WO2006099667A1

WO2006099667A1 - Prophylactic and therapeutic agents and uses therefor

Info

Publication number: WO2006099667A1
Application number: PCT/AU2006/000376
Authority: WO
Inventors: David C.S. Huang; Simon N. Willis; Jerry M. Adams
Original assignee: The Walter And Eliza Hall Institute Of Medical Research
Priority date: 2005-03-21
Filing date: 2006-03-21
Publication date: 2006-09-28

Abstract

The present invention relates generally to the field of cellular therapy. More particularly, the present invention provides agents, which modulate apoptotic processes. The agents of the present invention are useful, inter alia, for inducing apoptosis of cancer cells or for preventing aberrant apoptosis of normal cells.

Description

PROPHYLACTIC AND THERAPEUTIC AGENTS AND

USES THEREFOR

BACKGROUND OF THE INVENTION

FIELD OF THE INVENTION

DESCRIPTION OF THE PRIOR ART

The Bcl-2 family of proteins regulates programmed cell death triggered by developmental cues and in response to multiple stress signals (Cory and Adams, Nature Reviews Cancer 2:647-656, 2002; Adams, Genes and Development 77:2481-2495, 2003; Danial and Korsmeyer, Cell 116:205-219, 2004). Whereas cell survival is promoted by Bcl-2 itself and several close relatives (BCI-XL, Bcl-w, McI-I and Al), which bear three or four conserved Bcl-2 homology (BH) regions, apoptosis is driven by two other sub-families. The initial signal for cell death is conveyed by the diverse group of BH3-only proteins, including Bad, Bid, Bim, Puma and Noxa, which have in common only the small BH3 interaction domain (Huang and Strasser, Cell 103:839-842, 2000). However, Bax or Bak, multi-domain proteins containing BH1-BH3, are required for commitment to cell death (Cheng et al, Molecular Cell 5:705-711, 2001; Wei et al, Science 292:727-730, 2001; Zong et al, Genes and Development 75:1481-1486, 2001). When activated, they can permeabilize the outer membrane of mitochondria and release pro-apoptogenic factors (e.g. cytochrome c) needed to activate the caspases that dismantle the cell (Wang, Genes and Development 75:2922-2933, 2001; Adams, 2003 supra; Green and Kroemer, Science 305:626-629, 2004). Interactions between members of these three factions of the Bcl-2 family dictate whether a cell lives or dies. When BH3-only proteins have been activated, for example, in response to DNA damage, they can bind via their BH3 domain to a groove on their pro-survival relatives (Sattler et al, Science 275:983-986, 1997). How the BH3-only and Bcl-2-like proteins control the activation of Bax and Bak, however, remains poorly understood (Adams, 2003 supra). Most attention has focused on Bax. This soluble monomeric protein (Hsu et al, Journal of Biological Chemistry 272:13289-13834, 1997; Wolter et al, Journal of Cell Biology /39:1281-1292, 1997) normally has its membrane targeting domain inserted into its groove, probably accounting for its cytosolic localization (Nechushtan et al, EMBO Journal 18:2330- 2341, 1999; Suzuki et al, Cell 103:645-654, 2000; Schinzel et al, J Cell Biol 164:1021-1032, 2004). Several unrelated peptides/proteins have been proposed to modulate Bax activity reviewed in (Lucken-Ardjomande and Martinou, J Cell Sci 118:473-483, 2005), but their physiological relevance remains to be established. Alternatively, Bax may be activated via direct engagement by certain BH3-only proteins (Lucken-Ardjomande and Martinou 2005 supra), the best documented being a truncated form of Bid, tBid (Wei et al, Genes and Development 14:2060-2071, 2000; Kuwana et al, Cell 111:331-342, 2002; Roucou et al, Biochemical Journal 368:915-921, 2002; Cartron et al, MoI Cell 75:807-818, 2004). As discussed elsewhere (Adams 2003 supra), the oldest model, in which Bcl-2 directly engages Bax (Oltvai et al, Cell 74:609-619, 1993), has become problematic because Bcl-2 is membrane bound while Bax is cytosolic, and their interaction seems highly dependent on the detergents used for cell lysis (Hsu and Youle, 1997 supra). Nevertheless, it is well established that the BH3 region of Bax can mediate association with Bcl-2 (Zha and Reed, Journal of Biological Chemistry 272:31282-31488, 1997; Wang et al, Molecular and Cellular Biology 75:6083-6089, 1998) and that Bcl-2 prevents the oligomerization of Bax, even though no heterodimers can be detected (Mikhailov et al, Journal of Biological Chemistry 276:18361- 18374, 2001). Thus, whether the pro-survival proteins restrain Bax activation directly or indirectly remains uncertain.

Although Bax and Bak seem in most circumstances to be functionally equivalent (Lindsten et al, Molecular Cell (5:1389-1399, 2000; Wei et al, 2001 supra), substantial differences in their regulation would be expected from their distinct localization in healthy cells. Unlike Bax, which is largely cytosolic, Bak resides in complexes on the outer membrane of mitochondria and on the endoplasmic reticulum of healthy cells (Wei et al, 2000 supra; Zong et al, Journal of Cell Biology 162:59-69, 2003). Nevertheless, on receipt of cytotoxic signals, both Bax and Bak change conformation, and Bax translocates to the organellar membranes, where both Bax and Bak then form homo-oligomers that can associate, leading to membrane permeabilization (Hsu et al, Proceedings of the National Academy of Sciences of the United States of America 94:3668-3672, 1997; Wolter et al, 1997 supra; Antonsson et al, Journal of Biological Chemistry 276:11615-11623, 2001; Nechushtan et al, Journal of Cell Biology 153:1265-1276, 2001; Wei et al, 2001 supra; Mikhailov et al, Journal of Biological Chemistry 278:5367- 5376, 2003).

In accordance with the present invention, it is shown that stress stimuli drive BH3-only proteins to displace Bak from McI-I and BCI-X_L, allowing Bak to self-associate and trigger apoptosis. Furthermore, the association of Noxa with McI-I triggers Mcl-1 degradation. The demonstration that a subset of pro-survival family members controls pro-apoptotic proteins such as Bak and Bax has important implications for current efforts to develop drugs that regulate apoptosis by targeting the Bcl-2 family.

- A -

SUMMARY OF THE INVENTION

Since overexpression of pro-survival Bcl-2 proteins impairs apoptosis in malignant cells, it is proposed herein that drugs mimicking their BH3-only antagonists will overcome chemoresistance. However, many cell types proved refactory to the BH3 mimetic ABT- 737 (which requires Bax or Bak for apoptosis) (Oltersdorf et al, Nature 435:677-681, 2005), available from Abbott Pharmaceuticals, Chicago, USA, despite its high affinity for Bcl-2, BCI-X_L and Bcl-w. In accordance with the present invention, the limited action of agents such as ABT-737 is proposed to be its inability to target McI-I, which must be neutralized for efficient killing. Indeed, even when Bcl-2 was over-expressed, ABT-737 killed diverse cells if McI-I was targeted by the BH3-only protein Noxa or down-regulated in any of multiple ways. Hence, ABT-737 is proposed to be efficacious in inducing apoptosis in tumors with low McI-I, or when combined with agents inactivating McI-I or reducing its level, even if Bcl-2 is over-expressed.

Targeting pro-survival Bcl-2 like proteins for cancer therapy is attractive because their over-activity promotes tumor formation and often limits their response to cytotoxic agents. Unlike most other BH3 mimetics tested, ABT-737 acts specifically to induce apoptosis. Because it only targets selective pro-survival proteins, the efficacy of ABT-737 as a single agent is restricted to tumors where McI-I is low, but these may acquire resistance to ABT- 737 by up-regulating McI-I. Thus, ABT-737 should prove to be most efficacious when combined with approaches that down-regulate, reduce, destabilize or inactivate McI-I (including promoting its degradation) and/or other pro-survival proteins such as BCI-XL. The present invention provides a rational basis for testing highly promising compounds in the clinic and a benchmark for systematically evaluating BH3 mimetic compounds (such as ABT-737) which represent a promising class of novel anti-cancer agents.

Commitment of cells to apoptosis is governed largely by the interaction between members of the Bcl-2 protein family. Its three sub-families have distinct roles: BH3-only proteins trigger apoptosis by binding via their BH3 domain to pro-survival relatives, while the pro- apoptotic Bax and Bak have an essential downstream role involving permeabilization of organellar membranes and induction of caspase activation. In accordance with the present invention, it is determined that in healthy cells, Bak associates with McI-I and BCI-XL but not Bcl-2, Bcl-w or Al. These interactions require the Bak BH3 domain, which is also necessary for Bak dimerization and killing activity. When cytotoxic signals activate BH3- only proteins that can engage both McI-I and BCI-XL (such as Noxa plus Bad), Bak is displaced and induces cell death. Accordingly, the BH3-only protein Noxa could bind to McI-I, displace Bak and promote McI-I degradation, but Bak-mediated cell death also required neutralization of BCI-XL by other BH3-only proteins. The results indicate that Bak is held in check solely by McI-I and BCI-XL and induces apoptosis only if freed from both. The finding that different pro-survival proteins have selective roles has notable implications for the design of anti-cancer drugs that target the Bcl-2 family.

Accordingly, one aspect of the present invention provides an agent which modulates apoptosis through a pathway regulated by the Bcl-2 family, the apoptotic activity of said Bcl-2 member being controlled by association with one or more pro-survivial members of the Bcl-2 family of proteins said agent selected from the list consisting of:

(i) an agent which upregulates or down-regulates expression of a gene encoding said pro-apoptotic Bcl-2 family member;

(ii) an agent which upregulates or down-regulates the level or activity of said pro- apoptotic Bcl-2 family member;

(iii) an agent which upregulates, down-regulates or reduces expression of a gene encoding one or more of said pro-survival Bcl-2 family members; and

(iv) an agent which upregulates, down-regulates or reduces the level or activity of said one or more pro-survivial Bcl-2 family members.

In a particular aspect of the present invention, the pro-apoptotic member is Bak or Bax and the pro-survivial agent is McI-I and/or BCI-X_L. In another particular aspect, the agents induce apoptosis by preventing association of McI-I and/or BCI-XL to a pro-apoptotic agent such as but not limited to Bak.

In a further particular aspect, Noxa associates with McI-I and promotes McI-I degradation. Consequently, modulating the levels of Noxa is another way of controlling McI-I levels to regulate apoptosis.

In a particular embodiment a combination of agents is provided where at least one agent selectively inhibits pro-survival McI-I or reduces levels thereof and at least one other agent selectively inhibits BCI-X_L or reduces levels thereof. The term "reduces levels of incldues promoting its degradation.

In another embodiment, a cancer tissue is screened for levels of McI-I and/or BCI-XL and subjects with low levels of McI-I in the cancer are proposed to be eligible for treatment with compounds such as ABT-737.

Although the present invention is particularly useful for inducing apoptosis of cancers, it also enables the development of agents, which limit or prevent apoptosis such as in a cellular degenerative or necrotic diseases.

In another embodiment, the present invention also provides for methods of identifying agents useful for modulating Bak- or Bax-mediated apoptosis. These methods of identification comprise screening libraries of natural products, chemically synthesized compounds, as well as combinatorial libraries, phage display libraries and in vitro translation-based libraries.

The present invention also facilitates the development of diagnostic and/or prognostic assays and reagents to identify mechanisms of drug resistance that may increase McI-I and/or BCI-XL activity, or suppress Bak or Bax activity. The present invention also facilitates the development of diagnostic and/or prognostic assays and reagents useful for identifying the presence of an aberrant McI-I and/or BCI-XL , which is incapable of binding Bak or Bax.

The present invention provides, therefore, a method of diagnosing and/or prognosing a risk of a necrotic disease condition from developing or for natural apoptosis not occurring in cancer cells.

The present invention also facilitates the development of a medical assessment system in the form of an animal model of apoptosis characterized by Bak- or Bax-mediated apoptosis.

TABLE 1 : SUMMARY OF SEQUENCE IDENTIFIER

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a graphical representation showing UV-irradiation promotes McI-I degradation to trigger Bak activation. (A) Proteasome inhibition prevents McI-I degradation after UV- irradiation. Lysates prepared from untreated or UV-irradiated (200 J/m²) HeLa cells were resolved by SDS:PAGE and the resulting blot probed with the indicated antibodies. The rapid McI-I degradation and caspase-3 cleavage after UV-irradiation was blocked in cells pre- treated with the proteasome inhibitor MG-132 (right panels). (B) Abrogation of UV-induced Bak activation by proteasome inhibition. Bak activation detected by flow cytometric analysis of untreated or UV-irradiated HeLa cells stained with an antibody (Ab-I) that specifically recognizes activated Bak (Griffiths et άl, Journal of Cell Biology 144:903-914, 1999). Some cells were pre-treated with the proteasome inhibitor MG-132 (middle panels) or the broad- spectrum caspase inhibitor zVAD.fmk (bottom panels). Controls (dotted histograms) represent cells stained with the secondary antibody alone.

Figure 2 is a graphical representation showing UV-irradiation kills MEFs predominantly by a Bak-, not Bax-, dependent mechanism. (A) Expression of Bax or Bak in MEFs. Immunoblot analysis of lysates prepared from immortalized wild-type (wt) MEFs, ones lacking Bax and Bak (DKO) or DKO sub-clones reconstituted with HA-tagged Bax (DKO Bax) or Bak (DKO Bak), using antibodies to HA (to specifically detect transgene expression), Bax, Bak or McI-I. (B) Killing of immortalized MEFs by UV-irradiation depends primarily on Bak, rather than Bax. Whereas exposure to 100 μM etoposide for 24 hours caused comparable killing of Bax- or Bak-expressing MEFs (described in A), far more Bak- than Bax-expressing cells had died 24 hours after exposure to UV-irradiation (doses indicated). (C) UV-induced killing of primary MEFs is mainly mediated by Bak. Primary MEFs (derived independently from those used in A-B) were challenged with UV-irradiation or etoposide. In B and C, cell viability was assessed by flow cytometric analyses after staining with propidium iodide (PI); the data represent means ± SD from 3 independent experiments. (D) Unlike etoposide treatment, UV- irradiation does not cause significant Bax activation in transformed MEFs. Lysates prepared from untreated Bak^"A MEFs, or 24 hours after UV-irradiation or etoposide treatment, were immunoblotted for total Bax (top panel) or for activated Bax (lower panel) after immunoprecipitating with the conformation-specific antibody 6A7.

Figure 3 is a graphical representation showing Bak is sequestered by McI-I and BCI-XL in healthy cells. (A) Tight binding of Bak BH3 to McI-I and BCI-XL. Using solution competition assays, the relative affinities (measured as IC₅₀ in nM) of a BakBH3 peptide for pro-survival Bcl-2 proteins were determined as described elsewhere (Chen et al, Molecular Cell 11:292- 403, 2005b). The results (plotted on an inverse log scale) are from representative experiments, the variation observed in multiple experiments was less than two fold (using different chips or protein batches). (B) Over-expressed McI-I and BCI-X_L bind endogenous Bak. N-terminally FLAG-tagged pro-survival proteins were over-expressed (upper panel) in 293T cells and their capacity to bind endogenous Bak (middle panel) was tested by co-immunoprecipitation (bottom panel) using an anti-FLAG affinity resin. 'Control' refers to immunoprecipitation from untransfected cells, 'en' denotes endogenous; * an McI-I breakdown product; ** immunoglobulin light chain from the immunoprecipitating antibody. (C) McI-I, BCI-XL and Bak are present in the pellet fraction of healthy cells. HeLa cells, lysed in 0.025% digitonin, were fractionated into soluble (s) and pellet (p) fractions, and probed for the indicated proteins. Note that Bax, unlike Bak, is present mainly in the soluble fraction. (D) Endogenous BCI-XL and McI-I associate with endogenous Bak in healthy cells. HeLa cells (lysed in 0.025% digitonin) were fractionated into soluble (s) and pellet (p) fractions. The pellet fraction was solubilized in buffer containing Triton-X-100, immunoprecipitated with anti-Mcl-1 (left panel), anti-Bcl-X_L (right panel) or isotype-matched control antibodies, and examined for the presence of Bak (middle panels) or Bax (bottom panels).

Figure 4 is a graphical representation showing Bak BH3 is required for interaction with McI-I and BCI-X_L5 and for pro-apoptotic function. (A) A point mutation within Bak BH3 abrogates interaction with McI-I and BCI-X_L. Using solution competition assays, the relative affinities (IC₅₀ in nM) of Bak and mutant Bak L78A peptides for McI-I and BCI-XL were determined. (B) Bak L78A fails to heterodimerize with McI-I or homodimerize. N-terminally HA-tagged wild-type Bak or mutant Bak L78A were transiently expressed in 293T cells (upper panels) and tested for their ability to bind endogenous McI-I₅ Bax or Bak (lower panels) by co-immunopreciptation using anti-HA affinity resin. Control refers to immunoprecipitation from untransfected cells, 'en' denotes endogenous. (C) L78A mutation inactivates Bak pro-apoptotic function. Viability was determined for Bax/Bak-deficient (DKO) MEFs, or ones containing introduced Bak or Bak L78A, left untreated or 24 hours after UV-irradiation or etoposide treatment. Data represent means ± SD from 3 independent experiments. (D) L78A mutant Bak, like wild-type Bak, localizes to the pellet fraction. Wild- type MEFs₅ or Bax/Bak-deficient ones expressing wild-type Bak or mutant Bak L78A (two independent clones) were fractionated (in digitonin-containing buffer) into soluble (s) and pellet (p) fractions, and probed for Bak (upper panel) or cytochrome c (lower panel).

