complementary to SEQ ID NO: 22, i.e., CAAUCAUCGGAUUGAAGCAdTdT (SEQ ID NO: 80) where T has been replaced by U except for the 2 nt 3' overhang.
- Table IB lists siRNAs designed based on additional highly conserved regions of influenza virus transcripts.
- the first 19 nt sequences of the sequences indicated as "sense strand" in Table IB are sequences of highly conserved regions.
- the sense strand siRNA sequences are shown with a dTdT overhang at the 3' end, which does not correspond to influenza virus sequences and is an optional feature of the siRNA.
- Corresponding antisense strands are also shown, also incorporating a dTdT overhang at the 3' end as an optional feature.
- Nomenclature is as in Table IB.
- PB2- 4/22 sense indicates an siRNA whose sense strand has the sequence of nucleotides 4-22 of the PB2 transcript.
- PB2-4/22 antisense indicates the complementary antisense strand corresponding to PB2-4/22 sense.
- siRNA that target sites in a transcript that span a splice site, the positions within the unspliced transcript are indicated.
- M- 44-52/741-750 indicates that nucleotides corresponding to 44-52 and 741-750 of the genomic sequences are targeted in the spliced mRNA.
- Shaded areas in Figures 9 and 10 indicate some of the 21 nucleotide regions that meet the criteria for being highly conserved. siRNAs were designed based on these sequences as described above. The actual siRNA sequences that were tested are listed in Table 2.
- PA-6/26 AAGCAGGTACTGATCCAAAAT (SEQ ID NO: 19)
- PA-24/44 AATGGAAGATTTTGTGCGACA (SEQ ID NO : 20 )
- PA-35/55 TTGTGCGACA ⁇ TGCTTCAATC (SEQ ID NO : 21 ) PA-44/64 AATGCTTCAATCCGATGATTG (SEQ ID NO: 22) PA-52/72 AATCCGATGATTGTCGAGCTT (SEQ ID NO: 23) PA-121/141 AACAAATTTGCAGCAATATGC (SEQ ID NO: 24) PA-617/637 AAGAGACAATTGAAGAAAGGT (SEQ ID NO: 25) PA-711/731 TAGAGCCTATGTGGATGGATT (SEQ ID NO:26) PA-739/759 AACGGCTACATTGAGGGCAAG (SEQ ID NO: 27) PA-995/1015 AACCACACGAAAAGGGAATAA (SEQ ID NO: 28) PA-2054/2074 AACCTGGGACCTTTGATCTTG (SEQ ID NO:29) PA-2087/2107 AAGCAATTGAGGAGTGCCTGA (SEQ ID NO : 30 ) PA-2110/2130 A ⁇ TGATCCCTGGGTTTT
- NS-101/121 AAGAACTAGGTGATGCCCCAT (SEQ ID NO: 63; NS-104/124 AACTAGGTGATGCCCCATTCC (SEQ ID NO: 64; NS-128/148 ATCGGCTTCGCCGAGATCAGA (SEQ ID NO: 65; NS-137/157 GCCGAGATCAGAAATCCCTAA (SEQ ID NO: 66; NS-562/582 GGAGTCCTCATCGGAGGACTT (SEQ ID NO: 67; NS-589/609 AATGATAACACAGTTCGAGTC (SEQ ID NO: 68;
- Segment 1 PB2 PB2 - 4 /22 sense GAAAGCAGGUCAAUUAUAUdTdT ( SEQ ID NO : 190 ) PB2-4/22 antisense AUAUAAUUGACCUGCUUUCdTdT (SEQ ID NO: 191) PB2-12/30 sense GUCAAUUAUAUUCAAUAUGdTdT (SEQ ID NO: 192) PB2-12/30 antisense CAUAUUGAAUAUAAUUGACdTdT (SEQ ID NO: 193) PB2-68/86 sense CUCGCACCCGCGAGAUACUdTdT (SEQ ID NO: 194) PB2- 68/86 antisense AGUAUCUCGGGUGCGAGdTdT (SEQ ID NO: 195) PB2- 115/133 sense AUAAUCAAGAAGUACACAUdTdT (SEQ ID NO: 196) PB2-115/133 antisense AUGUGUACUUCUUGAUUAUdTdT (SEQ ID NO: 197)
- PBl - 1124/ 1142 sense AAAUACCUGCAGAAAUGCUdTdT (SEQ ID NO:
- PB1-1618/1636 sense AACAAUAUGAUAAACAAUGdTdT (SEQ ID NO:
- PA-3/21 sense CGAAAGCAGGUACUGAUCCdTdT (SEQ ID NO:
- PA-3/21 antisense GGAUCAGUACCUGCUUUCGdTdT (SEQ ID NO:
- PA-544/562 sense AGGCUAUUCACCAUAAGACdTdT (SEQ ID NO:
- PA-587/605 sense GGGAUUCCUUUCGUCAGUCdTdT (SEQ ID NO:
- PA-1438/1466 sense GCAUCUUGUGCAGCAAUGGdTdT (SEQ ID NO:
- PA-1438/1466 antisense CCAUUGCUGCACAAGAUGCdTdT (SEQ ID NO:
- PA-2175/2193 sense GUUGUGGCAGUGCUACUAUdTdT (SEQ ID NO:
- PA-2175/2193 antisense AUAGUAGCACUGCCACAACdTdT (SEQ ID NO:
- PA-2188/2206 sense UACUAUUUGCUAUCCAUACdTdT (SEQ ID NO:
- PA-2188/2206 antisense GUAUGGAUAGCAAAUAGUAdTdT (SEQ ID NO:
- NP-1505/1523 sense AUUUCUUCGGAGACAAUGCdTdT (SEQ ID NO: 226)
- NP-1521/1539 sense UGCAGAGGAGUACGACAAUdTdT (SEQ ID NO:
- NP-1488/1506 sense GAGTAATGAAGGATCTTATdTdT (SEQ ID NO: 230 )
- Segment 8 NS NS-5/23 sense AAAAGCAGGGUGACAAAGAdTdT (SEQ ID NO:
- NS-543/561 sense GGAUGUCAAAAAUGCAGUUdTdT (SEQ ID NO: 262)
- NS-623/641 sense AGAGAUUCGCUUGGAGAAGdTdT (SEQ ID NO:
- NS-623/641 antisense CUUCUCCAAGCGAAUCUCUdTdT (SEQ ID NO:
- Example 2 siRNAs that Target Viral RNA Polymerase or Nucleoprotein
- siRNAs were designed as described above. In addition to conforming to the selection criteria described in Example 1 , the siRNAs were generally designed in accordance with principles described in Technical Bulletin # 003- Revision B, "siRNA Oligonucleotides for RNAi Applications", available from Dharmacon Research, Inc., Lafayette, CO 80026. Technical Bulletins #003 and #004 from Dharmacon contain a variety of information relevant to siRNA design parameters, synthesis, etc., and are incorporated herein by reference. Sense and antisense sequences that were tested are listed in Table 2.
- siRNAs were synthesized by Dharmacon Research (Lafayette, CO) using 2'ACE protection chemistry. The siRNA strands were deprotected according to the manufacturer's instructions, mixed in equimolar ratios and annealed by heating to 95 0 C and slowly reducing the temperature by 1°C every 30 s until 35°C and I 0 C every min until 5°C.
- siRNA electroporation Log-phase cultures of MDCK cells were trypsinized, washed and resuspended in serum-free RPMI 1640 at 2x10 7 cells per ml. 0.5 ml of cells were placed into a 0.4 cm cuvette and were electroporated using a Gene Pulser apparatus (Bio-Rad) at 400 V, 975 ⁇ F with 2.5 nmol siRNAs. Electroporation efficiencies were approximately 30-40% of viable cells. Electroporated cells were divided into 3 wells of a 6-well plate in DMEM medium containing 10% FCS and incubated at 37°C, 5% CO 2 . [00371] Viral infection.
- the serum- containing medium was washed away and 100 ⁇ l of PR8 or WSN virus at the appropriate multiplicity of infection was inoculated into the wells, each of which contained approximately 10 6 cells.
