WO2006090933A1 - Hepatitis c virus particles and method of proliferating the same - Google Patents

Abstract

It is intended to provide proliferated HCV with which the replication of HCV gene and the formation and release of HCV particles can be efficiently conducted and a method of proliferating the same. A method of proliferating HCV particles by using a hydrogel-forming polymer the aqueous solution of which is in the state of a fluid sol at a temperature lower than the sol-gel transmission temperature but reversibly converted into a hydrogel at a temperature higher than the sol-gel transmission temperature. At a temperature higher than the sol-gel transmission temperature, a mixture of cells having HCV enclosed therein with an aqueous solution of the hydrogel-forming polymer as described above is gelled and then the cells are cultured in this state.

Description

 Hepatitis C virus particles and their propagation

Technical field

 The present invention relates to a proliferated hepatitis C virus (hereinafter referred to as “: HCV”) particle and a method for propagating the same.

 Background art

 HCV is a virus that describes human liver parenchymal cells as the host, and the HCV gene was cloned in 1898. Using various gene expression systems, the characteristics of each viral antigen were clarified. As a result, a very effective diagnostic system was developed, which enables accurate diagnosis of hepatitis C, and post-transfusion hepatitis. The outbreak was almost suppressed.

 On the other hand, a cultured cell line that efficiently replicates and propagates HCV has not yet been established. In recent years, self-replicating levicon cells of the HCV gene have been produced, but virus particle formation has not been successful. Although significant progress has been made in the study of gene replication mechanisms using levicon cells, there are still many unclear points regarding the mechanism of HCV infection, invasion, and particle formation. For this reason, the development of therapeutic drugs and vaccines has not progressed sufficiently. As an animal experiment system, an HCV infection model using chimpanzee has been established, but it is very expensive, lacks reproducibility due to individual differences, and is also very limited in terms of animal welfare. There are problems such as.

In the culture system of human hepatocytes, fetal hepatocytes, primary cultured cells using surgically excised liver tissue, or established cell lines derived from primary hepatocellular carcinoma are used. However, the former is not easy to obtain, poor proliferative The latter is disadvantageous in that dedifferentiation has progressed and the original hepatocyte function has been reduced. In epithelial cells such as liver parenchymal cells, it is known that cells are three-dimensionally cultured to form the original cell polarity and to express differentiation functions. It has been reported that when human hepatocytes are three-dimensionally cultured with an artificial liver device such as a bioreactor, production of liver proteins such as albumin and drug metabolism functions are enhanced (Patent Document 1).

 (Patent Document 1) International Publication WO 0 1 Z 1 4 5 1 7 Disclosure of Invention

 An object of the present invention is to provide a proliferating H C V that eliminates the above-mentioned drawbacks of the prior art, and a proliferating method thereof.

 Another object of the present invention is to provide a proliferating H C V that can efficiently perform gene replication of H C V, formation of H C V particles, and release of H C V particles from cells, and a method of proliferating the same.

 As a result of earnest research, the inventor has obtained a gel state using a hydrogel-forming polymer that becomes a fluid sol state at a temperature lower than the sol-gel transition temperature and reversibly becomes a hydrogel state at a temperature higher than the sol-gel transition temperature. It has been found that culturing cells containing HCV particles using this system is extremely effective for achieving the above object.

 The cultured HCV particles of the present invention are based on the above findings. More specifically, HCV (hepatitis C virus) —RNA and HCV—core are formed in the same fraction formed by centrifugation under a concentration gradient. It is characterized by the presence of protein.

Further, according to the present invention, a hydrogel-forming polymer is used in which the aqueous solution becomes a fluid sol state at a temperature lower than the sol-gel transition temperature and reversibly becomes a hydrogel state at a temperature higher than the sol-gel transition temperature. Mixing an aqueous solution of the gel-forming material in a fluid sol state at a temperature lower than the sol-gel transition temperature and cells containing the grown HCV particles; and at a temperature higher than the sol-gel transition temperature, the mixture is gelled The cells are cultured in such a state that HCV particles are released from the cells, and the mixture is solated at a temperature lower than the sol-gel transition temperature to recover or detect the HCV particles released from the cells. A method for growing HCV particles is provided.

 Furthermore, according to the present invention, there is provided a method for evaluating an antiviral agent using HCV particles produced by the above proliferation method.

 As described above, according to the present invention, a TGP (Thermoreversible gelation polymer) used as a simple and versatile matrix for tissue culture is used in a simple and easy manner. HCV can be cultured efficiently.

 TGP gel is a matrix using a temperature-sensitive polymer material. Contrary to agar gel and gelatin gel, TGP gel is an aqueous solution at a low temperature (15 X or less) and a gel at a high temperature (25 ° C or more). It becomes. Since it is easy to set the hardness of the gel within a range where cells and tissues can grow freely, three-dimensional culture of cells and the like is possible.

In addition, TGP gel melts easily by lowering the temperature, so it can be recovered with minimal damage to cells. Furthermore, unlike an artificial liver device, the TGP gel can arbitrarily select a culture scale from a small scale of about 0.1 mL to 10 O mL or more. It does not require special equipment such as a bioreactor. Therefore, it can be used for a variety of purposes, from screening high-throughput antiviral agents to large-scale preparation of virus particles. In the present invention, as a culture system, for example, a multiwell plate (for example, 6 wells, 1 2 holes, 2 4 wells, 9 6 wells 1 plate; usually made of plastic) used for clinical examinations, etc. Can be used. Brief Description of Drawings

 Fig. 1 is a phase contrast micrograph of HCV-expressing cells (R C YM 1) three-dimensionally cultured with TGP (A, B and C).

 Figure 2 is an electron micrograph of an HCV-expressing cell (R C YM 1) three-dimensionally cultured with TGP (D).

 Figure 3 is an electron micrograph of an HCV-expressing cell (R C YM 1) three-dimensionally cultured with TGP (E).

 FIG. 4 is a graph showing the presence of HC V—RNA in the culture supernatant.

 FIG. 5 is a graph showing the presence of HCV core protein in the culture supernatant.

 FIG. 6 is an electron micrograph of HCV particles released out of cultured cells (A 1.0 .4 g / m 1; B 1.18 g / m l).

 Figure 7 shows a TEM photograph (A anti-El, E2 antibody) and a negative control (primary antibody) showing a particle-like structure of 50–60 nm with gold colloid-labeled anti-HCV antibody bound thereto. 2 is a TEM photograph (B normal mouse serum) showing the state when an attempt was made to bind a gold colloid-labeled anti-HCV antibody to a mouse serum.

 FIG. 8 is a graph (A, B, C) showing the results of a sucrose density gradient analysis of the culture supernatant of R C YM 1 cells.

FIG. 9 is a photograph showing an example of an embodiment in which Huh-7 and RC YM 1 cells form spheres in TGP (A, a 1). Fig. 9B is an enlarged photograph of part (al) of Fig. 9A. FIG. 10 is a photograph showing an example of an embodiment in which Huh-7 and RC YM 1 cells form spheroids 3 in TGP (B, b 1). Figure 1

0 B is an enlarged photograph of the part (b 1) of FIG.

 Fig. 11 is a photograph showing an example of an embodiment in which Huh-7 and R C YM 1 cells form a sphaed in TGP (C, D, E, F,

G, H).

 Figure 12, HCV Yunha in R C YM 1 cells in TGP culture. It is a diagram showing the expression of the protein and the secretion of the virus molecule (A, B, C,

D).

 Fig. 13 shows the expression of HCV proteins and the secretion of virus molecules in R C YM 1 cells in TGP culture (E, F, G,

H).

 Figure 14 is an electron micrograph of an ultrathin section of R C YM l cells grown in TGP (A, B, C).

 Fig. 15 is an immunoelectron microscopic photoblind of ultrathin sections of R C YM 1 cells cultured in TGP (A, B, C)

 Figure 16 shows HC secreted from T C P cultured R C Y M 1 cells

FIG. 17 shows infectivity of V particles and neutralization of the infectivity (A, B). FIG. 17 shows inhibition of HC V particle production by IFN and RBV (A, B). BEST MODE FOR CARRYING OUT THE INVENTION

 Hereinafter, the present invention will be described more specifically with reference to the drawings as necessary. In the following description, “part” and “%” representing the quantity ratio are based on mass unless otherwise specified.

(Proliferated HCV particles) The proliferating HCV particles of the present invention are characterized by the coexistence of HCV (hepatitis C virus), single RNA and HC V-core protein in the same fraction formed by centrifugation under a concentration gradient. In the present invention, “HCV—RNA and HCV—core protein are both present” in “the same fraction formed by centrifugation under a concentration gradient” as described in Examples 1 to 3 described later. It can be easily confirmed under the experimental conditions.

 (H C V particle confirmation method)

 In the present invention, for example, the presence of HCV particles can be confirmed by the following method.

 (1) As described later, confirm that a new HCV gene has been formed by PCR in the culture supernatant of the HCV-containing cell culture system. (2) From this, it is presumed that “HCV” exists under the supernatant. (3) Furthermore, as shown in the examples described later, it is confirmed that both HC V—RNA and HC V—core exist in the same density fraction. (4) In addition, the presence of HCV particles can be confirmed by TEM (transmission electron microscope) observation of this density fraction.

 (Confirmation with gold colloid-labeled antibody)

 The presence of the HCV particles of the present invention can be reliably verified by an antigen-antibody reaction with an anti-HCV antibody labeled with a gold colloid. Such a reaction with the anti-HCV antibody can be performed, for example, under the conditions of “Example 4” described later.

 (HCV proliferation method)

In the HCV growth method of the present invention, the aqueous solution becomes a fluid sol state when the temperature is lower than the sol-gel transition temperature, and reversibly becomes a gel-like gel state when the temperature is higher than the sol-gel transition temperature. It is the feature to use. More specifically, in the present invention, an aqueous solution of the gel-forming material in a fluid sol state at a temperature lower than the sol-gel transition temperature is mixed with cells containing the grown HCV particles. Culturing the cells in a gelled state at a temperature higher than the sol-gel transition temperature and releasing HCV particles from the cells; and solating the mixture at a temperature lower than the sol-gel transition temperature; Collect HCV particles released from the cells.

 (HCV containing cells)

 The “HCV-containing cell” to be used in the present invention is not particularly limited as long as it can include HCV in the cell during the cell culture and proliferation. As the HCV-containing cells, for example, the following cells can be used (for details of such cells that can include HCV, see, for example, the literature Pietschmann, T. et al., Journal of Virology). 7 6; 40 0 8-2 1 (2 0 0 2). Aizaki, H. et al., Virology 3 1 4; 1 6-2 5 (2 0 0 3)).

 (Specific examples of HCV-containing cells)

 H uh 7 (Pietschmann, T. et al., Journal of Virology 7 6; 4 0 0 8-2 1 (2 0 0 2). Aizaki, H. et al. Virology 3 1 4; 1 6-2 5 (2 0 0 3 ))

 (Suitable HCV containing cells)

 From the viewpoint of H C V gene replication efficiency, Hu h 7 cells (for example, commercially available from the Human Science Research Resource Bank) can be preferably used as the H C V-containing cells.

