WO2006084937A1

WO2006084937A1 - Method for diagnosing and treating women with increased response to hormonal replacement therapy

Info

Publication number: WO2006084937A1
Application number: PCT/FI2005/000508
Authority: WO
Inventors: Hannu-Ville LESKELÄ; Petri Pauli Lehenkari; Lauri Kangas
Original assignee: Leskelae Hannu-Ville; Petri Pauli Lehenkari; Lauri Kangas
Priority date: 2005-02-14
Filing date: 2005-11-25
Publication date: 2006-08-17

Abstract

The invention relates to a method for diagnosing women having increased response to hormonal replacement therapy. Said women have a pp polymorphism in the estrogen receptor alpha gene. The invention concerns a method for treatment or preventing diseases or disorders relating to estrogen deficiency in women diagnosed for having increased response to hormonal replacement therapy. Further, the invention concerns selection of female subjects for clinical studies of hormone replacement therapy or of therapies of bone diseases, such as osteoporosis.

Description

METHOD FOR DIAGNOSING AND TREATING WOMEN WITH INCREASED RESPONSE TO HORMONAL REPLACEMENT THERAPY

FIELD OF THE INVENTION

This invention relates to a method for diagnosing women having increased response to hormonal replacement therapy. Furthermore, the invention concerns a method for treatment or preventing diseases or disorders relating to estrogen deficiency in women diagnosed for having increased response to hormonal replacement therapy. Still further, the invention concerns selection of female subjects for clinical studies of hormone replacement therapy or of therapies of bone diseases, such as osteoporosis.

BACKGROUND OF THE INVENTION

The publications and other materials used herein to illuminate the background of the invention, and in particular, cases to provide additional details respecting the practice, are incorporated by reference.

Sex steroid hormones play a pivotal role on both the development and the maintenance of the skeleton (1). Estrogen deficiency has been established as the major cause of postmenopausal osteoporosis. Estrogen deficiency, caused by either menopause or surgical removal of the ovaries, results in a marked bone loss as a result of increased osteoclastic bone resorption (2), which can be restored by hormone replacement therapy (HRT) (3). Although at general level the beneficial effect of estrogen on bone is well recognized and estrogen undoubtedly reduces the risk of the osteoporotic fractures in women (4). On the other hand the effect of 17β- estradiol (E2) can vary greatly at the individual level. After menopause, the rate of bone loss varies and, both fast and slow bone loss can be observed (5, 6). Reasons for these differences between individuals are not well understood. Individual variation is also observed concerning the skeletal responses to the HRT (7,8). Estrogen acts in bone cells via the binding and activation of the estrogen receptor (ER), although some recent studies have also suggested rapid non-genomic actions (9). It is thought that the major effect of estrogen is the inhibition of osteoclast- mediated bone resorption (10), although it is not shown whether this effect is direct or mediated, for example, by osteoblast-osteoclast interactions. However, estrogen has been shown to act as a regulator of osteoblasts and to mediate, for example, antiapoptotic effects as well as osteoprotegerin -RANKL -signaling (11, 12). Direct stimulatory effects of E2 on the expression of variety of markers for the osteoblast phenotype have been reported also in many types of human osteoblast cell lines and primary human osteoblast-like cells (13, 14). On the other hand, in some studies E2 failed to influence on the expression of markers of the osteoblast phenotype (15, 16). Recently, effect of E2 on human marrow stromal cells has been shown to vary depending on the cell strain (17).

Inactivation of the ERa gene is associated with low bone mineral density (BMD), which indicates that ERa could well be one candidate gene explaining the pathogenesis of osteoporosis (18). Despite some critical comments on this paradigm (19) the effect of ER on bone health is evident. It is also shown, that physiological polymorphism of ERa gene may explain the variation between individual BMD or in response to HRT (20-23). Most of the studies done so far have been focused on the polymorphism in the intron 1 of the ERa gene, which can be determined by Pvull and Xbal restriction endonucleases. However, the results in these studies concerning the relationship between PvwII ERa genotypes and BMD changes in different ethnic or environmental populations in postmenopausal women are not consistent (24). The polymorphisms have no known functional consequences for gene expression and therefore, any effects on the BMD are likely mediated through other functional ERa variants in linkage disequilibrium or ERa quantity as such.

The human ERa gene is a ligand-activated transcription factor located on chromosome 6q25. It is composed by eight exons separated by seven intronic regions and spans more than 140 kb (25). In the last years, genetic screening of the ERa gene locus revealed the existence of several polymorphic sites which may be responsible of different allelic variants of the receptor protein. An updated view of the ERa gene structure with its polymorphic variants (26), is illustrated in Figure 1. PvuII (ERa IVS 1-401 T/C) is restriction enzyme, which is used for digestion of genomic DNA, in polymorphic sites in the first intron of the ERa gene. Pvull enzyme recognizes CAG/CTG in the polymorphism site where the base-mutation from T to C has been found. Three different genotypes (PP, Pp and pp) can thus be separated. PP genotype means the sequence CC, Pp the sequence TC, and pp the sequence TT. Polymorphisms PP, Pp and pp on this site are observed in 18, 52-53 and 29-30% of women, respectively (Rizzoli R, Bonjour, J-P and Ferrari SL: Osteoporosis, genetics and hormones. J Molec Endocrinol 26, 79-94, 2001).

Both intron I polymorphisms (recognized by the restriction endonucleases Pvu II and Xba I) and polymorphic variable number of (TA)_n repeat upstream the ERa, were firstly associated with bone mineral density (BMD) variation in the Japanese population (27, 28). Increased osteoporotic risk and the lowest BMD values were found in post-menopausal women homozygous for the absence of Xba I restriction site and for the presence of Pvu II restriction site (Px homozygous haplotype) as well as those with a number of 12 TA repeats. Subsequent studies searching for a segregation of intron I Xba I and Pvu II RFLPs with BMD in other populations have yielded conflicting results (29, 30, 31, 32). Studies on bone turnover and rates of bone loss, according to different Pvu II and /or Xba I RFLPs also gave conflicting results (33).

The molecular mechanism by which Pvu II and Xba I polymorphisms influence bone mass and osteoporotic risk are as yet unclear as they lie in an intronic and apparently non-functional area of the gene. A recent analysis of potential regulatory elements surrounding the two polymorphisms, showed that the P allele, that indicates the absence of Pvu II restriction site, disrupts a potential recognition site (CAGCTG) for the transcription factor AP4, raising the possibility that this polymorphism could influence gene regulation (34). Another explanation is that the two polymorphisms in intron I may be in linkage disequilibrium with causal polymorphisms elsewhere in the ERa gene or in an adjacent gene. To this regard it has been well established that the Pvu II and Xba I polymorphisms are in linkage disequilibrium with an upstream TA repeat polymorphism in the promoter region of the ERa gene (35). The presence of Pvu II and Xba I restriction sites (px haplotype) is strongly associated with a low number of TA repeats, while the absence of Pvu II and Xba I restriction sites is linked with a high number of repeats.