- 2 ml of infection medium with 4 ⁇ g/ml of trypsin was added to each well and the cells were incubated at 37°C, 5% CO 2 .
- supernatants were harvested from infected cultures and the titer of virus was determined by hemagglutination of chicken erythrocytes (50 ⁇ l, 0.5%, Charles River laboratories, MA).
- siRNA targeted to GFP was used as control.
- GFP-949 siRNA-949.
- Figures 1 IA and 1 IB compare results of experiments in which the ability of individual siRNAs to inhibit replication of influenza virus A strain A/Puerto Rico/8/34 (HlNl) ( Figure 1 IA) or influenza virus A strain A/WSN/33 (HlNl) ( Figure 1 IB) was determined by measuring HA titer. Thus a high HA titer indicates a lack of inhibition while a low HA titer indicates effective inhibition. MDCK cells were infected at an MOI of 0.01.
- Filled circles represent cells that received siRNA PB 1-2257/2277.
- Open circles represent cells that received siRNA PB2-2240/2260.
- Open triangles represent cells that received siRNA PA-2087/2107 (G).
- the X symbol represents cells that received siRNA NP-231/251.
- the + symbol represents cells that received siRNA NP-390/410.
- Closed triangles represent cells that received siRNA NP- 1496/1516. Note that in the graphs certain symbols are sometimes superimposed. For example, in Figure 1 IB the open and closed triangles are superimposed. Tables 3 and 4, which list the numerical values for each point, may be consulted for clarification.
- siRNAs within a viral gene is indicated by the number that follows the name of the gene. As elsewhere herein, the number represents the starting nucleotide of the siRNA in the gene.
- NP- 1496 indicates an siRNA specific for NP, the first nucleotide starting at nucleotide 1496 of the NP sequence. Values shown (fold-inhibition) are calculated by dividing hemagglutinin units from mock transfection by hemagglutinin units from transfection with the indicated siRNA; a value of 1 means no inhibition.
- siRNA NP- 1496 or PA-2087 was used, inhibition was so pronounced that culture supernatants lacked detectable hemagglutinin activity.
- These potent siRNAs target 3 different viral gene segments: PBl and PA, which are involved in the RNA transcriptase complex, and NP which is a single-stranded RNA binding nucleoprotein.
- siRNAs are all positioned relatively close to the 3-prime end of the coding region ( Figure 13).
- Some siRNAs significantly inhibited virus production only at early time points (24 to 36 hours after infection) or only at lower dosage of infection (MOI 0.001), such as PB2-2240, PB1-129, NP-231 and M-37.
- siRNAs target different viral gene segments, and the corresponding sequences are positioned either close to 3-prime end or 5-prime end of the coding region ( Figure 13).
- Tables 5A and 5B present results of the assays. Approximately 45% of the siRNAs had no discernible effect on the virus titer, indicating that they were not effective in interfering with influenza virus production in MDCK cells. In particular, none of the four siRNAs which target the NS gene segment showed any inhibitory effect. [00381] To estimate virus titers more precisely, plaque assays with culture supernatants were performed (at 60 hrs) from culture supernatants obtained from virus- infected cells that had undergone mock transfection or transfection with NP- 1496.
- NP-1496 inhibited virus production about 200-fold.
- a graded amount of NP-1496 was transfected into MDCK cells followed by infection with PR8 virus. Virus titers in the culture supernatants were measured by hemagglutinin assay.
- Fig. 1 ID As the amount of siRNA decreased, virus titer increased in the culture supernatants as shown in Fig. 1 ID. However, even when as little as 25 pmol of siRNA was used for transfection, approximately 4-fold inhibition of virus production was detected as compared to mock transfection, indicating the potency of NP- 1496 siRNA in inhibiting influenza virus production.
- siRNA For therapy, it is desirable for siRNA to be able to effectively inhibit an existing virus infection.
- new virions are released beginning at about 4 hours after infection.
- MDCK cells were infected with PR8 virus for 2 hours and then transfected with NP- 1496 siRNA.
- virus titer increased steadily over time following mock transfection, whereas virus titer increased only slightly in NP- 1496 transfected cells.
- administration of siRNA after virus infection is effective.
- siRNAs can potently inhibit influenza virus production;
- influenza virus production can be inhibited by siRNAs specific for different viral genes, including those encoding NP, PA, and PBl proteins; and
- siRNA inhibition occurs in cells that were infected previously in addition to cells infected simultaneously with or following administration of siRNAs.
- NP-231 8 2 Table 5B. Effects of siRNAs on influenza virus production in MDCK cells
- Example 3 siRNAs that Target Viral RNA Polymerase or Nucleoprotein Inhibit Influenza A Virus Production in Chicken Embryos.
- Materials and Methods SiRNA-oligofectamine complex formation and chicken embryo inoculation. SiRNAs were prepared as described above. Chicken eggs were maintained under standard conditions. 30 ⁇ l of Oligofectamine (product number: 12252011 from Life Technologies, now Invitrogen) was mixed with 30 ⁇ l of Opti-MEM I (Gibco) and incubated at RT for 5 min.
- siRNAs specific for influenza virus showed results consistent with those observed in MDCK cells: The same siRNAs (NP-1496, PA2087 and PBl- 2257) that inhibited influenza virus production in MDCK cells also inhibited virus production in chicken eggs, whereas the siRNAs (NP-231, M-37 and PB 1-129) that were less effective in MDCK cells were ineffective in fertilized chicken eggs. Thus, siRNAs are also effective in interfering with influenza virus production in fertilized chicken eggs.
- Example 4 SiRNA inhibits influenza Virus Production at the mRNA Level
- RT Reverse transcription
- NP vRNA, NP-367 5'-CTCGTCGCTTATGAC AA AGA AG-3' (SEQ ID NO:
- NP cRNA, NP-1565R [00398] 5 '-ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTT-S ' (SEQ ID NO:
- NS vRNA, NS-527 5'-CAGGACATACTGATGAGGATG-S' (SEQ ID NO:
- NS cRNA, NS-890R [00401] 5'-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-S' (SEQ ID NO:
- RT reaction mixture i.e., the sample obtained by performing reverse transcription
- sequence-specific primers were used for real-time PCR using SYBR
- PCR primers were as follows. [00404] For NP RNAs: [00405] NP-367: 5'-CTCGTCGCTTATGACAAAGAAG-S' (SEQ ID NO: 117). [00406] NP-460R: 5'-AGATCATCATGTGAGTCAGAC-S' (SEQ ID NO: 118). [00407] For NS RNAs:
- NS-527 5'-CAGGACATACTGATGAGGATG-S' (SEQ ID NO: 119).
- NS-617R 5'-GTTTCAGAGACTCGAACTGTG-S' (SEQ ID NO: 120).
- Results [00411] As described above, during replication of influenza virus, vRNA is transcribed to produce cRNA, which serves as a template for more vRNA synthesis, and mRNA, which serves as a template for protein synthesis (1).
- RNAi is known to target the degradation of mRNA in a sequence-specific manner (16-18), there is a possibility that vRNA and cRNA are also targets for siRNA since vRNA of influenza A virus is sensitive to nuclease (1).
- reverse transcription using sequence-specific primers followed by real time PCR was used to quantify the levels of vRNA, cRNA and mRNA.
- Figure 16 shows the relationship between influenza virus vRNA, mRNA, and cRNA.
- cRNA is the exact complement of vRNA, but mRNA contains a cap structure at the 5' end plus the additional 10 to 13 nucleotides derived from host cell mRNA, and mRNA contains a polyA sequence at the 3' end, beginning at a site complementary to a site 15 - 22 nucleotides downstream from the 5' end of the vRNA segment. Thus compared to vRNA and cRNA, mRNA lacks 15 to 22 nucleotides at the 3' end.
- primers specific for vRNA, cRNA and mRNA were used in the first reverse transcription reaction ( Figure 16B). For mRNA, poly dTl 8 was used as primer.
- RNA was isolated early after infection. Briefly, NP- 1496 was electroporated into MDCK cells. A mock electroporation (no siRNA) was also performed).