Figure 5 is a graphical representation showing pro-apoptotic BH3-only protein Noxa displaces Bak from McI-I and triggers McI-I destruction. (A) Noxa displaces Bak from McI-I. N-terminally HA-tagged wild-type Noxa or the inert mutant Noxa 3E were transiently expressed in 293T cells and the impact of Noxa expression on McI-I :Bak complex formation assessed. Wild-type, but not mutant, Noxa bound McI-I (fourth panel), disrupting the complex between McI-I and Bak (bottom panel). The 293T cells were used because McI-I is very stable in them. (B) Noxa triggers McI-I degradation. Immunoblot of lysates prepared from Bax/Bak doubly deficient MEFs retrovirally infected with HA-tagged wild-type Noxa or mutant Noxa 3E was probed with antibodies to McI-I (upper panel), BCI-XL (middle panel), or HA (lower panel, to detect transgene expression). Control - uninfected MEFs. (C) Noxa- induced McI-I degradation is proteasome dependent. A blot of lysates prepared from a Noxa- expressing fibroblast line (described in B) after treatment with the proteasome inhibitor MG- 132 for different times was probed for McI-I (upper panel) and HSP70 (lower panel; loading control).

Figure 6 is a graphical representation showing neutralization of McI-I and BCI-XL triggers Bak-dependent apoptosis. (A) Selective binding profiles of Puma, Bad, Noxa and Noxa m3, based on interaction studies (Chen et άl, 2005b supra). Puma binds all pro-survival proteins tested; Bad binds tightly to BCI-XL, Bcl-w and Bcl-2, whereas Noxa selectively targets McI-I. In addition to McI-I₅ Noxa m3 also binds BCI-XL and Bcl-w, but its affinity for Bcl-2 is insignificant (Chen et at, 2005b supra). (B) Puma, but not Noxa or BadBH3 is sufficient to induce Bak-mediated apoptosis. Wild-type MEFs, Bax and Bak doubly deficient MEFs (DKO), or MEFs lacking only Bax were infected with the indicated retroviruses. The BadBH3 was tested within an inert Binis backbone (Chen et al, 2005b supra) to preclude any effects due to regulation of the Bad polypeptide. Expression of each BH3-only protein was linked via an IRES to that of GFP and the viability of GFP^+ve cells determined by PI exclusion 24 hours after infection. (C) The weak killing activity of Noxa, which only targets McI-I, can be complemented by neutralization of BCI-XL. The indicated MEFs were infected with retroviruses co-expressing Noxa and Binis BadBH3 (Chen et al, 2005b supra). The combination of the BadBH3 (which neutralizes Bcl-2, BCI-X_L and Bcl-w; see A) and Noxa gives potent Bak-dependent killing. Retroviral infection with Noxa m3 caused comparable killing of wild-type MEFs and those only expressing Bak. As Noxa m3 binds McI-I, BCI-X_L and Bcl-w but not Bcl-2 (A), targeting of these pro-survival proteins suffices for Bak- mediated apoptosis, whereas neutralization of Bcl-2 is not required. (D) Bcl-2 is not required for killing by Noxa m3 in long-term colony assays. Equivalent numbers of retrovirally infected cells were plated and the number of colonies formed scored 6 days later. Data in B- D represent means ± SD from 3 independent experiments.

Figure 7 is a graphical representation showing loss of BCI-XL, but not Bcl-2, sensitizes MEFs to Noxa killing. (A) Hypothesis for Bak regulation. If Bak is regulated by McI-I and BCI-XL but not Bcl-2 or Bcl-w, wild-type MEFs may be resistant to Noxa killing because it only targets McI-I, allowing BCI-X_L to keep Bak in check. This hypothesis predicts that Noxa will kill MEFs lacking BCI-XL but not those lacking Bcl-2. (B) Expression of Bcl-2 pro-survival proteins in MEFs. A blot of lysates prepared from wild-type, BC1-X_L ^+/", BCI-X₁/^" and Bcl-2^"A MEFs was probed with antibodies to McI-I, Bcl-x_L, Bcl-w, Bcl-2 and HSP70 (loading control). * Bcl-w breakdown product. (C) Noxa potently kills Bcl-x_L-null MEFs. Wild-type, BCI-XL^"7" or BcX-T^1" MEFs were infected with the indicated retroviruses and cell viability was assessed after 24 hours by flow cytometry. (D) Representative plates of colonies formed after infection with the indicated retroviruses. Noxa expression results in scant Bcl-X_L-deficient colonies but does not affect Bcl-2^"A MEFs. (E) Bcl-X_L-deficiency prevents the formation of Noxa-expressing colonies. Quantification of the representative data shown in D. (F) Reconstituting BCI-XL expression in BCI-X_L ^"7" MEFS. Flow cytometric analysis for the expression of FLAG-tagged BCI-XL (filled histogram) stably expressed in BC1-XL^"Λ MEFS (unfilled histogram). (G) Restoring BCI-XL expression renders Bcl-xi/^" MEFs resistant to Noxa killing in a short-term assay. (H) BCI-XL expression, but not overexpression of Bcl-2, inhibits Noxa killing of BcI-X₁/^" in long-term assay of colony formation. Data in C, E, G and H represent means ± SD from 3 independent experiments.

Figure 8 is a graphical representation showing model for Bak regulation. The central proposal of the model is that both McI-I and BCI-X_L, but not other pro-survival family members (e.g. Bcl-2), bind Bak in healthy cells until cytotoxic signals activate a combination of BH3-only proteins that can displace Bak. While Noxa can readily displace Bak from McI-I and promote its degradation, another BH3-only protein that can bind BCI-XL ('BH3') is also required for Bak liberation. The Bak BH3 (red beak) is required for both Bak regulation and for formation of Bak oligomers. When freed, it might directly mediate Bak association. Alternatively, if Bak also exists (as shown) as a 'receptor' conformer, dimerization of the two conformers via the exposed Bak BH3 might nucleate oligomerization.

Figures 9A through J are graphical and photographic representations showing the many putative BH3 mimetics do not kill like BH3-only proteins. A: The viability of wild-type MEFs (WT) or Bax- and Bak-deficient MEFs (DKO) 24 hours after infection with the indicated retroviruses. Expression of the cDNA encoding the BH3-only protein Bim_s or tBid was linked by an IRES to that of GFP, and the viability of GFP^+Ve cells determined by PI exclusion. B: The relative affinities (IC₅₀ in nM) of a BimBFB peptide (as previously reported (Chen et al, MoI Cell 77:393-403, 2005a) and several putative BH3 mimetic compounds for Bcl-2 and/or Bcl-w. The affinities were measured in competition assays (Chen et al, 2005a supra). C-H: The viability (% cells excluding PI) of WT or Bax- and Bak- deficient (DKO) MEFs treated for 24 hours with graded doses of the indicated putative BH3 mimetics. I, J: Representative wells showing colonies formed by wild-type (WT) or Bax/Bak-deficient (DKO) MEFs, I: after infection with the control parental retrovirus or one expressing Biπi_L, or J: in the presence of no treatment, HA14-1 or Antimycin A. Data in A and C-H represent means + SD from three independent experiments. Figure 10 is a tabulated representation showing that ABT-737 is a Bad BH3 mimetic. A: The relative affinities (IC₅₀ in nM) of a BadBH3 peptide (as reported previously Chen et al, 2005a supra) and ABT-737 for mammalian pro-survival proteins. The affinities were determined in solution competition assays using pro-survival proteins that had been C-terminally truncated to facilitate their production in bacteria (Chen et al, 2005a supra; Day et al, J Biol Chem 280:4738-4744, 2005; Hinds etal, EMBO J 22:1497-1507, 2003). B: ABT-737 and Bad bind to the same subset of Bcl-2 pro-survival proteins. According to the model for initiating the apoptotic program (Chen et al, 2005a supra), Bad and Noxa are poor inducers of apoptosis individually because each binds only a subset of the pro-survival proteins, whereas Bim is a potent killer because it binds all of them. Bad and Noxa can cooperate to induce apoptosis because they bind to complementary subsets of pro-survival proteins (Chen et al, 2005a supra; Willis et al, Genes Dev 72:1294-1305, 2005). By this rationale, ABT-737 should also cooperate with Noxa to kill cells.

Figures HA through D are graphical representations showing that ABT-737 cooperates with Noxa to induce Bax/Bak-dependent killing. A: The viability of wild-type MEFs (WT), Bax/Bak-deficient MEFs (DKO), and Bak- or Bax-singly deficient MEFs was determined by PI exclusion 48 hours after exposure to ABT-737 (lOμM) or Etoposide (lOμM). B: Noxa triggers McI-I degradationa and sensitizes wild-type MEFs to ABT-737 killing. Wild-type MEFs expressing wild-type human Noxa or an inactive mutant that does not bind McI-I (Noxa 3E) (Willis et al, 2005 supra), were exposed to ABT-737 for 8 hours and their viability determined. Inset: immunoblots of lysates prepared from the MEFs after retroviral infection with wild-type Noxa or the 3E mutant probed for McI-I and HSP70 (loading control). C: Bax/Bak-deficient MEFs (DKO) are resistant to ABT- 737 even when McI-I is targeted. Viability of the indicated MEFs stably expressing Noxa was determined 8 hours after exposure to ABT-737. D: Long-term clonogenic survival of cells exposed to ABT-737. Equal numbers of the indicated MEFs, or their counterparts stably expressing Noxa or the inactive Noxa 3E, were plated in media containing vehicle or ABT-737 (lμM, replenished after 3 d) and the colonies formed scored after 6 d. The numbers of colonies obtained with ABT-737 treatment are expressed as a proportion of those with vehicle alone, t - no colonies. Data in all panels represent means + SD from a representative of 3 experiments.

Figures 12 A through C are graphical representations showing that neutralizing McI-I sensitizes different cell types to ABT-737. A: Noxa sensitizes FDC-Pl myeloid cells to ABT-737 killing. The viabilities of FDC-Pl cells, retrovirally infected to express Noxa, mutant Noxa 3E or Bad, were compared 24 hours after treatment with ABT-737. B, C: Colony formation after continuous exposure to ABT-737 (lμM, replenished every 3 d) of MCF-7, B: or HeLa cells, C: infected with empty vectors, or stably expressing Noxa, mutant Noxa 3E, RNAi targeting McI-I, or RNAi to an irrelevant target (control RNAi - mouse caspase-12). Clonogenic survival data (after 7 days) are representative of 3 independent experiments. The lower panels are immunoblots for McI-I or HSP70 (loading control).

Figures 13 A through D are representations showing that ABT-737 induces cytochrome c release and caspase-dependent apoptosis when McI-I is neutralized. A: Cell death triggered by ABT-737 is caspase-dependent. Noxa-expressing wild-type MEFs were treated with ABT-737 (lμM) and their viability was assessed by PI exclusion; incubation with the broad-spectrum caspase inhibitor zVAD.fmk (50μM) abrogated ABT-737 killing at this time point. Data represent means + SD from a representative of 3 experiments. B: ABT-737 induces cytochrome c release when McI-I is neutralized. Noxa-expressing wild- type (WT) or Bax/Bak-deficient MEFs (DKO) were exposed to ABT-737 (lOμM for 4 h), permeabilized with digitonin to wash out any cytochrome c released to the cytosol and then fixed. Residual mitochondrial cytochrome c was detected by immunostaining and flow cytometry (Waterhouse et al, 2004 supra). ABT-737 triggered loss of cytochrome c from the mitochondria of WT MEFs, as indicated by the peak of weaker staining (compare filled with unfilled histogram; upper), but not from the Bax/Bak-deficient DKO MEFs (lower). C: ABT-737 and Noxa cooperate in vitro to release cytochrome c. Lysates prepared from wild-type (left) or Bax/Bak-deficient MEFs (DKO; right) stably expressing Noxa or Bad were incubated with vehicle (-) or 5μM ABT-737 (+), before fractionation into the pellet (P) and supernatant (S) fractions. Equivalent fractions were probed for cytochrome c, Bcl-2 (membrane fraction marker) and Apaf-1 (cytosolic marker). D: ABT- 737 triggers Bax activation when McI-I is neutralized. HeLa cells expressing mutant Noxa 3E, Noxa or McI-I RNAi, were treated for 4 hours with ABT-737 (10μM), and Bax activation detected by flow cytometric analysis after staining permeabilized cells with an antibody (clone 3) that specifically recognizes activated Bax (Willis et al, 2005 supra).

Figures 14A through D are graphical representations showing the pro-survival proteins differ in their ability to antagonize ABT-737. A: Noxa variants that selectively neutralize McI-I or both McI-I and Al. Whereas the human Noxa used in Figures 11-13 (above) binds both McI-I and Al (Chen et al, 2005a, b supra) (Figure 10), the mouse Noxa BH3 B region (mNoxaB) only binds tightly to McI-I (IC₅₀ 60 nM; IC₅₀ > 2μM for all other pro- survival proteins). The E74F mutant of mNoxaB binds tightly to both McI-I and Al (IC₅₀McI-I 24 nM, IC₅₀Al 12nM), but has weaker affinity (IC₅₀ > 2μM) for all other pro- survival proteins. The affinities were measured in solution competition assays (Chen et al, 2005 supra). B: Al expression confers partial resistance to ABT-737. Colony formation after 6 days by parental wild-type MEFs or MEFs stably over-expressing FLAG-tagged Al in the presence of ABT-737 (lμM, replenished after 3 d) and the indicated BH3 domains, placed within an otherwise inert Bims backbone lacking its own BH3 (Chen et al, 2005a, b) and expressed from retroviruses. C: Killing by ABT-737 is not inhibited by Bcl-2 and only partially by BCI-X_L. Wild-type MEFs, or MEFs over-expressing FLAG-tagged BCI-XL or Bcl-2, were tested for their sensitivity to ABT-737 (lμM) in the presence human Noxa. The Bcl-2 overexpression did not rescue any colony formation, even though it inhibited apoptosis induced by 24 hours exposure to Etoposide D: Data in B-D represent means + SD from a representative of 3 experiments.

Figures 15A through D are graphical representations showing ABT-737 potently sensitizes cells over-expressing Bcl-2 to genotoxic agents. A: Bcl-2 or BCI-X_L overexpression renders FDC-Pl cells resistant to genotoxic agents. FDC-Pl cells or FDC-Pl cells over-expressing Bcl-2 or BCI-XL were treated with Etoposide (25 μM) or Cytosine Arabinoside (25 μM) for 24 hours and viability determined by PI exclusion. B: Cytotoxic agents trigger McI-I degradation. Equivalent amounts of Iy sates prepared from cells over-expressing Bcl-2 or BCI-XL that were left untreated or after 24 hours exposure to Etoposide (25μM) or Ara-C (25μM) were probed for McI-I or HSP70 (loading control). C, D: FDC-Pl cells over-expressing Bcl-2 (C) or Bcl-x_L (D) were treated with ABT-737 (0-10μM), and Etoposide (25μM) or Cytosine Arabinoside (Ara-C; 25μM) or no other drug (none) for 24 hours and the viability determined by PI exclusion. Bold lines - fold increase in killing efficacy; hatched lines - EC₅₀ values. Data in A, C and D represent means + SD from a representative experiment.

Figures 16A through D are representatives of alternative ways to target McI-I and sensitize cells to ABT-737 A: IL-3 withdrawal triggers McI-I degradation and Bim accumulation in FDC-Pl cells. Lysates prepared from Bcl-2-over-expressing FDC-Pl cells grown for 0-24 hours in the absence of its essential growth factor IL-3 were blotted for McI-I, Bim or HSP70 (loading control). B: IL-3 deprivation sensitizes FDCPl cells over- expressing Bcl-2 (squares) or BCI-XL (circles) to ABT-737. Viability was determined for the cells, cultured with (filled symbols) or without (unfilled symbols) IL-3 and exposed to ABT-737 (0-10μM) for 24 h. C: The protein synthesis inhibitor cycloheximide (CHX) and the CDK inhibitor Seliciclib both reduce McI-I expression. HeLa cells were treated with 50μg/mL cycloheximide or 30μM Seliciclib (R-roscovitine/CYC202) for 12 hours and McI-I expression measured by immunoblotting (HSP-70, loading control). D: HeLa cells were left untreated, treated with 2.5μM ABT-737, 50 μg/mL cycloheximide or 30μM Seliciclib (R-roscovitine/CYC202), or combinations of ABT-737 with cycloheximide or Seliciclib, for 14 h. Data in B and D represent means + SD from 3 independent experiments. DETAILED DESCRIPTION OF THE INVENTION

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in any country.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>l (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

It is to be understood that unless otherwise indicated, the subject invention is not limited to specific agents, targets, formulation or fractional components, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

It must also be noted that, as used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to an "agent" includes a single agent, as well as two or more agents; reference to a "cell" includes a single cell, as well as two or more cells reference to "the Bcl-2 family" member includes a single member as well as two or more members and so forth.

In one embodiment, the present invention provides agents, which modulate the expression of a gene or the level or activity of a product which is involved in modulating cell survival. More particularly, the present invention provides modulation of a Bcl-2 family member- mediated apoptosis wherein the Bcl-2 family member is rendered non-apoptotic by the association of one or more pro-survival members of the Bcl-2 family.

Even more particularly, the present invention provides an agent, which promotes apoptosis of cells such as malignant cells which agent selectively inhibits or promotes degradation of pro-survival proteins which modulate the activity of pro-apoptotic Bak or Bax.