SUMMARY OF THE INVENTION

The inventors of the present inventions have surprisingly found that women having a pp polymorphism in the estrogen receptor alpha gene have an increased response to hormonal replacement therapy, compared to women of the other genotypes (PP or Pp).

Thus, according to one aspect, this invention concerns a method for diagnosing an increased response to hormonal replacement therapy in a woman suffering from estrogen deficiency, said method comprising determining whether said woman has a pp polymorphism in the estrogen receptor alpha gene, said pp polymorphism being indicative of increased response to hormonal replacement therapy.

According to another aspect, the invention concerns a method for the treatment or prevention of a disease or disorder related to estrogen deficiency in a woman having a pp polymorphism in the estrogen receptor alpha gene, said method comprising administering to said woman an effective amount of an estrogen or a selective estrogen receptor modulator or a combination thereof.

According to a third aspect, the invention concerns a method for selection of female subjects for clinical studies in hormonal replacement therapy or therapies related to bone diseases, especially osteoporosis, said method comprising selecting subjects having a pp polymorphism in the estrogen receptor alpha gene.

The benefits of the selection are that number of patients can be decreased and efficacy can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the polymorphisms at the ER-alpha gene locus.

Figure 2 shows the expression of ER-alpha of human MSC cells.

Figure 3 shows that the effect of 17beta-estradiol and the SERMs ospemifene and raloxifene on human MSC derived osteoblasts differentiation and bone formation is different in cells with pp genotype than in non-pp genotype.

DETAILED DESCRIPTION OF THE INVENTION

Definitions:

The term "pp polymorphism" refers to the presence of the sequence TT in the first intron of the estrogen receptor alpha gene as described in prior art.

The tern "treatment" or "treating" shall be understood to include complete curing of a disease or disorder, amelioration or alleviation and of said disease or disorder and delaying the progress or onset of said disease or disorder.

The term "prevention" shall be understood to include complete prevention, prophylaxis, as well as lowering the individual's risk of falling ill with said disease or disorder.

The expression "effective amount" is meant to include any amount of an agent according to the present invention that is sufficient to bring about a desired therapeutical result, especially upon administration to an animal or human subject. The term "estrogen deficiency" shall mean a condition in the woman where the serum level of estrogen is decreased, due to age, medication, surgical measures or any other reason.

"Hormonal replacement therapy" shall mean therapy with natural or synthetic estrogen, combination of estrogen and progestin, a selective estrogen receptor modulator or a combination of these.

The wording "selective estrogen receptor modulator" and any specific compound belonging to this group shall be understood to cover any geometric isomer, any stereoisomer, racemate or other mixture of isomers of the compound. Furthermore, pharmaceutically acceptable salts and other derivatives such as esters as well as metabolites are also included.

Preferred embodiments

Although the diagnostic method according to this invention is useful for screening any woman suffering from estrogen deficiency to find out whether the woman has pp polymorphism in her ER alpha gene, the method is particularly useful for menopausal or postmenopausal women, particularly postmenopausal woman.

Accordingly, the therapeutic method should preferably be applied on menopausal or postmenopausal women with pp polymorphism in the ER alpha gene.

The pp polymorphism of the estrogen receptor alpha gene can be analysed from any cell containing intact DNA. Most preferably from blood leucocytes, mucosal membrane or mucosal biopsy of the woman is used for this purpose. The pp polymorphism in the estrogen receptor alpha gene is preferably carried out by a DNA analyse according to any well known method. Alternatively, the pp polymorphism can be detected by an RNA analyse or an immunoassay.

Most preferably, the hormonal replacement therapy is based on the use of a selective estrogen receptor modulator (SERM). Preferable SERMs

Selective estrogen receptor modulators have both estrogen-like and antiestrogenic properties (Kauffman & Bryant, Drug News Perspect 8:531-539, 1995). The effects may be tissue-specific as in the case of tamoxifen and toremifene which have estrogen-like effects in the bone, partial estrogen-like effect in the uterus and liver, and pure antiestrogenic effect in breast cancer. Raloxifene and droloxifen are similar to tamoxifen and toremifene, except that their antiestrogenic properties dominate. They are known to decrease total and LDL cholesterol, thus deminishing the risk of cardiovascular diseases, and they may prevent osteoporosis and inhibit breast cancer growth in postmenopausal women.

Suitable selective estrogen receptor modulators (SERMs) for use in this invention are, for example, the compounds disclosed in V Craig Jordan, J Medicinal Chemistry (2003):46, No.7.

Thus, examples of especially suitable SERM compounds for use in the present invention are triphenylalkene or triphenylalkane compounds such as compounds disclosed in WO 01/36360, US 4,996,225, US 4,696,949, US 5,750,576, WO

99/42427 and the toremifene metabolites disclosed in L Kangas, Cancer Chemother Pharmacol (1990)27:8-12. As examples of specific drugs disclosed in the aforementioned references can be mentioned toremifene, fispemifene and ospemifene. Droloxifene and iodoxifene also examples of suitable SERMs of triphenylalkene structure.

Other preferable examples of SERM compounds are compounds of benzothiophene structure (described for example in EP 584952, US 4,133,814, US 4,418,068) and arzoxifene.

As further examples of suitable SERMs can be mentioned EM652, EM800, EM776, EM651, EM312, ICI 182780, ERA-923, zindoxifene and deacetylated zindoxifene, ZKl 19010, TSE-4247, lasoxifene and its analogues, particularly those disclosed in EP 802910, nafoxidine, basedoxifene, GW5638, GW7604, compound no. 32 disclosed in Jordan (2003), ICI 164384, RU 58668, RU 39411 and EM 319.

Preferably, the SERM is a triphenylalkane compound, a triphenylalkene compound, abenzothiophene compound, EM652, EM800, EM776, EM651, EM312, ICI 182780, ERA-923, zindoxifene, deacetylated zindoxifene, ZKl 19010, TSE-4247, lasoxifene, a lasoxifene analogue, nafoxidine, basedoxifene, GW5638, GW7604, ICI 164384, RU 58668, RU 39411 or EM 319, or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

Still more preferably, the SERM is a triphenylbutene compound of the formula (I)

Cl wherein Rl is H, halogen, OCH₃, or OH; and R2 is

where X is O, NH or S; and n is an integer from 1 to 4; and

R4 and R5, which are the same or different, are a 1 to 4 carbon alkyl, H, -CH₂CsCH or -CH₂CH₂OH; or R4 and R5 form an N-containing five- or six-membered ring or heteroaromatic ring; or b) -Y-(CH₂)_nCH₂-O-R6 where Y is O, NH or S and n is an integer from 1 to 4; and R6 is H, -CH₂CH₂OH, or -CH₂CH₂Cl; or c) 2,3-dihydroxypropoxy, 2-methylsulfamylethoxy, 2-chloroethoxy, l-ethyl-2- hydroxyethoxy, 2,2-diethyl-2-hydroxyethoxy or carboxymethoxy; and

R3 is H, halogen, OH or -OCH₃ or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

The aforementioned specific SERMs or classes of SERMs are examples only, and other SERMs may be suitable for use in this invention as well.