 (One aspect of HCV proliferation method)

In the present invention, for example, HCV can be propagated as follows. (Introduction of HCV gene into HCV-containing cells) HCV can be transferred to HCV-containing cells (eg Hu h 7 cells) by conventional methods. Introduce genes (For information on such HCV gene introduction methods, see, for example, the literature Pietschmann, T. et al., Journal of Virology 7 6: 4 0 0 8-2 1 (2 0 0 2)) .

 (Culture of H C V-containing cells)

 (1) HCV-containing cells (eg, Huh cells) are cultured in a flask using a normal medium (Dulbecco medium).

 (2) Remove the proliferating cells from the flask wall by trypsinization (2 to 3 minutes) and resuspend them in Dulbecco's medium.

 (3) Count the cells using a blood cell counter and adjust the concentration (ie, the number of cells in a certain volume).

 (4) In a suitable container (for example, a test tube with a capacity of 10 cc), on ice, an aqueous solution of a sol-like gel mouth-forming polymer (for example, Meiviol Co., Ltd. (Hiratsuka, Kanagawa)) Mix the above suspension with “Meviol Giel”, commercially available from the company, and suspend evenly by pipetting.

 (5) Dispense the suspension into 6 well plates and cultivate it at 37 T: (The suspension containing the cells solidifies into a gel in about 5 minutes).

 (6) Overlay the Dulbecco medium warmed in 3-7 on the gel.

(7) Incubate for 7 to 10 days in a carbon dioxide incubator.

 (8) During the course, replace “Dulbecco medium at 37” every 4 days (by decantation).

 (H C V recovery)

(1) After the above culture, the lower layer is a gel and the upper layer is a supernatant (if it is a large container, the cooled medium is directly poured into this container, and the gel + supernatant is collected. May be recovered). This smell Since the container is a small test tube, the supernatant and gel are collected separately as shown below.

 (2) First, collect the supernatant. The remaining gel is put into a sol by refrigeration and suspended in a pre-cooled medium. This suspension is combined with the above supernatant.

 (3) Separate the cell supernatant by centrifugation.

 (4) Concentrate the supernatant by pelleting (ie, centrifuge to remove solids; however, it may be milder than pelleting, if necessary).

 (5) Suspend the pellet from the supernatant and centrifuge under a concentration gradient.

(6) As shown in the examples described later, HCV-RNA and core protein are present in the specific density fraction (ie, it is determined that HCV particles are present).

 (7) If necessary, confirm the H C V particles by TEM observation as shown in the examples described later.

 (Details of each material)

 Hereinafter, each material to be used in the present invention will be described in detail.

 (Eight-mouthed gel-forming polymer)

The hydrogel-forming polymer used in the present invention exhibits a thermoreversible sol-gel transition in which the aqueous solution becomes a sol state at a temperature lower than the sol-gel transition temperature and becomes a gel state at a temperature higher than the sol-gel transition temperature. “Hydrogel-forming high molecule” constituting the hydrogel in the present invention has a cross-linking structure or a network structure, and based on the structure, a dispersion liquid such as water is held in the inside. A polymer that has the property of forming a high-mouth gel. “Hide mouth gel” refers to a gel containing at least a cross-linked or network structure containing a polymer and water that is not supported or held in the structure (dispersed liquid). 3 The “dispersed liquid” retained in the cross-linked or network structure is not particularly limited as long as it is a liquid containing water as a main component. More specifically, the dispersion liquid may be water itself, and may be either an aqueous solution and / or a water-containing liquid. The water-containing liquid preferably contains 80 parts or more, more preferably 90 parts or more of water with respect to 100 parts of the whole water-containing liquid.

 Unless it is contrary to the object of the present invention, the dispersion liquid may contain an organic solvent (for example, a hydrophilic solvent such as ethanol having compatibility with water) or a contrast agent at a predetermined content.

 (Sol-gel transition temperature)

 In the present invention, the definition and measurement of “sol state”, “gel state” and “sol-gel transition temperature are described in the literature (H. Yoshioka et al., Journal of macromolecular Science, A 3 1 (1), 1 1 3 (1 9 9 4 )) Based on the definitions and methods described in)), that is, the dynamic modulus of the sample at an observation frequency of 1 Hz is measured by gradually changing the temperature from the low temperature side to the high temperature side (1/1 minute), The temperature at which the storage elastic modulus (G ′, elastic term) of the sample exceeds the loss elastic modulus (G〃, viscosity term) is defined as the sol-gel transition temperature. Yes, it is defined that the state of G and G ′ is a gel.In measuring the sol-gel transition temperature, the following measurement conditions can be suitably used.

Measurement conditions for dynamic and loss modulus>

Measuring instrument (trade name): Stress-controlled rheometer AR 500, sample solution (or dispersion) concentration of TA Instrument Co. (however, "Hide mouth gel-forming polymer with sol-gel transition temperature") Concentration): 10 (weight)% Sample solution volume: approx. 0.8 g Measurement cell shape · Dimensions: Acrylic parallel disk (diameter 4.0 cm), gap β Ο Ο ^ ιη Measurement frequency : 1 H z Applicable stress: Linear area In the region.

 In the present invention, from the viewpoint of preventing thermal damage of cells or cultured HCV particles, the sol-gel transition temperature is preferably higher than 0 ° C and not higher than 37 t, and more preferably from 5 ° C. It is preferably not higher than 3 5 ^ (particularly not less than 10 and not more than 3 3).

 Such a hydrogel-forming polymer having a suitable sol-gel transition temperature can be easily selected from the specific compounds described below according to the above-described screening method (sol-gel transition temperature measurement method). Can do. In the present invention, in the operation of gelling an aqueous solution of a gel gel-forming polymer and culturing HCV-containing cells, the above-mentioned sol-gel transition temperature (in a) is the same as the culturing temperature (in b) and injection. It is preferable to set the temperature between the cooling temperature (c ° C) for solification in the operation such as recovery. That is, it is preferable that a relation of b> a> c exists between the above three temperatures a :, b, and c ° C. More specifically, (b — a) is preferably 1 to 36 ° C, more preferably 2 to 30, and (a — c) is preferably 1 to 35 ° C, and more preferably 2 to 3 0 is preferred.

 (Followability of the aqueous solution of the hydrogel-forming polymer in the aqueous solution) In the present invention, the hydrogel based on the aqueous solution of the hydrogel-forming polymer has the following characteristics: It is preferable to exhibit solid behavior for higher frequencies, while exhibiting liquid behavior for lower frequencies. More specifically, the followability to the operation of the hydrogel can be suitably measured by the following method.

 (Measuring method for tracking performance)

In the present invention including a hydrogel-forming polymer, an aqueous solution of the hydrogel-forming polymer (1 mL as a hydrogel) is dissolved in a sol state (1 mL). Put it in a test tube with an inner diameter of 1 cm at a temperature lower than the sol-gel transition temperature), and a temperature sufficiently higher than the sol-gel transition temperature of the aqueous solution of the gel-forming polymer of the mouth opening (for example, about 10 higher than the sol-gel transition temperature). The test tube is held for 12 hours in a water bath at a temperature of 1 hour to gel the hydrogel.

Next, when the test tube is turned upside down, the time (T) until the interface of the solution Z air (meniscus) is deformed by its own weight is measured. Here, the hydrogel behaves as a liquid for operation at a frequency lower than 1 / T (sec—), and for operation at a frequency higher than 1 (sec— ¹ ), the hydrogel as a solid. It will behave. In the present invention, in the case of a hydrogel, T is 1 minute to 24 hours, preferably 0.5 minutes to 10 hours.

 (Steady flow viscosity)

 In the present invention, the gel-like properties of a hide-mouth gel based on an aqueous solution of an eight-mouth gel-forming polymer can also be suitably measured by measuring the steady flow viscosity. The steady flow viscosity can be measured, for example, by a creep experiment. In the creep experiment, a constant shear stress is applied to the sample and the temporal change in shear strain is observed. In general, in the cleaving behavior of a viscoelastic body, the shear rate changes with time, but after that the shear rate becomes constant. The ratio of shear stress to shear rate at this time is defined as steady flow viscosity 77. This steady flow viscosity is sometimes called Newtonian viscosity. However, the steady flow viscosity must be determined in a linear region that is almost independent of shear stress.

Specifically, a stress-controlled viscoelasticity measuring device (AR 500, TA Instruments, Inc.) is used as the measuring device, and an acrylic disc (diameter 4 cm) is used as the measuring device. Measurement time creep behavior (delay curve) of at least 5 minutes as the sample thickness 6 0 0 ^ 01 06304223 Observe. The sampling time is once per second for the first 100 seconds and then once every 10 seconds. When the decision of the application to shear stress (less scan g), shift angle loaded with 1 0 seconds shear stress 2 X 1 0 - set to the minimum value detected ³ rad or more. Use at least 20 measurements after 5 minutes for analysis. In the present invention, a hydrogel based on an aqueous solution of a hydrogel-forming polymer preferably has a force of s' 5 X 10 ³ to 1 X 1 0 ⁷ Pa · sec at 37 ° C. , more ^{8 X 1 0 3 ~ 8 X} 1 0 6 P a - sec, in particular ^{1 X 1 0 4 P a ·} sec or ^{more, 7 X 1 0 6 P a} · sec arbitrary preferred that less.

If the above τί is less than 5 × 10 ³ Pa · sec, the fluidity is relatively high even in short-time observation, and it is easy to move from within the cell culture system. On the other hand, when exceeds 1 X 1 0 ⁷ Pa · sec, the gel tends to show little fluidity even for long-term observation, and the aqueous solution of the hydrogel-forming polymer follows the deformation of the cell culture system. Insufficient sex. In addition, if exceeds 1 X 10 ⁷ Pa-sec, the possibility of the gel becoming brittle increases, and after a slight pure elastic deformation, the tendency to brittle fracture, which breaks all at once, is likely to occur.

 (Dynamic elastic modulus)

In the present invention, the gel property of the hydrogel based on the aqueous solution of the hydrogel-forming polymer can be suitably measured also by the dynamic elastic modulus. Amplitude in the gel? ·. , The distortion with the frequency ω / 2 π (t) =. When cosct (t is time) is given, constant stress is applied. , Σ (t) = σ with phase difference <5. Suppose that cos (ω t + δ) is obtained. | G | = a. / A. Then, the ratio of dynamic elastic modulus G '(ω) = IGI cos 0 and loss elastic modulus G "(ω) = IGI sin <5 (G"ZG') is an indicator of gel-like properties . JP2006 / 304223 In the present invention, a hydrogel based on an aqueous solution of an octagel-forming polymer behaves as a solid with respect to a strain of ω / 2 = 1 Η ζ (corresponding to a fast movement), and 6 / 2 兀 = 1 0—4 Behaves as a fluid to ⁴ ^ 12 distortion (corresponding to slow motion). More specifically, in the present invention, it is preferable that a hide-mouth gel based on an aqueous solution of a hide-mouth gel-forming polymer exhibits the following properties (for details of such elasticity measurement, for example, Reference: Ryohei Oda, edited by Modern Industrial Chemistry 19, pages 3 59, Asakura Shoten, 1 9 85).