Hence, another aspect of the present invention contemplates a method for inducing apoptosis of a eukaryotic cell said method comprising reducing the level and/or activity of BCI-XL and McI-I for a time and under conditions sufficient for a pro-apoptotic protein rendered non-toxic through interaction with BCI-X_L and/or McI-I to become cytotoxic and thereby induce apoptosis of said cell. Still another aspect of the present invention provides a combination of two or more agents wherein at least one agent reduces the levels or activity of McI-I and at least one other agent reduces the levels or activity of BCI-X_L.

In a particular aspect, the present invention provides an agent, which modulates apoptosis by Bak or through a pathway regulated by Bak, the apoptotic activity of said Bak being controlled by association with McI-I and/or BCI-X_L said agent selected from the list consisting of:

(i) an agent which upregulates or down-regulates expression of a gene encoding said Bak;

(ii) an agent which upregulates or down-regulates activity of said Bak;

(iii) an agent which upregulates or down-regulates the level of expression of a gene encoding said McI-I and/or BCI-X_L; and

(iv) an agent which upregulate, down-regulates or reduces activity of said McI-I and/or

BCI-XL.

An example of an agent in (iv) is Noxa, which associates with McI-I to promote its degradation.

The agent may, in one aspect, be a proteinaceous or non-proteinaceous molecule and may be based on the structure of Bak, Bax, McI-I, BCI-XL or Noxa or may be identified following screening libraries of natural products or chemically synthesized compounds. A combinational approach to agent selection may also be adopted. An example of one suitable agent is ABT-737 (Oltersdorf et al, 2005 supra), which promotes Bak-mediated cell death when McI-I levels are low. The reduction in McI-I levels may be a feature of a cancer, for example, or may be reduced by the administration of an agent, which reduces the levels or activity of McI-I. Hence, another aspect of the present invention provides a method for inducing Bak- mediated apoptosis in a cancer cell, said method comprising co-administering ABT-737 or a chemical or function homolog, analog, derivative, isomer or pharmaceutically acceptable salt thereof and an agent which reduces the level or activity of McI-I .

The terms "agent", "compound", "active agent", "pharmacologically active agent", "medicament", "active", "drug" and the like may be used interchangeably herein to refer to a substance that induces a desired pharmacological and/or physiological effect such as reducing the level or activity of a target Bcl-2 family member. The terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms "agent", "compound", "active agent", "pharmacologically active agent", "medicament" "active", "drug" and the like are used, then it is to be understood that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc. The agents of the present invention may be any proteinaceous molecules such as peptides, polypeptides and proteins or non-proteinaceous molecules such as nucleic acid molecules and small to large natural or synthetically derived organic and inorganic molecules. A "nucleic acid molecule" includes a genetic agent such as RNAi or RNAi-type complex. Anti-sense molecules are also encompassed by this term.

As described hereinbefore, the agents of the present invention may be any proteinaceous molecules such as peptides, polypeptides and proteins. In relation to proteinaceous molecules, including peptides, polypeptide and proteins, without distinction, the terms include mutants, parts, derivatives, homologs, analogs or mimetics of one or more of Bak, Bax, McI-I, BCI-XL and/or Noxa. By "modulating" is meant an agent which upregulates or down-regulates gene expression or protein level or activity. In one embodiment, for example, the level of a protein is reduced following induction of degradative processes. In another embodiment, the agent promotes dissociation of McI-I and/or BCI-XL from Bak or association of Noxa to McI-I or both thus facilitating apoptosis. In this regard, the present invention is capable of facilitating apoptosis such as, in the treatment of cancer. In addition, the agents can be selected to inhibit apoptosis by elevating levels of McI-I and/or BCI-X_L or through other means, such as in the treatment of necrotic and degenerative diseases.

Mutant forms of the above-mentioned protein may be naturally occurring or artificially generated; such mutant forms are proposed to regulate Bak- or Bax-mediated apoptosis, such as but not limited to mimicking McI-I and/or BCI-XL binding to Bak or B ax or Noxa binding to McI-I. The mutants may comprise one or more amino acid substitutions, deletions or additions. Mutants may be induced by mutagenesis or other chemical methods or generated recombinantly or synthetically. For example, alanine scanning is a useful technique for identifying important amino acids (Wells, Methods Enzymol 202:2699-2705, 1991). In this technique, an amino acid residue is replaced by alanine and its effect on the peptide's activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the important regions of the polypeptide. Mutants are tested for their ability to regulate apoptosis and for other qualities such as longevity, binding affinity, dissociation rate and ability to cross biological membranes.

The present invention extends to parts of Bak, Bax, McI-I, BCI-XL and/or Noxa. Examples of parts include BH3 domains and binding regions. Sections which at least 10, or at least

20 and or at least 30 or at least 40 contiguous amino acids, and which exhibit the requisite binding activity are contemplated by the present invention. The "requisite binding activity" includes the required competition to exclude or reduce binding of naturally occuring McI-I, BCI-X_L or Noxa. Peptides of this type may be obtained through the application of standard recombinant nucleic acid techniques or synthesized using conventional liquid or solid phase synthesis techniques. For example, reference may be made to solution synthesis or solid phase synthesis as described, for example, in Chapter 9 entitled "Peptide Synthesis" by Atherton and Shephard, which is included in a publication entitled "Synthetic Vaccines" edited by Nicholson and published by Blackwell Scientific Publications. Alternatively, peptides can be produced by digestion of an amino acid sequence of the invention with proteinases such as endoLys-C, endoArg-C, endoGlu-C and staphylococcus V8-protease. The digested fragments can be purified by, for example, high performance liquid chromatographic (HPLC) techniques. Any such part, section or fragment, irrespective of its means of generation, is also to be understood as being encompassed by the term "derivative" as used herein.

In addition, random peptidase cleavage to generate small fragments of peptides based on similarities between homologs from different species are also contemplated by the present invention.

Thus, a derivative, encompasses parts, mutants, homologs, fragments, analogs as well as hybrid or fusion molecules and glycosylaton variants. Derivatives also include molecules having a percent amino acid sequence identity over a window of comparison after optimal alignment. Preferably, the percentage similarity between a particular sequence and a reference sequence is at least about 60% or at least about 70% or at least about 80% or at least about 90% or at least about 95% or above such as at least about 96%, 97%, 98%, 99% or greater. Preferably, the percentage similarity between species, functional or structural homologs of the instant agents is at least about 60% or at least about 70% or at least about 80% or at least about 90% or at least about 95% or above such as at least about 96%, 97%, 98%, 99% or greater. Percentage similarities or identities between 60% and 100% are also contemplated such as 60, 61, 62, 63, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%.

Analogs of the agents contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecule or their analogs. This term also does not exclude modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as those given in Table 2) or polypeptides with substituted linkages. Such polypeptides may need to be able to enter the cell and/or cross the blood- brain barrier.

Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH₄; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH₄.

The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.

The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.

Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.

Tryptophan residues may be modified by, for example, oxidation with N- bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-m^'trotyrosine derivative. Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate .

Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids. A list of unnatural amino acids, contemplated herein is shown in Table 2.

TABLE 2 : CODES FOR NON-CONVENTIONAL AMINO ACIDS

Non-conventional Code Non-conventional Code amino acid amino acid

α-aminobutyric acid Abu L-N-methylalanine Nmala α-amino-α-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-Nmethylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile

D-alanine Dal L-N-methylleucine Nmleu

D-arginine Darg L-N-methyllysine Nmlys

D-aspartic acid Dasp L-N-methylmethionine Nmmet

D-cysteine Dcys L-N-methylnorleucine Nmnle

D-glutamine DgIn L-N-methylnorvaline Nmnva

D-glutamic acid DgIu L-N-methylornithine Nmorn

D-histidine Dhis L-N-methylphenylalanine Nmphe

D-isoleucine DiIe L-N-methylproline Nmpro

D-leucine Dleu L-N-methylserine Nmser

D-lysine Dlys L-N-methylthreonine Nmthr

D-methionine Dmet L-N-methyltryptophan Nmtrp

D-ornithine Dorn L-N-methyltyrosine Nmtyr

D-phenylalanine Dphe L-N-methylvaline Nmval

D-proline Dpro L-N-methylethylglycine Nmetg

D-serine Dser L-N-methyl-t-butylglycine Nmtbug

D-threonine Dthr L-norleucine NIe

D-tryptophan Dtrp L-norvaline Nva

D-tyrosine Dtyr α-methyl-aminoisobutyrate Maib

D-valine Dval α-methyl-γ-aminobutyrate Mgabu

D-α-methylalanme Dmala α-methylcyclohexylalanine Mchexa

D-α-methylarginine Dmarg α-methylcylcopentylalanine Mcpen

D-α-methylasparagine Dmasn α-methyl-α-napthylalanine Manap

D-oc-methylaspartate Dmasp α-methylpenicillamine Mpen

D-α-methylcysteine Dmcys N-(4-aminobutyl)glycine NgIu

D-α-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg

D-α-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn

D-α-methylisoleucine Dmile N-amino-α-methylbutyrate Nmaabu

D-α-methylleucine Dmleu α-napthylalanine Anap

D-α-methyllysine Dmlys N-benzylglycine Nphe Non-conventional Code Non-conventional Code amino acid amino acid

D-α-methylmethionine Dmmet N-(2-carbamylethyl)glycine NgIn

D-α-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn

D-α-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine NgIu

D-α-methylproline Dmpro N-(carboxymethyl)glycine Nasp

D-α-methylserine Dmser N-cyclobutylglycine Ncbut

D-α-methylthreonine Dmthr N-cycloheptylglycine Nchep

D-α-methyltryptophan Dmtrp N-cyclohexylglycine Nchex

D-α-methyltyrosine Dmty N-cyclodecylglycine Ncdec

D-α-methylvaline Dmval N-cylcododecylglycine Ncdod

D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct

D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro

D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund

D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm

D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe

D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg

D-N-methylglutamate Dnmglu N-(I -hydroxyethyl)glycine Nthr

D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser

D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis

D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp

D-N-methyllysine Dnmlys N-methyl-γ-aminobutyrate Nmgabu

N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet

D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen

N-methylglycine NaIa D-N-methylphenylalanine Dnmphe

N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro

N-( 1 -methylpropyl) glycine Nile D-N-methylserine Dnmser

N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr

D-N-methyltryptophan Dnnitrp N-( 1 -methylethyl)glycine Nval

D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap

D-N-methylvaline Dnmval N-methylpenicillamine Nmpen γ-aminobutyric acid Gabu N-(j3-hydroxyphenyl)glycine Nhtyr

L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys

L-ethylglycine Etg penicillamine Pen

L-homophenylalanine Hphe L-α-methylalanine Mala

L-α-methylarginine Marg L-α-methylasparagine Masn

L-α-methylaspartate Masp L-α-methyW-butylglycine Mtbug

L-α-methylcysteine Mcys L-methylethylglycine Metg

L-α-methylglutamine MgIn L-α-methylglutamate MgIu

L-α-methylhistidine Mhis L-α-methylhomophenylalanine Mhphe

L-α-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet

L-α-methylleucine Mleu L-α-methyllysine Mlys Non-conventional Code Non-conventional Code amino acid amino acid

L-α-methylmethionine Mmet L-α-methylnorleucine MnIe

L-α-methylnorvaline Mnva L-α-methylornithine Mom

L-α-methylphenylalanine Mphe L-α-methylproline Mpro

L-α-methylserine Mser L-α-methylthreonine Mthr

L-α-methyltryptophan Mtrp L-α-methyltyrosine Mtyr

L-α-methylvaline Mval L-N-methylhomophenylalanine Nmhphe

N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine

1 -carboxy- 1 -(2,2-diphenyl- Nmbc ethylamino)cyclopropane

Crosslinkers can be used, for example, to stabilize 3D conformations, using homo- bifunctional crosslinkers such as the bifunctional imido esters having (CH₂)_n spacer groups with n = 1 to n = 6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). In addition, peptides can be conformationally constrained by, for example, incorporation of C_α and N _α-methylamino acids, introduction of double bonds between C_α and Cp atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.

Mimetics are another useful group of agents for modulating apoptosis such as mimetics of one or more of Bak, Bax, McI-I, BCI-X_L and Noxa. The term is intended to refer to a substance, which has some chemical similarity to the molecule it mimics but which antagonizes or agonizes its interaction with a target, such as, for example, Bak, Bax,

McI-I, BCI-XL and Noxa. A peptide mimetic may be a peptide-containing molecule that mimics elements of protein secondary structure (Johnson et al, Peptide Turn Mimetics in Biotechnology and Pharmacy, Pezzuto et al, Eds., Chapman and Hall, New York, 1993).

The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions such as those of antibody and antigen, enzyme and substrate or scaffolding proteins. A peptide mimetic, therefore, is designed to permit molecular interactions similar to the natural molecule.

The designing of niimetics to a pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration, e.g. peptides are unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal. Mimetic design, synthesis and testing is generally used to avoid randomly screening large numbers of molecules for a target property.

There are several steps commonly taken in the design of a mimetic from a compound having a given target property. First, the particular parts of the compound that are critical and/or important in determining the target property are determined. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. As described hereinbefore, Alanine scans of peptides are commonly used to refine such peptide motifs. These parts or residues constituting the active region of the compound are known as its "pharmacophore".

Once the pharmacophore has been found, its structure is modelled according to its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, x-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process.

In a variant of this approach, the three-dimensional structure of a receptor and ligand are modelled. This can be especially useful where the receptor and/or ligand change conformation on binding, allowing the model to take account of this in the design of the mimetic. Modelling can be used to generate agents which interact with the linear sequence or a three-dimensional configuration.

A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted onto it can conveniently be selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. Alternatively, where the mimetic is peptide-based, further stability can be achieved by cyclizing the peptide, increasing its rigidity. The mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.

The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g. agonists, antagonists, inhibitors or enhancers) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, for example, enhance or interfere with the function of a polypeptide in vivo (see, e.g. Hodgson, BioTechnology P: 19-21,

1991). In one approach, one first determines the three-dimensional structure of a protein of interest by x-ray crystallography, by computer modelling or most typically, by a combination of approaches. Useful information regarding the structure of a polypeptide may also be gained by modelling based on the structure of homologous proteins.

As noted hereinbefore, the agents of the present invention may also be nucleic acid molecules. As such, the present invention also extends to a genetic approach for modulating the expression of Bak, Bax, McI-I, BCI-XL and/or Noxa genes or the level of activity of Bak, Bax, McI-I, BCI-X_L and/or Noxa. This could involve, inter alia, providing gene function to cell such as in a gene therapy, or, it could involve inhibiting gene function using gene silencing constructs and antisense oligonucleotides. A gene silencing construct includes an RNAi-like molecule or complex, and post-transcriptional or pre-transcriptional silencing constructs. A target nucleic acid sequence or a part of a nucleic acid sequence may be introduced into a cell in a vector such that the nucleic acid sequence remains extrachromosomal. In such a situation, the nucleic acid sequence will be expressed by the cell from the extrachromosomal location. Vectors for introduction of nucleic acid sequence both for recombination and for extrachromosomal maintenance are known in the art and any suitable vector may be used. Methods for introducing nucleic acids into cells such as electroporation, calcium phosphate co-precipitation and viral transduction are known in the art.

In particular, a number of viruses have been used as nucleic acid transfer vectors or as the basis for preparing nucleic acid transfer vectors, including papovaviruses (e.g. SV40, Madzak et al, J Gen Virol 75:1533-1536, 1992), adenovirus (Berkner, Curr Top Microbiol Immunol 158:39-66, 1992; Berkner et al, BioTechniques 6:616-629, 1988; Gorziglia and Kapikian, J Virol 55:4407-4412, 1992; Quantin et al, Proc Natl Acad Sci USA 89:2581- 2584, 1992; Rosenfeld et al, Cell 68:143-155, 1992; Wilkinson et al, Nucleic Acids Res 20:233-2239, 1992; Stratford-Perricaudet et al, Hum Gene Titer 1:241-256, 1990; Schneider et al, Nat Genetics 75:180-183, 1998), vaccinia virus (Moss, Curr Top Microbiol Immunol 158: 5-38, 1992; Moss, Proc Natl Acad Sci USA 95:11341-11348, 1996), adeno-associated virus (Muzyczka, Curr Top Microbiol Immunol 158:97-129, 1992; Ohi et al, Gene 89:279-282, 1990; Russell and Hirata, Nat Genetics 75:323-328, 1998), herpesviruses including HSV and EBV (Margolskee, Curr Top Microbiol Immunol 158:67-95, 1992; Johnson et al, J Virol 55:2952-2965, 1992; Fink et al, Hum Gene Ther 3:1-19, 1992; Breakefield and Geller, MoI Neurobiol 7:339-371, 1987; Freese et al, Biochem Pharmaco. 40:2189-2199, 1990; Fink et al, Ann Rev Neurosci 19:265-287, 1996), lentiviruses (Naldini et al, Science 272:263-267, 1996), Sindbis and Semliki Forest virus (Berglund et al, Biotechnology 11:916-920, 1993) and retroviruses of avian (Bandyopadhyay and Temin, MoI Cell Biol 4:749-754, 1984; Petropoulos et al, J Virol 55:3391-3397, 1992), murine (Miller, Curr Top Microbiol Immunol 158:1-24, 1992; Miller et al, MoI Cell Biol 5:431-437, 1985; Sorge et al, MoI Cell Biol 4:1730-1737, 1984; Mann and Baltimore, J Virol 54:401-407, 1985; Miller et al, J Virol 52:4337-4345, 1988) and human (Shimada et al, J Clin Invest §5:1043-1047, 1991; Helseth et al, J Virol 64:2416- 2420, 1990; Page et al, J Virol 64:5270-5276, 1990; Buchschacher and Panganiban, J Virol (55:2731-2739, 1982) origin.