As specific examples of particularly useful SERMs can be mentioned certain compounds of those disclosed in WO 01/36360, namely

(Z)-2-[3-(4-Chloro-l,2-diphenyl-but-l-enyl)phenoxy]ethanol (Z)-2-{2-[4-(4-Chloro-l ,2-diphenylbut-l-enyl)phenoxy]ethoxy}ethanol (also known under the generic name fϊspemifene)

(Z)-{2-[3-(4-Chloro-l,2-diphenylbut-l-enyl)phenoxy]ethyl}dimethylamine (E)-3 - {4-Chloro- 1 - [4-(2-hydroxyethoxy)phenyl] -2-phenyl-but- 1 -enyl } -phenol (E)-3 - {4-Chloro- 1 - [4-(2-imidazol- 1 -yl-ethoxy)phenyl] -2-phenyl-but- 1 -enyl } -phenol, ■ (Z)-3 - {4-Chloro- 1 - [4-(2-imidazol- 1 -yl-ethoxy)phenyl] -2-phenyl-but- 1 -enyl} -phenol,

and (Z)- 2-[4-(4-Chloro-l,2-diphenyl-but-l-enyl)phenoxy]ethanol (ospemifene).

Also raloxifene or lasofoxifene are preferred.

Most preferably, the SERM is ospemifene or a metabolite or a pharmaceutically acceptable salt thereof. The term "metabolite" shall be understood to cover any ospemifene or (deaminohydroxy)toremifene metabolite already discovered or to be discovered. As examples of such metabolites can be mentioned the oxidation metabolites mentioned in Kangas (1990) on page 9 (TORE VI, TORE VII, TORE XVIII, TORE VIII, TORE XIII), especially TORE VI and TORE XVIII, and other metabolites of the compound. The most important metabolite of ospemifene is 4- hydroxyospemifene, which has the formula

For the purpose of this invention, the SERM or its isomer, isomer mixture or their pharmaceutically acceptable salts can be administered by various routes. The suitable administration forms include, for example, oral formulations; parenteral injections including intravenous, intramuscular, intradermal and subcutanous injections; and transdermal or rectal formulations. Suitable oral formulations include e.g. conventional or slow-release tablets and gelatine capsules.

The required dosage of the SERM compounds will vary with the particular condition being treated, the severity of the condition, the duration of the treatment, the administration route and the specific compound being employed. For example, ospemifene can be administered perorally. The optimal daily dose may be 25- 100 mg, preferably 30 - 90 mg. Ospemifene can be given as tablets or other formulations like gelatine capsules alone or mixed in any clinically acceptable non-active ingredients which are used in the pharmaceutical industry.

Diseases or disorders that can be prevented or treated by using hormonal replacement therapy according to this invention

The hormonal replacement therapy can be used for treatment or prevention of any disease or disorder caused by estrogen deficiency, particularly any bone disesase expected to respond favourably to estrogens or SERMs. As examples of such diseases can be mentioned osteoporosis, periodontisis, or loosening or loss of teeth. FI2005/000508

11

As non-limiting examples of other disorders or diseases can be mentioned treatment or prevention of symptoms related to skin atrophy, or to epithelial or mucosal atrophy. A particular form of atrophy which can be inhibited by administering of ospemifene is urogenital atrophy. Symptoms related to urogenital atrophy can be divided in two subgroups: urinary symptoms and vaginal symptoms. As examples of urinary symptoms can be mentioned micturation disorders, dysuria, hematuria, urinary frequency, sensation of urgency, urinary tract infections, urinary tract inflammation, nocturia, urinary incontinence, urge incontinence and involuntary urinary leakage. As examples of vaginal symptoms can be mentioned irritation, itching, burning, maladorous discharge, infection, leukorrhea, vulvar pruritus, feeling of pressure and postcoital bleeding.

The invention will be illuminated by the following non-restrictive Experimental Section.

EXPERIMENTAL SECTION

Hormone replacement therapy (HRT) is used effectively to prevent postmenopausal bone loss but individual variation in response to the therapy is seen frequently. We studied the effect of 17β-estradiol (E2) and two SERMs, ospemifene and raloxifene, in human bone marrow derived mesenchymal stem cell (MSC) cultures from female subjects of various ages. MSCs were differentiated into osteoblasts in vitro; differentiation and activity of the cells were quantified by measuring alkaline phosphatase (ALP) activity and calcium deposition, respectively. We found that individual responses to sex hormones varied significantly. In general, E2 and the SERMs increased ALP activity and calcium deposition in MSCs. To explain the individual variation, we hypothesized that the effect of E2 and the SERMs could be influenced by the known estrogen receptor α (ERa) polymorphism and, consequently, PvwII polymorphic site on the locus of the ERa gene was determined. It is shown here, for the first time, that higher spontaneous recruitment and activation of osteoblasts from MSCs is associated with the presence of the P allele in the group of postmenopausal females, whereas higher response to sex steroids treatment is associated with the pp genotype. These results might, at least partly, explain the earlier shown effects of ERa polymorphism on bone and different responses to HRT.

We used the well characterized human bone marrow derived mesenchymal stem cells (MSC) derived osteoblast differentiation and bone formation model to study the variation between individuals in response to E2 and the SERMs. As expected, the drugs caused an increase in the osteoblast differentiation and activity in both sexes. However, we observed large variations between individuals and, surprisingly, this variation was independent on age as such. It was found that the action of sex steroids on human MSCs is ERa PvwII genotype dependent, which suggest that this genotype might be a useful genetic marker in explaining differences in the individual responses to estrogen or SERM treatment.

Methods

Human MSC culture. Human bone marrow was harvested between the years 2002- 2003 from 39 patients, who were operated for either hip fracture or osteoarthrosis and who were randomly selected for the study. Eighteen of the patients were women (from 4 to 88 yr of age, average age 60.95 yr) and 21 were men (from 2 to 86 yr of age, average age 55.86 yr). Two females (age 4 and 6 yr) were operated for a congenital coil of the tibia and femoral excostosis, respectively. Three males (age 2, 13 and 21 yr) underwent surgical operation for a congenital coil of the tibia, chondromatosis of the tarsal joint, and multiple excostosis, respectively. The study protocol was approved by the Ethical Committee of the Northern Ostrobothnia Hospital District.