- Figure 17 shows amounts of viral NP and NS RNA species at various times following infection with vims, in cells that were mock transfected or transfected with siRNA NP- 1496 approximately 6-8 hours prior to infection.
- 1 hour after infection there was no significant difference in the amount of NP mRNA between samples with or without NP siRNA transfection.
- NP mRNA increased by 38 fold in the mock transfection group, whereas the levels of NP mRNA did not increase (or even slightly decreased) in cells transfected with siRNA.
- mRNA transcript levels continued to increase in the mock transfection whereas a continuous decrease in the amount of NP mRNA was observed in the cells that received siRNA treatment.
- NP vRNA and cRNA displayed a similar pattern except that the increase in the amount of vRNA and cRNA in the mock transfection was significant only at 3 hrs post-infection. While not wishing to be bound by any theory, this is probably due to the life cycle of the influenza virus, in which an initial round of mRNA transcription occurs before cRNA and further vRNA synthesis. [00414] These results indicate that, consistent with the results of measuring intact, live virus by hemagglutinin assay or plaque assay, the amounts of all NP RNA species were also significantly reduced by the treatment with NP siRNA.
- SiRNA preparation of unmodified siRNAs was performed as described above. Modified RNA oligonucleotides, in which the 2'-hydroxyl group was substituted with a 2'-O-methyl group at every nucleotide residue of either the sense or antisense strand, or both, were also synthesized by Dharmacon. Modified oligonucleotides were deprotected and annealed to the complementary strand.as described for unmodified oligonucleotides. siRNA duplexes were analyzed for completion of duplex formation by gel electrophoresis.
- RNA extraction, reverse transcription and real time PCR were performed essentially as described above.
- M vRNA 5'- CGCTCAGACATGAGAACAGAATGG - 3' (SEQ ID NO: 161)
- M cRNA 5 ' - ATATCGTCTCGTATTAGTAGAAAC AAGGTAGTTTTT-3 ' (SEQ ID NO: 162).
- PCR primers for M RNAs were as follows: [00424] M forward: 5'- CGCTCAGACATGAGAACAGAATGG - 3' (SEQ ID NO: 163)
- NP- 1496 siRNAs in which either the sense (S or +) or antisense (AS or -) strand was modified were synthesized.
- the modification which substitutes a 2'-O-methyl group for the 2'-hydroxyl group in every nucleotide residue, does not affect base-pairing for duplex formation, but the modified RNA strand no longer supports RNA interference.
- an siRNA in which the sense strand is modified but the antisense strand is wild type (mS:wtAS) will support degradation of RNAs having a sequence complementary to the antisense strand but not a sequence complementary to the sense strand.
- an siRNA in which the sense strand is wild type but the antisense strand is modified will support degradation of RNAs having a sequence complementary to the sense strand but will not support degradation of RNAs having a sequence complementary to the sense strand.
- MDCK cells were either mock transfected or transfected with NP- 1496 siRNAs in which either the sense strand (mS:wtAS) or the antisense strand (wtS:mAS), , was modified while the other strand was wild type. Cells were also transfected with NP- 1496 siRNA in which both strands were modified (mS:mAS).
- RNA interference is either niRNA (+) or cRNA (+) or both.
- siRNA-transfected MDCK cells were harvested for RNA isolation 1 , 2, and 3 hours after infection (before the release and re-infection of new virions).
- the viral mRNA, vRNA, and cRNA were first independently converted to cDNA by reverse transcription using specific primers. Then, the level of each cDNA was quantified by real time PCR. As shown in Figure 18B, when M-specific siRNA M-37 was used, little M-specific mRNA was detected one or two hours after infection.
- M-specific mRNA was readily detected in the absence of M-37.
- the level of M-specific mRNA was reduced by approximately 50%.
- the levels of M-specific vRNA and cRNA were not inhibited by the presence of M-37. While not wishing to be bound by any theory, these results indicate that viral mRNA is probably the target of siRNA- mediated interference.
- Example 6 Effects of Certain siRNAs on Viral RNA Accumulation
- RNA extraction, reverse transcription and real time PCR were performed as described in Example 3.
- Primers specific for either mRNA, NP vRNA, NP cRNA, NS vRNA, NS cRNA, M vRNA, or M cRNA were as described in Examples 4 and 5.
- PBl vRNA 5'-GTGCAGAAATCAGCCCGAATGGTTC-S' (SEQ ID NO:
- PBl cRNA 5'-ATATCGTCTCGTATTAGTAGAAACAAGGCATTT-3'
- PB2 cRNA 5'-ATATGGTCTCGTATTAGTAGAAACAAGGTCGTTT-S' (SEQ ID NO: 168)
- PA vRNA 5'-GCTTCTTATCGTTCAGGCTCTTAGG-S' (SEQ ID NO: 169)
- PA cRNA 5'-ATATCGTCTCGTATTAGTAGAAACAAGGTACTT-S' (SEQ ID NO: 170)
- PCR primers for PB 1 , PB2, and PA RNAs were as follows :
- PB2 forward 5'-GCGAAAGGAGAGAAGGCTAATGTG-S' (SEQ ID NO:
- PA forward 5'-GCTTCTTATCGTTCAGGCTCTTAGG-S' (SEQ ID NO: 175)
- RNAs are coordinately regulated, at least with respect to NP RNAs.
- coordinately regulated is meant that levels of one transcript affect levels of another transcript, either directly or indirectly. No particular mechanism is implied. When NP transcripts are degraded by siRNA treatment the levels of other viral RNAs are also reduced.
- NP-specific mRNA was low one or two hours after infection. Three hours after infection, NP mRNA was readily detected in the absence of NP-1496, whereas in the presence of NP-1496, the level of NP mRNA remained at the background level, indicating that siRNA inhibited the accumulation of specific mRNA. As shown in Figure 19A (middle and bottom panels) levels of NP-specific and NS-specific vRNA and cRNA were greatly inhibited by the presence of NP-1496.
- top, middle, and bottom panels on the right side in Figures 19E, 19F, and 19G present results of the same experiment performed with PA-2087 siRNA at the same concentration.
- Figure 19E right upper, middle, and lower panels respectively, at three hours after infection PA, M, and NS mRNA were readily detected in the absence of PA-2087, whereas the presence of PA-2087 inhibited transcription of PA, M, and NS mRNA.
- Figure 19F right upper, middle, and lower panels respectively, at three hours after infection PA, M, and NS vRNA were readily detected in the absence of PA-2087, whereas the presence of PA-2087 inhibited accumulation of PA, M, and NS vRNA.
- FIG. 19G right upper, middle, and lower panels respectively, at three hours after infection PA, M, and NS cRNA were readily detected in the absence of PA-2087, whereas the presence of PA-2087 inhibited accumulation of PA, M, and NS cRNA.
- Figure 19H shows that NP-specific siRNA inhibits the accumulation of PBl- (top panel), PB2- (middle panel) and PA- (lower panel) specific mRNA.
- the inventors suggest that the broad effect of NP siRNA is probably a result of the importance of NP in binding and stabilizing vRNA and cRNA, and not because NP-specific siRNA targets RNA degradation non-specifically.
- the NP gene segment in influenza virus encodes a single- stranded RNA-binding nucleoprotein, which can bind to both vRNA and cRNA (see Figure 15).
- NP mRNA is first transcribed and translated.
- the primary function of the NP protein is to encapsidate the virus genome for the purpose of RNA transcription, replication and packaging.
- the full- length synthesis of both vRNA and cRNA is strongly impaired.
- NP siRNA induces the degradation of NP RNA, NP protein synthesis is impaired and the resulting lack of sufficient NP protein subsequently affects the replication of other viral gene segments. In this way, NP siRNA could potently inhibit virus production at a very early stage.
- NP protein The number of NP protein molecules in infected cells has been hypothesized to regulate the levels of mRNA synthesis versus genome RNA (vRNA and cRNA) replication (1).
- vRNA and cRNA genome RNA
- cRNA mRNA synthesis versus genome RNA
- NP protein was shown to be required for elongation and antitermination of the nascent cRNA and vRNA transcripts (71, 72).
- the results presented above show that NP-specific siRNA inhibited the accumulation of all viral RNAs in infected cells.