 When ω / 2 π = 1 Η ζ (frequency at which the gel behaves as a solid)

(G "/ G ') s = (ta [eta] [delta]) It is preferred that s is less than 1 (more preferably not more than 08, particularly preferably not more than 0.5).

(G "ZG ') L = (tan δ) L is preferably 1 or more when ω / 2 7t = 1 0 to 1 ⁴ Hz (frequency at which the gel behaves as a liquid) <Is 1.5 or more, particularly preferably 2 or more).

 Preferably, the ratio {(tan δ) s / (ta η 6) L} between ± 13 κ tan δ) s and (tan S) L is less than 1 (more preferably 0.8 or less, particularly preferably Is less than 0.5).

 <Measurement conditions>

 Concentration of hydrogel-forming polymer in aqueous solution of hydrogel-forming polymer: approx. 8% by mass t: Degree of measurement: 3 7 Measuring instrument: Stress control type Rheomechi (Model name: AR 5 0 0, manufactured by TA Instruments Inc.) Shape of measurement cell · Dimensions: Stainless steel parallel disk (diameter 4.0 cm), gap 60 m Applicable stress: Within linear range.

 (Fluidity at low temperature)

In the present invention, an aqueous solution of a high HP gel-forming polymer is injected into a cell culture system at a low temperature, and therefore preferably has an appropriate viscosity at a low temperature. . Viscosity can be measured by normal static viscosity measurement.

 In the present invention, the aqueous solution of the hydrogel-forming polymer preferably has a viscosity at 10 ° C. of from 0.05 to 10 0 Pa · sec, more preferably from 0.001 to : L OP a 'sec, in particular, 0.1 l Pa to sec or more and 1 Pa to sec or less is preferable.

<Measurement conditions>

 Concentration of hydrogel-forming polymer in aqueous solution of hydrogel-forming polymer: Approx. 8% by mass Temperature: 10 ° C Measuring instrument: Stress-controlled rheometer (Model name: AR 500, TA insturmen Measurement cell shape · Dimensions: Stainless steel parallel disk (diameter 4.0 cm), gap 6 0 0 ΠΙ Applicable stress: Within the linear region.

 (Hide mouth gel-forming polymer)

 As long as it exhibits a thermoreversible sol-gel transition as described above (that is, having a gel gel transition temperature), it can be used in an aqueous solution of a gel-forming gel-forming polymer in the present invention. The polymer is not particularly limited.

 A specific example of a polymer in which the aqueous solution has a sol-gel transition temperature and reversibly shows a sol state at a temperature lower than the transition temperature is, for example, a block copolymer of polypropylene oxide and polyethylene oxide. Polyalkylene oxide block copolymers typified by polymers, etc .; etherified celluloses such as methylcellulose and hydroxypropylcellulose; chitosan derivatives (KR Holme et al., Macromolecules, 2 4, 3 8 2 8 (1 9 9 1)) etc. are known.

As a polyalkylene oxide block copolymer, pullulonic F-1 2 7 (trade name, BASF Wyandotte Chemica, with polypropylene oxide bonded to both ends of polypropylene oxide) Made by Is Co.) Gel has been developed. It is known that this high-concentration aqueous solution of Pluronic F- 1 2 7 becomes a high-mouth gel at about 20 or more, and an aqueous solution at a lower temperature. However, in the case of this material, it becomes a gel state only at a high concentration of about 20% by mass or more, and even if it is kept at a high concentration of about 20% by mass or more and higher than the gelation temperature, water is further added. If added, the gel will dissolve. Pull-mouth nick F- 1 2 7 has a relatively low molecular weight and not only exhibits a very high osmotic pressure in a high gel state of about 20% by mass or more, but also easily penetrates the cell membrane. May adversely affect the culture of

 On the other hand, in the case of etherified cellulose represented by methyl cellulose, hydroxypropyl cellulose, etc., the sol-gel transition temperature is usually high and is about 45 or more (N. Sarkar, J. Appl. Polyin. Scie). nce, 24, 1 0 7 3, 1 9 7 9). In contrast, since the temperature during cell culture is usually around 37, the etherified cell mouth is in a sol state, and the etherified cellulose is used as an aqueous solution of a hydrogel-forming polymer. It is practically difficult to use.

 As described above, the problems of conventional polymers that have a sol-gel transition point in the aqueous solution and reversibly show a sol state at a temperature lower than the transition temperature are as follows: 1) Once the gel is heated at a temperature higher than the sol-gel transition temperature. 2) The sol-gel transition temperature is higher than the cell culture temperature (near 37 ° C), and the body temperature is in the sol state. ) In order to make it gel, the polymer concentration in the aqueous solution needs to be very high, etc.

On the other hand, according to the study by the present inventors, a hydrogel-forming polymer (for example, a plurality of blocks having a cloud point), preferably having a sol-gel transition temperature higher than 0 and lower than 37. And a hydrophilic block, and the aqueous solution has a sol-gel transition temperature, In addition, it is known that the above problem can be solved when an aqueous solution of a hydrogel-forming polymer is formed using a polymer that exhibits a sol state reversibly at a temperature lower than the sol-gel transition temperature. .

 (Suitable hydrogel-forming polymer)

 In the present invention, a hydrogel-forming polymer using a hydrophobic bond that can be suitably used as an aqueous solution of a hydrogel-forming polymer is formed by combining a plurality of blocks having a cloud point and a hydrophilic block. Is preferred. The hydrophilic block is preferably present because the hide-mouthed gel becomes water-soluble at a temperature lower than the sol-gel transition temperature, and the plurality of blocks having cloud points have a sol-gel transition. It is preferable to exist in order to change to a gel state at a temperature higher than the temperature. In other words, a block having a cloud point dissolves in water at a temperature lower than the cloud point, and becomes insoluble in water at a temperature higher than the cloud point, so that the block forms a gel at a temperature higher than the cloud point. It serves as a cross-linking point that includes a hydrophobic bond. That is, the cloud point derived from the hydrophobic bond corresponds to the sol-gel transition temperature of the above hydrogel.

 However, the cloud point and the sol-gel transition temperature do not necessarily coincide with each other. This is because the cloud point of the “block having a cloud point” described above is generally affected by the bond between the block and the hydrophilic block.

 The octagel used in the present invention utilizes the property that not only the hydrophobic bond becomes stronger as the temperature increases, but the change is reversible with respect to temperature. Multiple cross-linking points are formed in one molecule

From the viewpoint of forming a gel having excellent stability, it is preferable that the polymer having a high-mouth gel property has a plurality of “blocks having cloud points”.

On the other hand, the hydrophilic block in the above-mentioned gel-forming polymer is As described above, the high-mouth gel-forming polymer has a function of changing to water solubility at a temperature lower than the sol-gel transition temperature, and the hydrophobic binding force increases too much at a temperature higher than the transition temperature. It has the function of forming a water-containing gel state while preventing the above-mentioned gel from agglomerating and precipitating.

 Furthermore, it is desirable that the hide mouth gel used in the present invention is one that is decomposed and absorbed in cell culture. That is, in the present invention, the hydrogel-forming polymer is preferably decomposed in the cell culture by a hydrolysis reaction or an enzymatic reaction to be absorbed and excreted as a low molecular weight body that is harmless to the cell culture. .

 In the present invention, when the hydrogel-forming polymer is formed by combining a plurality of blocks having a cloud point and a hydrophilic block, at least one of the block having a cloud point and the hydrophilic block, It is preferable that both of them are decomposed and absorbed in the cell culture.

 (Multiple blocks with cloud points)

 The block having a cloud point is preferably a polymer block in which the temperature coefficient of water solubility is negative, more specifically, polypropylene oxide, propylene oxide and other alkylene oxides. Copolymer, Poly N—Substituted acrylamide derivative, Poly N _Substituted methacrylamide derivative, Copolymer of N—Substituted acrylamide derivative and N—Substituted methacrylamide derivative, Polyvinyl methyl ether, Poly A polymer selected from the group comprising vinyl alcohol partial acetylates can be preferably used.

In order for a block having a cloud point to be decomposed and absorbed in cell culture, it is effective to make the block having a cloud point a polypeptide composed of a hydrophobic amino acid and a hydrophilic amino acid. . Or poly milk Polyester-type biodegradable polymers such as acid polyglycolic acid can also be used as blocks having cloud points that are decomposed and absorbed in cell culture.

 The polymer (block having a cloud point) has a cloud point higher than 4 t but not higher than 40 t, and the polymer used in the present invention (a plurality of blocks having a cloud point and a hydrophilic block are combined). The sol-gel transition temperature of the compound is preferably from 0 ° C. to 3 7 or less.

 Here, the cloud point can be measured by, for example, cooling an aqueous solution of about 1% by mass of the above polymer (cloud point-containing block) to obtain a transparent uniform solution, and then gradually increasing the temperature (heating rate) About 1 ^ Z min), and the point at which the solution becomes cloudy for the first time is taken as the cloud point.

 Specific examples of poly N-substituted acrylamide derivatives and poly N monosubstituted methacrylamide derivatives that can be used in the present invention are listed below. Poly_N-acryloylbiperidine; Poly-N-n—Propylmethacrylamide; Poly-N-isopropylacrylamide; Poly-N, N—Jetylacrylamide; Poly-N—isopropyl Poly-N-cyclopropyl acrylamide; Poly-N-acryloylpyrrolidine; Poly-N, N-ethylmethyl acrylamide; Poly-N-cyclopropylmethacrylamide; Poly-N-ethyl acrylamide Lilamide.

The polymer may be a homopolymer or a copolymer of a monomer constituting the polymer and another monomer. As another monomer constituting such a copolymer, either a hydrophilic monomer or a hydrophobic monomer can be used. In general, copolymerization with hydrophilic monomers raises the cloud point of the product, and copolymerization with hydrophobic monomers lowers the cloud point of the product. Therefore, by selecting these monomers to be copolymerized, the desired cloud point (for example, from 4 ° C) A polymer having a high cloud point of 40 ° C. or less can be obtained.

 (Hydrophilic monomer)

 Examples of the hydrophilic monomer include N-vinylpyrrolidone, vinylpyridine, acrylamide, methacrylamide, N-methylacrylamide, hydroxetyl methacrylate, hydroxetyl acrylate. , Hydroxymethyl methacrylate, Hydroxymethyl acrylate, Acrylic acid with acidic group, Metaacrylic acid and their salts, Vinyl sulfonic acid, Styrene sulfonic acid, etc., and Basic group N, N—dimethylaminoethyl methacrylate, N, N—jetylaminoethyl methacrylate 卜, N, N—dimethylaminopropyl acrylamide, and salts thereof, but are not limited thereto. It is not something.

 (Hydrophobic monomer)

 On the other hand, examples of the hydrophobic monomer include acrylate derivatives such as ethyl acrylate, methyl methacrylate, glycidyl methacrylate, and methacrylate derivatives, and N—n-butyl methacrylate. Examples thereof include, but are not limited to, N-substituted alkylmethacrylamide derivatives such as acrylamide, vinyl chloride, acrylonitrile, styrene, and vinyl acetate.