The procedure for the culture of human MSCs is described earlier (25). Briefly, human MSCs which were obtained from the femoral collum and trochanteric region, were allowed to attach to the culture flasks. After 2 days non-attached cells were washed away, and the cells on flasks were cultured 1 - 2 wk until near- confluence in phenol red free alpha MEM buffered with 20 mM HEPES (Gibco) and containing 10 % heat-inactivated fetal bovine serum (Autogen Bioclear, Wiltshire, United Kingdom), 100 U/ml penicillin, 0.1 mg/ml streptomycin; (Gibco), 2 mM L-glutamine (Gibco, Paisley, United Kingdom), and 100 nM dexamethasone (Sigma- Aldrich, St. Louis, Missouri, USA) at 37⁰C in 5 % CO₂ and 95 % air. Cells used in this study were from the first or the second passage and serum batch in all cell cultures was the same. The culture media with supplements were changed twice a week.

ERa staining. Human MSCs from three patients were seeded at 5000 cells/well into 24-well plates in four replicate wells on glass coverslips and were cultured with medium described, above After 1 and 3 weeks of culture period, the cells were immunostained for ERa as described below. The paraformaldehyde-fixed cells were permeabilized with 0.1 % Triton-X-100 in PBS for 10 min. The cells were incubated in rabbit polyclonal ERa Ab (1 : 100 dilution; Santa Cruz Biotechnology, Santa Cruz, California, USA) for 30 min and rinsed thoroughly in PBS. Cells were then incubated for 30 min with biotinylated goat anti-rabbit Ab (1:100 dilution; Dako Cytomation, Glostrup, Denmark) as secondary Ab until rinsing in PBS and streptavidin biotinylated peroxidase complex (Dako Cytomation). Cells were rinsed again and incubated in DAB-solution (3,3-diaminobenzidine containing 0.09% H₂O₂) for 5 min and counterstained by hematoxylin. Negative controls were stained according to the same procedure without secondary Ab. Subsequent quantitation of proportional stained area was performed with a digital image analysis system MCID M4 (Imaging Researc Inc., St Catharines, Canada) using a Nikon Optiphot II microscope and a Sony DXC-930P color camera.

Western blot. For Western analysis, human MSCs from eleven patients were seeded at 4 x 10³ cells/cm² into 60 mm² Petri dishes, with medium described above. The cells were cultured in duplicate dishes for 3 wk. Cultures were rinsed with PBS and then extracted with RIPA buffer [IxPBS, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% SDS, and Complete EDTA-free protease inhibitor tablets

(Boehringer Mannheim, Mannheim, Germany)] for 30 min on ice. The total protein concentration of the Iy sate was determined using a DC Protein Assay kit (Bio-Rad I2005/000508

14

Laboratories, Hercules, California, USA). Samples with equal amounts of total protein were loaded onto SDS polyacrylamide gel. After electrophoresis, proteins were electrophoretically transferred to Immobilon-P filter (Millipore Corporation, Bedford, Massachusetts, USA). The filter was immunolabeled with rabbit-anti-ERα or goat-anti-ERβ antibodies (Santa Cruz Biotechnology) and peroxidase-linked anti- rabbit or anti goat IgG Ab (Amersham Life Sciences, Little Chalfont, United Kingdom) was used as secondary Ab. Proteins were detected with ECL (Amersham Life Sciences).

Specific alkaline phosphatase (ALP) activity. Human MSCs were seeded at 5000 cells/well into 24-well plates in four replicate wells and were cultured with medium described above, as a control, containing either 0.001 - 10 nM E2 (Sigma-Aldrich), 3xlO^"6, 3x10^"8 and 3xlO^"10 M ospemifene or 10^"7, 10^"9 and 10^"11 M raloxifene. After 3 wk, cultured cells were assayed as described below. The assay buffer containing 0.1% Triton X-100, pH 7.6, was added to each well, and the plates were frozen. After thawing, alkaline phosphatse activity was determined using 0.ImM 4-p- nitrophenylphosphate (Sigma-Aldrich) as substrate and absorbance was read at 405 nm in a plate reader (Victor 2, Wallac Oy, Turku, Finland). Each sample was measured in duplicates. The protein content of the wells was determined by BIO- RAD Protein Assay (Bio-Rad Laboratories, Richmond, California, USA). The enzyme activities were expressed as U/mg protein (specific ALP activity).

Calcium quantification. Human MSCs were seeded at 5000 cells/well into 24-well plates in four replicate wells and were cultured in above described medium with 10 mM sodium β-glycerophosphate (Sigma-Aldrich) and 0.05 mM ascorbic acid-2- phosphate (Sigma-Aldrich), as a control, containing either 0.001 - 10 nM E2 (Sigma-Aldrich), 3x10^"6, 3x10^"8 and 3x10^"10 M ospemifene, or 10^'7, 10^"9 and lO^"11 M raloxifene. For calcium quantification, the cultures were characterized after 5 wk and the cells were washed three times with Ca²⁺ and Mg²⁺ -free PBS and incubated overnight at room temperature in 0.6 M HCl. Calcium determination was based on the reaction of calcium with o-cresolphthalein-complexone according to the manufacturer's instruction (Roche Diagnostics Co., Mannheim, Germany). The colorimetric reaction was read at 570 nm in a plate reader (Victor 2, Wallac Oy).

Genetic Analysis. Genomic DNA was extracted from all cultured human MSCs by lysing them with Proteinase-K (10 mg/ml, Roche) for 2 h at 55 ⁰C. The polymorphic Pvull site [CAGC(T/C)G] of the ER α gene was detected by PCR followed by enzymatic digestion (43). The 1.3-kbase (kb) fragment of ER-α gene was amplified in 20 μl of a buffer solution: 10 mM Tris-HCl pH 8.8, 50 niM KCl, 1.5 mM MgCl₂, 0.08% NP-40, 200 μM each of the four deoxyribonucleotides, 1.2U Taq polymerase (Fermentas, Vilnius, Lithuania), and 20 pmol of each oligonucleotide primer

(forward, 5'-CTGCCACCCTATCTGTATCTTTTCCTATTCACC-S ' in intron 1 and reverse 5'- TCTTTCTCTGCCACCCTGGCGTCGATTATCTGA -3' in exon 2). PCR was performed with the following steps: 94°C for 5 min; 94°C for 1 min, 60°C for 1 min, 72°C for 1 min for 30 cycles, and a final extension 72°C for 7 min (Biometra, Gδttingen, Germany). After amplification, the PCR product was digested with 1OU Pvu //restriction endonuclease (Fermentas) 2 h 37°C, electrophoresed in 2.0% agarose gel, and visualized by ethidium bromide. Capital (P) and small letters (p) refer to the absence and presence of the restriction site, respectively.

Statistical analysis. Values are expressed as mean ± SE or SD. Statistical evaluation was performed using analysis of variance (ANOVA), Student's t-test and linear regression analysis. When ANOVA revealed significant differences, further analysis was performed using Student's t-test for comparing group averages. In the figures *, ** and *** represent the Student's t-test p values of p < 0.05, p < 0.01 and/? < 0.001, respectively.