- NP-specific siRNA While not wishing to be bound by any theory, it appears probable that in the presence of NP-specific siRNA, the newly transcribed NP mRNA is degraded, resulting in the inhibition of NP protein synthesis following virus infection. Without newly synthesized NP, further viral transcription and replication, and therefore new virion production is inhibited.
- Example 7 Broad Inhibition of Influenza Virus RNA Accumulation by Certain siRNAs is Not Due to the Interferon Response or to Virus-induced RNA Degradation.
- RNA levels were measured using PCR under standard conditions. The following PCR primers were used for measurement of ⁇ -actin RNA.
- Example 6 One possible cause for the broad inhibition of viral RNA accumulation described in Example 6 is an interferon response of the infected cells in the presence of siRNA (23, 65, 66).
- siRNA 23, 65, 66
- the above experiments were repeated in Vero cells in which the entire IFN locus, including all ⁇ , ⁇ , and ⁇ genes, are deleted (67, 68) (Q. G. and J.C. unpublished data).
- the accumulation of NP-, M-, and NS-specific mRNAs were all inhibited by NP- 1496 (Fig. 19D).
- the effect of siRNA on the levels of transcripts from cellular genes, including ⁇ -actin, ⁇ -actin, and GAPDH was assayed using PCR.
- Example 8 Systematic Identification of siRNAs With Superior Ability to Inhibit Influenza Virus Production Either Alone or in Combination
- a high throughput screen (Example 18) was conducted to identify siRNAs with superior ability to inhibit influenza virus production.
- the siRNAs were tested individually in cell culture, and a number were further tested in mice. Certain combinations were also tested and demonstrated an additive effect. Systematic testing of additional combinations is performed to identify combinations with synergistic (i.e., greater than additive) effects.
- the siRNAs and other RNAi-inducing entitities comprising the same antisense strands are further tested against additional influenza virus strains, including major human and avian pathogens.
- Example 9 Evaluation of Non-viral Delivery Agents that Facilitate Cellular Uptake of siRNA.
- a variety of non-viral delivery agents were tested for their ability to enhance cellular uptake of siRNA. Subsequent examples provide data showing positive results (e.g., inhibition of influenza virus production) with a number of the polymers in both cell culture and in animals. Additional delivery agents are tested using similar approaches.
- Example 10 Testing of Compositions Containing RNAi-Inducing Agents in Mice
- Dry particles comprising an RNAi-inducing agent targeted to an influenza virus transcript are prepared as described (58).
- water-soluble excipients i.e. lactose, albumin, etc.
- therapeutics were dissolved in distilled water.
- the solution was fed to a Niro Atomizer Portable Spray Dryer (Niro, Inc., Colombus, MD) to produce the dry powders, which have a mean geometric diameters ranged between 3 and 15 ⁇ m and tap density between 0.04 and 0.6 g/cm 3 .
- the dry powders are administered to the respiratory system of mice by inhalation or intratracheal administration. Inhalational delivery of a dry powder aerosol is accomplished by forced ventilation on anesthetized mice.
- a solution containing therapeutics is injected via a tube into the lungs of anesthetized mice (54).
- liquid aerosols are produced by a nebulizer into a sealed plastic cage, where the mice are placed (52).
- Insufflators such as those available from Perm Century (URLwww.penncentury.com), e.g., Model IA-IC may be used for pulmonary delivery of dry powders to small animals.
- Example 11 Inhibition of Influenza Virus Infection by siRNAs Transcribed from Templates Provided by DNA Vectors orLentiviruses
- Figures 20A-20C show vectors that were used for previous studies (27, 59), results of which are shown in Figure 2OD and further described in U.S. Ser. No. 10/674,159.
- Figures 21A - 21C show additional constructs that can be used to test the efficacy of hairpin precursors that include precursors for multiple different siRNAs.
- Example 12 Inhibition of Influenza Virus Production in Mice by siRNAs
- This example describes experiments showing that administration of siRNAs targeted to influenza virus NP or PA transcripts inhibit production of influenza virus in mice when administered either prior to or following infection with influenza virus. The inhibition is dose-dependent and shows additive effects when two siRNAs each targeted to a transcript expressed from a different influenza virus gene were administered together.
- mice were injected into mice intravenously, into the retro-orbital vein, 200 ⁇ l per mouse, 4 mice per group. 200 ⁇ l 5% glucose was injected into control (no treatment) mice. The mice were anesthetized with 2.5% Avertin before siRNA injection or intranasal infection.
- Viral infection B6 mice (maintained under standard laboratory conditions) were intranasally infected with PR8 virus by dropping virus-containing buffer into the mouse's nose with a pipette, 30 ul (12,000 pfu) per mouse.
- the virus titers were determined by interpolation of the dilution end point that infected 50% of wells by the method of Reed and Muench (TCID 50 ), thus a lower TCID 50 reflects a lower virus titer.
- the data from any two groups were compared by Student t test, which was used throughout the experiments described herein to evaluate significance.
- Figure 22A shows results of an experiment demonstrating that siRNA targeted to viral NP transcripts inhibits influenza virus production in mice when administered prior to infection.
- 30 or 60 ⁇ g of GFP-949 or NP-1496 siRNAs were incubated with jetPEI and injected intravenously into mice as described above in Materials and Methods. Three hours later mice were intranasally infected with PR8 virus, 12000 pfu per mouse. Lungs were harvested 24 hours after infection.
- the average log ⁇ TCIDso of the lung homogenate for mice that received no siRNA treatment (NT; filled squares) or received an siRNA targeted to GFP (GFP 60 ⁇ g; open squares) was 4.2.
- Figure 22B shows results of another experiment demonstrating that siRNA targeted to viral NP transcripts inhibits influenza virus production in mice when administered intravenously prior to infection in a composition containing the cationic polymer PLL.
- 30 or 60 ⁇ g of GFP-949 or NP-1496 siRNAs were incubated with PLL and injected intravenously into mice as described above in Materials and Methods. Three hours later mice were intranasally infected with PR8 virus, 12000 pfu per mouse. Lungs were harvested 24 hours after infection.
- the average 1Og 1 OTCID 50 of the lung homogenate for mice that received no siRNA treatment (NT; filled squares) or received an siRNA targeted to GFP (GFP 60 ⁇ g; open squares) was 4.1.
- mice that were pretreated with 60 ⁇ g siRNA targeted to NP NP 60 ⁇ g; filled circles
- PLL the average logioTCID 50 of the lung homogenate was 3.0.
- siRNA targeted to the influenza NP transcript reduced the virus titer in the lung when administered prior to virus infection. They also indicate that a mixtures of an siRNA with a cationic polymer effectively inhibits influenza virus in the lung when administered by intravenous injection, not requiring techniques such as hydrodynamic transfection. [00479] Table 6A. Inhibition of influenza virus production in mice by siRNA with cationic polymers
- Figure 22C shows results of a third experiment demonstrating that siRNA targeted to viral NP transcripts inhibits influenza virus production in mice when administered prior to infection and demonstrates that the presence of a cationic polymer significantly increases the inhibitory efficacy of siRNA.
- 60 ⁇ g of GFP-949 or NP- 1496 siRNAs were incubated with phosphate buffered saline (PBS) or jetPEI and injected intravenously into mice as described above in Materials and Methods. Three hours later mice were intranasally infected with PR8 virus, 12000 pfu per mouse. Lungs were harvested 24 hours after infection.
- PBS phosphate buffered saline
- the average 1Og 10 TCID 50 of the lung homogenate for mice that received no siRNA treatment was 4.1
- the average logioTCID 50 of the lung homogenate for mice that received an siRNA targeted to GFP in PBS was 4.4
- the average log 10 TCID 50 of the lung homogenate was 4.2, showing only a modest increase in efficacy relative to no treatment or treatment with an siRNA targeted to GFP.
- mice that were pretreated with 60 ⁇ g siRNA targeted to GFP in jetPEI (GFP PEI; open circles)
- the average logi 0 TCID 50 of the lung homogenate was 4.2.