Non-viral nucleic acid transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer. Viral-mediated nucleic acid transfer can be combined with direct in vivo nucleic acid transfer using liposome delivery, allowing one to direct the viral vectors to particular cells. Alternatively, the retroviral vector producer cell line can be injected into particular tissue. Injection of producer cells would then provide a continuous source of vector particles.

In relation to nucleic acid molecules, the terms mutant, section, derivative, homolog, analog or mimetic have analogous meanings to the meanings ascribed to these forms in relation to proteinaceous molecules. In all cases, variant forms are tested for their ability to function as proposed herein using techniques which are set forth herein or which are selected from techniques which are currently well known in the art.

When in nucleic acid form, a derivative comprises a sequence of nucleotides having at least 60% identity to a parent molecule, such as a nucleic acid sequence encoding a binding partner of the present invention, or a section thereof. A "section" of a nucleic acid molecule is defined as having a minimal size of at least about 5 nucleotides or preferably about 10 nucleotides or more preferably at least about 15 nucleotides. This definition includes all sizes in the range of 5-15 nucleotides including 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, nucleotides as well as greater than 15 nucleotides including 50, 100, 300, 500, 1000 or 2000 nucleotides or nucleic acid molecules having any number of nucleotides within these values. Having at least about 60% identity means, having optimal alignment, a nucleic acid molecule comprises at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with a reference sequence which encodes a binding partner of the present invention.

The terms "similarity" or "identity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and amino acid sequence comparisons are made at the level of identity rather than similarity.

Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as, for example, disclosed by Altschul et al (Nucl Acids Res 25:3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994- 1998, Chapter 15).

The terms "sequence similarity" and "sequence identity" as used herein refer to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) or the identical amino acid residue (e.g. Ala, Pro, Ser, Thr, GIy, VaI, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, GIu, Asn, GIn, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.

The nucleic acid molecules of the present invention are also capable of hybridizing to other genetic molecules. Reference herein to "hybridizes" refers to the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art. For example, stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature, altering the time of hybridization, as described in detail, below. In alternative aspects, nucleic acids of the invention are defined by their ability to hybridize under various stringency conditions (e.g., high, medium, and low).

Reference herein to a "low stringency" includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions. Generally, low stringency is at from about 25-3O⁰C to about 42⁰C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as "medium stringency", which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or "high stringency", which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out T_m = 69.3 + 0.41 (G+C)% (Marmur and Doty, JMoI Biol 5:109-118, 1962). However, the T_m of a duplex nucleic acid molecule decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur J Biochem ¥5:83-88, 1974). Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42⁰C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 2O⁰C to 65⁰C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65⁰C.

The terms "nucleic acid", "nucleotide" and "polynucleotide" include RNA (mRNA, tRNA, rRNA, siRNA), DNA (genomic DNA, cDNA), synthetic forms and mixed polymers, both sense and/or antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g. phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g. polypeptides), intercalators (e.g. acridine, psoralen, etc.), chelators, alkylators and modified linkages (e.g. α-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

Antisense polynucleotide sequences, for example, are useful in silencing transcripts of target genes, such as to genes encoding Bak, Bax, McI-I, BCI-XL and/or Noxa.

Furthermore, polynucleotide vectors containing all or a portion of a gene locus encoding the expression product of a target gene may be placed under the control of a promoter in an antisense orientation and introduced into a cell. Expression of such an antisense construct within a cell will interfere with target transcription and/or translation. Alternatively, antisense or sense molecules may be directly administered to a neural cell or tissue. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells as described hereinafter.

A variation on antisense and sense molecules involves the use of morpholinos, which are oligonucleotides composed of morpholine nucleotide derivatives and phosphorodiamidate linkages (for example, Summerton and Weller, Antisense and Nucleic Acid Drug Devel 7: 187-195, 1997). Such compounds are injected into embryos and the effect of interference with mRNA is observed.

In one embodiment, the present invention employs compounds such as oligonucleotides and similar species for use in modulating the expression of nucleic acid molecules, such as genes encoding Bak, Bax, McI-I, BCI-XL and/or Noxa, upregulated apoptosis, i.e. the oligonucleotides induce pre-transcriptional or post-transcriptional gene silencing of McI-I or BCI-X_L or Bak or Bax. This is accomplished by providing oligonucleotides which specifically hybridize with one or more target nucleic acid molecules encoding the target gene product. The oligonucleotides may be provided directly to a cell or generated within the cell. As used herein, the term "target nucleic acid" is used for convenience to encompass DNA encoding the target gene product, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of the subject invention with its target nucleic acid is generally referred to as "antisense". Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition." Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.

The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. In one example, the result of such interference with target nucleic acid function is reduced expression levels of the target gene itself or of a gene which inhibits or potentiates target gene expression or activity of a gene product. In the context of the present invention, "modulation" and "modulation of expression" mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g. DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.

An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

"Complementary" as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.

According to the present invention, agents include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of a target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.

While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many cells the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. As such, co-suppression and mechanisms to induce RNAi or siRNA may also be employed in the present invention.

In the context of the subject invention, the term "oligomeric compound" refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.

While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those herein described. The open reading frame (ORP) or "coding region" which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is a region which may be effectively targeted. Within the context of the present invention, one region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORP) of a gene.

Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of an mRNA comprises an N7 -methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.

Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns", which are excised from a transcript before it is translated. The remaining (and, therefore, translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e. intron- exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may, therefore, fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

In another embodiment, the present invention also provides for methods of identifying agents useful for modulating apoptosis and in particular Bak-mediated apoptosis. These methods of identification comprise screening naturally produced libraries, chemical produced libraries, as well as combinatorial libraries, phage display libraries and in vitro translation-based libraries. The capability of the agents of the present invention, whether they be proteinaceous or non-proteinaceous, to modulate the expression of genes encoding Bak, Bax, McI-I, BCI-XL and/or Noxa or the level of activity of Bak, Bax, McI-I, BCI-XL and/or Noxa may be assessed via a number of screening methods which would be well known to a person skilled in the art. One method of screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant polynucleotides expressing a target protein of interest, such as Bak, Bax, McI-I, BCI-XL and/or Noxa, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. One may measure, for example, the formation of complexes between a target and the agent being tested, or examine the degree to which the formation of a complex between a target and a known ligand is aided or interfered with by the agent being tested.

The screening procedure includes assaying (i) for the presence of a complex between the agent and the target, or (ii) an alteration in the expression levels of nucleic acid molecules encoding the target. As described hereinbefore, one form of assay involves competitive binding assays. In such competitive binding assays, the target is typically labeled. Free target is separated from any putative complex and the amount of free (i.e. uncomplexed) label is a measure of the binding of the agent being tested to target molecule. One may also measure the amount of bound, rather than free, target. It is also possible to label the agent rather than the target. Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a target and is described in detail in Geysen

(International Patent Publication No. WO 84/03564). Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with a target and washed. Bound target molecule is then detected by methods well known in the art. This method may be adapted for screening for non-peptide, chemical entities. This aspect, therefore, extends to combinatorial approaches to screening for agents capable of modulating the level of expression of the target proteins or genes encoding same.

The identification of agents could also be carried out in accordance with the present invention by a process comprising the following steps:

(i) isolating a sample of cells or tissue (i.e. normal or malignant);

(ii) placing samples of the cells or tissue into suitable receptacles; and

(iii) exposing the samples of cells or tissue to agents for a particular period of time and under particular conditions; and

(iv) screening for morphological, physiological and genetic changes to the cells or tissue which are characteristic of apoptosis or cell survival.

Two-hybrid screening is also useful in identifying other members of a biochemical or genetic pathway associated with a target. Two-hybrid screening conveniently uses Saccharoniyces cerevisiae and Saccharomyces pombe. Target interactions and screens for agonists and antagonists can be carried out using the yeast two-hybrid system, which takes advantage of transcriptional factors that are composed of two physically separable, functional domains. The most commonly used is the yeast GAL4 transcriptional activator consisting of a DNA binding domain and a transcriptional activation domain. Two different cloning vectors are used to generate separate fusions of the GAL4 domains to genes encoding potential binding proteins. The fusion proteins are co-expressed, targeted to the nucleus and if interactions occur, activation of a reporter gene (e.g. lacZ) produces a detectable phenotype. In the present case, for example, S. cerevisiae is co-transformed with a library or vector expressing a cDNA GAL4 activation domain fusion, and a vector expressing a target gene fused to GAL4. If lacZ is used as the reporter gene, co-expression of the fusion proteins will produce a blue color. Small molecules or other candidate compounds which interact with a target will result in loss of color of the cells. Reference may be made to the yeast two-hybrid systems as disclosed by Munder et al, Appl Microbiol Biotechnol 52:311-320, 1999 and Young et al, Nat Biotechnol 16:946-950, 1998. Molecules thus identified by this system are then re-tested in animal cells.

In yet another embodiment, the present invention provides a method of regulating apoptosis, said method comprising administering to a subject an agent which is capable of modulating the level of Bak-or Bax-mediated apoptosis activity.

The agents and methods of the present invention also facilitate the development of methods and pharmaceutical compositions for preventing and/or treating a range of cancers or necrotic conditions. Examples of cancers include, without being limited to, ABLl protooncogene, AIDS related cancers, acoustic neuroma, acute lymphocytic leukaemia, acute myeloid leukaemia, adenocystic carcinoma, adrenocortical cancer, agnogenic myeloid metaplasia, alopecia, alveolar soft-part sarcoma, anal cancer, angiosarcoma, aplastic anaemia, astrocytoma, ataxia-telangiectasia, basal cell carcinoma (skin), bladder cancer, bone cancers, bowel cancer, brain stem glioma, brain and CNS tumors, breast cancer, CNS tumors, carcinoid tumors, cervical cancer, childhood brain tumors, childhood cancer, childhood leukaemia, childhood soft tissue sarcoma, chondrosarcoma, choriocarcinoma, chronic lymphocytic leukaemia, chronic myeloid leukaemia, colorectal cancers, cutaneous t-cell lymphoma, dermatofibrosarcoma-protuberans, desmoplastic- small-round-cell-tumor, ductal carcinoma, endocrine cancers, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, extra-hepatic bile duct cancer, eye cancer, eye: melanoma, retinoblastoma, fallopian tube cancer, fanconi anaemia, fibrosarcoma, gall bladder cancer, gastric cancer, gastrointestinal cancers, gastrointestinal- carcinoid-tumor, genitourinary cancers, germ cell tumors, gestational-trophoblastic- disease, glioma, gynaecological cancers, haematological malignancies, hairy cell leukaemia, head and neck cancer, hepatocellular cancer, hereditary breast cancer, histiocytosis, Hodgkin's disease, human papillomavirus, hydatidiform mole, hypercalcemia, hypopharynx cancer, intraocular melanoma, islet cell cancer, Kaposi's sarcoma, kidney cancer, Langerhan's-cell-histiocytosis, laryngeal cancer, leiomyosarcoma, leukaemia, li-fraumeni syndrome, lip cancer, liposarcoma, liver cancer, lung cancer, lymphedema, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, male breast cancer, malignant-rhabdoid-tumor-of-kidney, medulloblastoma, melanoma, Merkel cell cancer, mesothelioma, metastatic cancer, mouth cancer, multiple endocrine neoplasia, mycosis fungoides, myelodysplastic syndromes, myeloma, myeloproliferative disorders, nasal cancer, nasopharyngeal cancer, nephroblastoma, neuroblastoma, neurofibromatosis, nijmegen breakage syndrome, non-melanoma skin cancer, non-small-cell-lung-cancer- (nsclc), ocular cancers, oesophageal cancer, oral cavity cancer, oropharynx cancer, osteosarcoma, ostomy ovarian cancer, pancreas cancer, paranasal cancer, parathyroid cancer, parotid gland cancer, penile cancer, peripheral-neuroectodermal-tumors, pituitary cancer, polycythemia vera, prostate cancer, rare-cancers-and-associated-disorders, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, Rothmund-Thomson syndrome, salivary gland cancer, sarcoma, schwannoma, Sezary syndrome, skin cancer, small cell lung cancer (sclc), small intestine cancer, soft tissue sarcoma, spinal cord tumors, squamous-cell-carcinoma-(skin), stomach cancer, synovial sarcoma, testicular cancer, thymus cancer, thyroid cancer, transitional-cell-cancer-(bladder), transitional-cell-cancer- (renal-pelvis-/-ureter), trophoblastic cancer, urethral cancer, urinary system cancer, uroplakins, uterine sarcoma, uterus cancer, vaginal cancer, vulva cancer, Waldenstrom' s- macrόglobulinemia or Wilms' tumor.

Reference herein to "treatment" may mean a reduction in the severity of an existing disease or condition. The term "treatment" is also taken to encompass "prophylactic treatment" to prevent the onset of a disease or condition. The term "treatment" does not necessarily imply that a subject is treated until total recovery. Similarly, "prophylactic treatment" does not necessarily mean that the subject will not eventually contract a disease or condition.

Subject as used herein refers to humans and non-human primates (e.g. gorilla, macaque, marmoset), livestock animals (e.g. sheep, cow, horse, donkey, pig), companion animals

(e.g. dog, cat), laboratory test animals (e.g. mouse, rabbit, rat, guinea pig, hamster), captive wild animals (e.g. fox, deer), reptiles or amphibians (e.g. cane toad), fish (e.g. zebrafish) and any other organisms (e.g. C. elegans) who can benefit from the agents of the present invention. There is no limitation on the type of animal that could benefit from the presently described agents. The most preferred subject of the present invention is a human. A subject regardless of whether it is a human or non-human organism may be referred to as a patient, individual, animal, host or recipient.

The agents of the present invention can be combined with one or more pharmaceutically acceptable carriers and/or diluents to form a pharmacological composition.

Pharmaceutically acceptable carriers can contain a physiologically acceptable compound that acts to, e.g., stabilize, or increase or decrease the absorption or clearance rates of the pharmaceutical compositions of the invention. Physiologically acceptable compounds can include, e.g., carbohydrates, such as glucose, sucrose, or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, compositions that reduce the clearance or hydrolysis of the peptides or polypeptides, or excipients or other stabilizers and/or buffers. Detergents can also used to stabilize or to increase or decrease the absorption of the pharmaceutical composition, including liposomal carriers.

Pharmaceutically acceptable carriers and formulations for peptides and polypeptide are known to the skilled artisan and are described in detail in the scientific and patent literature, see e.g., Remington's Pharmaceutical Sciences, 18^th Edition, Mack Publishing

Company, Easton, PA, USA, 1990 ("Remington's").

Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives, which are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, e.g., phenol and ascorbic acid. One skilled in the art would appreciate that the choice of a pharmaceutically acceptable carrier including a physiologically acceptable compound depends, for example, on the route of administration of the modulatory agent of the invention and on its particular physio-chemical characteristics.

Administration of the agent, in the form of a pharmaceutical composition, may be performed by any convenient means known to one skilled in the art. Routes of administration include, but are not limited to, respiratorally, intratracheally, nasopharyngeally, intravenously, intraperitoneally, subcutaneously, intracranially, intradermally, intramuscularly, intraoccularly, intrathecally, intracereberally, intranasally, orally, rectally, patch and implant.

For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, lozenges, powders, suspensions or emulsions. In preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, suspending agents, and the like in the case of oral liquid preparations (such as, for example, suspensions, elixirs and solutions); or carriers such as starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations (such as, for example, powders, capsules and tablets). Due to their ease in administration, tablets and capsules represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be sugar-coated or enteric-coated by standard techniques. The active agent can be encapsulated to make it stable to passage through the gastrointestinal tract while at the same time allowing for passage across the blood brain barrier, see, e.g, International Patent Publication Number WO 96/11698.

Agents of the present invention, when administered orally, may be protected from digestion. This can be accomplished either by complexing the agent with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the agent in an appropriately resistant carrier such as a liposome. Means of protecting compounds from digestion are well known in the art, see, e.g. Fix, Pharm Res 13:1760-1764, 1996; Samanen et al, J Pharm Pharmacol ¥5:119-135, 1996; U.S. Patent Number 5,391,377, describing lipid compositions for oral delivery of therapeutic agents.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion or may be in the form of a cream or other form suitable for topical application. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the agents in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof. For parenteral administration, the agent may dissolved in a pharmaceutical carrier and administered as either a solution or a suspension. Illustrative of suitable carriers are water, saline, dextrose solutions, fructose solutions, ethanol, or oils of animal, vegetative or synthetic origin. The carrier may also contain other ingredients, for example, preservatives, suspending agents, solubilizing agents, buffers and the like. When the agents are being administered intrathecally, they may also be dissolved in cerebrospinal fluid.

For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated can be used for delivering the agent. Such penetrants are generally known in the art e.g. for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents can be used to facilitate permeation. Transmucosal administration can be through nasal sprays or using suppositories e.g. Sayani and Chien, Crit Rev Ther Drug

Carrier Syst 75:85-184, 1996. For topical, transdermal administration, the agents are formulated into ointments, creams, salves, powders and gels. Transdermal delivery systems can also include patches.