Results

Human MSCs express ERa. The majority of MCS cells at 1 and 3 weeks of culture showed intense nuclear and cytoplasmic ERa immonoreactivity. The intensity of the staining was quantified by image analysis. It appeared, that the intensity and proportional area of positive staining increased significantly (p < 0.001) during the culture period. To confirm these immunohistochemical observations, we used the Western blotting method, which showed a distinct band at 66 kDa corresponding to the molecular weight of ERa but not at 54 kDa corresponding to ERβ when the cells were cultured for three weeks (Figure 2). The figure shows the MSC derived osteoblasts express ERa. 2a indicates proportional area of positive histological staining vs. negative staining (with secondary antibody) with anti-ERα in human MSC cultures at weeks 1 and 3. The columns show the mean ± SD compared with the negative staining. 2b is a Western blot analysis for expression of ERa and ERβ in differentiating osteoblasts. ERa expression is seen at 66 kDa. No ERβ was found.

E2 enhances human MSC derived osteoblast differentiation and bone formation in vitro. We had previously shown that in the human MSC culture model the osteoblastic differentiation, which is quantified by ALP activity and calcium deposition, reach maximum after 3 and 5 weeks of culture, respectively (25).

The effect ofEl or SERMs on human MSC derived osteoblast differentiation and bone formation in vitro is associated with ERa gene PvuZZ polymorphism in postmenopausal women. In human MSC differentiation and bone formation assays E2 and SERMs had large variation in responses between individuals. These variations could not be explained simply by age and therefore, we asked whether the ERa gene polymorphism could have an effect on the spontaneous osteoblast differentiation and bone formation of the human MSCs. AU cell cultures initially, expressed ALP activity and calcium deposition was also observed even without added steroids. In the group of over 50 years of age female cells with P allele had significantly higher initial ALP activities than the cells with non-P allele (3.24- and 1.44-fold; p < 0.001 and p < 0.01; respectively). In addition, in the female cells, a significant difference between P allele group and non-P allele group on initial calcium deposition could be observed (2.26-fold; p < 0.001) (Figure 3). The figure shows the effect of PuvII ERa gene polymorphism on bone formation in vitro in MSC cultures. The initial levels of calcification in cells carrying pp genotype is weak when compared to non-pp genotype in cells derived from women over 50 years of age. Estradiol and the SERMs raloxifene and ospemifene induce significantly higher calcification in cells with pp genotype than in cells with non-pp genotype.

Discussion

Postmenopausal estrogen deficiency is known to cause a decline in BMD and increased fracture rate in aging females (37). In this study, our preliminary hypothesis was that the E2 or SERM responses might be age-dependent in both male and female. The parameters that were recorded for osteoblast differentiation and activity were ALP activity and calcium deposition, which have been shown earlier to correlate with type 1 collagen deposition and osteocalcin secretion (36).

Surprisingly, we could not demonstrate clear age-dependent changes in E2/SERM effects. Nevertheless, individual responses to both sex steroids showed large variation. Holzer et al. (17) have recently shown that the direct effects of E2 on human marrow stromal cells vary depending on the cell strain, which is consistent with our finding. Several other studies performed using different types of human osteoblastic cells have shown both stimulative (13, 14) and inhibitive (15, 16) E2 effects on classical osteoblast markers such as ALP activity, type I collagen and osteocalcin expression as well as extracellular matrix mineralization.

Immunostaining of ER suggested that ERa has a role as a mediator of E2 effects in our cultures. We could also demonstrate here that ERa protein levels increased during osteoblast differentiation in vitro. Despite several trials we were not able to observe ERβ in these cells which is in conflict with the data presented by Vidal et al. (38) and others who have reported the presence of ERβ protein in human osteoblast cell lines (39).

As the ERa appeared to have a role in mediating the effects of E2/SERMs in these MSC cultures, we studied the effect of PVMII polymorphism of the ERa gene in order to find an explanation for the large variations between individuals both in the initial and sex steroid stimulated levels of osteoblastic markers. The Pp and PP genotypes were combined due to rareness of PP genotype (n = 4, 10.3 %) in our population. The P allele group was compared with the non-P allele group (pp- genotype). When the ALP and calcium deposition data of osteoblasts was carefully analysed according to these allele groups, it became evident that there was a higher spontaneous recruitment and activation of osteoblasts from MSCs associated with the P allele in the group of postmenopausal females, whereas non-P allele was associated with higher response to sex steroid treatments and significantly lower initial ALP and calcium values. This is partly inconsistent with the meta-analysis that reported no association of the Pvull genotypes with BMD and fractures (24). This issue has recently been investigated in several observational studies performed in different ethnical populations with conflicting results (20-23).

The ERa gene maps to chromosome 6q24.1, and the Pvull polymorphic site is located in the first intron of the gene (40). The molecular mechanism by which the Pvωll polymorphism is associated with osteoblast function is currently unclear. However, introns have been recognized to contain regulatory sequences and intronic polymorphisms could affect mRNA production. For example, the SpI polymorphism in the first intron of the collagen type I alpha 1 gene changes the transcription of the gene which eventually leads to decreased BMD and increased fracture risk (41, 42). Intronic polymorphisms are also known to cause changes in gene function by affecting the splicing of mRNA (43, 44) and even have had a significant effect on the level of protein synthesis (45). It is possible that the Pvull polymorphism is linked to another unidentified gene adjacent in the ERa gene that has direct effect on gene transcription. Several studies indicate that a high degree of linkage disequilibrium exists between Pvull andXbal polymorphisms, and the TA repeat polymorphism in the ERa gene (46-48). Herrington et al. (49) have observed that the absence of the PwII restriction site (and the production of the P allele) produces a myb binding site that is capable of regulating transcription of a downstream reporter. Expression of myb itself is induced by estrogen (50) and it is possible that the P allele leads to increased ERa levels in cells by augmented myb expression. According to this, non-P allele might lead to lower ERa protein levels T/FI2005/000508

19 and might encode a "less sensitive" ERa in the target cells. However, alternative explanations are also possible.

Little is known about ERa gene polymorphism, particularly PvwII restriction site. Some in vivo studies have shown, that estrogen response is impaired in cases of the loss-of-function of the ER gene (19, 51). It is possible that physiological mutations of the ERa may cause mild variations in responsiveness to estrogen between individuals (52).

In summary, this is the first study at the cellular level investigating the association between the ERa gene polymorphism and MSCs responses to sex steroids. A new and important finding was that especially postmenopausal female MSCs without P allele seem to have higher capability to response to the E2 or SERMs on recruitment and activation of osteoblasts, whereas cells from postmenopausal females with P allele have higher spontaneous ability to differentiate and form bone. These observations give a better understanding of genetic modifiers of estrogen or SERM action and may help maximize the safety and efficacy of HRT and select to HRT therapy and clinical studies patients who optimally benefit estrogen or SERM therapy.