- mice that received 60 ⁇ g siRNA targeted to NP in jetPEI NP PEI; closed circles
- the average 1Og I0 TCID 50 of the lung homogenate was 3.2.
- siRNA was administered as described above except that 120 ug siRNA was administered 12 hours before virus infection.
- Table 6C shows the results expresesed as 1Og 10 TCID 5 O. The P value comparing NP -treated with control group was 0.049 Table 6C
- siRNA 60 ug was administered 3 hours before infection. 1500 pfu of PR8 virus was administered intranasally. The infected lung was harvested 48h after infection. Table 6D shows the results expressed as logioTCIDso. The P value comparing NP -treated with control group was 0.03. Table 6D
- siRNA 120 ug was administered 24 hours after PR8 (1500 pfu) infection. 52 hours post-infection, the lung was harvested and virus titer was measured. Table 6D shows the results expressed as logioTCID 50 . The P value comparing NP -treated with control group was 0.03. Table 6E
- FIG 22D is a plot showing that siRNA targeted to NP (NP- 1496) inhibits influenza virus production in mice when administered intravenously together with a poly(beta amino ester) (J28).
- Figure 22E is a plot showing that siRNA targeted to NP (NP- 1496) inhibits influenza virus production in mice when administered intraperitoneally together with a poly(beta amino ester) (J28 or C32) while a control RNA (GFP) has no significant effect.
- the experiments were performed essentially as described above except that the ratio of polymer to siRNA was a weight/weight ratio (for instance, 60:1 w/w).
- Polymers and siRNA were mixed and administered to mice either intravenously or intraperitoneally 3 hours prior to intranasal infection with 12,000 pfu of PR8 virus. Lungs were harvested 24 hours later and HA assays were performed. The amine and bis(acrylate ester) monomers present in J28 and C32 are described and depicted in U.S. S.N. 10/446,444. The polymers were a kind gift of Dr. Robert Langer.
- Figure 23 shows results of an experiment demonstrating that siRNAs targeted to different influenza virus transcripts exhibit an additive effect.
- Sixty ⁇ g of NP- 1496 siRNA, 60 ⁇ g PA-2087 siRNA, or 60 ⁇ g NP-1496 siRNA + 60 ⁇ g PA-2087 siRNA were incubated with jetPEI and injected intravenously into mice as described above in Materials and Methods. Three hours later mice were intranasally infected with PR8 virus, 12000 pfu per mouse. Lungs were harvested 24 hours after infection.
- the average logioTCIDso of the lung homogenate for mice that received no siRNA treatment was 4.2.
- mice that received 60 ⁇ g siRNA targeted to NP In mice that received 60 ⁇ g siRNA targeted to NP (NP 60 ⁇ g; open circles), the average logioTCIDso of the lung homogenate was 3.2. In mice that received 60 ⁇ g siRNA targeted to PA (PA 60 ⁇ g; open triangles), the average 1Og 10 TCIDs 0 of the lung homogenate was 3.4. In mice that received 60 ⁇ g siRNA targeted to NP + 60 ⁇ g siRNA targeted to PA (NP + PA; filled circles), the average log 10 TCID 50 of the lung homogenate was 2.4.
- Figure 24 shows results of an experiment demonstrating that siRNA targeted to viral NP transcripts inhibits influenza virus production in mice when administered following infection.
- Mice were intranasally infected with PR8 virus, 500 pfu.
- Sixty ⁇ g of GFP-949 siRNA, 60 ⁇ g PA-2087 siRNA, 60 ⁇ g NP-1496 siRNA, or 60 ⁇ g NP siRNA + 60 ⁇ g PA siRNA were incubated with jetPEI and injected intravenously into mice 5 hours later as described above in Materials and Methods. Lungs were harvested 28 hours after administration of siRNA.
- the average logi 0 TCID 5 o of the lung homogenate for mice that received no siRNA treatment (NT; filled squares) or received the GFP-specific siRNA GFP-949 (GFP; open squares) was 3.0.
- the average 1Og 10 TCID 50 of the lung homogenate was 2.2.
- the average log] 0 TCID 5 o of the lung homogenate was 2.2.
- mice that received 60 ⁇ g NP siRNA + 60 ⁇ g PA siRNA PA + NP; filled circles
- the average logioTCID 5 o of the lung homogenate was 1.8.
- the difference in virus titer in the lung homogenate between the group that received NP siRNA and PA + NP siRNAs had a P value of 0.2.
- Example 13 Inhibition of Influenza Virus Production in Cells by Administration of a Lentivirus that Provides a Template for Production ofshRNA
- Materials and Methods [00493] Cell culture. Vero cells were seeded in 24-well plates at 4x10 5 cells per well in 1 ml of DMEM-10%FCS and were incubated at 37°C under 5% CO 2 .
- oligonucleotide that serves as a template for synthesis of an NP- 1496a shRNA was cloned between the U6 promoter and termination sequence of lentiviral vector pLL3.7 (Rubinson, D., et al, Nature Genetics, Vol. 33, pp. 401-406, 2003), as depicted schematically in Figure 25A.
- the oligonucleotide was inserted between the Hpal and Xhol restriction sites within the multiple cloning site of pLL3.7.
- This lentiviral vector also expresses EGFP for easy monitoring of transfected/infected cells.
- Lentivirus was produced by co-transfecting the DNA vector comprising a template for production of NP-1496a shRNA and packaging vectors into 293T cells. Forty-eight h later, culture supernatant containing lentivirus was collected, spun at 2000 rpm for 7 min at 4°C and then filtered through a 0.45 um filter. Vero cells were seeded at 1 x 10 5 per well in 24- well plates. After overnight culture, culture supernatants containing that contained the insert (either 0.25 ml or 1.0 ml) were added to wells in the presence of 8 ug/ml polybrene. The plates were then centrifuged at 2500 rpm, room temperature for Ih and returned to culture.
- NP-1496a differs from NP-1496 due to the inadvertent inclusion of an additional nucleotide (A) at the 3' end of the sense portion and a complementary nucleotide (U) at the 5' end of the antisense portion, resulting in a duplex portion that is 20 nt in length rather than 19 as in NP-1496. (See Table 2). According to other embodiments of the invention NP-1496 sequences rather than NP- 1496a sequences are used. In addition, the loop portion of NP- 1496a shRNA differs from that of NP- 1496 shRNA shown in Figure 21.
- Lentivirus containing templates for production of NP- 1496a shRNA were tested for ability to inhibit influenza virus production in Vero cells.
- the NP- 1496a shRNA includes two complementary regions capable of forming a stem-loop structure containing a double-stranded portion that has the same sequence as the NP- 1496a siRNA described above.
- Figure 25B incubation of lentivirus-containing supernatants with Vero cells overnight resulted in expression of EGFP, indicating infection of Vero cells by lentivirus.
- the shaded curve represents mean fluorescence intensity in control cells (uninfected).
- virus titers remained very low in supernatants of Vero-NP-1.0 cell cultures, indicating influenza virus production was inhibited in these cells.
- influenza virus production in Vero-NP-0.25 cell cultures was also partially inhibited.
- the viral titers are presented in Table 9. These results suggest that NP-1496 shRNA expressed from lentivirus vectors can be processed into siRNA to inhibit influenza virus production in Vero cells. The extent of inhibition appears to be proportional to the extent of virus infection per cell (indicated by EGFP level).
- Example 14 Inhibition of Influenza Production in Mice by Intranasal
- Oligonucleotides that serve as templates for synthesis of PB 1-2257 shRNA or RSV- specific shRNA were cloned between the U6 promoter and termination sequence of lentiviral vector pLL3.7 as described in Example 13 and depicted schematically in Figure
- NP- 1496a shRNA 25 A for NP- 1496a shRNA.