 (Hydrophilic block)

On the other hand, specific examples of hydrophilic blocks to be combined with the above-mentioned block having a cloud point are methyl cellulose, dextran, polyethylene oxide, polyvinyl alcohol, and poly N-vinyl vinylidone. , Polyvinyl pyridine, polyacrylamide, polyacrylamide, poly N—methyl acrylamide, polyhydroxymethyl acrylate, polyacrylic acid, polymethacrylic acid, polyvinyl sulfonic acid, polystyrene sulfonic acid and salts thereof; Poly N , N—dimethylaminoethyl methacrylate, poly N, N—dimethylaminoethyl methacrylate, poly N, N-dimethylaminopropyl amide, and salts thereof.

 In addition, hydrophilic blocks are desirably degraded, metabolized and excreted in cell cultures. Proteins such as albumin and gelatin, and hydrophilic substances such as polysaccharides such as hyaluronic acid, heparin, chitin, and chitosan. Cell culture polymers are preferably used.

There is no particular limitation on the method for bonding the block having a cloud point to the hydrophilic block. For example, a polymerizable functional group (for example, an acryloyl group) is introduced into any of the blocks, This can be done by copolymerizing a monomer that gives the other block. Further, the combined product of a block having a cloud point and the hydrophilic block is obtained by block copolymerization of a monomer that gives a block having a cloud point and a monomer that gives a hydrophilic block. Is also possible. In addition, the bond between the block having a cloud point and the hydrophilic block is preliminarily introduced with a reactive functional group (for example, a hydroxyl group, an amino group, a forceloxyl group, an isocyanate group, etc.), and the two are chemically reacted It can also be done by combining them. At this time, usually a plurality of reactive functional groups are introduced into the hydrophilic block. In addition, the bond between the polypropylene oxide having a cloud point and the hydrophilic block is, for example, a monomer that forms propylene oxide and “another hydrophilic block” by anionic polymerization or cationic polymerization (for example, By repeating sequential polymerization of ethylene oxide), a block copolymer in which polypropylene oxide and a “hydrophilic block” (for example, polyethylene oxide) are bonded can be obtained. In such a block copolymer, a polymerizable group (for example, an acryloyl group) is introduced at the end of polypropylene oxide, and then a monomer constituting a hydrophilic block is used as a copolymer. It can also be obtained by polymerization. Furthermore, a functional S capable of binding reaction with a functional group at the end of polypropylene oxide (for example, a hydroxyl group) is introduced into a hydrophilic block, and both are reacted with each other. A polymer can be obtained. Further, the present invention can also be achieved by linking materials such as pull mouth nick F-1 27 (trade name, manufactured by Asahi Denka Kogyo Co., Ltd.) in which polyethylene glycol is bonded to both ends of polypropylene glycol. It is possible to obtain a hydrogel-forming polymer used in the above.

 The polymer of the present invention in an embodiment including a block having a cloud point is water-soluble together with a hydrophilic block at a temperature lower than the cloud point, the above-mentioned “block having a cloud point” present in the molecule. It completely dissolves in water and shows a sol state. However, when the temperature of the aqueous solution of this polymer is raised to a temperature higher than the above cloud point, the “blocks with cloud point” existing in the molecule become hydrophobic and associate with each other by hydrophobic interaction. .

On the other hand, since the hydrophilic block is still water-soluble at this time (when heated to a temperature higher than the cloud point), the polymer of the present invention has a hydrophobic association between the blocks having the cloud point in water. Generates a hydrogel with a three-dimensional network structure as a cross-linking point. When the temperature of the hydrogel is cooled again to a temperature lower than the cloud point of the “block with cloud point” existing in the molecule, the block having the cloud point becomes water-soluble, and the crosslinking point due to hydrophobic association is released. Then, the hide-mouth gel structure disappears, and the polymer of the present invention becomes a complete aqueous solution again. Thus, the sol-gel transition of the polymer of the present invention in a preferred embodiment is based on reversible changes in hydrophilicity and hydrophobicity of the block having a cloud point present in the molecule. Therefore, it has complete reversibility in response to temperature changes. (Gel solubility)

 As described above, in the present invention containing at least a polymer having a sol-gel transition temperature in an aqueous solution, the polymer having a gel formation temperature is substantially insoluble in water at a temperature (d) higher than the sol-gel transition temperature. It is reversibly soluble in water at a temperature lower than the sol-gel transition temperature (et :).

 The high temperature (d :) described above is preferably a temperature that is 1 ° C or higher than the sol-gel transition temperature, and more preferably a temperature that is 2 ° C or higher (especially 5 ° C or higher). The above “substantially water-insoluble” means that the amount of the polymer dissolved in 100 mL of water at the above temperature (d) is 5. O g or less (or 0.5 g In the following, it is particularly preferably 0.lg or less.

 On the other hand, the above-mentioned low temperature (in e) is preferably 1 or more lower (in absolute value) than the sol-gel transition temperature, more preferably 2 or more (in particular 5 or more) lower. . In addition, the above-mentioned “water-soluble” means that the amount of the polymer dissolved in 100 mL of water at the above temperature (e ° C) is 0.5 g or more (more preferably 1.0 g or more). It is preferable that Furthermore, “reversibly water-soluble” means that the aqueous solution of the above-mentioned hydrogel-forming polymer is gelated (at a temperature higher than the sol-gel transition temperature) once at a temperature lower than the sol-gel transition temperature. Means to exhibit water solubility as described above. The polymer preferably has a viscosity of 10 to 3,000 centoise (more preferably 50 to 1,000 centipoise) when its 10% aqueous solution is 5 ° C. Such viscosity is preferably measured under the following measurement conditions, for example.

Viscometer: Stress-controlled rheometer (Model name: AR500, manufactured by TA Instruments) Rotor diameter: 60 mm Rotor shape: parallel plate In the present invention, the aqueous solution of the hydrogel-forming polymer is gelled at a temperature higher than the sol-gel transition temperature, and then immersed in a large amount of water. The gel does not substantially dissolve. The characteristics of the aqueous solution of the hydrogel-forming polymer can be confirmed, for example, as follows.

 That is, 0.15 g of the hydrogel-forming polymer in the present invention is dissolved in 1.35 g of distilled water at a temperature lower than the sol-gel transition temperature (for example, under ice cooling), and 1 O wt% An aqueous solution was prepared, the aqueous solution was poured into a plastic petri dish having a diameter of 35 mm, and heated at 37 to form a gel having a thickness of about 1.5 mm in the petri dish. Then, the total weight (f grams) of the petri dish containing the gel is measured. Next, the entire petri dish containing the gel was allowed to stand in water in 25 O ml at 37 t for 10 hours, and then the weight (g gram) of the whole petri dish containing the gel was measured. The presence or absence of dissolution of the gel is evaluated. At this time, in the present invention, in the polymer having a gel with a mouth opening, the weight reduction rate of the gel, that is, (f 1 g) / f is preferably 5.0% or less, and more preferably 1 It is preferably 0% or less (particularly 0.1% or less).

 In the present invention, the aqueous solution of the hydrogel-forming polymer is gelled at a temperature higher than the sol-gel transition temperature, and then in a large amount (about 0.1 to 100 times that of the gel by volume) in water. Even when immersed, the gel does not dissolve over a long period of time. Such properties of the polymer used in the present invention can be achieved, for example, by the presence of two or more (multiple) blocks having cloud points in the polymer.

On the other hand, using the above-mentioned pull neck nick F-1 2 7 in which polyethylene oxide is bonded to both ends of polypropylene oxide. The inventors have found that when a similar gel is prepared, the gel is completely dissolved in water after standing for several hours.

 From the point of suppressing the non-gelling cytotoxicity to the lowest possible level

, The concentration in water, ie, {(polymer) / (polymer + water)} XI 0 0 (), gelation occurs at a concentration of 20% or less (and 15% or less, especially 10% or less). It is preferable to use a possible high-mouth gel-forming polymer.

 The molecular weight of the hydrogel-forming polymer used in the present invention is preferably 30,000 or more and 3,000,000 or less, more preferably 10,000 or more and 1,000,000 or less, more preferably 500,000 or more. 5 million or less.

 (Confirmation of H C V particle infectivity)

 In the present invention, as described later, the fact that the HCV particles secreted into the culture medium of 3D culture are infectious, for example, against Huh-7.5.1 cells that highly allow HCV replication. This can be confirmed by the behavior of the HCV particles. Infection is neutralized by anti-E2 antibodies or by patient sera that interfere with the binding of E2 protein to human cells. As will be described later, the usefulness of the TGP-3D culture system for the evaluation of antiviral drugs can also be demonstrated. It can be confirmed that the 3D culture system induced by Huh-7 can produce infectious HCV particles. This system can be a valuable tool for further studying HCV morphogenesis in the natural host cell environment.

The present invention will be specifically described based on the following examples and drawings. However, the technical scope of the present invention is not limited to the following examples. Example 4223 Production Example 1

 Polypropylene Oxide Polyethylene Oxide Copolymer (Propylene Oxide / Edylene Oxide Average Degree of Polymerization approx. 60/1800, manufactured by Asahi Denka Kogyo Co., Ltd .: Pull-mouth Nick F— 1 2 7) 10 g Was dissolved in 30 ml dry chloroform, 0.13 g hexamethylene diisocyanate was added in the presence of phosphorus pentoxide, and the mixture was reacted for 6 hours under reflux at the boiling point. After distilling off the solvent under reduced pressure, the residue was dissolved in distilled water and ultrafiltered using an ultrafiltration membrane (Amicon PM-30) with a molecular weight cut off of 30,000 to obtain a high molecular weight polymer and a low molecular weight polymer. Was fractionated. The obtained aqueous solution was frozen to obtain F-1 27 high polymer and F-1 27 low polymer.

 The F-1 27 high polymer obtained as described above (in the present invention, a hydrogel-forming polymer, TGP-1) was dissolved in distilled water at a concentration of 8% by mass under ice cooling. When this aqueous solution was gently warmed, the viscosity gradually increased from 21 and solidified at about 27 ° C to form a hydrated gel. When this gel was cooled, it returned to an aqueous solution at 21 ° C. This change was observed reversibly and repeatedly. On the other hand, the F-1 27 low polymer dissolved in distilled water at a concentration of 8 mass% below freezing did not gel at all even when heated to 60 ° C or higher.

 Production example 2

 160 mol of ethylene oxide was added by cationic polymerization to 1 mol of polymethylolpropane to obtain polyethylene oxide-riol having an average molecular weight of about 700.000.

After dissolving 100 g of polyethylene oxide 卜 riol obtained in the above in 100 ml of distilled water, 12 g of calcium permanganate was gradually added at room temperature, and this was continued for about 1 hour. Oxidized. After removing the solid matter by filtration, the product is extracted with black mouth form, and the solvent (black mouth form) is distilled off under reduced pressure to remove polyethylene oxide tricarboxyl. 90 g of rutile body was obtained.