For inhalation, the agents of the invention can be delivered using any system known in the art, including dry powder aerosols, liquids delivery systems, air jet nebulizers, propellant systems, and the like, see, e.g., Patton, Nat Biotech 7(5:141-143, 1998; product and inhalation delivery systems for polypeptide macromolecules by, e.g., Dura Pharmaceuticals (San Diego, CA), Aradigm (Hayward, CA)₅ Aerogen (Santa Clara, CA), Inhale Therapeutic Systems (San Carlos, CA), and the like. For example, the pharmaceutical formulation can be administered in the form of an aerosol or mist. For aerosol administration, the formulation can be supplied in finely divided form along with a surfactant and propellant. In another aspect, the device for delivering the formulation to respiratory tissue is an inhaler in which the formulation vaporizes. Other liquid delivery systems include, for example, air jet nebulizers.

The agents of the invention can also be administered in sustained delivery or sustained release mechanisms, which can deliver the formulation internally. For example, biodegradeable microspheres or capsules or other biodegradeable polymer configurations capable of sustained delivery of an agent can be included in the formulations of the invention (e.g. Putney and Burke, Nat Biotech 16:153-151, 1998).

In preparing pharmaceuticals of the present invention, a variety of formulation modifications can be used and manipulated to alter pharmacokinetics and biodistribution. A number of methods for altering pharmacokinetics and biodistribution are known to one of ordinary skill in the art. Examples of such methods include protection of the compositions of the invention in vesicles composed of substances such as proteins, lipids (for example, liposomes), carbohydrates, or synthetic polymers. For a general discussion of pharmacokinetics, see, e.g., Remington's.

In one aspect, the pharmaceutical formulations comprising agents of the present invention are incorporated in lipid monolayers or bilayers such as liposomes, see, e.g., U.S. Patent Numbers 6,110,490; 6,096,716; 5,283,185 and 5,279,833. The invention also provides formulations in which water-soluble modulatory agents of the invention have been attached to the surface of the monolayer or bilayer. For example, peptides can be attached to hydrazide-PEG-(distearoylphosphatidyl) ethanolamine-containing liposomes (e.g. Zalipsky et al, Bioconjug Chem (5:705-708, 1995). Liposomes or any form of lipid membrane, such as planar lipid membranes or the cell membrane of an intact cell e.g. a red blood cell, can be used. Liposomal formulations can be by any means, including administration intravenously, transdermally (Vutla et al, J Pharm Sci 85:5-8, 1996), transmucosally, or orally. The invention also provides pharmaceutical preparations in which the agents of the invention are incorporated within micelles and/or liposomes (Suntres and Shek, J Pharm Pharmacol 46:23-28, 1994; Woodle et al, Pharm Res 9:260- 265, 1992). Liposomes and liposomal formulations can be prepared according to standard methods and are also well known in the art see, e.g., Remington's; Akimaru et al, Cytokines MoI Ther 7:197-210, 1995; Alving et al, Immunol Rev 145:5-31, 1995; Szoka and Papahadjopoulos, Ann Rev Biophys Bioeng P.-467-508, 1980, U.S. Patent Numbers 4, 235,871, 4,501,728 and 4,837,028. The pharmaceutical compositions of the invention can be administered in a variety of unit dosage forms depending upon the method of administration. Dosages for typical pharmaceutical compositions are well known to those of skill in the art. Such dosages are typically advisorial in nature and are adjusted depending on the particular therapeutic context, patient tolerance, etc. The amount of agent adequate to accomplish this is defined as the "effective amount". The dosage schedule and effective amounts for this use, i.e., the "dosing regimen" will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age, pharmaceutical formulation and concentration of active agent, and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration. The dosage regimen must also take into consideration the pharmacokinetics, i.e., the pharmaceutical composition's rate of absorption, bioavailability, metabolism, clearance, and the like. See, e.g., Remington's; Egleton and Davis, Peptides 75:1431-1439, 1997; Langer, Science 249:1527-1533, 1990.

In accordance with these methods, the agents and/or pharmaceutical compositions defined in accordance with the present invention may be co-administered with one or more other agents. Reference herein to "co-administered" means simultaneous administration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes. Reference herein to "sequential" administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two types of agents and/or pharmaceutical compositions. Coadministration of the agents and/or pharmaceutical compositions may occur in any order.

Alternatively, targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as, but not limited to, antibodies or cell specific ligands. Targeting may be desirable for a variety of reasons, e.g. if the agent is unacceptably toxic or if it would otherwise require too high a dosage or if it would not otherwise be able to enter the target cells, e.g., by not being able to cross the blood-brain barrier. The inability to cross the blood-brain barrier is a particular problem for agents directed to brain cancers and as such, a number of strategies are well known in the art for improving the accessibility to the brain of administered agents (Misra et al, J Pharm Pharm Sci 6:252-213, 2003).

The present invention also facilitates the development of diagnostic and/or prognostic assays and reagents useful for identifying the presence of a disease, or the propensity to develop a disease, or the severity of a disease such as cancer of an subject wherein the disease is characterized by an abnormal Bak, Bax, McI-I, BCI-XL and/or Noxa which, for example, promotes excessive Bak- or Bax-mediated apoptosis or which do not permit Bak- or Bax-mediated apoptosis.

The present invention provides, therefore, a method of diagnosing and/or prognosing a disease characterized by abnormal level of expression of one or more of Bak, Bax, McI-I, BCI-X_L and/or Noxa and/or abnormal level or activity of one or more of Bak, Bax, McI-I, BCI-XL and/or Noxa of a subject said method comprising determining the level of expression of genes encoding Bak, Bax, McI-I, BCI-X_L and/or Noxa and/or level or activity of Bak, Bax, McI-I, BCI-XL and/or Noxa in a biological sample obtained from a subject and determining whether the level of expression of genes encoding Bak, Bax, McI-I, BCI-X_L and/or Noxa and/or level or activity of Bak, Bax, McI-I, BCI-XL and/or Noxa is above or below a threshold level wherein a level of expression of genes encoding one or more of Bak, Bax, McI-I, BCI-X_L and/or Noxa and/or level or activity of Bak, Bax, McI-I, BCI-XL and/or Noxa which is above a threshold level is indicative of the presence of a disease and/or injury, or the propensity to develop a disease and/or injury, or the severity of a disease and/or injury in the nervous system of a subject.

In addition, some agents such ABT-737, do not work efficiently or are prone to induce chemoresistance. Hence, another aspect of the present invention contemplates determining levels of McI-I in cancer cells prior to or during ABT-737 treatment.

Accordingly, another aspect of the present invention provides a method of treating cancer in a subject, said method comprising screening cancer tissue in said subject to determine levels of McI-I and administering to said subject ABT-737 alone if McI-I levels are low compared to a control or ABT-737 in combinationwith a Mcl-1 and/or BCI-XL lowering agent if Mcl-1 levels are high compared to a control. Examples of Mcl-1 or BCI-XL modulating agents include cytokines, chemical agents, and/or genetic agents. Noxa is also an example of a protein which modulates the level or activity of McI- 1.

Reference herein to "biological sample" includes any biological sample obtained from a subject. Examples of suitable samples include those obtained from cells, a biological fluid (such as blood, plasma, serum, urine, bile, saliva, tears, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion).

Samples may also be obtained from any organ or tissue (including a biopsy or autopsy specimen) or may comprise cells (including primary cells, passaged or cultured primary cells, cell lines, cells conditioned by a specific medium) or medium conditioned by cells. In preferred embodiments, a biological sample is free of intact cells. If desired, the biological sample may be subjected to prior processing, such as lysis, extraction, subcellular fractionation, and the like, see, e.g., Deutscher (Ed), Methods Enzymol 752:147-238, 1990.

The present invention also facilitates the development of a medical assessment system in the form of an animal model of apoptosis characterized by abnormal levels of one or more of Bak, Bax, Mcl-1, Bcl-x_L and/or Noxa. By "abnormal" means high or low levels.

The animal models of the present invention are preferably genetically modified organisms.

Reference herein to a "genetically modified organism" refers to an organism that contains within its genome a specific gene that has been modified. Modification to a gene occurs, inter alia, when the nucleic acid sequence comprising the gene is disrupted and/or mutated. Disruption and mutation may comprise single or multiple nucleic acid insertions, deletions, substitutions or combinations thereof. Disruption and/or mutation in a gene may, for example, alter the normal expression of the gene by enhancing or inhibiting (partially or totally) the expression of the RNA and protein which the gene encodes.

The genetically modified organism of the present invention may be a non-human primate (e.g. gorilla, macaque, marmoset), livestock animal (e.g. sheep, cow, horse, donkey, pig), companion animal (e.g. dog, cat), laboratory test animal (e.g. mouse, rabbit, rat, guinea pig, hamster), captive wild animal (e.g. fox, deer, horse, donkey), reptile or amphibian (e.g. cane toad), fish (e.g. zebrafish) or any other organism (e.g. C. elegans). Preferably, the genetically modified organism is a mouse.

Techniques for constructing genetically modified organisms are well known in the art (see, e.g., Hogan et al, Manipulating the Mouse Embryo : A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, 1986; Robertson (Ed), Teratocarcinomas and Embryonic Stem Cells : A Practical Approach. IRL Press, Washington DC, 1987; Mansour et al, Nature 336:348-352, 1988; Capecchi et al, Trends Genet 5:70-76, 1989a, Capecchi et al, Science 244:1288-1292, 1989b; Pickert, Transgenic Animal Technology : A Laboratory Handbook, Academic Press, San Diego, CA, 1994).

In generating the genetically modified organism of the present invention a targeting construct may be used. Reference herein to a "targeting construct" refers to an artificially constructed segment of genetic material which can be transferred into selected cells. The targeting construct can integrate with the genome of the host cell in such a position so as to enhance or inhibit (partially or entirely) expression of a specific gene.

The targeting construct may be produced using standard methods known in the art (e.g. Sambrook and Russell, Molecular Cloning : A Laboratory Manual, 3^rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001; Ausubel (Ed), Current Protocols in Molecular Biology, 5^th Edition, John Wiley & Sons, Inc, NY, 2002).

The targeting construct of the present invention may also comprise a positive selection marker. Examples of selectable markers include genes conferring resistance to compounds such as antibiotics, genes conferring the ability to grow on selected substrates, genes encoding proteins that produce detectable signals such as luminescence. A wide variety of such markers are known and available, including, for example, antibiotic resistance genes, such as the neomycin resistance gene (neό) and the hygromycin resistance gene (hyg). Selectable markers also include genes conferring the ability to grow on certain media substrates such as the tk gene (thymidine kinase) or the hprt gene (hypoxanthine phosphoribosyltransferase) which confer the ability to grow on HAT medium (hypoxanthine, aminopterin and thymidine); and the bacterial gpt gene (guanine/xanthine phosphoribosyltransferase) which allows growth on MAX medium (mycophenolic acid, adenine and xanthine). Other selectable markers for use in mammalian cells and plasmids carrying a variety of selectable markers are well known in the art.

The preferred location of the marker gene in the targeting construct will depend on the aim of the gene targeting. For example, if the aim is to inhibit target gene expression, then the selectable marker can be cloned into targeting DNA corresponding to coding sequence in the target gene. Alternatively, if the aim is to express an altered product from the target gene or to enhance expression of the target gene, then the selectable marker can be placed outside of the coding region, for example, in a nearby intron.

The selectable marker may depend on its own promoter for expression and the marker gene may be derived from a very different organism than the organism being targeted (e.g. prokaryotic marker genes used in targeting mammalian cells). However, it is preferable to replace the original promoter with transcriptional machinery known to function in the recipient cells. A large number of transcriptional initiation regions are available for such purposes including, for example, metallothionein promoters, thymidine kinase promoters, β-actin promoters, immunoglobulin promoters, SV40 promoters and human cytomegalovirus promoters. A widely used example is the pSV2-«eo plasmid which has the bacterial neomycin phosphotransferase gene under control of the SV40 early promoter and confers in mammalian cells resistance to G418 (an antibiotic related to neomycin). A number of other variations may be employed to enhance expression of the selectable markers in animal cells, such as the addition of a poly(A) sequence and the addition of synthetic translation initiation sequences. Both constitutive and inducible promoters may be used.

The targeting construct of the present invention may also comprise loxP and fit sites to facilitate site specific recombination in the presence of ere and flp recombinase respectively.

The development of the targeting construct of the present invention facilitates its introduction into a host cell. Reference herein to a "host cell" includes an individual cell or cell population that can be or has been a recipient for the incorporation of nucleic acid molecules. Host cells include progeny of a single host cell, and the progeny may not necessarily be genetically identical to the original parent due to natural, accidental or deliberate mutation. A host cell includes those cells transfected with the targeting constructs of the present invention.

A host cell in the context of the present invention is preferably derived from a non-human primate (e.g. gorilla, macaque, marmoset), livestock animal (e.g. sheep, cow, horse, donkey, pig), companion animal (e.g. dog, cat), laboratory test animal (e.g. mouse, rabbit, rat, guinea pig, hamster), captive wild animal (e.g. fox, deer, horse, donkey), reptile or amphibian (e.g. cane toad), fish (e.g. zebrafish) or any other organism (e.g. C. elegans). In the most preferred embodiment of the invention the host cell is derived from a mouse.

Various techniques for introducing a targeting construct into a host cell, either in vivo or in vitro, are well known in the art and include, but are not limited to, microinjection, viral- mediated transfer and electroporation. In a preferred embodiment of the present invention, the targeting construct is introduced into the host cell by electroporation. In the electroporation process, electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the construct into the host cell. The pores created during electroporation permit the uptake of macromolecules such a nucleic acids (Potter et al, Proc Natl Acad Sci U.S.A. 81:7161-7165, 1984). The host cell of the present invention can be any host cell whose genome is capable of homologous recombination. Reference herein to "homologous recombination" refers to the exchange of nucleic acid regions between two nucleic acid molecules at the site of homologous nucleotide sequences.

The present invention contemplates stem cells or embryonic stem (ES) cells or embryonic cells or embryos for use in generating an organism which produces substantially higher levels of Bak, Bax, McI-I, BCI-XL and/or Noxa or produces substantially lower levels of Bak, Bax, McI-I, BCI-XL and/or Noxa or is substantially incapable of producing Bak, Bax, McI- 1 , BCI-XL and/or Noxa.

The preferred host cell of the present invention is an ES cell which is typically derived from pre-implantation embryos maintained in vitro (see, e.g., Evans et al, Nature 292:154- 156, 1981; Bradely et al, Nature 309:255-258, 1984; Gossler et al, Proc Natl Acad Set U.S.A. 83:9065-9069, 1986 and Robertson et al, Nature 322:445-448, 1986). The ES cells are cultured and prepared for introduction of the targeting construct using methods well known to a person skilled in the art (see, e.g., Hogan et al, 1986 supra; Robertson (Ed), 1987 supra). The ES cells that will be inserted with the targeting construct are derived from an embryo or blastocyst of the same species as the developing embryo into which they are to be introduced. ES cells are typically selected for their ability to integrate into the inner cell mass and contribute to the germ line of an individual when introduced into the mammal in an embryo at the blastocyst stage of development. Thus, any ES cell line having this capability is suitable for use in the practice of the present invention.

After the targeting construct has been introduced into the host cells, the cells in which successful gene targeting has occurred are identified. Insertion of the targeting construct into the targeted gene is typically detected by identifying cells for expression of the marker gene as described hereinbefore. In a preferred embodiment, the cells transformed with the targeting construct of the present invention are subjected to treatment with an appropriate agent that selects against cells not expressing the selectable marker. Only those cells expressing the selectable marker gene survive and/or grow under certain conditions. Successful recombination may be identified by analyzing the DNA of the selected host cells to confirm homologous recombination. Various techniques known in the art, such as PCR and/or Southern analysis may be used to confirm homologous recombination events.

Selected host cells that have undergone successful homologous recombination are then injected into a blastocyst (or other stage of development suitable for the purposes of creating a viable organism, such as, for example, a morula) to form chimeras. Alternatively, selected ES cells can be allowed to aggregate with dissociated embryo cells to form the aggregation chimera. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster organism and the embryo brought to term. Chimeric progeny harboring the homologously recombined DNA in their germ cells can be used to breed organisms in which all cells of the organism contain the homologously recombined nucleic acid. In one embodiment, chimeric progeny mice are used to generate an organism with a heterozygous modification in one allele of the target gene. Heterozygous genetically modified organisms can then be interbred. It is well known in the art that typically 25% the offspring of such matings will have a homozygous modification to both alleles in the target gene.

The heterozygous and homozygous genetically modified organism of the present invention can then be compared to a non-genetically modified organism of the same species to determine whether mutant target causes changes in the phenotype of said genetically modified organism. Reference herein to "phenotype" should be understood as a reference to the totality of the characteristics, or any particular characteristic or set of characteristics, of a cell and/or organism as determined by interaction of the genotype of the cell and/or organism with the environment in which it exists.

In one embodiment, the genetically modified organism of the present invention produces substantially higher levels of Bak, Bax, McI-I, Bcl-x_L and/or Noxa or produces substantially lower levels of Bak, Bax, McI-I, Bcl-x_L and/or Noxa or is substantially incapable of producing Bak, Bax, McI-I, BCI-X_L and/or Noxa. T/AU2006/000376

- 59 -

In a preferred embodiment, the present invention provides a genetically modified organism producing substantially lower levels of Bak, Bax, McI-I, BCI-XL and/or Noxa or that is substantially incapable of producing Bak, Bax, McI-I₅ BCI-XL and/or Noxa as a result of homozygous or heterozygous modifications of the target allele compared to a non- genetically modified organism of the same species.