- sequences of the oligonucleotides were as follows: [00503] NP- 1496a sense:
- NP-1496a antisense 5 '-TCGAGAAAAAAGGATCTTATTTCTTCGGAGATCTCTTGAATCTCCGAAGAAATAA
- RSV antisense 5 '-TCGAGAAAAAACGATAATATAACTGCAAGATCTCTTGAATCTTGCAGTTATATTA TCGCA-3' (SEQ ID NO: 184)
- the RSV sliRNA expressed from the vector comprising the above oligonucleotide is processed in vivo to generate an siRNA having sense and antisense strands with the following sequences: [00510] Sense: 5'-CGATAATATAACTGCAAGA-S' (SEQ ID NO: 185) [00511] Antisense: 5'-TCTTGCAGTTATATTATCG-S' (SEQ ID NO: 186) [00512] A PA-specific hairpin may be similarly constructed using the following oligonucleotides: [00513] PA-2087 sense: 5 '-TGCAATTGAGGAGTGCCTGATTCAAGAGATCAGGCACTCCTCAATTGCTTTTTTC- 3' (SEQ ID NO: 187) [00514] PA-2087 antisense:
- Plasmid DNAs capable of serving as templates for expression of NP-1496a shRNA, PB1-2257 shRNA, or RSV-specific shRNA (60 ⁇ g each) were individually mixed with 40 ⁇ l Infasurf ® (ONY, Inc., Amherst NY) and 20 ⁇ l of 5% glucose and were administered intranasally to groups of mice, 4 mice each group, as described above.
- 40 ⁇ l Infasurf and 20 ⁇ l of 5% glucose was administered to mice in the no treatment (NT) group.
- the mice were intranasally infected with PR8 virus, 12000 pfu per mouse, 13 hours later, as described above.
- RSV virus-specific sliRNA.
- NP- 1496a shRNA plasmid DNA that expresses either NP- 1496a shRNA or PB 1-2257 shRNA.
- the virus titers were more significantly decreased when mice were given both influenza-specific plasmid DNAs together, one expressing NP-1496a shRNA and the other expressing PB1-2257 shRNA.
- the average logioTCIDso of the lung homogenate for mice that received no treatment (NT; open squares) or received a plasmid encoding an RSV-specific shRNA (RSV; filled squares) was 4.0 or 4.1, respectively.
- mice that received plasmid capable of serving as a template for NP-1496a shRNA (NP; open circles) the average logioTCID 5 o of the lung homogenate was 3.4.
- mice that received plasmid capable of serving as a template for PB 1-2257 shRNA (PB; open triangles) the average logioTCIDso of the lung homogenate was 3.8.
- mice that received plasmids capable of serving as templates for NP and PB shRNAs (NP + PBl; filled circles)
- the average logjoTCID 50 of the lung homogenate was 3.2.
- the differences in virus titer in the lung homogenate between the group that received no treatment or RSV-specific shRNA plasmid and the groups that received NP shRNA plasmid, PBl shRNA plasmid, or NP and PBl shRNA plasmids had P values of 0.049, 0.124, and 0.004 respectively.
- Example 15 Cationic Polymers Promote Cellular Uptake ofsiRNA
- Poly-L-lysines of two different average molecular weights [poly-L- lysine (MW (vis) 52,000; MW (LALLS) 41,800, Cat. No. P2636) and poly-L-lysine (MW (vis) 9,400; MW (LALLS) 8,400, Cat. No. P2636], poly-L-arginine (MW 15,000- 70,000 Cat. No. P7762) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma.
- LALLS method molecular weights obtained using the LALLS method will be assumed, but it is to be understood that molecular weights are approximate since the polymers display some heterogeneity in size.
- siRNA-polymer complexes were formed by mixing 10 ⁇ l of siRNA (10 pmol in 10 mM Hepes buffer, pH 7.2) with 10 ⁇ l of polymer solution containing varying amounts of polymer. Complexes were allowed to form for 30 min at room temperature, after which 20 ⁇ l was run on a 4% agarose gel. Bands were visualized with ethidium-bromide staining.
- Cytotoxicity assay siRNA-polymer complexes were formed by mixing equal amounts (50 pmol) of siRNA in 10 mM Hepes buffer, pH 7.2 with polymer solution containing varying amounts of polymer for 30 min at room temperature. Cytotoxicity was evaluated by MTT assay. Cells were seeded in 96-well plates at 30,000 cells per well in 0.2 ml of DMEM containing 10% fatal calf serum (FCS). After overnight incubation at 37 0 C, the medium was removed and replaced with 0.18 ml OPTI-MEM (GIBCO/BRL). siRNA-polymer complexes in 20 ⁇ l of Hepes buffer were added to the cells.
- siRNA-polymer complexes were formed by adding 50 ⁇ l of siRNA (400 pmol (about 700 ng) in 10 mM Hepes buffer, pH 7.2) to 50 ⁇ l of polymer vortexing. Different concentrations of polymer were used in order to achieve complete complex formation between the siRNA and polymer. The mixture was incubated at room temperature for 30 min to complete complex formation. The cell- growth medium was removed and replaced with OPTI-MEM I (Life Technologies) just before the complexes were added.
- siRNA 400 pmol (about 700 ng) in 10 mM Hepes buffer, pH 7.2
- Cell viability was reduced with increasing PLA/siRNA ratios as shown in Figure 28B, but viability remained above 80% at PLA/siRNA ratios as high as 4.5: 1.
- the polymer/siRNA ratio is indicated on the x-axis in Figures 28A and 28B.
- the data plotted in Figures 28A and 28B are presented in Tables 11 and 12.
- Table 12 indicate PLA/siRNA ratio, % survival, and standard deviation as shown. [00532] Table 11. Cytotoxicity of PLL/siRNA complexes (% survival)
- virus titers increased with time in the non-transfected cultures.
- Virus titers were significantly lower in cultures that were transfected with NP-1496/Lipofectamine and were even lower in cultures treated with PLL/NP-1496 complexes.
- the PLL:siRNA ratio is indicated in parentheses.
- virus titers increased with time in the control (mock-transfected) culture and in the culture treated with PLA/siRNA at a 1 : 1 ratio.
- Virus titers were significantly lower in cultures that were transfected with NP-1496/Lipofectamine and were even lower in cultures treated with PLA/siRNA complexes containing complexes at PLA/siRNA ratios of 4:1 or higher. Increasing amounts of polymer resulted in greater reduction in viral titer.
- the data plotted in Figure 29B are presented in Table 13B.
- cationic polymers promote cellular uptake of siRNA and inhibit influenza virus production in a cell line and are more effective than the widely used transfection reagent Lipofectamine. These results also suggest that additional cationic polymers may readily be identified to stimulate cellular uptake of siRNA and describe a method for their identification. PLL and PLA can serve as positive controls for such efforts.
- Example 16 A Inhibition of Luciferase Activity in the Lung by Delivery of siRNA to the Vascular System or the Respiratory Tract [00540] Materials and Methods
- siRNAs were obtained from Dharmacon and were deprotected and annealed as described above. siRNA sequences for NP (NP-1496), PA (PA-2087), PBl (PB 1-2257), and GFP were as given above. Luc-specific siRNA was as described in (McCaffrey, AP, Qt al, Nature, 418:38-39)
- PEI-mediated DNA transfection in mice pCMV-luc DNA (Promega) was mixed with PEI (Qbiogene, Carlsbad, CA) at a nitrogen/phosphorus molar ratio (N/P ratio) of 10 at room temperature for 20 min.
- N/P ratio nitrogen/phosphorus molar ratio
- 200 ⁇ l of the mixture containing 60 ⁇ g of DNA was injected retroorbitally into 8 week old male C57BL/6 mice (Taconic Farms).
- intratracheal (i.t.) adminstration 50 ⁇ l of the mixture containing 30 ⁇ g or 60 ⁇ g of DNA was administered into the lungs of anesthetized mice using a Penn Century Model IA-IC insufflator.
- siRNA-PEI compositions were formed by mixing 60 ⁇ g of luc-specific or GFP-specific siRNA with jetPEI at an N/P ratio of 5 at room temperature for 20 min.
- i.v. administration 200 ⁇ l of the mixture containing the indicated amounts of siRNA was injected retroorbitally.
- pulmonary administration 50 ⁇ l was delivered intratracheally.