 Polyethylene oxide tricarboxylate 10 g obtained above and polypropylene oxide diamino compound (average degree of polymerization of propylene oxide about 65, manufactured by Jefferson Chemical Co., USA, product name: Jeffermine D—400 0, cloud point: about 9) 10 g is dissolved in carbon tetrachloride 100 m 1, and 1.2 g of dicyclohexylcarbodiimide is added, followed by boiling at reflux for 6 hours. Reacted. The reaction liquid is cooled and solids are removed by filtration. Then, the solvent (carbon tetrachloride) is distilled off under reduced pressure, and the residue is vacuum-dried to combine a plurality of polypropylene oxides with polyethylene oxide. The hydrogel-forming polymer (TGP-2) was obtained. This was dissolved in distilled water at a concentration of 5% by mass under ice cooling, and its sol-gel transition temperature was measured to be about 16 ° C.

 Production Example 3

 N—Isopropylacrylamide (Eastman Kodak) 9 6 g, N—acryloxy succinimide (manufactured by Kokusan Chemical Co., Ltd.) 17 g, and n—Petyl methacrylate (Kanto Chemical Co., Ltd.) 7 g is dissolved in black mouth form 400 ml, and after substitution with nitrogen, 1.5 g of N, N'-azobisisoptylonitrile is added and polymerized at 60 for 6 hours. It was. After the reaction solution was concentrated, it was reprecipitated (reprecipitated) in jetyl ether. The solid was collected by filtration and dried in vacuo to give 78 g of poly (N-isopropylacrylamide, N-acryloxy succinimide, n-butyl methacrylate).

To the poly (N-isopropylacrylamidoco-N-acryloxysuccinimine doco-n-butyl methacrylate) obtained above, an excess isopropylamine is added to add poly (N-isopropylacrylamidoco-colate n —Butyl methacrylate) was obtained. This poly The cloud point of the aqueous solution of (N_isopropylacrylamidoco-n-butyl methacrylate) was 19.

 Poly (N-isopropylacrylamido-N-acryloxy succinimide) n-butyl methacrylate 10 g, and both ends aminated polyethylene oxide (molecular weight 6, 0 0 0, manufactured by Kawaken Fine Chemical Co., Ltd.) 5 g

It was dissolved in 1 and reacted at 50 ° C for 3 hours. After cooling to room temperature, 1 g of isopropylamine was added and allowed to stand for 1 hour, and then the reaction solution was concentrated, and the residue was precipitated in jetyl ether. In the present invention in which a solid substance is collected by filtration and then vacuum-dried to combine a plurality of poly (N-isopropylacrylamido alcohol n-butyl methacrylate) and polyethylene oxide. A gel-forming polymer (TGP-13) was obtained.

 The TGP-3 thus obtained was dissolved in distilled water at a concentration of 5% by mass under ice-cooling, and the sol-gel transition temperature was measured to be about 21 ° C.

 Production Example 4

 (Sterilization method)

 In the above-described present invention, 2. O g of the gel gel forming polymer (TGP-3) is put into an EOG (ethylene oxide gas) sterilization bag (trade name: Hybrid sterilization bag, manufactured by Hogi Medical Co., Ltd.). The bag was filled with EOG with an EOG sterilizer (Easy Pack, manufactured by Inoue Seieido) and left at room temperature for a whole day and night. After leaving at 40 for half a day, EOO G was removed from the bag and aerated. The knives were sterilized by placing them in a vacuum dryer (40 ° C) and leaving them for half a day with occasional aeration.

This sterilization operation does not change the sol-gel transition temperature of the polymer. And were confirmed separately.

 Production Example 5

 N-isopropyl acrylamide 3 7 g, η-butyl methacrylate 3 g, polyethylene oxide monoacrylate (molecular weight

4, 0 0 0, manufactured by Nippon Oil & Fats Co., Ltd .: P ME— 4 0 0 0) 2 8 g was dissolved in benzene 3 4 0 m 1, and then 2, 2 ′ -azobisiso-peptide ditolyl 0. 8 g was added and reacted at 60 ° C. for 6 hours. To the resulting reaction product, 60 ml of black mouth form was added and dissolved, and the solution was added dropwise to 20 L (liter) to cause precipitation. The resulting precipitate was recovered by filtration, and the precipitate was vacuum-dried for 24 hours at about 40 ° C, and then dissolved again in 6 L of distilled water, and a hollow fiber type with a molecular weight cut off of 100,000 was obtained. 2 at 1 0 using an ultrafiltration membrane (HIP 10 00-4 3 manufactured by Amicon)

Concentrated to 1. Distilled water 4 1 was added to the concentrate for dilution, and the above dilution operation was performed again. The above dilution and ultrafiltration concentration operations were further repeated 5 times to remove those having a molecular weight of 10 million or less. What was not filtered by this ultrafiltration (remaining in the ultrafiltration membrane) was recovered and freeze-dried, and in the present invention having a molecular weight of 100,000 or more, a high-mouth gel-forming polymer (TGP — 4) 6 0 g was obtained.

 In the present invention obtained as described above, a gel-forming polymer (TGP-4) 1 g was dissolved in 9 g of distilled water under ice-cooling. When the sol-gel transition temperature of this aqueous solution was measured, the sol-gel transition temperature was 2

5 ° C.

 Production Example 6

In the present invention of Production Example 3, the gel-forming polymer (TGP-3) was dissolved in distilled water at a concentration of 10% by mass, and η at 37 ° C was measured. 1 0 ⁵ Pa · sec. On the other hand, agar was dissolved in distilled water at a concentration of 2% by mass at 90 ° C and then at 10 for 1 hour. After gelling, when measuring 7) in 37, is that? ? Exceeded the instrument's measurement limit (1 X 10 ⁷ Pa-sec).

 Production Example 7

 N-Isopropyl acrylamide 7 1.0 g and n-butyl methacrylate 4.4 g were dissolved in ethanol 11 1 17 g. Polyethylene glycol dimethylate (PDE 600, manufactured by Nippon Oil & Fats Co., Ltd.) was added to this solution, and an aqueous solution prepared by dissolving 2. 6 g in 77. Warm up. N, N, N ', N'-tetramethylethylenediamine (TEME D) 0.8 mL and 10% ammonium persulfate (APS) aqueous solution 8 mL while maintaining 70 ° C under nitrogen flow And stirred for 30 minutes. Further, 8 mL of T E M E D O. And 8 mL of 10% APS aqueous solution were added four times at intervals of 30 minutes to complete the polymerization reaction. After cooling the reaction solution to below 10 ° C, dilute by adding 5 L of cold distilled water of l O t, and concentrate to 2 L at 10 ° C using an ultrafiltration membrane with a molecular weight cut off of 100,000. did.

 The concentrated solution was diluted by adding 4 L of cooled distilled water, and the above ultrafiltration concentration operation was performed again. The above dilution and ultrafiltration concentration operations were further repeated 5 times to remove those having a molecular weight of 100,000 or less. What was not filtered by this ultrafiltration (remaining in the ultrafiltration membrane) was recovered and freeze-dried, and in the present invention having a molecular weight of 100,000 or more, a high-mouth gel-forming high molecule (TGP-5) ) 7 2 g was obtained.

 In the present invention obtained as described above, the hydrogel-forming polymer (TGP-5) lg was dissolved in 9 g of distilled water under ice-cooling. When the sol-gel transition temperature of this aqueous solution was measured, the sol-gel transition temperature was 20 ° C.

 Production Example 8

N-isopropyl acrylamide 4 2. 0 g and n-butyl methyl Evening rate 4.0 g was dissolved in ethanol 59 2 g. To this was added an aqueous solution of polyethylene glycol dimethacrylate (PDE 600, 0, manufactured by Nippon Oil & Fats Co., Ltd.) 11.5 g dissolved in water 6 1 .5 g. Warmed to ° C. N, N, N ', N'-tetramethylethylenediamine (TEMED) 0.4 mL and 10% ammonium persulfate (APS) aqueous solution 4 mL The mixture was stirred for 30 minutes. Further, 4 mL of TEMEDO. And 4 mL of 10% APS aqueous solution were added 4 times at intervals of 30 minutes to complete the polymerization reaction. The reaction solution was cooled to 5 or less, diluted with 5 L of cold distilled water from 5 and concentrated to 2 L at 5 ° C using an ultrafiltration membrane with a molecular weight cut off of 100,000.

 The concentrated solution was diluted by adding 4 L of cooled distilled water, and the above ultrafiltration concentration operation was performed again. The above dilution and ultrafiltration concentration operations were further repeated 5 times to remove those having a molecular weight of 100,000 or less. What was not filtered by this ultrafiltration (remaining in the ultrafiltration membrane) was recovered and freeze-dried, and in the present invention having a molecular weight of 100,000 or more, a hydrogel-forming high molecule (TGP-6) 4 0 g was obtained.

 In the present invention obtained as described above, the hydrogel-forming polymer (T G P-6) 1 g was dissolved in 9 g of distilled water under ice cooling. When the sol-gel transition temperature of this aqueous solution was measured, the sol-gel transition temperature was 7 ° C.

 Production Example 9

45.5 g of N-isopropyl acrylamide and 0.56 g of n-butyl methacrylate were dissolved in 59 2 g of ethanol. Polyethylene glycol dimethylate (PDE 600, manufactured by Nippon Oil & Fats Co., Ltd.) 11.5 g of water dissolved in 65. Warmed to. While keeping at 70 under nitrogen flow, N, N, N ′, N′-tetramethylethylenediamine (TE MED) 0.4 mL and 10% ammonium persulfate (APS) aqueous solution 4 mL were added, and the mixture was stirred for 30 minutes. Further, 4 mL of TE ME DO. And 4 mL of 10% APS aqueous solution were added 4 times at 30 minute intervals to complete the polymerization reaction. After cooling the reaction solution to 10 ° C or less, dilute it by adding 5 L of 10 ° C cold distilled water, and concentrate to 2 L at 10 using an ultrafiltration membrane with a molecular weight cut off of 100,000. did.

 The concentrated solution was diluted by adding 4 L of cooled distilled water, and the above ultrafiltration concentration operation was performed again. The above dilution and ultrafiltration concentration operations were further repeated 5 times to remove those having a molecular weight of 100,000 or less. What was not filtered by this ultrafiltration (remaining in the ultrafiltration membrane) was recovered and freeze-dried, and in the present invention having a molecular weight of 100,000 or more, a hydrogel-forming high molecule (TGP-7) 2 2 g was obtained.

 In the present invention obtained above, the gel-forming polymer (T G P-7) 1 g was dissolved in 9 g of distilled water under ice-cooling. When the sol-gel transition temperature of this aqueous solution was measured, the sol-gel transition temperature was 37 ° C.