It will be appreciated that the methods of the present invention can be incorporated in the form of a variety of embodiments, only a few of which are disclosed herein. It will be apparent for the expert skilled in the field that other embodiments exist and do not depart from the spirit of the invention. Thus, the described embodiments are illustrative and should not be construed as restrictive. REFERENCES

1. Compston, J.E. 2001. Sex steroids and bone. Physiol Rev. 81:419-447.

2. Riggs, B.L., Khosla, S., and Melton, LJ., III. 1998. A unitary model for involutional osteoporosis: estrogen deficiency causes both type I and type II osteoporosis in postmenopausal women and contributes to bone loss in aging men. J. Bone Miner. Res. 13:763-773.

3. Lindsay, R., Hart, D.M., Aitken, J.M., MacDonald, E.B., Anderson, J.B., and Clarke, A.C. 1976. Long-term prevention of postmenopausal osteoporosis by oestrogen. Evidence for an increased bone mass after delayed onset of oestrogen treatment. Lancet 1:1038-1041.

4. Ettinger, B., Genant, H.K., and Cann, CE. 1985. Long-term estrogen replacement therapy prevents bone loss and fractures. Ann.Intern.Med. 102:319- 324.

5. Christiansen, C, Riis, BJ., and Rodbro, P. 1987. Prediction of rapid bone loss in postmenopausal women. Lancet 1:1105-1108.

6. Hansen, M.A., Overgaard, K., Riis, BJ., and Christiansen, C. 1991. Role of peak bone mass and bone loss in postmenopausal osteoporosis: 12 year study. BMJ 303:961-964.

7. Hassager, C, Jensen, S.B., and Christiansen, C. 1994. Non-responders to hormone replacement therapy for the prevention of postmenopausal bone loss: do they exist? Osteoporos.Int. 4:36-41.

8. Komulainen, M., Kroger, H., Tuppurainen, M.T., Heikkinen, A.M., Honkanen, R., and Saarikoski, S. 2000. Identification of early postmenopausal women with no bone response to HRT: results of a five-year clinical trial. Osteoporos.Int. 11:211- 218.

9. Kelly, MJ. and Levin, E.R. 2001. Rapid actions of plasma membrane estrogen receptors. Trends Endocrinol.Metab 12:152-156.

10. Tobias, J.H. and Compston, J.E. 1999. Does estrogen stimulate osteoblast function in postmenopausal women? Bone 24:121-124. 11. Kousteni, S., Bellido, T., Plotkin, L.I., O'Brien, C.A., Bodenner, D.L., Han, L., Han, K., DiGregorio, G.B., Katzenellenbogen, J.A., Katzenellenbogen, B. S. et al. 2001. Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104:719-730.

12. Bord, S., Ireland, D.C., Beavan, S.R., and Compston, J.E. 2003. The effects of estrogen on osteoprotegerin, RANKL, and estrogen receptor expression in human osteoblasts. Bone 32:136-141.

13. Ireland, D.C., Bord, S., Beavan, S.R., and Compston, J.E. 2002. Effects of estrogen on collagen synthesis by cultured human osteoblasts depend on the rate of cellular differentiation. J. Cell Biochem. 86:251-257.

14. Waters, K.M., Rickard, D.J., Riggs, B.L., Khosla, S., Katzenellenbogen, J.A., Katzenellenbogen, B. S., Moore, J., and Spelsberg, T.C. 2001. Estrogen regulation of human osteoblast function is determined by the stage of differentiation and the estrogen receptor isoform. J. Cell Biochem. 83:448-462.

15. Katzburg, S., Lieberherr, M., Ornoy, A., Klein, B.Y., Hendel, D., and Somjen, D. 1999. Isolation and hormonal responsiveness of primary cultures of human bone- derived cells: gender and age differences. Bone 25:667-673.

16. Keeting, P.E., Scott, R.E., Colvard, D.S., Han, I.K., Spelsberg, T.C, and Riggs, B. L. 1991. Lack of a direct effect of estrogen on proliferation and differentiation of normal human osteoblast-like cells. J.Bone Miner.Res. 6:297-304.

17. Holzer, G., Einhorn, T. A., and Majeska, R.J. 2002. Estrogen regulation of growth and alkaline phosphatase expression by cultured human bone marrow stromal cells. J.Orthop.Res. 20:281-288.

18. Smith, E.P., Boyd, J., Frank, G.R., Takahashi, H., Cohen, R.M., Specker, B., Williams, T.C, Lubahn, D.B., and Korach, K.S. 1994. Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. N.Engl.J.Med. 331:1056- 1061.

19. Manolagas, S.C, Kousteni, S., and Jilka, RL. 2002. Sex steroids and bone. Recent Prog.Horm.Res. 57:385-409.

20. Deng, H.W., Li, J., Li, JL., Johnson, M., Gong, G., Davis, K.M., and Recker, R.R. 1998. Change of bone mass in postmenopausal Caucasian women with and without hormone replacement therapy is associated with vitamin D receptor and estrogen receptor genotypes. Hum.Genet. 103:576-585.

21. Ongphiphadhanakul, B., Chanprasertyothin, S., Payatikul, P., Tung, S. S., Piaseu, N., Chailurkit, L., Chansirikarn, S., Puavilai, G., and Rajatanavin, R. 2000. Oestrogen-receptor-alpha gene polymorphism affects response in bone mineral density to oestrogen in post-menopausal women. Clin.Endocrinol.(Oxf) 52:581-585.

22. Salmen, T., Heikkinen, A.M., Mahonen, A., Kroger, H., Komulainen, M., Saarikoski, S., Honkanen, R., and Maenpaa, P.H. 2000. Early postmenopausal bone loss is associated with PvuII estrogen receptor gene polymorphism in Finnish women: effect of hormone replacement therapy. J.Bone Miner.Res. 15:315-321.

23. Salmen, T., Heikkinen, A.M., Mahonen, A., Kroger, H., Komulainen, M., Saarikoski, S., Honkanen, R., and Maenpaa, P.H. 2000. The protective effect of hormone-replacement therapy on fracture risk is modulated by estrogen receptor alpha genotype in early postmenopausal women. J.Bone Miner.Res. 15:2479-2486.

24. Ioannidis, J.P., Stavrou, L, Trikalinos, T.A., Zois, C, Brandi, M.L., Gennari, L., Albagha, O., Ralston, S.H., and Tsatsoulis, A. 2002. Association of polymorphisms of the estrogen receptor alpha gene with bone mineral density and fracture risk in women: a meta-analysis. J.Bone Miner.Res. 17:2048-2060.

25. S. Green, P. Walter, V. Kumar, J. Bornet, P. Arpos and P. Chambon , Human estrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature

320 (1986), pp. 134-139.