- Luc assay At various times after pCMV-luc DNA administration, lungs, spleen, liver, heart, and kidney were harvested and homogenized in Cell Lysis Buffer (Marker Gene Technologies, Eugene, OR). Luminescence was analyzed with the
- mice were first given pCMV-luc DNA-PEI complexes i.t., followed by i.v. injection of Luc-specific siRNA complexed with PEI, control GFP-specific siRNA complexed with PEI, or the same volume of 5% glucose.
- mice were first given pCMVDNA-PEI complexes i.v., followed immediately by i.t. administration of Luc-specific siRNA mixed with PEI, control GFP-specific siRNA mixed with PEI, or the same volume of 5% glucose. Twenty-four hours later, luciferase activities were assayed in lung homogenates.
- Figure 30D shows luciferase activity in lung homogenates from mice given either luciferase- specific or GFP-specific siRNA, normalized to protein amounts.
- Cyclophilin B is an endogenous gene that is widely expressed in mammals.
- outbred Blackswiss mice around 30 g or more body weight
- siRNA targeted to cyclophilin B Dharmacon, D-001136-01-20 siCONTROL Cyclophilin B siRNA (Human/Mouse/Rat) or control GFP-949 siRNA (2 mg/kg) was administered intranasally to groups of 2 mice for each siRNA.
- Lungs were harvested 24 hours after administration. RNA was extracted from the lung and reverse transcription was done using a random primer.
- Example 17 Selection of Favorably conserved Target Portions [00552] To identify favorably conserved regions of various influenza virus A transcripts for use as target portions against which to target RNAi-inducing agents to inhibit expression in a wide variety of strains, genome segments from a set of virus strains isolated from humans were aligned (in their positive sense form, i.e., the sequences found in mRNA). The strains included a number of strains in addition to those listed in Example 1. Tables 15A - 15H list the Genbank accession number (left column), strain name (middle column), and serotype (right column) of the influenza A virus genome segments that were used to identify favorably conserved regions.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Nanotechnology (AREA)
- Optics & Photonics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pulmonology (AREA)
- General Chemical & Material Sciences (AREA)
- Communicable Diseases (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002602182A CA2602182A1 (en) | 2005-03-22 | 2006-03-22 | Influenza therapeutic |
| US11/909,413 US20100204297A1 (en) | 2002-09-28 | 2006-03-22 | Influenza therapeutic |
| JP2008503156A JP2008533990A (en) | 2005-03-22 | 2006-03-22 | Influenza treatment |
| EP06748570A EP1869181A2 (en) | 2005-03-22 | 2006-03-22 | Influenza therapeutic |
| MX2007011665A MX2007011665A (en) | 2005-03-22 | 2006-03-22 | Influenza therapeutic. |
| AU2006226945A AU2006226945A1 (en) | 2005-03-22 | 2006-03-22 | Influenza therapeutic |
| IL186057A IL186057A0 (en) | 2005-03-22 | 2007-09-19 | RNAi-INDUCING AGENT FOR INFLUENZA VACCINE |
| NO20074929A NO20074929L (en) | 2005-03-22 | 2007-09-28 | Influenza therapeutic agent |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US66458005P | 2005-03-22 | 2005-03-22 | |
| US60/664,580 | 2005-03-22 | ||
| US11/102,097 US20060160759A1 (en) | 2002-09-28 | 2005-04-08 | Influenza therapeutic |
| US11/102,097 | 2005-04-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006102461A2 true WO2006102461A2 (en) | 2006-09-28 |
| WO2006102461A3 WO2006102461A3 (en) | 2007-07-26 |
Family
ID=37024600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/010491 Ceased WO2006102461A2 (en) | 2002-09-28 | 2006-03-22 | Influenza therapeutic |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US20060160759A1 (en) |
| EP (1) | EP1869181A2 (en) |
| KR (1) | KR20070119706A (en) |
| AU (1) | AU2006226945A1 (en) |
| CA (1) | CA2602182A1 (en) |
| WO (1) | WO2006102461A2 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008115851A3 (en) * | 2007-03-16 | 2008-11-13 | Mdrna Inc | Rnai therapeutic for respiratory virus infection |
| WO2009005095A1 (en) | 2007-07-03 | 2009-01-08 | Kyorin Pharmaceutical Co., Ltd | Treatment of influenza |
| EP2031060A1 (en) * | 2007-09-03 | 2009-03-04 | Karin Mölling | siDNA against influenza virus |
| JP2010505897A (en) * | 2006-10-11 | 2010-02-25 | マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エー・ファオ | Influenza target |
| EP2146575A4 (en) * | 2007-04-12 | 2010-11-24 | Alnylam Pharmaceuticals Inc | Influenza polynucleotides, expression constructs, compositions, and methods of use |
| EP2160466A4 (en) * | 2007-05-16 | 2011-07-13 | Mat Malta Advanced Technologies Ltd | TREATMENT AND PREVENTION OF FLU |
| WO2014138792A1 (en) * | 2013-03-14 | 2014-09-18 | Commonwealth Scientific And Industrial Research Organisation | Double-stranded rna |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7297786B2 (en) | 2004-07-09 | 2007-11-20 | University Of Iowa Research Foundation | RNA interference in respiratory epitheial cells |
| US20080213891A1 (en) * | 2004-07-21 | 2008-09-04 | Alnylam Pharmaceuticals, Inc. | RNAi Agents Comprising Universal Nucleobases |
| AU2006235364A1 (en) * | 2005-04-08 | 2006-10-19 | Marina Biotech, Inc. | RNAi therapeutic for respiratory virus infection |
| EP1951737A4 (en) * | 2005-11-01 | 2009-07-01 | Alnylam Pharmaceuticals Inc | Rnai inhibition of influenza virus replication |
| WO2007056861A1 (en) * | 2005-11-18 | 2007-05-24 | Protiva Biotherapeutics, Inc. | Sirna silencing of influenza virus gene expression |
| WO2008000023A1 (en) * | 2006-06-26 | 2008-01-03 | Biochip Innovations Pty Ltd | Detection of influenza virus |
| WO2008048984A2 (en) * | 2006-10-18 | 2008-04-24 | St. Jude Children's Research Hospital | Methods and compositions for preparing a universal influenza vaccine |
| US9689031B2 (en) | 2007-07-14 | 2017-06-27 | Ionian Technologies, Inc. | Nicking and extension amplification reaction for the exponential amplification of nucleic acids |
| US20090042823A1 (en) * | 2007-08-10 | 2009-02-12 | Mdrna, Inc. | Uses of broad spectrum rnai therapeutics against influenza |
| WO2009026576A1 (en) * | 2007-08-23 | 2009-02-26 | Keren Pharmaceuticals | Targeting rna with external guide sequences |
| WO2010001325A2 (en) * | 2008-06-30 | 2010-01-07 | Silenseed Ltd | Methods, compositions and systems for local delivery of drugs |
| WO2010083163A1 (en) * | 2009-01-13 | 2010-07-22 | Philadelphia Health And Education Corporation | The role of p110 delta signaling in morbidity and lung pathology induced by influenza virus infection |
| US12371522B2 (en) * | 2011-10-12 | 2025-07-29 | The Johns Hopkins University | Bioreducible poly (beta-amino ester)s for siRNA delivery |
| EP3305920B1 (en) | 2010-07-12 | 2020-02-12 | Gen-Probe Incorporated | Compositions and assays to detect seasonal h3 influenza a virus nucleic acid |
| US9868952B2 (en) | 2012-07-08 | 2018-01-16 | Sirnaomics, Inc. | Compositions and methods for “resistance-proof” SiRNA therapeutics for influenza |
| US10731161B2 (en) * | 2013-03-11 | 2020-08-04 | The Johns Hopkins University | Influenza-activated constructs and methods of use thereof |
| ES2981185T3 (en) * | 2013-03-14 | 2024-10-07 | Translate Bio Inc | Methods for purifying messenger RNA |
| CN106132206B (en) * | 2014-01-23 | 2020-11-13 | 科罗拉多州立大学研究基金会 | Escherichia coli mediated siRNA silencing of avian influenza in chickens |
| JP6571679B2 (en) * | 2014-04-25 | 2019-09-04 | トランスレイト バイオ, インコーポレイテッド | Method for purifying messenger RNA |