 Production example 1 0

N-isopropyl acrylamide 44.0 g and n-butyl methacrylate チ ル 1.68 g were dissolved in ethanol 59 2 g. Polyethylene glycol dimethylate (PDE 600, manufactured by Nippon Oil & Fats Co., Ltd.) 11.5 g of water dissolved in 65. 1 g of water was added to this, and nitrogen gas flowed at 70 ° C Warmed to. N, N, N ', N' — Tetramethylethylenediamine (TE ME D) 0.4 mL and 10% ammonium persulfate (APS) aqueous solution 4 mL while maintaining 70 ° C under nitrogen flow And stirred for 30 minutes. Furthermore, TE ME DO. 4 mL and 10% APS aqueous solution 4 mL were added 4 times at 30 minute intervals to complete the polymerization reaction. Let After cooling the reaction solution to below 10 ° C, dilute it by adding 5 L of chilled distilled water at 10 ° C and concentrate to 2 L at 10 ° C using an ultrafiltration membrane with a molecular weight cut off of 10 million. did.

 The concentrated solution was diluted by adding 4 L of cooled distilled water, and the above ultrafiltration concentration operation was performed again. The above dilution and ultrafiltration concentration operations were further repeated 5 times to remove those having a molecular weight of 100,000 or less. Those that were not filtered by this ultrafiltration (remaining in the ultrafiltration membrane) were collected and freeze-dried, and in the present invention having a molecular weight of 100,000 or more, the eight-mouthed gel-forming high molecule (TGP— 8) 2 2 g was obtained.

 In the present invention obtained above, the hydrogel-forming polymer (TG P-8) 1 g was dissolved in 9 g of distilled water under ice-cooling. When the sol-gel transition temperature of this aqueous solution was measured, the sol-gel transition temperature was 26.

Example 1

 (Detection of HC V-RNA in TGP cultured cell culture supernatant)

 Daisystronic HCV gene clone (consisting of hepatitis C virus (HCV) 5 'untranslated region gene 1 neomycin resistance gene 1 encephalomyocarditis virus 5' untranslated region gene 1 HCV total protein gene 1 HCV 5 'untranslated region gene) RNA was synthesized using the 銬 type and introduced into ^ 1 uh 7 cells by the el ^ 0 0 ^ 011 method. (For details on such HC V gene transfer methods, see, for example, the literature Pietschman n, T. , Journal of Virology 7 6: 40 0 8-2 1 (2 0 0 2).).

The cells obtained above were cultured for 3 weeks in ASF 104 medium (ΑΠΝ0Μ0Τ0) containing dienetin 0.5 mgzml, D-glucose 4 g / L, and fetal bovine serum 2%. The drug-resistant cell line (RC YM 1) selected. HC V genomic RNA is retained in RC YM 1 cells Real-time reverse transcription bets (RT> - by PCR, HCV proteins were subcultured in a flask that was confirmed respectively by Western blot method this cells to 5 X 1 0 ⁶ pieces of being produced. .

TGP (TGP prepared in Production Example 3) broth in lg (above) 4t added 1 0 mL: The cells cultured in flasks to those cooling was added, 8 0 0 / ^/ \ to 6 well plates ¥ 6 1 1 Poured every minute and warmed to 37 ° C to gel the TGP. The gel inoculated with these cells was overlaid with 3 ml of a culture solution warmed to 37 ° C and cultured at 37 for 10 days. During the culture, the culture medium that had been overlaid every 4 days was collected and replaced with a new culture medium.

 After completion of the culture, the gel was cooled to 4 to be solated, added with the culture medium and diluted, and the two-dimensionally cultured RCYM 1 cells were collected by centrifugation, and the supernatant was 80 00 g, 50 min. Cell debris etc. were removed by centrifugation. The supernatant was centrifuged at 25, 00 rpm for 4 hr. Pellet 卜 Τ Ε Ε Buffer (10 m M Tris-H C 1 p H 7.4

, 100 mM NaC 1, 1 mM EDTA) dissolved in 1 ml 1

0-60% sucrose density gradient. After measuring the specific gravity of each fraction

, Ν Ν Diluted twice with E buffer 5 0, 0 0 0 r pm, 2 h r far

Then, the precipitate was redissolved in 100 L of TNE buffer. RNA was extracted from this solution, and the amount of HCV-RNA in each fraction was quantified by real-time R-1 PCR method. As control, the same number of R

C Υ Μ 1 cell monolayer cultured for 10 days was used for the same method.

 The base sequences of the primer and probe of real-time RT-PCR used in the analysis are shown below.

5 '-GAGT GT C GT GC AG CCTCC A- 3' 5 'One C AC TCGC AAG C AC CC TAT C A- 3' 5 'One (6- carboxyf luorescine) CCCGCAAGACTGCTAGCCGAG TAGTGTTGG (tet rach 1 o ro-6-carbo x yf uoresc ine)-3 'RT-PCR reaction' was performed using TaaMan EZ RT-PCR Kit (PE Applied Biosystems). The total amount of the reaction solution was 50 1, and the temperature and the like were the following reaction conditions.

 After the reaction of 6 0 1 m i n> 5 0 60 0 m i n, 9 5 5 m i n, the cycle of 9 4 1 5 sec 5, 5 5: 1 0 sec 6 9 1 min was repeated 50 cycles. The standard RN A was diluted with HC V—RN A synthesized at the in-house outlet and used as a standard.

The results are shown in Fig. 4. The black circle (秦) in Figure 4 is the TGP culture supernatant, and the white circle (◯) in the figure is the HCV-RNA amount of the monolayer culture supernatant. The vertical axis is the amount of HCV—RNA (10 ⁴ copies / fraction), and the horizontal axis is the specific gravity (g / ml) of each fraction. As shown in the figure, HCV-RNA was detected from the TGP culture supernatant of RC YM 1 cells with a specific gravity of 1.18 g / ml as a peak. This density was close to the value reported for the density of HCV particles in studies using HCV-infected patient sera, confirming the presence of HCV-like particles in the culture supernatant.

Example 2

 (Detection of HCV-core protein in TGP culture cell culture supernatant)

Hepatitis C virus expressing the entire protein, and autonomously replicating dicing be sampled port nick holding the HCV genome H uh 7 cells passaged in flasks with (RC YM 1 cells) to 5 X 1 0 ⁶ pieces Cultured. The cell culture medium was added to the TGP and cooled to 4. The cells cultured in the flask were added, and 800 LZ wells were dispensed into the 6 well plate. This gel was overlaid with 3 ml of culture solution and cultured at 37 ° C for 10 days. During the culture, the culture solution was layered every 4 days. Was recovered and replaced with a new culture medium. The culture medium used was the same as in Example 1.

 After completion of the culture, the gel was cooled 4: 4 (this was cooled to a sol, diluted with a culture medium, and RC YM 1 cells were collected by centrifuging by centrifugation. The culture supernatant was 800 g. The supernatant was centrifuged for 4 hr at 25, 00 rpm, and the pellet was lysed with 1 ml of TNE buffer, and then 10 — After fractionation by 60% sucrose density gradient, the specific gravity of each fraction was measured, diluted three-fold with TNE buffer, and centrifuged at 50, 0 00 rpm for 2 hr. Redissolved in ML TNE buffer Using this solution as a sample, the amount of HCV-core protein in each fraction was quantified by ELISA.

 As a control, culture supernatants obtained by monolayer culture of the same number of R C YM 1 cells for 10 days were analyzed by the same method. The results are shown in Fig. 5. The black circle (參) in Fig. 5 is the TGP culture supernatant, and the white circle (◯) in the diagram is the HC V-core protein content of the monolayer culture supernatant. Vertical axis is H C V—core protein content

(fmol / fraction), the horizontal axis is the specific gravity (g / ml) of each fraction. As shown in the figure, HCV-core protein was detected in the T C P culture supernatant of R C Y M 1 cells with a specific gravity of 1.18 g / ml as a peak. This density is close to the value reported for the density of H C V particles in studies using sera from H C V infected patients. Further, according to Example 1, the presence of HCV-RNA was confirmed at the same density, and it was confirmed that HCV-like particles were present in the culture supernatant.

Example 3

 (Ding 0? ^^ \ particle detection in cultured cell culture supernatant)

Huh 7 cells (RC YM 1 cells) expressing the entire protein of hepatitis C virus and carrying the dystrophic HCV genome that replicates autonomously were prepared. Passage up to 5 x 10 ⁶ cells in a flask Nourished. The culture solution was added to TGP and cooled to 4t, and then the cells cultured in the flask were added. SOO ^ LZ well was dispensed into the 6-well plate, and TGP was gelled because it was heated to 37t. To this gel, 3 ml of the culture solution warmed to 37 was added, followed by culturing at 37 for 10 days.

 After completion of the culture, the gel was cooled to 4 to form a sol, diluted with a culture solution, and R C YM 1 cells cultured three-dimensionally by centrifugation were collected. From the culture supernatant, cell debris and the like were removed by centrifugation at 800 g and 5 O min. The supernatant was centrifuged at 25, O O O r pm for 4 hr. The pellet was dissolved in 1 ml of TNE buffer and fractionated by centrifugation at 10–60% sucrose density gradient. Specific gravity 1.0 4 Fraction of 4 g Zm l and peak of HCV RNA and HCV core protein 1.1 Fraction l ml of 18 g / m 1 was diluted 3 times with TNE buffer 50 It was centrifuged at OOO rpm for 2 hr. This precipitate was redissolved in 20 TNE buffer. After staining with 4% uranium acetate, observation was performed with a transmission electron microscope. The result is shown in Fig. 6. 1. In the fraction of 18 gZm l, a virus particle-like structure with a membrane structure and a complex internal structure was observed at a diameter of 50 to 60 nm, whereas 1.0 4 g Zm 1 No such structure was observed in this fraction. This particle-like structure was identical in size and density to those reported as particles in studies using HC V-infected sera, and was confirmed to be HC V particles.

 Fig. 6 shows the electron microscope (T EM) photographs of the 1.18 g / ml fraction (A) and 1.04 g Zml fraction (B) obtained above. As shown in FIG. 6, HCV particles were confirmed in the 1.18 g / m 1 fraction.

Example 4

 (Immunostaining of HCV particles in TGP cultured cell culture supernatant)

Daisy that expresses all hepatitis C virus proteins and replicates autonomously We prepared Huh 7 cells (RC YM 1 cells) that maintain the stoic HCV genome. Up to 5 × 10 ⁶ cells were subcultured in a flask. Add culture medium to TGP and cool to 4 ° C, add cells cultured in flask, dispense 80 L L-well to 6 well plate, heat to 37 ° C, and gel TGP did. To this gel, 3 ml of the culture solution warmed to 37 was added, followed by culturing at 37 ° C for 10 days.

 After completion of the culture, the gel was cooled to 4 to form a sol, diluted with a culture solution, and R C YM 1 cells cultured three-dimensionally by centrifugation were collected. From the culture supernatant, cell debris and the like were removed by centrifugation at 800 g and 50 min. The supernatant was centrifuged at 25,00 rpm for 4 hr. The pellet was dissolved in 1 ml of TNE buffer and fractionated by centrifugation at 10 to 60% sucrose density gradient. HCV—RNA and HC V—core protein peak specific gravity 1.1 1 ml fraction of 1 S g Zml was diluted 3 times with TNE buffer to 50, 0 00 rpm, 2 h. r Centrifuged. This precipitate was redissolved in 20 L of TNE buffer. This solution was reacted with an anti-HCV envelope mouse antibody as a primary antibody and an anti-mouse antibody labeled with a gold colloid of 1 ◦ nm as a secondary antibody, washed, and then observed with a transmission Nyoko microscope. It was. The results are shown in Fig. 7A (Ant i — E l, E 2 A b). As shown in FIG. 7A, it was observed that the gold colloid was bound to the particle-like structure of 50-60 nm by an antigen-antibody reaction.