26. Gennari et al, Genetics of osteoporosis: role of steroid hormone receptor gene polymorphisms. J Steroid Biochem Molec Biol 81 (2002) 1-24.

27. M. Sano, S. Inoue, T. Hosoi, Y. Ouchi, M. Emi, M. Shiraki and H. Orimo , Association of estrogen receptor dinucleotide repeat polymorphism with osteoporosis. Biochem. Biophys. Res. Commun. 217 (1995), pp. 378-383.

28. S. Kobayashi, S. Inoue, T. Hosoi, Y. Ouchi, M. Shiraki and H. Orimo , Association of bone mineral density with polymorphism of the estrogen receptor gene. J. Bone Miner. Res. 11 (1996), pp. 306-311. 29. K.O. Han, LG. Moon, Y.S. Kang, H.Y. Chung, H.K. Min and LK. Han , Non- association of estrogen receptor genotypes with bone mineral density and estrogen responsiveness to hormone replacement therapy in Korean post-menopausal women. J. CHn. Endocrinol. Metab. 82 (1997), pp. 991-995. 30. C. Vandevyver, J. Vanhoof, K. Declerck, P. Stinissen, C. Vandervorst, L. Michiels, JJ. Cassiman, S. Boonen, J. Raus and P. Geusens , Lack of association between estrogen receptor genotypes and bone mineral density, fracture history or muscle strength in elderly women. J. Bone Miner. Res. 14 (1999), pp. 1576-1582. 31. S. Kobayashi, S. Inoue, T. Hosoi, Y. Ouchi, M. Shiraki and H. Orimo , Association of bone mineral density with polymorphism of the estrogen receptor gene. J. Bone Miner. Res. 11 (1996), pp. 306-311.

32. Ioannidis et al, Differential genetic effects of ESRl gene polymorphisms on osteoporosis outcomes. JAMA 292 (2004) 2105-2114).

33. M. Willing, M. Sowers, D. Aron, M.K. Clark, T. Burns, C. Bunten, M. Crutchfield, D. D'Agostino and M. Jannausch , Bone mineral density and its change in white women: estrogen and Vitamin D receptor genotypes and their interaction. J. Bone Miner. Res. 13 (1998), pp. 695-705. 34. O.M.E. Albagha, F.E.A. McGuigan, DM. Red and S.H. Ralston , Estrogen receptor Ot^* gene polymorphism and bone mineral density: haplotype analysis in women from the UK. J. Bone Miner. Res. 16 (2001), pp. 128-134.

35. B.L. Langdahl, E. Lokke, M. Carstens, L.L. Stenkjer and E.F. Eriksen , A TA repeat polymorphism in the estrogen receptor gene is associated with osteoporotic fractures but polymorphisms in the first exon and intron are not. J. Bone Miner. Res. 15 (2000), pp. 2222-2230.

36. Leskela, H.V., Risteli, J., Niskanen, S., Koivunen, J., Ivaska, K.K., and Lehenkari, P. 2003. Osteoblast recruitment from stem cells does not decrease by age at late adulthood. Biochem.Biophys.Res.Commun. 311:1008-1013.

37. Riggs, B.L., Khosla, S., Atkinson, E.J., Dunstan, C.R., and Melton, L.J., III. 2003. Evidence that type I osteoporosis results from enhanced responsiveness of bone to estrogen deficiency. Osteoporos.Int. 14:728-733.

38. Vidal, O., Kindblom, L.G., and Ohlsson, C. 1999. Expression and localization of estrogen receptor-beta in murine and human bone. J.Bone Miner. Res. 14:923-

929.

39. Bord, S., Horner, A., Beavan, S., and Compston, E. 2001. Estrogen receptors alpha and beta are differentially expressed in developing human bone. Journal of Clinical Endocrinology and Metabolism 86:2309-2314. 40. Albagha, O.M., McGuigan, F.E., Reid, D.M., and Ralston, S.H. 2001. Estrogen receptor alpha gene polymorphisms and bone mineral density: haplotype analysis in women from the United Kingdom. J.Bone Miner.Res. 16:128-134.

41. Grant, S.F., Reid, D.M., Blake, G., Herd, R., Fogelman, L, and Ralston, S.H. 1996. Reduced bone density and osteoporosis associated with a polymorphic SpI binding site in the collagen type I alpha 1 gene. Nat.Genet. 14:203-205.

42. Uitterlinden, A.G., Burger, H., Huang, Q., Yue, F., McGuigan, F.E., Grant, S.F., Hofinan, A., van Leeuwen, J.P., Pols, H.A., and Ralston, S.H. 1998. Relation of alleles of the collagen type Ialphal gene to bone density and the risk of osteoporotic fractures in postmenopausal women. N.Engl.J.Med. 338:1016-1021.

43. Gotoda, T., Kinoshita, M., Ishibashi, S., Inaba, T., Harada, K., Shimada, M., Osuga, J., Teramoto, T., Yazaki, Y., and Yamada, N. 1997. Skipping of exon 14 and possible instability of both the mRNA and the resultant truncated protein underlie a common cholesteryl ester transfer protein deficiency in Japan. Arterioscler.Thromh. Vasc.Biol. 17:1376-1381.

44. O'Neill, J.P., Rogan, P.K., Cariello, N., andNicklas, J.A. 1998. Mutations that alter RNA splicing of the human HPRT gene: a review of the spectrum. Mutat.Res. 411:179-214.

45. Laurie, CC. and Stam, L.F. 1994. The effect of an intronic polymorphism on alcohol dehydrogenase expression in Drosophila melanogaster. Genetics 138:379- 385.

46. Becherini, L., Gennari, L., Masi, L., Mansard, R., Massart, F., Morelli, A., Falchetti, A., Gonnelli, S., Fiorelli, G., Tanini, A. et al. 2000. Evidence of a linkage disequilibrium between polymorphisms in the human estrogen receptor alpha gene and their relationship to bone mass variation in postmenopausal Italian women. HumMol.Genet. 9:2043-2050.

47. Langdahl, B.L., Lokke, E., Carstens, M., Stenkjaer, L.L., and Eriksen, E.F. 2000. A TA repeat polymorphism in the estrogen receptor gene is associated with osteoporotic fractures but polymorphisms in the first exon and intron are not. J.Bone Miner.Res. 15:2222-2230.

48. van Meurs, J.B., Schuit, S.C., Weel, A.E., van der, K.M., Bergink, A.P., Arp, P.P., Colin, E.M., Fang, Y., Hofman, A., van Duijn, CM. et al. 2003. Association of 5' estrogen receptor alpha gene polymorphisms with bone mineral density, vertebral bone area and fracture risk. HumMol.Genet. 12:1745-1754. 49. Herrington, D.M., Howard, T.D., Brosnihan, K.B., McDonnell, D.P., Li, X., Hawkins, G.A., Reboussin, D.M., Xu, J., Zheng, S.L., Meyers, D.A. et al. 2002. Common estrogen receptor polymorphism augments effects of hormone replacement therapy on E-selectin but not C-reactive protein. Circulation 105:1879- 1882.