Reference herein to "substantially lower levels" and "substantially incapable" refers to zero amounts to about 90% of the normal amounts such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 64, 66, 67, 68, 69, 70, 71, 72, 73, 74,75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90% lower amounts.

The genetically modified organism of the present invention may be in the form of the mature organism or may be, for example, in the form of the immature organism (e.g. embryos) for transplantation. The immature organism is preferably maintained in a frozen state and may optionally be sold with instructions for use.

It should also be understood that the present invention also provides a genetically modified cell comprising the targeting construct described hereinbefore. These cells may be derived from any suitable source, such as the genetically modified organism described hereinbefore, or may be generated by any suitable means, such as the means described hereinbefore for introducing a targeting construct into a host cell. Such cells include stem cells and embryonic cells which are preferably maintained in a frozen state and may be sold for use in generating an organism which produces substantially higher levels of Bak, Bax, McI-I, BCI-XL and/or Noxa or produces substantially lower levels of Bak, Bax, McI-I, BCI-XL and/or Noxa or is substantially incapable of producing Bak, Bax, McI-I, BCI-XL and/or Noxa. The present invention is further described by the following non-limiting Examples. The Examples refer to or rely on the following experimental procedures:

Expression, retroviral and RNAi constructs FLAG-tagged mammalian expression vectors (in pEF PGKpuro) for Bcl-2 or BCI-X_L, and HA-tagged Bax or Bak have been described (Huang et al, EMBO Jl 6:4628-4638, 1997b; O'Connor et al, EMBO J 17:384-395, 1998; Willis et al, 2005 supra), as have retroviral expression constructs expressing Bims, Bims 4E or Bini_L, and HA-tagged Bad, Noxa or Noxa 3E (Chen et al, 2005b supra). Constructs for HA-tagged tBid (amino acids 60-195 of mouse Bid), and FLAG-tagged human Bcl-2 or BCI-XL were made by sub-cloning into the same pMIG retroviral vector. The retroviral constructs that target McI-I and/or Al (Figure 14) replaced residues 51-76 of human Bims with residues 68-93 of mouse Noxa (BH3 B; (Oda et al, 2000) or a mutant of this (E74F). In pMIH retroviral constructs, the GFP cassette of pMIG is replaced by a hygromycin B resistance gene to link expression of human Noxa or Noxa 3E (Figures 12B, C and D), and FLAG-tagged human Bcl-2, BcI -XL or Al (Figure 14), to that of the selectable marker. All cDNAs used are of human origin except for mouse Bad and Bid. Retroviral vectors for RNA interference were constructed by ligating annealed oligonucleotides encoding short hairpin sequences into the pRetroSuper vector (Brummelkamp et al, Cancer Cell 2:243-247, 2002). The human McI-I short hairpin targets the sequence 5'-GCAAGAGGATTATGGCTAA (SEQ ID NO:1). The hairpin oligonucleotides are:

McI-I Sense: 5'-GATCCCCGCAAGAGGATTATGGCTAATTCAAGAGATT AGCCATAATCCTCTTGCTTTTTGGAAA (SEQ ID NO:2)

McI-I anti-sense: 5'- AGCTTTTCCAAAAAGCAAGAGGATTATGGCTAATCTCTTG AATTAGCCATAATCCTCTTGCGGG (SEQ ID NO:3)

The control short hairpin targets the mouse caspase-12 sequence 5' GGCCACATTGCCAATTCCCA (SEQ ID NO:4).

All constructs were verified by sequencing. Tissue culture, retroviral infections, cell death induction and apoptosis assays

Cell lines (FDC-Pl: mouse myelomonocytic, MCF-7: breast epithelial, HeLa CCL-2: human cervical carcinoma, Eμ-myc mouse B lymphoma, Phoenix Ecotropic packaging cells) and mouse embryonic fibroblasts (MEFs) were all cultured in Dulbecco's Modified Eagles (DME) medium supplemented with 10% v/v fetal calf serum (FCS), and in some cases also with 250μM L-asparagine, 50μM 2-mercaptoethanol or 1,000 U/mL IL-3 (for FDC-Pl cells). MEFs used in some experiments (Figures 9, 10) were as described (Cheng et al, 2001 supra); other C57BL/6-derived MEFs (Figures 12, 14, 15, 16) have been described (Willis et al, 2005 supra). Eμ-myc B lymphoma cells were derived from lymphomatous tissue arising in an Eμ-myc transgenic mouse (Adams et al, Nature 375:533-538, 1985) on the C57BL/6 genetic background. Bax/Bak DKO cells re- expressing HA-tagged Bax or Bak and FDC-Pl cells expressing FLAG-tagged Bcl-2 and BCI-X_L have been described (Huang et al, Oncogene /4/405-414, 1997a; Willis et al, 2005 supra).

MEFs or Eμ-myc lymphoma cells expressing Noxa, Noxa3E, Bad, Bcl-2 or BCI-XL were generated by retrovirally infecting the cells with pMIG retroviruses (Chen et al, 2005b supra). Retroviral constructs were transiently transfected into Phoenix Ecotropic packaging cells and viral supernatants were used to infect cells as described (Chen et al, 2005b supra). To allow infection of MCF-7 or HeLa cells (Figure 12), these cells were first transfected with an expression plasmid encoding mouse ecotropic retroviral receptor by nucleofection (Amaxa). Twenty-four hours later, the cells were infected with retroviruses (Noxa, Noxa 3E or RNAi constructs) that had been packaged in Phoenix cells, and the antibiotic-resistant (hygromycin or puromycin) cells were then expanded.

Cell death was induced by retroviral infection with constructs expressing BH3-only proteins (Chen et al, 2005b supra); by continuous exposure for the indicated times to HA14-1 (Calbiochem), BH3I-1 (Chembridge), Compound 6, Antimycin A (Sigma), Chelerythrine chloride (Calbiochem), Gossypol (Sigma), ABT-737 (Abbott Pharmaceuticals) (Oltersdorf et al, 2005 supra), Cytosine Arabinoside (Ara-C; Pharmacia), Etoposide (Pharmacia), Seliciclib (R-roscosvitine/CYC202; Sigma) or Cycloheximide (Sigma); by 10 Gy γ-irradiation (provided by a 60Co source); or by IL-3 deprivation of FDC-Pl cells (Vaux et al, Nature 555:440-442, 1988). Cell viability was quantified by flow cytometric analysis of cells excluding 5 μg/mL PI (Sigma) using a FACScan (Registered Trade Mark) (BD). At each time point, the assay was performed in triplicate on multiple independent clones of each genotype and the experiments repeated at least 3 times. In some experiments, the cells were cultured in the presence of a broad-spectrum caspase inhibitor, 50μM zVAD.fmk (Bachem). Long-term survival (colony) assays were performed by plating equal numbers of retrovirally infected cells and scoring for GFP+ve clones 6 d later (Chen et al, 2005b supra). Equal numbers of cells in replicate wells were exposed to ABT-737 (lμM), HA14-1 (50μM) or Antimycin A (50μM); the media and drug were replenished after 72 h and scored for macroscopically visible colonies on day 7. The results are presented as a percentage of the number of colonies formed in the presence of drug relative to that in its absence.

Flow cytometric analysis

Transgene expression was confirmed by flow cytometric analysis, as previously described (Huang et al, 1997b supra), or by immunoblotting of cell lysates. Cytochrome c release was assayed as described (Waterhouse et al, 2004 supra) using the mouse monoclonal anti-cytochrome c antibody (6H2.B4; BD) and Bax activation using the mouse monoclonal anti-Bax clone 3 (BD) as previously described (Willis et al, 2005 supra). The samples were analyzed using a FACScan [Registered Trade Mark] (BD).

In vitro cytochrome c release assays Cells were pelleted and lysed in 0.05% w/v digitonin containing lysis buffer (20 mM Hepes pH 7.2, 100 mM KCl, 5 mM MgC12, 1 mM EDTA, 1 mM EGTA, 250 mM sucrose, supplemented with Complete Protease Inhibitor Cocktail from Roche). The crude lysates, containing mitochondria, were incubated with 0 or 5μM ABT-737 for 1 h at 30°C, before pelleting at 13,000 rpm at 4⁰C for 5min. The supernatant was retained as the soluble (S) fraction while the pellet (P), which contains intact mitochondria, was solubilized in RIPA buffer. Affinity measurements and solution competition assays

Affinity measurements were performed at room temperature on a Biacore 3000 biosensor as previously described (Chen et al, 2005b supra) using a 26-mer human (Ace. no. S58873) BakBH3 or mutant L78A peptide (Mimotopes, Australia): Bak(67-92) PSSTMGQVGRQLAIIGDDINRRYDSE (SEQ ID NO:5), where alanine replaces the highly conserved leucine 78 (underlined) (Huang and Strasser Cell 103:839-842, 2000 supra) in the mutant peptide L78A. All recombinant proteins used were described previously (Chen et al, 2005b supra).

EXAMPLE 1 McI-I degradation promotes activation of Box andBak

To investigate how DNA damaging agents provoke activation of Bak and Bax, it was examined whether UV-irradiation altered the expression of Bcl-2 family proteins in HeLa cells. Consistent with recent observations (Nijhawan et al, Genes and Developmkent 17:1475- 1486, 2003), McI-I was rapidly degraded following UV-irradiation, and this was accompanied by caspase-3 processing (Figure IA). In contrast, the levels of Bcl-2, BCI-XL, Bcl-w, Bax and Bak remained unchanged (Figure IA and (Hausmann et al, Journal of Cell Biology 1491623-634, 2000; Wilson-Annan et al, Journal of Cell Biology /62:877-888, 2003)). Pre-incubation of cells with the proteasome inhibitor MG- 132 blocked UV-induced degradation of McI-I and caspase-3 cleavage (Figure IA). By contrast, pre-treating cells with the wide-spectrum caspase inhibitor zVAD.fmk did not impair McI-I degradation.

As Bak and Bax levels were unaffected by UV-irradiation (Figure IA), tests were carried out to show if their activation was somehow related to McI-I degradation. Both Bak (Griffiths et al, 1999 supra) and Bax (Hsu et al, 1997 supra; Wolter et al, 1997 supra; Hsu and Youle, 1998 supra) change conformation when activated by numerous stress stimuli, and these changes can be readily detected in permeabilized cells using antibodies that recognize only the activated conformers of Bak [clone Ab-I] (Griffiths et al, 1999 supra) or Bax (clone 3) (Dewson et al, Oncogene 22:2643-2654, 2003). Following UV-irradiation, flow cytometric analysis revealed that a population of cells harboring activated Bak appeared within 2 hours and accumulated subsequently (Figure IB, upper panels). Strikingly, pre-treatment with the proteasome but not the caspase inhibitor prevented Bak activation (Figure IB). Activation of Bax followed similar kinetics, and it then translocated into the pellet fraction accompanied by cytochrome c release. Importantly, the activation of Bax (as detected using conformation- specific antibodies), its translocation and the cytochrome c release were all prevented by proteasome inhibition. Thus, the McI-I degradation triggered in HeLa cells by UV-irradiation (Nijhawan et al, 2003 supra) is closely coupled to activation of Bak and Bax. EXAMPLE 2 In fibroblasts UV-induced apoptosis is mediated primarily by Bak, not Box

As either Bax or Bak can carry out almost all cytotoxic responses (Lindsten et al, 2000 supra; Cheng et al, 2001 supra; Wei et al, 2001 supra; Zong et al, 2001 supra), it was anticipated that either protein would mediate UV-killing equally. Since UV-irradiation of mouse embryo fibroblasts (MEFs) also resulted in McI-I degradation, assessment could also be made of relative roles of Bax and Bak in this response using MEFs that contained only one of these proteins.

Comparison was first made to the sensitivity of immortalized wild-type (wt) MEFs with those lacking both Bax and Bak (DKO) and DKO clones engineered to express either HA-tagged Bax (denoted DKO Bax) or Bak (DKO Bak). The levels of exogenous HA-tagged Bax and Bak in these lines were comparable, as judged by HA staining, and marginally higher than that of the endogenous proteins (Figure 2A). As expected, loss of both Bax and Bak rendered wt MEFs resistant to killing induced by etoposide, while the DKO MEFs expressing either Bax or Bak regained high sensitivity (Figure 2B). Unexpectedly however, the sensitivity of DKO MEFs to UV-irradiation was restored to a much greater extent by re-expression of Bak compared to Bax (Figure 2B), indicating that Bak has a more central role in this response.

To preclude any confounding effects due to immortalization of the MEFs, tests were also made to freshly isolated, non-transformed MEFs. The UV-induced death of the primary fibroblasts also proceeded mainly via Bak: three days after a high dose of UV-irradiation (200 J/m²), over 90% of the fibroblasts expressing Bak alone (i.e. the Bax^'Λ MEFs) were dead, whereas over 50% of the Bax-expressing (Bak^{" "}) fibroblasts remained alive (Figure 2C). Thus, whereas Bax and Bak are equally proficient in mediating apoptosis induced by etoposide, Bak plays the dominant role in UV-induced killing of MEFs. In accord with these killing assays, Bax was activated in Bak^"A fibroblasts by etoposide treatment but not by UV- irradiation at this time point (Figure 2D). Thus, in MEFs, unlike HeLa cells (Figure 1), UV- irradiation predominately activates Bak. EXAMPLE 3

Bak associates in healthy cells specifically with McI-I andBcl-X_L

To account for the unique role of Bak in the UV-induced apoptosis of MEFs, it was reasoned that Bak might be directly regulated by a restricted sub-set of the pro-survival

Bcl-2-like proteins. If so, it seemed likely that their association would be mediated by binding of the Bak BH3 domain to the groove on the latter (Sattler et al, 1997 supra).

Therefore, it was first tested, in solution competition assays using an optical biosensor

(Biacore) (Chen et al, 2005a supra), whether a (26-mer) peptide spanning the BH3 region of Bak could bind recombinant pro-survival Bcl-2-like proteins. Strikingly, the BakBH3 peptide bound tightly to both McI-I and BCI-XL but only weakly to Bcl-w and not detectably to Bcl-2 (Figure 3A).

Since an isolated BakBH3 peptide had high affinity for McI-I and BCI-X_L, assessment was made whether any of the pro-survival proteins bind full-length Bak by co- immunoprecipitation from cell lysates. Immune complexes isolated from 293T cells over- expressing comparable amounts of McI-I, Bcl-2, BCI-XL, Bcl-w, or Al were tested for associated endogenous Bak. In accord with the affinity measurements (Figure 3A), McI-I and BCI-XL bound Bak but no significant binding was observed between Bak and Bcl-2, Bcl-w or Al (Figure 3B). Furthermore, sub-cellular fractionation showed that most endogenous McI-I and BCI-X_L co-localized with Bak to the membrane-associated (pellet) fraction of healthy HeLa cells (Figure 3C). In contrast to the lack of interaction between Bcl-2 and Bak (Figs. 3A, 3B), endogenous Bak was found in complex with endogenous McI-I and BCI-XL in the pellet fraction (Figure 3D). As expected (Hsu et al, 1997 supra; Wolter et al, 1997 supra; Hsu and Youle, 1998 supra), Bax was predominantly cytosolic (Figure 3C), and the small portion of membrane-associated Bax in healthy cells was not complexed with McI-I or BCI-XL (Figure 3D).

The association of pro-survival proteins with Bax is promoted when non-ionic detergents (e.g. Triton-X-100) but not certain others (e.g. CHAPS) are used for cell lysis (Hsu and

Youle, 1997 supra). Although no such findings have been reported for Bak, it was shown that Bak formed complexes with BCI-X_L and McI-I not only in lysates made with Triton-X- 100 (Figure 3B₃ 3D) but also in those prepared with CHAPS (Supplemental Figure S2). This is consistent with two other recent studies (Cuconati et al, Genes Dev 17:2922-2932, 2003; Leu et al, Nat Cell Biol (5:443-450, 2004). Collectively, these interaction and localization studies suggest that in healthy cells McI-I and BCI-XL directly sequester Bak, but not Bax.

EXAMPLE 4

Bak BH3 is required for both its sequestration by MCI-1/BCI-X_L and its dimerization and killing activity

Binding studies (Figure 3A) indicate that the BH3 domain of Bak mediates its association with McI-I and BCI-X_L. AS expected (Sattler et al, 1997 supra), the binding of the BH3 peptide to these proteins was greatly impaired when the highly conserved leucine in the Bak BH3 (L78) was replaced by alanine (Figure 4A). To explore whether the Bak BH3 domain is required for association of the full-length proteins, the L78 A mutation was engineered into Bak. Importantly, this subtle mutation ablated the interaction of Bak with McI-I (Figure 4B).

The BH3 region of Bak seems to be required not only for its interaction with other Bcl-2 family members but also for its pro-apoptotic function (Chittenden et al, EMBO Journal

74:5589-5596, 1995). Various apoptotic stimuli induce Bak to associate into homo-oligomers and to form higher order complexes that also contains Bax (Wei et al, 2001 supra; Mikhailov et al, 2003 supra). Formation of these complexes is thought to be critical for the killing activity of Bak (and Bax) (reviewed in (Korsmeyer et al, Cell Death and Differentiation 7:1166-1173, 2000)). Interestingly, while over-expressed wild-type Bak readily associated with endogenous Bax or Bak, the Bak L78A mutant failed to do so significantly (Figure 4B).