On the other hand, when the same treatment was performed using mouse serum as the primary antibody as a negative control, a particle image with gold colloid bound as shown in Fig. 7 B (Normalinouse serum) could not be observed. . From these results, it was reconfirmed that E 1 and E 2 which are HCV structural proteins exist on the surface of the particle-like structure and that they are HCV particles. Example 5

 (Radial flow bioreactor (R F B)) Secretion of HCV particles from R C YM 1 carrying genomic length dicistronicHCV—RNA cultured in culture)

 The selectable capacity of HCV-RNA of selectable genome length in FLC4 cells was first evaluated. However, no G 4 18 resistant colonies were observed, indicating that FLC 4 cells did not support these HC V—RNA replication. Therefore, subsequent experiments were performed on a stable Hu h-7 cell line (R C YM 1). C o n l clone 1 3 8 9 n e oZ c o r e — 3 7 NK 5.1 (genotype 1 b) (P i e t schmann, T., V. Lohmann,

A. Kaul,. Krieger, G. Rinck, G. Rut ter, D. Strand, and R.

Bartenschl ager. 2002. Persistent and transient replication of full- length hepatitis C virus genomes in cell culture.

Virol. 76: 4008-4021) is a genomic-length dicist ron iRNA that supports full-length HCV-RNA replication expressed by cells. HCV-RNA levels RCYM 1 cells was about 5 X 1 0 ⁶ copies Z g total RNA was determined by real-time RT- PCR. HCV protein expression and subcellular localization was confirmed by Western blotting and immunofluorescence analysis. 3 To develop DRFB culture, RCYM 1 cells were first loaded onto the RFB column by flowing a cell suspension, and the cells were then attached to carriers and beads. The cells grew within the 3D matrix and the culture was circulated through the column in the radial direction.

In the RFB culture system, HCV particles are separated from RCYM 1 cells. To determine whether they were delivered, culture fluids were collected after 5-10 days of culture and fractionated by continuous 10–60% (wt / vol) sucrose density gradient centrifugation. HCV RNA and core protein were found primarily at 1.15—1.20 g / ml, maximal at 1.18 g Zml fraction (FIGS. 8A and B).

 FIG. 8 is a graph showing the results of sucrose density gradient analysis of the culture supernatant of R C YM 1 cells. As described in “Materials and Methods”, from RF Y cultured RC YM 1 (black circle), monolayer cultured RC YM 1 (white square) and RFB cultured 5 — 15 cells (white triangle) The collected culture media was separated.

 Figure 8 A: H C V—R NA in individual fractions was measured by real time R T—P C R. The average of duplicate measurements was plotted against the corresponding fractional density.

 Figure 8B: HCV core protein in individual fractions was determined by ELISA. The average of duplicate measurements was plotted against density.

 FIG. 8 C: The culture medium of R C M 1 cells cultured in R F B was treated with 0.2% NP 40 (white circles) and then centrifuged with a sucrose gradient. Each fraction was tested for H C V—R N A by real-time R T—P C R.

In the same experiment with 5 — 15 cells (subgenomic HCV replicon replicated), no similar peak corresponding to HCV RNA observed in RC YM 1 cells was detected. A substantial amount of HCV RNA was detected in the OT g Zm l fraction in both 5 — 15 cells and RC YM 1 cells in the RFB culture system (Figure 8A). ) Previous report by Pietschmann et al. (Pie tschmann, T., V. Lohmann, A. Kaul, N. Krieger, G. Rinck , G. Rutter, D. Strand, and R. Bartenschlager. 2 0 0 2. Per sistent and transient replication of ful length hepatitis C virus genomes in cell cul ture. J. Virol. 7 6: 4 0 0 8-4 Consistent with 0 2 1), these RNAs released from cells with subgenomic ♦ levicons did not match the virus fragments. When an equivalent number of RC YM 1 cells were cultured in a monolayer culture system, only limited amounts of HCV—RNA and core protein were detected in the culture supernatant (FIG. 8A and B).

 Mature HCV virions are thought to have a nucleoside psid and an outer envelope composed of a lipid membrane and a viral envelope * glycoprotein. The culture fluid was treated with NP40 to solubilize lipids and then subjected to sucrose density gradient centrifugation. HCV (Fig. 8 C) concentrated at 1. 2 2 g / ml (rather than 1 8 g Zml) has a higher density due to the de-envelopement of HCV particles. Indicates the shift. 1. 1 8 g / ml fraction

Transmission electron microscope (TEM) (concentrated and then subjected to negative staining) showed a particle structure with a diameter of 30-60 nm and a main particle size of 50 nm . Similar particle-like structures were not observed in the same density fraction of R C YM 1 —monolayer culture or in the 1.0 7 g / m 1 fraction of R C YM 1 —R F B culture. These results show that in the R F B system, the production and secretion of HC V particles was possible with a selectable bicistronic HC V genome Example 6

Production and secretion of HCV particles from spheroid culture of RC YM 1 cells using thermoreversible gelling polymer (TGP) R CYM 1 cells seeded in TPG in the same manner as in Examples 1 and 2 formed spheroids after 3 days of culture, and many spheroids having a diameter of about 1 mm were cultured. — Observed after 10 days. After 8 days of culture, the spheroids were fixed and examined by scanning electron microscopy (Figures 9A and 9B (a 1)) and ultrathin sections by TEM (Figure 10A ( B) and Fig. 10 B (b 1)).

 FIGS. 9 to 11 are photographs showing examples of embodiments in which Hu h-7 and R CYM 1 cells form spheroids in TGP. Scanning electron micrographs of RC YM 1 cells cultured in TPG for 8 days (Fig. 9 A and Fig. 9 B (a 1)) and transmission electron micrographs (Fig. 10 A (B) and diagram 1 OB (b1)).

 Black arrow: Villiform process, White arrow: Bile tubule-like structure.

 Fig. 1 1 A to 1 IF (C-H): Hu in TGP culture (Fig. 1 1 A to C (C-E)) and monolayer culture (Fig. 1 1 D to 1 IF (F-H)) Intracellular localization of connexin32 in h-7 cells.

 Fig. 1 1 A C) and 1 1 D (F): immunostaining of connexin 3 2 Fig. 1 1 B (D) and 1 1 E (G): phase contrast microscope

 Figure 1 1 C (E): 1 1 A (C) and 1 I B (D) Overlay

 The nuclei were colored by post-staining with propidium iodide.

Well-developed villus-like processes (polarizing epithelial features) were observed on the cell surface (Figures 9A and 9B (al)). Bile tubule-like structures were also observed in the intercellular spaces, and they appeared to be connected via junction junctions (Figs. 10A (B) and 10B ( bl))). This cell morphology is similar to that observed in RFB culture (Garoff, H., R. Hewson, and DJ Opstel ten. 1 9 9 8. Virus maturation by budding. Microbiol. Mol. Bio. 1. Rev. 6 2 ： 1 1 7 1-1 1 9 0. Grakoui, A., DW McCourt, C. Wychowski, SM Feinstone, and CM Rice. 1 9 9 3. C haracter izat ion of the hepatitis C vi J. Virol. 6 7: 2 8 3 2-2 8 4 3), which correlates well with the characteristics of the mature liver tissue. rus-encoded serine prote e inase: determination of prote inase-dependen t polyprote in c 1 eavage sites. It was. The observation of connexin 3 2 that plays an important role in the formation of gap junctions between cells by immunostaining localizes connexin 3 2 on the surface of cell adhesion in TGP culture (Fig. 1 1 A to 1 1 C (C1E)), on the other hand, in monolayer cultures, it was found that it was mainly distributed in the cytoplasm (Fig. 11D-; L1F (F-H)). This indicates that Huh-7 cells gained cell polarity in the 3D culture system.

It is known that HCV replicon replication in Huh-7 cells depends on host cell growth. Here, it was found that the growth of RC YM 1 cells in the TGP culture system was significantly (significanUy) slower than that of the cells in the monolayer culture (Fig. 12 A). Therefore, the expression of HCV protein (Fig. 12 B) and the viral RNA copy number in RC YM 1 spheroids were more apprently compared to those observed in monolayer cells. It was low. The results from sucrose density gradient analysis of the culture supernatant are: 1. HCV—RNA and core protein co-precipitation (co_ sedimentation) at a density of 1.15—1.20 g / m 1, and 18 g / A peak at m 1 was shown (Figures 12 C (C) and 12 D (D)). This distribution was consistent with the pattern obtained in RFB culture (Figures 8A and B). It should be noted that due to the slower growth of cells, fewer cells were used in 3D cultures in these experiments compared to monolayer cultures. Figures 12 to 13 are diagrams showing expression of HCV protein and secretion of viral molecules in RC YM 1 cells in TGP culture.

 Fig. 1 2 A: Cell growth curves of T C P culture (black circle) and monolayer (white circle) of R C YM 1 cells. Cells were harvested on days 0, 3, 6, and 9 after inoculation and the number of cells determined.

 Fig. 12B: Western plot of HCV core and NS5A protein in RCYM1 cells and controls Huh-7 cells.

 Fig. 12 C and 12 D: Sucrose density gradient analysis of the culture supernatant of R C YM 1 cells. HC V core protein (C) and viral RNA (D) in individual fractions were determined by ELISA and real-time RT-PCR, respectively. Representative data from three independent experiments are shown. Black circle: HCV—RNA in TG culture, white circle: HCV—RNA in monolayer culture; black triangle: HCV core protein in TG culture, white triangle: core protein in monolayer culture.

 Fig. 1 3 A to 1 3 D (E-H): Electron micrographs of HC V particles in the supernatant of R C YM 1 cells cultured in TGP.

 Fig. 1 3 A (E): 1. 1 8 Negative negative staining of HC V particles in 8 gZm l density fraction

 As shown in Fig. 1 3 D (H), the spherical structure was absent in the 1.0 5 g_m 1 density fraction.

 Fig. 1 3 B (F): Ultrathin section of H C V particles. Precipitated HC V particle samples were prepared from 1. 18 g / ml fraction.

Fig. 1 3 C (G): 1. Immunogold labeling of HCV particles with anti-E 2 antibody in a fraction of 18 g / ml density. Gold particles: 5 nm, Bars, 50 nm. TEM analysis of fractions of 1. 18 g Zm l after negative staining showed a particle structure with diameters of 50-60 nm and spike-like projections (Fig. 1). 3 A (E)). Observation of ultrathin slices showed a lipid bilayer-like membrane structure with a width of about 5 nm (Fig. 13 B (F)). Immunoelectron microscopy using an anti-E2 antibody revealed HCV envelope protein on the particle surface (Fig. 13 C (G)). A significant amount of HCV—RNA was detected in the supernatant at 1. 0 3— 1. 0 5 g / m 1 fraction (Figure 1 2 A) force ^ In these fractions, the virus-like particle structure was Not observed (Figure 1 3D (H)). These results were consistent with the results from the RFB system shown above. Thus, the effectiveness of the 3D cell culture system in the virus particle structure was shown in the TGP culture system and the RFB system using cells derived from human liver.