| US11141545B2 (en) * | 2016-12-01 | 2021-10-12 | Mark L. Anderson, Llc | Sprayer technology |
| CA3058474A1 (en) | 2017-04-03 | 2018-10-11 | Sivec Biotechnologies, Llc | A transkingdom platform for therapeutic nucleic acid delivery |
| CA3081905C (en) * | 2017-11-13 | 2023-10-03 | Silence Therapeutics Gmbh | Nucleic acids for inhibiting expression of lpa in a cell |
| PH12021550801B1 (en) | 2018-11-13 | 2024-04-26 | Silence Therapeutics Gmbh | Nucleic acids for inhibiting expression of lpa in a cell |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5811533A (en) * | 1990-06-11 | 1998-09-22 | Nexstar Pharmaceuticals, Inc. | High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF) |
| US5580767A (en) * | 1990-08-14 | 1996-12-03 | Isis Pharmaceuticals, Inc. | Inhibition of influenza viruses by antisense oligonucleotides |
| US7344722B1 (en) * | 1993-06-29 | 2008-03-18 | The Regents Of The University Of Michigan | Cold-adapted influenza virus |
| FR2751224B1 (en) * | 1996-07-19 | 1998-11-20 | Rhone Merieux | POLYNUCLEOTIDE VACCINE FORMULA AGAINST BREATHING AND PIG REPRODUCTIVE CONDITIONS |
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| AUPP249298A0 (en) * | 1998-03-20 | 1998-04-23 | Ag-Gene Australia Limited | Synthetic genes and genetic constructs comprising same I |
| US6872395B2 (en) * | 2000-04-14 | 2005-03-29 | Wisconsin Alumni Research Foundation | Viruses comprising mutant ion channel protein |
| EP1292614A2 (en) * | 2000-06-23 | 2003-03-19 | American Cyanamid Company | Nucleotide sequence of influenza a/udorn/72 (h3n2) genome |
| US6998115B2 (en) * | 2000-10-10 | 2006-02-14 | Massachusetts Institute Of Technology | Biodegradable poly(β-amino esters) and uses thereof |
| KR100872437B1 (en) * | 2000-12-01 | 2008-12-05 | 막스-플랑크-게젤샤프트 츄어 푀르더룽 데어 비쎈샤프텐 에.파우. | Small RNA molecules that mediate JR interference |
| US20030099670A1 (en) * | 2001-02-09 | 2003-05-29 | Gert Hobom | Influenza viruses with enhanced transcriptional and replicational capacities |
| US10590418B2 (en) * | 2001-07-23 | 2020-03-17 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| EP1532248B1 (en) * | 2002-07-26 | 2009-04-01 | Novartis Vaccines and Diagnostics, Inc. | Modified small interfering rna molecules and methods of use |
| JP2006512906A (en) * | 2002-09-28 | 2006-04-20 | マサチューセッツ インスティチュート オブ テクノロジー | Influenza treatment |
| EP2000160A3 (en) * | 2002-10-30 | 2009-03-11 | Gambro Lundia AB | Method and apparatuses for determining the efficiency of dialysis |
| JP2006507841A (en) * | 2002-11-14 | 2006-03-09 | ダーマコン, インコーポレイテッド | Functional and ultrafunctional siRNA |
| CA2531069A1 (en) * | 2003-07-03 | 2005-01-27 | The Trustees Of The University Of Pennsylvania | Inhibition of syk kinase expression |
| US7199109B2 (en) * | 2005-06-03 | 2007-04-03 | Cal Poly Pomona Foundation | Potent inhibition of influenza virus by specifically designed short interfering RNA |
-
2005
- 2005-04-08 US US11/102,097 patent/US20060160759A1/en not_active Abandoned
-
2006
- 2006-03-22 US US11/909,413 patent/US20100204297A1/en not_active Abandoned
- 2006-03-22 EP EP06748570A patent/EP1869181A2/en not_active Withdrawn
- 2006-03-22 CA CA002602182A patent/CA2602182A1/en not_active Abandoned
- 2006-03-22 AU AU2006226945A patent/AU2006226945A1/en not_active Withdrawn
- 2006-03-22 KR KR1020077024044A patent/KR20070119706A/en not_active Withdrawn
- 2006-03-22 WO PCT/US2006/010491 patent/WO2006102461A2/en not_active Ceased
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010505897A (en) * | 2006-10-11 | 2010-02-25 | マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エー・ファオ | Influenza target |
| WO2008115851A3 (en) * | 2007-03-16 | 2008-11-13 | Mdrna Inc | Rnai therapeutic for respiratory virus infection |
| EP2146575A4 (en) * | 2007-04-12 | 2010-11-24 | Alnylam Pharmaceuticals Inc | Influenza polynucleotides, expression constructs, compositions, and methods of use |
| EP2160466A4 (en) * | 2007-05-16 | 2011-07-13 | Mat Malta Advanced Technologies Ltd | TREATMENT AND PREVENTION OF FLU |
| EP2527445A3 (en) * | 2007-05-16 | 2013-02-20 | MAT Malta Advanced Technologies Limited | Treatment and prevention of influenza |
| CN101918558B (en) * | 2007-05-16 | 2016-12-07 | Mat马耳他先进技术有限公司 | The treatment of influenza and prevention |
| WO2009005095A1 (en) | 2007-07-03 | 2009-01-08 | Kyorin Pharmaceutical Co., Ltd | Treatment of influenza |
| EP2031060A1 (en) * | 2007-09-03 | 2009-03-04 | Karin Mölling | siDNA against influenza virus |
| WO2014138792A1 (en) * | 2013-03-14 | 2014-09-18 | Commonwealth Scientific And Industrial Research Organisation | Double-stranded rna |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2006226945A1 (en) | 2006-09-28 |
| US20060160759A1 (en) | 2006-07-20 |
| CA2602182A1 (en) | 2006-09-28 |
| EP1869181A2 (en) | 2007-12-26 |
| US20100204297A1 (en) | 2010-08-12 |
| WO2006102461A3 (en) | 2007-07-26 |
| KR20070119706A (en) | 2007-12-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100204297A1 (en) | Influenza therapeutic | |
| AU2003279004B2 (en) | Influenza therapeutic | |
| US20090124567A1 (en) | Influenza Therapeutic | |
| Ge et al. | Use of siRNAs to prevent and treat influenza virus infection | |
| US20100144843A1 (en) | Rnai therapeutic for respiratory virus infection | |
| Thomas et al. | Non-viral siRNA delivery to the lung | |
| US20110112169A1 (en) | RNAi-BASED THERAPEUTICS FOR ALLERGIC RHINITIS AND ASTHMA | |
| JP2008535496A (en) | RNAi therapeutic factor for respiratory virus infection | |
| JP2006512906A5 (en) | ||
| WO2006121464A2 (en) | Compositions for treating respiratory viral infections and their use | |
| CN101180395A (en) | Therapeutic agent for influenza | |
| CN1968959B (en) | SiRNA, shRNA used for restraining influenza, carrier used for coding those, relative composition of matter and application thereof | |
| CN101880677A (en) | siRNA sequence and its application against polymerase gene and nucleoprotein gene of 2009 new influenza A virus | |
| WO2014011512A1 (en) | Compositions and methods for "resistance-proof" sirna therapeutics for influenza | |
| EP2146575A1 (en) | Influenza polynucleotides, expression constructs, compositions, and methods of use | |
| HK1104302B (en) | Short interfering rna, short hairpin rna and coding vectors thereof, related compositions and use thereof used for inhibiting influenza virus infection | |
| WO2025166047A1 (en) | Composition and method for preventing or treating influenza | |
| CN102618541A (en) | Compositions for treating respiratory viral infections and their use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200680017734.4 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 2602182 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 186057 Country of ref document: IL Ref document number: 2006226945 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2008503156 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/011665 Country of ref document: MX Ref document number: 561780 Country of ref document: NZ |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2006226945 Country of ref document: AU Date of ref document: 20060322 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006748570 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4010/KOLNP/2007 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020077024044 Country of ref document: KR |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11909413 Country of ref document: US |
