This result suggests that the BH3 region of Bak is essential for its oligomerization.

In accord with the inability of Bak L78A to associate with itself or with Bax (Figure 4B)₅ the mutant proved to lack pro-apoptotic activity. Whereas wild-type Bak readily restored the sensitivity of MEFs lacking Bax and Bak (DKO MEFs) to apoptotic stimuli (Figures 2, 4C), the L78A mutant was inert (Figure 4C), even though it was expressed at levels comparable to the wild-type protein and was also located in the membrane-associated compartment (Figure 4D). These results indicate that the BH3 domain of Bak is required not only for its sequestration by pro-survival McI-I and BCI-XL but also for its oligomerization and hence its pro-apoptotic activity.

EXAMPLE 5 Noxa can both displace Bak from McI-I and promote McI-I degradation

A Bak BH3 peptide binds tightly to the hydrophobic groove on Bcl-x_L (Sattler et al, 1997 supra) and the very similar hydrophobic groove demonstrated recently in McI-I (Day et al, 2005 supra) presumably is responsible for the observed Bak BH3 binding (Figures 3 A, 4A). As the BH3 regions of the BH3-only proteins also target these grooves (Petros et al, Protein Science P:2528-2534, 2000; Liu et al, Immunity /P:341-352, 2003), their binding to McI-I may well displace Bak.

To test this model, the BH3-only protein Noxa was focused upon since UV-irradiation of MEFs leads to elevated levels of Noxa (Oda et al, Science 255:1053-1058, 2000; Shibue et al, Genes Dev 77:2233-2238, 2003) it was shown that Noxa binds tightly to McI-I but not significantly to Bcl-2, BCI-XL or Bcl-w (Chen et al, 2005a supra). Hence, exploration of how increased Noxa expression affected the composition of endogenous Bak immune complexes, initially in 293T cells. Consistent with the proposed model, over-expressed Noxa bound McI-I tightly and displaced Bak. In contrast, the inert Noxa mutant 3E, which cannot bind McI-I due to three mutations in its BH3 region (Chen et al, 2005a supra), was unable to do so (Figure 5A). Since Noxa itself does not directly bind Bak or Bax (Figure 5A), this BH3-only protein is likely to promote Bak activation by displacing it from McI-I.

Unexpectedly, enforced Noxa expression in transformed MEFs also triggered marked degradation of McI-I, whereas the level of BCI-XL was unaffected (Figure 5B). This McI-I degradation, like that observed following UV-treatment (Figure 1), required proteasome activity (Figure 5C). It also seems to require association of the proteins, because DKO MEF cells transduced with a Noxa retrovirus had lost most of their McI-I, whereas McI-I was spared in cells infected with a virus encoding the non-binding mutant Noxa 3E (Figure 5B). Furthermore, McI-I degradation was reduced when røoxα-deficient MEFs were UV-irradiated.

These surprising and novel findings suggest that Noxa not only displaces Bak from McI-I (Figure 5A) but also promotes McI-I degradation (Figures 5B, 5C), both of which can contribute to Bak activation. Noxa expression alone, however, is not sufficient to mediate the UV-induced apoptosis of MEFs. Noxa over-expression is well tolerated by wild-type MEFs (Chen et al, 2005a supra) (see below). Conversely, noxa deficiency only confers limited protection to MEFs from UV-induced apoptosis (Shibue et al, 2003 supra), unlike the marked protection afforded by the loss of both Bax and Bak (Figure 2). Hence, McI-I is unlikely to be the sole guardian of Bak.

EXAMPLE 6 Neutralization of both McI-I and BCI-X_L drives efficient Bak-mediated apoptosis

The binding studies (Figure 3) herein implicate BCI-X_L as a second pro-survival regulator of Bak, but MEFs also express Bcl-2 and Bcl-w, albeit not Al (Chen et al, 2005a supra). To determine which pro-survival proteins govern Bak-mediated death, advantage was taken of the recent finding that different BH3-only proteins target particular subsets of the Bcl-2-like proteins (Figure 6A) (Chen et al, 2005a supra). As expected, Puma, which targets all pro- survival proteins, killed Bak-expressing (Bax^';") MEFs as effectively as wild-type cells, but Bax/Bak-deficient cells were spared (Figure 6B). In contrast, no significant apoptosis was induced by either Noxa, which targets only McI-I, or by BimsBadBFD (BadBH3 within an inert Bim backbone (Chen et al, 2005a supra)), which targets BCI-XL, Bcl-w and Bcl-2 (Figure 6B), even though both of the BH3-only proteins were adequately expressed. Significantly, however, the Noxa plus Bad combination, which together neutralizes all four of these pro- survival proteins (Figure 6A), induced potent Bak-mediated apoptosis (Figure 6C).

A Noxa mutant (Noxa m3) engineered to engage BCI-XL (and Bcl-w) was also tested in addition to McI-I (Chen et al, 2005b supra) (Figure 6A). Noxa m3 efficiently killed the fibroblasts in a Bak-dependent manner in both a short-term assay (Figure 6C) and in a long- term assay of colony formation (Figure 6D). Since Noxa m3 does not bind Bcl-2 (Chen et al, 2005a supra), it was concluded that Bak can be activated and cell death induced without neutralizing Bcl-2. Moreover, both Bcl-2 and Bcl-w appear irrelevant to the direct control of Bak, because neither bound Bak (Figure 3).

EXAMPLE 7 Loss of Bcl-xi, but not Bcl-2, sensitizes MEFs to Noxa killing

These findings led to the hypothesize that McI-I and BCI-XL are the only direct regulators of Bak. Since Noxa only antagonizes McI-I (Chen et al, 2005a supra), the poor killing of wild- type MEFs by Noxa (Figure 6B) would be explained if BCI-XL acts as a second brake on Bak activation. If so, loss of BCI-X_L should sensitize MEFs to Noxa-induced killing, whereas loss of Bcl-2 should have no impact (Figure 7A).

To test this model, the effect of forced Noxa expression was compared on wild-type MEFs and MEFs lacking BCI-XL or Bcl-2 (Figure 7B). In accord with the hypothesis, Bcl-x_L- deficient MEFs infected with a Noxa retrovirus died rapidly (Figure 7C) and failed to form colonies (Figures 7D, 7E). In striking contrast, the absence of Bcl-2 had no effect (Figures 7C-E). When BCI-XL was re-introduced into Bcl-X_L-null cells (Figure 7F), resistance to Noxa induced killing was restored (Figure 7G). The re-introduced BCI-XL also markedly augmented clonogenic survival of the cells, whereas Bcl-2 overexpression, at comparable levels, only had a minor impact (Figure 7H). From these findings, it was concluded that Bcl-2 is irrelevant for Bak-mediated cell death (Figure 7A). EXAMPLE 8 Therapeutic potential of selectively activating Bak

Since BH3-only proteins are key initiators of apoptosis, there is a need to develop drugs that kill tumor cells by mimicking their inactivation of pro-survival targets. The appeal of such 'BH3-mimetics' is that upstream sensors of cellular damage (e.g. p53) are often defective in tumor cells and that certain pro-survival Bcl-2 proteins, particularly Bcl-2 itself, are over- expressed in many tumors (Cory et al, 2003 supra). Furthermore, their overexpression contributes to chemoresistance, a common cause of treatment failure (Kaufmann and Vaux, 2003 supra).

In accordance with the present invention, drugs are developed based on inactivation of McI-I and BCI-X_L and/or promoting Noxa binding to BCI-XL. It is noteworthy that this approach bypasses Bcl-2, because Bcl-2 has no role in regulating Bak. This is a major advantage, since Bcl-2 overexpression is common in tumors. The efficient killing elicited by the engineered Noxa mutant m3 indicates that it serves as the prototype for a strategy based upon unleashing Bak.

EXAMPLE 9 Putative BH3 minietics do not kill like BH3-only proteins

BH3-only proteins require Bax or Bak to kill mouse embryo fibroblasts (MEFs) (Cheng et al, 2001 supra; Zong et al, 2001 supra). Thus, infection with retroviruses encoding Bim or tBid induced rapid death of wild-type MEFs, but not of MEFs lacking both Bax and Bak (Figure 9A). Hence, it was tested whether Bax/Bak-deficient cells were also resistant to killing by several small chemical entities reported to be BH3 mimetics. When HA 14-1 (Wang et al, Proc Natl Acad Sci USA 27:7124-7129, 2000), BH3I-1 (Degterev et al, Nat Cell Biol 5:173-182, 2001), Compound 6 (Enyedy et al, J Med Chem 44:4313-4324, 2001), Antimycin A (Tzung et al, Nat Cell Biol 3:183-191, 2001), Chelerythrine (Chan et al, J Biol Chem 275:20453-20456, 2003) and Gossypol (Kitada et al, J Med Chem 4(5:4259-7430, 2003) were tested at concentrations reportedly effective on other cell types, the Bax/Bak-deficient cells proved to be as sensitive as wild-type cells (Figures 9C-H). In the absence of both Bax and Bak, it was found that long-term survival of MEFs over- expressing a BH3-only protein such as Bim is also unaffected, as illustrated by a clonogenic assay (Figure 91). The two putative BH3 mimetics tested, however, eliminated all clonogenic growth of Bax/Bak-deficient cells (Figure 9J). These results indicate that none of these six compounds functioned solely as BH3 mimetics, as they killed predominantly by mechanisms that are not mediated by Bax or Bak. This finding probably reflects their much lower binding affinities (μM range) for pro-survival targets than the BH3-only proteins (nM range) (Chen et al, 2005b supra; Petros et al, 2000 supra). Solution competition assays with an optical biosensor confirmed the weak affinities of some of the compounds (HA14-1, BH3I-1, Antimycin A, Gossypol) for their putative targets (Figure 9B).

EXAMPLE 10 ABT- 737, a Bad-like BH3 mimetic compound

In contrast to these compounds, by a solution competition assay (Chen et al, 2005b supra), the BH3 mimetic ABT-737 (Oltersdorf et al, 2005 supra) showed high affinity binding to Bcl-2, BCI-XL and Bcl-w (IC₅₀ <10 nM), but not detectably to the more divergent McI-I or Al (Figure 10A). Direct binding studies using isothermal calorimetry confirmed tight stoichiometric (1:1) binding of ABT-737 to BCI-XL, akin to the binding of Bim. As shown in Figures 1OA and B, ABT-737 targets the same subset of pro-survival proteins as the BH3-only protein Bad (Chen et al, 2005b supra). EXAMPLE 11 ABT-737 kills through Bax/Bak, but efficient killing also requires Mcl-1 neutralization

On its own, ABT-737 was found to kill only a subset of tumor cells (Oltersdorf et al, 2005 supra). When tested with MEFs, ABT-737 had weak cytotoxic activity on wild-type cells but none on Bax/Bak-deficient ones (Figure HA). Even after 48 h of exposure with the maximal dose of ABT-737 tested (10 μM), -80% of wild-type MEFs remained viable (Figure 1 IA)₅. and several other cell types, including cells of hematopoietic or epithelial origin, gave comparable results

Bad, which has the same binding profile as ABT-737 (Figure 10), also fails to kill MEFs efficiently, but its cytotoxic action is potently augmented by co-expression of Noxa, which selectively targets Mcl-1 and Al (Figure 10B) and promotes Mcl-1 degradation (Chen et al, 2005b supra; Willis et al, 2005 supra). Since Al is not expressed in MEFs (Chen et al, 2005b supra; Willis et al, 2005 supra), these findings suggested that inability to bind Mcl-1 accounts for the weak pro-apoptotic activity of ABT-737. Hence, it was tested whether Noxa could sensitize wild-type MEFs to ABT-737. As expected (Willis et al, 2005 supra), expression of wild-type Noxa, but not a non-binding Noxa mutant (3E), triggered marked Mcl-1 degradation (Figure HB inset). Importantly, Noxa sensitized the cells to ABT-737 at least several hundred fold (Figure HB). In striking contrast to the wild-type MEFs₅ Bax/Bak-deficient MEFs remained entirely resistant in both a short-term viability (Figure 11C) and long-term clono genie assays (Figure 11D). When Noxa had neutralized McI-I₅ ABT-737 could kill MEFs expressing either Bax or Bak, but the killing was more efficient in the presence of both Bax and Bak (Figure 11C).

It is concluded that ABT-737 can induce killing mediated by Bax or Bak, but that its selective binding profile limits its cytotoxicity in MEFs. EXAMPLE 12 McI-I neutralization sensitizes diverse cell types to ABT-737

The potent sensitization of MEFs to ABT-737 by McI-I neutralization prompted us to investigate whether other cell types could be similarly sensitized. Like MEFs, the myelomonocytic cell line FDC-Pl was refractory to ABT-737 (EC₅₀ >10μM), and introduction of Noxa alone did not impair viability of untreated FDC-Pl cells. Strikingly, however, the over-expressed Noxa increased the sensitivity of the myeloid cells to ABT- 737 over 2,000 fold (EC₅₀ ~ 5 nM; Figure 12A). In contrast, as anticipated from the similar binding profiles of ABT-737 and Bad (Figure 10B), introduction of Bad did not render the cells more sensitive to the drug, nor did the inert Noxa mutant 3E (Figure 12A).

The effect of neutralizing McI-I was also tested on two human carcinoma cell lines, both of which were refractory to ABT-737 alone. Imniunoblots showed that McI-I levels were markedly down-regulated either by over-expressing Noxa or by RNAi against McI-I in both MCF-7 breast epithelial cells (Figure 12B) and HeLa cervical epithelial cells (Figure 12C). The stringent test of colony formation then revealed that both ways of reducing the McI-I level potently sensitized these cells to ABT-737. In striking contrast, when McI-I levels were unperturbed (eg. by the inert Noxa mutant or the vector control), long-term growth was not impaired by ABT-737 (Figures HD, 12B, 12C). Thus, ABT-737 appears to lack non-specific toxicity on diverse cultured cells.

EXAMPLE 13 ABT-737 initiates apoptosis by inactivating pro-survival proteins

ABT-737 kills sensitized cells through a pathway that requires Bax or Bak (Figures HC, 1 ID). It was confirmed that this killing was apoptosis by showing that loss of plasma membrane integrity (measured by uptake of propidium iodide) required caspase activity

(Figure 13A) and that the death was associated with release of cytochrome c from mitochondria (Figure 13B). ABT-737 also caused Bax/Bak-dependent cytochrome c release from mitochondria in vitro, but only when McI-I had been neutralized with Noxa (Figure 13).

It was next considered whether the drug could kill by directly activating Bax/Bak, as proposed for certain BH3-only proteins (Kuwana et al, MoI Cell 7:525-535, 2005; Letai et al, Cancer Cell 2:183-192, 2002). Direct activation of either by ABT-737 appeared very unlikely because most cell types, which contain both Bax and Bak, tolerate high concentrations of the drug with no apparent ill effects (Oltersdorf et al, 2005 supra) (Figures 11, 12). Furthermore, it was established that ABT-737 does not bind Bax and, when used on cells, does not trigger Bax to undergo the conformational alteration characteristic of its activation (Willis et al, 2005 supra), unless McI-I is also inactivated with Noxa or by McZ-I RNAi (Figure 13D).

It is concluded that ABT-737 causes Bax/Bak activation indirectly by binding tightly and selectively to Bcl-2, BCI-X_L and Bcl-w (FigurelO). Its cytotoxic activity is complemented by Noxa, which targets McI-I, but not by Bad (Figures 11, 12, 13). EXAMPLE 14

AB T-737 effectively counters overexpression ofBcl-2

When ABT-737 is used alone, the experiments above (Figures 11 to 13) strongly implicate McI-I as an important predictor of responsiveness. Al₅ the other pro-survival protein that the drug fails to bind (Figure 10), is not expressed in most tumor cell lines, including MCF-7 and HeLa cells (Su et al, Proc Natl Acad Sci USA 99:4465-4470, 2002), nor in MEFs (Willis et al, 2005 supra). To allow tests of whether Al reduces the response to ABT-737, a variant Noxa BH3 that is highly selective for McI-I over Al and other pro- survival proteins were exploited, namely mouse Noxa BH3 B (mNoxaB), as well a mutant of it (E74F) that binds both McI-I and Al (Figure 14). Each was placed within an inert Bims backbone, and introduced with retroviruses into MEFs engineered to overexpress Al. When treated with ABT-737, the McI-I -specific ligand (mNoxaB) was less effective at blocking colony growth than the E74F mutant that binds both guardians (Figure 14B). Thus, Al can also reduce responsiveness to ABT-737, albeit not as greatly as McI-I.

Since tumors often overexpress Bcl-2 or BCI-X_L (Cory et al, 2003 supra), the impact of their overexpression was also tested. Even when McI-I was inactivated (by expressing Noxa), BCI-XL overexpression conferred limited resistance to ABT-737 (Figure 14C), perhaps by raising the level of ABT-737 targets. Surprisingly, however, Bcl-2 overexpression did not prevent ABT-737-induced death (Figure 14C), even though its level was sufficient to inhibit Etoposideinduced apoptosis (Figure 14D). Thus, if McI-I is inactivated, Bcl-2 overexpression does not diminish killing by ABT-737 activity and BCI-X_L overexpression does so only moderately. This suggests that combining ABT-737 with strategies to inactivate McI-I has therapeutic potential, even in the many tumors where Bcl-2 markedly elevated. EXAMPLE 15

Synergy between ABT-737 and genotoxic agents, even in the face ofBcl-2 overexpression

One therapeutic strategy would be to combine ABT-737 with genotoxic agents, as several lead to McI-I down-regulation (Cuconati et al, 2003 supra; Nijhawan et al, 2003 supra; Willis et al, 2005 supra), in part by p53-induced up-regulation of Noxa (Shibue et al, 2003 supra; Villunger et al, Science 302:1036-1038, 2003). Therefore, ABT-737 and genotoxic drugs should exhibit synergy. Indeed, in accord with results in other cell types (Oltersdorf et al, 2005 supra), ABT-737 sensitized FDCPl cells, by at least 100-fold, to apoptosis induced by Cytosine Arabinoside (Ara-C), Etoposide and γ-irradiation.