Example 7

 Ultrastructural localization of HC V particles in TG cultured spheroids of R C YM 1 cells

 Subsequently, EM analysis ultrathin sections determined the subcellular localization of H C V particles generated in R C YM 1 —TGP cultures at the ultrastructural level. Spherical particles with a membrane-like structure with protrusions on the short surface (diameter 50–60 nm) are predominantly ER membranes (Fig. 1) as in the wide ER capsule (Fig. 14 B). 4) observed in A).

 FIG. 14 is an electron micrograph of an ultrathin section of RCYM1 cells grown in TGP. HC V particles in T C P cultured R C YM 1 cells. Globular virus-like particles (arrows) with a diameter of 50–6 Onm were observed in ER membranes (Figures 14 A and B) and in cytoplasmic vesicles.

In follicles, these virus-like particles are often amorphic Accompanied by a false material. Previously, Shimizu et al. Reported that virus-like particles similar in morphology and size were observed in human B cells infected with HCV (Shifflizu, YK, SM Feinstone, M. et al.

Ko ara, R. H. Pur cells, and H. Yoshikura. 1996. Hepatitis C virus: detect ion of a cell ular virus particles by electron microscopy. Hepatology 2 3: 2 0 5— 2 0 9). Similar particle-like structures were not observed in R C YM 1 cells in monolayer cultures or in subgenomic levicons 5 — 15 cells in T GP cultures.

 To determine whether the virus-like particles observed using conventional TEM in this experiment were HCV particles, immunoelectron microscopic analysis was performed using anti-core and anti-E1 antibodies. . Double-labeling experiments showed that virus-like particles working with the ER membrane were immunoreactive with both HCV proteins and that the E1 protein surrounded the core protein ( Fig. 15 A). According to the findings of the present inventors, this is the first report that clearly shows that the viral envelope protein surrounds the core protein in HCV particle formation. As negative controls, slices prepared from 5-15 cells containing subgenomic RNA were stained with these antibodies, and they showed negligible levels of background in immunostaining.

Due to the low resolution and contrast of photomicrographs, it is generally difficult to visualize intracellular microstructure using immunogold electron microscopy and perform antigenic protein localization. To overcome this difficulty, silver-sensitized immunogold labeling was applied in this experiment (Figures 15B and 15C). Using this method, approximately 2 O nm of antigen-reactive immunogold particles were observed. Fig. 15 is an immunoelectron micrograph of an ultrathin section of RC YM 1 cells cultured in TGP.

 Fig. 15 A (A): Double immunostaining with anti-E1 and anti-core monoclonal antibodies. Core protein monospecific gold particles (10 nm diameter) and E1 protein monospecific gold particles (5 nm diameter) formed rosettes on the surface of the ER membrane.

 Fig. 15 B (B) and 15 C (C)): Silver-sensitized immune gold with anti-core (B) and anti-E 1 (C) antibodies. 1. A second antibody conjugated with 4 nm diameter gold particles was applied, and then the particles were enlarged with a silver sensitizer. Arrows indicate that virus-like particles react with anti-core and anti-E1 antibodies.

 Specific immunolabeling of core and E1 proteins was detected mainly within the ER and on the ER membrane. Strong immunopositive reactions were detected in cytoplasmic vesicles and on virus-like particles observed on ER membranes. Such immunolabeling was not observed when normal mouse serum was used as the first antibody. These results confirm conventional T EM superstructure observations and suggest that the formation of H C V particles is achieved by estimated core particle budding in the ER film.

Example 8

 Dependence of HCV particle infectivity on E2 glycoprotein

To determine whether HCV particles released from RCYM 1 cells cultured in the TGP system are infectious, naive Huh—7.5.1 cells (HCV—negative Huh—7.5) (7) cells were inoculated with the culture supernatant of RC YM 1 spheroids, and 4 days after inoculation, NS 5 A protein was analyzed by immunofluorescence staining (Figure 16). A) FIG. 16 is a diagram showing infectivity of HCV particles secreted from RC YM l cells cultured in TGP and neutralization of the infectivity.

 Fig. 16 A (A): Huh 7.5.1 cells infected with HCV pups (upper panel: infection (+)) or without infection (lower panel: infection (—)) were cultured for 4 days. Subsequently, immunostaining was performed with an anti-NS 5 A antibody. Nuclei were colored by post-staining with D A P I.

 Fig. 16 B (B): Huh 7.5.1 cells post-treated with anti-E2 antibody (AP33), NOB antibody, or anti-FLAG antibody were infected with HCV particles and incubated for 4 days. It was HCV—RNA in the cells was determined by real time RT—PCR. Average values for triplicate samples are shown with standard deviations.

Approximately 1% of Huh—7.5.1 cells were observed to be NS 5 A positive. In contrast, NS 5 A-positive cells were detected when Huh-7.5.1 cells were inoculated using cell supernatant samples obtained from 5-15 cells cultured in TGP. Was not. To further determine whether the virus envelope protein mediates infection by HCV particles, high titers of anti-E 2 and NO B antibodies (1/3 5 0 0-1/4 0 0 0) Sera with patients (Ishii, K., D. Rosa, Y. Watanabe, T. Katayama, H. Harada, C. Wyat t, K. Kiyo sawa, H. Aizaki, Y. Matsuura, M. Houghton, S. Abr ignan i, and T. Miyamura. 1998.High titers of antibodies inhibiting the binding of envelope to human cells s correlate with natural resolution of chronic hepatitis C. Hepatology 2 8: 1 1 1 7-1 1 2 0), Alternatively, HCV particles were pre-incubated with an anti-FLAG antibody (Figure 16B). Intracellular HCV—RNA levels decreased to 43%, 28%, and 26% in the presence of anti-E2 antibody, NOB3, and NOB4, respectively. Virus in infected cells R NA No decrease was observed after treatment with anti-FLAG antibody. Taken together, these results indicate that HCV particles produced by RC YM 1 cells cultured in TGP are infectious, and viral envelope proteins are important in infection of Huh _ 7.5.1 cells It strongly suggests that it will play a role.

Example 9

 Potential use of TGP culture system for HCV production and evaluation of antiviral agents

 Lindenbach et al. Recently reported that cell culture systems that support complete replication of HCV genotype 2a clones are useful for the evaluation of antiviral drugs (Lindenbach, BD, MJ Evans, AJ Syder, B. Wol k, TL Tel 1 inghuisen, CC Liu, T. Maruyama, R. 0. Hynes, DR Burton, JA McKeat ing, and CM Rice. 2 0 0 5. Com plete replication of hepatitis C virus in cell culture. nce 3 0 9: 6 2 3-6 2 6). To date, however, this complete HCV culture system has not been extended to genotype 1, which is most often detected and most difficult to treat in patients with hepatitis C.

 Here, we show the potential utility of T C P culture of R C YM 1 cells to evaluate anti-HCV drugs (Figure 17).

Figure 17 shows the inhibition of HCV particle production by IFN and RBV. RC YM 1 cells cultured in TGP were treated with 100 IU / m 1 of IFN_a, or 10 Ομ ιη of RBV, and then HCV RNA in the cells (Figure 17A), and HCV-RNA in the medium (Figure 17 B) was determined. Media from individual samples was fractionated by sucrose gradient centrifugation and analyzed for HCV particle positive (1.18 g / ml) and negative (1.04 g / m1) fractions . Average values and standard deviations for a set of samples are shown

. Black bar: Untreated control, Shade bar: IFN-α, White bar: RΒV.

 Intracellular CV—RNA levels in RC YM 1 cell spheroids cultured in TGP were reduced to 90% after 3 days of culture with 100 I UZml IFN—α (Figure 17). )). Similarly, the extracellular HCV particle concentration calculated using the HCV—RNA copy number in the 1. 18 g / m 1 supernatant fraction was 89% with IFN— treatment (Figure 1). 7 A). Furthermore, the production of H C V particles was inhibited to the same extent (85%) as intracellular H C V—R NA by treatment with I O O M R B V (FIG. 17A). The level of HCV—RNA detected in the 1.0 4 g / ml fraction of the culture supernatant of the untreated group was about one-quarter of that in the 1.18 g / ml fraction. Increased with the addition of IFN—Q! Or RBV (Figure 17 A). The mechanism underlying this increase is unknown, but a similar phenomenon was observed when highly cytotoxic drugs were evaluated using TGP—RCYM1 cultures. Thus, as a result of cell death due to the mild cytotoxic effects of IFN and RBV, several cellular proteins that cooperate with HCV—RNA may be released into the culture supernatant.

 In summary, these results demonstrate that a HCV production model based on TGP culture is useful for evaluating HCV particle production and the inhibitory effects of anti-HCV drugs.

Claims

The scope of the claims

1. Cultured HCV particles characterized by the presence of both HCV (hepatitis C virus), RNA and HCV-core protein in the same fraction formed by centrifugation under a concentration gradient.

 2. Cultured HCV particles characterized by being capable of binding to anti-HCV antibody labeled with gold colloid.

 3. A hydrogel-forming polymer is used in which the aqueous solution is in a fluid sol state at a temperature lower than the sol-gel transition temperature and reversibly becomes a hydrogel state at a temperature higher than the sol-gel transition temperature.

 An aqueous solution of the gel-forming material in a fluid sol state at a temperature lower than the sol-gel transition temperature and a cell containing the grown H C V particles are mixed,

 In a state where the mixture is gelled at a temperature higher than the sol-gel transition temperature, the cells are cultured,

 A method for growing H C V particles, comprising: solating the mixture at a temperature lower than a sol-gel transition temperature to recover H C V particles released from the cells.

 4. The method for growing HCV particles according to claim 3, wherein the cells are collected in addition to the collection of the released HCV particles.

 5. The method for growing HCV particles according to claim 3 or 4, wherein the sol-gel transition temperature is in the range of 0 ° C to 37 T.

 6. The method for growing HCV particles according to any one of claims 3 to 5, wherein the aqueous solution of the high-mouth gel forming polymer is substantially insoluble in a gel state.

7. When the aqueous solution is at a temperature lower than the sol-gel transition temperature, it is in a fluid state, and at a temperature higher than the sol-gel transition temperature, it is reversibly hydrodehydrated Using a hydrogel-forming polymer that is in a gel state, mixing the aqueous solution of the gel-forming material in a fluid sol state at a temperature lower than the sol-gel transition temperature and cells containing the HCV particles that have been propagated And

 Culturing the cells in the presence of the drug to be evaluated in a gelled state of the mixture at a temperature higher than the sol-gel transition temperature;

 A method for evaluating a drug, characterized in that the mixture is made into a sol at a temperature lower than the sol-gel transition temperature, and the HCV particles released from the cells are collected or detected.