As chemoresistance mediated by overexpression of Bcl-2 or BCI-XL is a major clinical problem (Cory et al, 2003 supra; Kaufmann and Vaux, 2003 supra), it was assessed whether the synergy persisted in FDC-Pl cells engineered to overexpress these guardians. The engineered cells were indeed resistant to treatment with Ara-C, Etoposide, or γ- irradiation [Figure 15A] (Huang et al, 1997a supra). As reported with other triggers of DNA damage (Cuconati et al, 2003 supra; Nijhawan et al, 2003 supra; Willis et al, 2005 supra), all three genotoxic agents reduce McI-I levels in the myeloid cells (Figure 15B). Notably, even in the face of the over-expressed Bcl-2 or BCI-XL, ABT-737 showed striking synergy with all three genotoxic agents (Figures 15C, 15D).

The Bcl-2 over-expressing cells were sensitized ~100-fold, and the BCI-XL ones at least 5- fold. Similar effects were observed in Eμ-røyc B lymphoma cells engineered to overexpress Bcl-2 or BCI-XL- Curiously, in every case, the sensitization was greater in cells over-expressing Bcl-2 than BCI-XL, even though Bcl-2 was expressed at higher levels than BCI-XL. EXAMPLE 16 Removing cytokine support sensitizes cells over-expressing Bcl-2 or BCI-X_L to ABT-737

Since sensitizing cells to ABT-737 with genotoxic agents (Figure 15) may be less effective in the many tumors where p53 mutations blunt genotoxic responses, consideration was given to alternative strategies to counter McI-I. As McI-I expression is usually maintained by cytokines in hematopoietic cells (Kozopas et al, Proc Natl Acad Sci USA 90:3516-3520, 1993), it was reasoned that eliminating cytokine support might well sensitize such cells to ABT-737, even if Bcl-2 were over-expressed. FDC-Pl cells over-expressing Bcl-2 or BCI-XL, which tolerate IL-3 deprivation for prolonged periods (Vaux et al, 1988 supra). Upon IL-3 withdrawal, the McI-I levels dropped significantly and levels of the BH3-only protein Bim rose (Figure 16A), but the over-expressed Bcl-2 or BCI-XL prevented apoptosis. Nevertheless, the IL-3-deprived Bcl-2-over-expressing cells were now readily killed by ABT-737, their sensitivity rising by ~three orders of magnitude (Figure 16B). The starved FDC-Pl cells over-expressing BCI-XL were also sensitized to ABT-737, albeit to a much lesser degree (Figure 16B). These results indicate that combining ABT-737 with selected cytokine antagonists, to reduce McI-I levels, is an effective strategy to eliminate Bcl-2-over-expressing malignancies in vivo.

EXAMPLE 17 Inhibitors of McI-I production also sensitize cells to ABT-737

Since both McZ-I niRNA and McI-I protein have very short half-lives (Craig, Leukemia 76:444-454, 2002), strategies that reduce synthesis at either level may render cells sensitive to ABT-737. Notably, the cyclin-dependent kinase inhibitor Seliciclib (R- roscovitine/CYC202), now in Phase II clinical trials, has recently been shown to act by blocking production of McM mRNA (MacCallum et al, Cancer Res (55:5399-5407, 2005; Raje et al, Blood 706:1042-1047, 2005). Indeed, it was found that both Seliciclib and the protein synthesis inhibitor cycloheximide (CHX) reduced McI-I levels (Figure 16C) and markedly boosted the action of ABT-737 in HeLa carcinoma cells (Figure 16D) and modestly augmented it in MEFs. Thus, strategies exploiting the lability of McI-I have promise.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

BIBLIOGRAPHY

Adams et al, Nature 575:533-538, 1985

Adams, Genes and Development 77:2481-2495, 2003

Akimaru et al, Cytokines MoI Ther 1 : 197-210, 1995

Altschul et al, Nucl Acids Res 25:3389-3402, 1997

Alving et al, Immunol Rev 145:5-31, 1995

Antonsson et al, Journal of Biological Chemistry 276:11615-11623, 2001

Ausubel et al, "Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994- 1998

Ausubel (Ed), Current Protocols in Molecular Biology, 5^th Edition, John Wiley & Sons, Inc, NY, 2002

Bandyopadhyay and Temin, MoI Cell Biol 4:749-754, 1984

Berglund et al, Biotechnology 77:916-920, 1993

Berkner et al, BioTechniques 6:616-629, 1988

Berkner, Curr Top Microbiol Immunol 158:39-66, 1992

Bonner and Laskey EurJBiochem 46:83-88, 1974

Bradely et al, Nature 309:255-258, 1984 Breakefield and Geller, MolNeurobiol 7:339-371, 1987

Brummelkamp et al, Cancer Cell 2:243-247, 2002

Buchschacher and Panganiban, J Virol 66:2131-2139, 1982

Capecchi et al, Trends Genet 5:70-76, 1989a

Capecchi et al, Science 244:1288-1292, 1989b

Cartron et al, MoI Cell 7.6:807-818, 2004

Chan et al, J Biol Chem 275:20453-20456, 2003

Chen et al, MoI Cell 77:393-403, 2005a

Chen et al, Molecular Cell 17:292-403, 2005b

Cheng et al, Molecular Cell 8:105-111, 2001

Chittenden et α/, EMBO Journal 14:5589-5596, 1995

Cory and Adams, Nature Reviews Cancer 2:641-656, 2002

Cory et al, Oncogene 22:8590-8607, 2003

Craig, Leukemia 7(5:444-454, 2002

Cuconati et al, Genes Dev 17:2922-2932, 2003 Danial and Korsmeyer, Cell 116:205-219, 2004

Day et al, The Journal of Biological Chemistry 250:4738-4744, 2005

Degterev et al, Nat Cell Biol 5:173-182, 2001

Deutscher (Ed), Methods Enzymol 182:147-238, 1990

Dewson et al, Oncogene 22:2643-2654, 2003

Egleton and Davis, Peptides 75:1431-1439, 1997

Enyedy et al, J Med Chem 44:4313-4324, 2001

Evans et al, Nature 292:154-156, 1981

Fink et al, Hum Gene Ther 3:1-19, 1992

Fink et al, Ann Rev Neurosci 19:265-287, 1996

Fix, Pharm Res 75:1760-1764, 1996

Freese et al, Biochem Pharmaco. 40:2189-2199, 1990

Geysen International Patent Publication No. WO84/03564

Gorziglia and Kapikian, J Virol <5<5:4407-4412, 1992

Gossler et al, Proc Natl Acad Sci U.S.A. 83:9065-9069, 1986

Green and Kroemer, Science 305:626-629, 2004 Griffiths et al, Journal of Cell Biology 144:903-914, 1999

Hausmann et al, Journal of Cell Biology 1491623-634, 2000

Helseth et al, J Virol 64:2416-2420, 1990

Hinds et al, EMBO J 22:1491 Λ501 , 2003

Hodgson, BioTechnology 9:19-21, 1991

Hogan et al, Manipulating the Mouse Embryo : A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, 1986

Hsu et al, Journal of Biological Chemistry 272:13289-13834, 1997

Hsu et al, Proceedings of the National Academy of Sciences of the United States of America 94:3668-3672, 1997

Hsu and Youle, Journal of Biological Chemistry 275:10777-10783, 1998

Huang et al, Oncogene ./4:405-414, 1997a

Huang et al, EMBO Jl 6:4628-4638, 1997b

Huang and Strasser, Cell 103:839-842, 2000

Johnson et al, J Virol 66:2952-2965, 1992

Johnson et al, Peptide Turn Mimetics in Biotechnology and Pharmacy, Pezzuto et al, Eds., Chapman and Hall, New York, 1993 Kaufmann and Vaux, Oncogene 22:7414-7430, 2003

Kitada et al, J Med Chem 46:4259-1 '430, 2003

Korsmeyer et al, Cell Death and Differentiation 7:1166-1173, 2000

Kozopas et al, Proc Natl Acad Sci USA 90:3516-3520, 1993

Kuwana et al, Cell 111:331-342, 2002

Kuwana et al, MoI Cell 7:525-535, 2005

Langer, Science 249:1527-1533, 1990

Letai et al, Cancer Cell 2:183-192, 2002

Leu et al, Nat Cell Biol 5:443-450, 2004

Lindsten et al, Molecular Cell 6:1389-1399, 2000

Liu et al, Immunity 79:341-352, 2003

Lucken-Ardjomande and Martinou, J Cell Sci 775:473-483, 2005

MacCallum et al, Cancer Res 55:5399-5407, 2005

Madzak et a/, JGe« Virol 73:1533-1536, 1992

Mann and Baltimore, J Virol 54:401-407, 1985 Mansour et al, Nature 336:348-352, 1988

Margolskee, Curr Top Microbiol Immunol 158:67-95, 1992

Marmur and Doty JMo/ Biol 5Ll 09-118, 1962

Mikhailov et al, Journal of Biological Chemistry 27(5:18361-18374, 2001

Mikhailov et al, Journal of Biological Chemistry 278:5367-5376, 2003

Miller et al, MoI Cell Biol 5:431-437, 1985

Miller et al, J Virol 52:4337-4345, 1988

Miller, Curr Top Microbiol Immunol 158:1-24, 1992

Misra et al, JPharm Pharm Sci 5:252-273, 2003

Moss, Curr Top Microbiol Immunol 158: 5-38, 1992

Moss, Proc Natl Acad Sci USA 25:11341-11348, 1996

Munder et al, Appl Microbiol Biotechnol 52:311-320, 1999

Muzyczka, Curr Top Microbiol Immunol 158:97-129, 1992

Naldini et al, Science 272:263-267, 1996

Nechushtan et α/, EMBO Journal 18:2330-2341, 1999

Nechushtan et al, Journal of Cell Bilogy 153:1265-1276, 2001 Nijhawan et al, Genes and Development 77:1475-1486, 2003

O'Connor et al, EMBO Journal 77:384-395, 1998

Oda et al, Science 2SS:1053-1058, 2000

Ohi et al Gene §9:279-282, 1990

Oltersdorf Nature 435:677-681, 2005

Oltvai et al, Cell 74:609-619, 1993

Page et al, J Virol 64:5270-5276, 1990

P 'atton, Nat Biotech 7(5:141-143, 1998

Petropoulos et al, J Virol 66:3391-3397, 1992

Petros et al, Protein Science P:2528-2534, 2000

Pickert, Transgenic Animal Technology : A Laboratory Handbook. Academic Press, San Diego, CA, 1994

Potter et al, Proc Natl Acad Sci U.S.A. 81:7161-7165, 1984

Putney and Burke, Nat Biotech 76:153-157, 1998

Quantin et al, Proc Natl Acad Sci USA SP:2581-2584, 1992

Raje et al, Blood 106:1042-1047 , 2005 Remington's Pharmaceutical Sciences, 18^th Edition, Mark Publishing Company, easton, PA₅ USA, 1990

Robertson (Ed), Teratocarcinomas and Embryonic Stem Cells : A Practical Approach. IRL Press, Washington DC, 1987

Robertson et al, Nature 522/445-448, 1986

Rosenfeld et al, Cell 55:143-155, 1992

Roucou et al, BiochemicalJournal 368:915-921, 2002

Russell and Hirata, Nat Genetics /5:323-328, 1998

Samanen et al, J Pharm Pharmacol 45:119-135, 1996

Sambrook and Russell, Molecular Cloning : A Laboratory Manual, 3^rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001

Sattler et al, Science 275:983-986, 1997

Sayani and Chien, CritRev Ther Drug Carrier Syst 75:85-184, 1996

Schinzel et al, J Cell Biol 764:1021-1032, 2004

Schneider et al, Nat Genetics 75:180-183, 1998

Shibue et al, Genes Dev 77:2233-2238, 2003

Shimada et al, JCUn Invest 55:1043-1047, 1991 Sorge et al, MoI Cell Biol 4:1130-1131, 1984

Stratford-Perricaudet et al, Hum Gene Ther 1:241-256, 1990

Su et al, Proc Natl Acad Sci USA 99:4465-4410, 2002

Summerton and Wellex, Antisense and Nucleic Acid Drug Devel 7: 187-195, 1997

Suntres and Shek, JPharm Pharmacol 46:23-2%, 1994

Suzuki et al, Cell 103:645-654, 2000

Szoka and Papahadjopoulos, Ann Rev Biophys Bioeng 9:461-508, 1980

Tzung et al, Nat Cell Biol 5:183-191, 2001

Vaux et al, Nature 355:440-442, 1988

Villunger et al, Science 302:1036-1038, 2003

Vutla et al, JPharm Sci 85:5-8, 1996

Wang et al, Molecular and Cellular Biology 75:6083-6089, 1998

Wang et al, Proc Natl Acad Sci USA 97:1124-1129, 2000

Wang, Genes and Development 15:2922-2933, 2001

Waterhouse et al, Methods MoI Biol 284:301-313, 2004 Wei et al, Genes and Development 14:2060-2071, 2000

Wei et al, Science 292:727-730, 2001

Wells, Methods Enzymol 202:2699-2705, 1991

Wilkinson et al, Nucleic Acids Res 20:233-2239, 1992

Willis et al, Genes Dev 7P:1294-1305, 2005

Wilson-Annan et al, Journal of Cell Biology 7(52:877-888, 2003

Wolter et al, Journal of Cell Biology 139:1281-1292, 1997

Woodle et al, Pharm Res 9:260-265, 1992

Young et al, Nat Biotechnol 16:946-950, 1998

Zalipsky et al, Bioconjug Chem (5:705-708, 1995

Zha and Reed, Journal of Biological Chemistry 272:31282-31488, 1997

Zong et al, Cell 121:1085-1095, 2001

Zong et al, Journal of Cell Biology 162:59-69, 2003

Claims

CLAIMS:

1. A method for inducing apoptosis of a eukaryotic cell said method comprising reducing the level and/or activity of BCI-XL and McI-I for a time and under conditions sufficient for a pro-apoptotic protein rendered non-toxic through interaction with BCI-X_L and/or McI-I to become cytotoxic and thereby induce apoptosis of said cell.

2. The method of Claim 1 wherein the pro-apoptotic protein is selected from Bak and Bax.

3. The method of Claim 2 wherein the pro-apoptotic protein is Bak.

4. The method of Claim 2 wherein the pro-apopototic protein is Bax.

5. The method of Claim 1 or 2 or 3 or 4 wherein the eurkaryotic cell is a cancer or tumor cell.

6. The method of Claim 5 wherein the cancer or tumor cell is a human cancer or tumor cell.

7. The method of Claim 1 or 6 wherein the level of BCI-XL and/or McI-I is reduced via genetic means.

8. The method of Claim 7 wherein the genetic means is RNAi or antisense inhibitor of expression of a gene encoding BCI-X_L and/or McI-I.

9. The method of Claum 1 or 6 wherein the activity of BCI-X_L and/or McI-I is inhibited by a chemical molecule.

10. The method of Claim 1 or 7 or 8 or 9 wherein ABT-737 is administered in combination with a genetic or chemical agent or cytokine.

11. A method of treating cancer in a mammalian subject, said method comprising inducing apoptosis of cancer cells by reducing the level or activity of BCI-XL and McI-I in said cancer cell for a time and under conditions sufficient for a pro-apoptotic protein rendered non-toxic through interaction with BCI-XL and/or McI-I to become cytotoxic and thereby induce apopotosis of said cancer cell.

12. The method of Claim 11 wherein the pro-apoptotic protein is selected from Bak and Bax.

13. The method of Claim 12 wherein the pro-apoptotic protein is Bak.

14. The method of Claim 12 wherein the pro-apopototic protein is Bax.

15. The method of Claim 11 wherein the level of BCI-XL and/or McI-I is reduced via genetic means.

16. The method of Claim 15 wherein the genetic means is RNAi or antisense inhibitor of expression of a gene encoding BCI-X_L and/or McI-I.

17. The method of Claum 11 wherein the activity of BCI-X_L and/or McI-I is inhibited by a chemical molecule.

18. The method of Claim 11 or 15 or 16 or 17 wherein ABT-737 is administered in combination with a genetic or chemical agent or cytokine.

19. Use of one or more agents which reduce the level or activity of BCI-XL and McI-I in the manufacture of a medicament in the treatment of cancer.

20. Use of Claim 19 wherein at least one agent is ABT-737.

21. Use of Claim 19 or 20 wherein the cancer is a human cancer.

22. A composition comprising at least two agents reduces the level or activity of BCI-XL and at least agent reduces the level or activity of McI-I and one or more pharmaceutically acceptable carriers and/or diluents.

23. A method of treating cancer in a subject, said method comprising screening cancer cells in said subject to determine levels of McI-I and administering to said subject ABT- 737 alone if McI-I levels are low compared to a control or ABT-737 in combinationwith a McI-I and/or BCI-XL lowering agent if McI-I levels are high compared to a control.