50. Jeng, M.H., Shupnik, M.A., Bender, T.P., Westin, E.H., Bandyopadhyay, D., Kumar, R., Masamura, S., and Santen, RJ. 1998. Estrogen receptor expression and function in long-term estrogen-deprived human breast cancer cells. Endocrinology 139:4164-4174.

51. Korach, K. S. 1994. Insights from the study of animals lacking functional estrogen receptor. Science 266:1524-1527.

52. Purohit, A., Flanagan, A.M., and Reed, MJ. 1992. Estrogen synthesis by osteoblast cell lines. Endocrinology 131:2027-2029.

Claims

050826CLAIMS

1. A method for diagnosing an increased response to hormonal replacement therapy in a woman suffering from estrogen deficiency, said method comprising determining whether said woman has a pp polymorphism in the estrogen receptor alpha gene, said pp polymorphism being indicative of increased response to hormonal replacement therapy.

2. The method according to claim 1 wherein the woman is a menopausal or postmenopausal woman.

3. The method according to claim 1 or 2 wherein the polymorphism of the estrogen receptor alpha gene is analysed from any cell containing intact DNA, preferably from blood leucocytes of said woman.

4. The method according to claim 1 or 2 wherein the determination of the pp polymorphism in the estrogen receptor alpha gene is carried out by a DNA analyse, an RNA analyse or an immunoassay.

5. The method according to any of the claims 1-4 wherein the hormonal replacement therapy is a therapy with an estrogen, a combination of estrogen and progestine, a therapy with a selective estrogen receptor modulator or a combination of said therapies.

6. A method for selection of female subjects for clinical studies in hormonal replacement therapy or therapies related to bone diseases, especially osteoporosis, said method comprising selecting subjects having a pp polymorphism in the estrogen receptor alpha gene.

7. A method for the treatment or prevention of a disease or disorder related to estrogen deficiency in a woman having a pp polymorphism in the estrogen receptor alpha gene, said method comprising administering to said woman an effective amount of an estrogen or a selective estrogen receptor modulator or a combination thereof.

8. The method according to claim 7 wherein the woman is a menopausal or postmenopausal woman.

9. The method according to claim 7 or 8 wherein the disease is a bone disease expected to respond favourably to estrogens.

10. The method according to claim 9 wherein said disease is osteoporosis.

11. The method according to claim 9 wherein said disease is periodontitis, or loosening or loss of teeth.

12. The method according to any of the claims 7 - 11 comprising administering of a selective estrogen receptor modulator or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

13. The method according to claim 12 wherein the selective estrogen receptor modulator is a triphenylalkane compound, a triphenylalkene compound, a benzothiophene compound, EM652, EM800, EM776, EM651, EM312, ICI 182780, ERA-923, zindoxifene, deacetylated zindoxifene, ZKl 19010, TSE-4247, lasoxifene, a lasoxifene analogue, nafoxidine, basedoxifene, GW5638, GW7604, ICI 164384, RU 58668, RU 39411 or EM 319, or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

14. The method according to claim 13 wherein the selective estrogen receptor modulator is a triphenylbutene compound of the formula (I)

wherein Rl is H, halogen, OCH₃, or OH; and

R2 is

where X is O, NH or S; and n is an integer from 1 to 4; and

R4 and R5, which are the same or different, are a 1 to 4 carbon alkyl, H, -CH₂C^CH or -CH₂CH₂OH; or

R4 and R5 form an N-containing five- or six-membered ring or heteroaromatic ring; or b) -Y-(CH₂)_nCH₂-O-R6 where Y is O, NH or S and n is an integer from 1 to 4; and R6 is H, -CH₂CH₂OH, or -CH₂CH₂Cl; or c) 2,3-dihydroxypropoxy, 2-methylsulfamylethoxy, 2-chloroethoxy, l-ethyl-2- hydroxyethoxy, 2,2-diethyl-2-hydroxyethoxy or carboxymethoxy; and R3 is H, halogen, OH or -OCH₃ or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

15. The method according to claim 13 wherein the selective estrogen receptor modulator is selected from the group consisting of (Z)-2-[3-(4-Chloro-l,2-diphenyl-but-l-enyl)ρhenoxy]ethanol,

(Z)-2- {2-[4-(4-Chloro- 1 ,2-diphenylbut- 1 -enyl)phenoxy]ethoxy } ethanol (fispemifene),

(Z)- {2-[3 -(4-Chloro- 1 ,2-diphenylbut- 1 -enyl)phenoxy]ethyl} dimethylamine, (E)-3- {4-Chloro- 1 -[4-(2-hydroxyethoxy)phenyl] -2-phenyl-but- 1 -enyl} -phenol,

(E)-3 - {4-Chloro- 1 -[4-(2-imidazol-l -yl-ethoxy)phenyl]-2-phenyl-but- 1 -enyl} - phenol,

(Z)-3 - {4-Chloro- 1 -[4-(2-imidazol- 1 -yl-ethoxy)phenyl] -2-phenyl-but- 1 -enyl} - phenol,

(Z)-2-[4-(4-chloro-l,2-diphenyl-but-l-enyl)phenoxy]ethanol (ospemifene), raloxifene, and lasofoxifene or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

16. The method according to claim 15 wherein the selective estrogen receptor modulator is ospemifene or metabolite or a pharmaceutically acceptable salt thereof.

17. The use of an estrogen or a selective estrogen receptor modulator or a combination thereof for the manufacture of a pharmaceutical composition for use in a method for the treatment or prevention of a disease or disorder related to estrogen deficiency in a woman having a pp polymorphism in the estrogen receptor alpha gene.

18. The use according to claim 17 wherein the woman is a menopausal or postmenopausal woman.

19. The use according to claim 17 or 18 wherein the disease is a bone disease expected to respond favourably to estrogens.

20. The use according to claim 19 wherein said disease is osteoporosis.

21. The use according to claim 19 wherein said disease is periodontitis, or loosening or loss of teeth.

22. The use according to any of the claims 17 - 21 comprising administering of a selective estrogen receptor modulator or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

23. The use according to claim 22 wherein the selective estrogen receptor modulator is a triphenylalkane compound, a triphenylalkene compound, a benzothiophene compound, EM652, EM800, EM776, EM651, EM312, ICI 182780, ERA-923, zindoxifene, deacetylated zindoxifene, ZKl 19010, TSE-4247, lasoxifene, a lasoxifene analogue, nafoxidine, basedoxifene, GW5638, GW7604, ICI 164384, RU 58668, RU 39411 or EM 319, or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

24. The use according to claim 23 wherein the selective estrogen receptor modulator is a triphenylbutene compound of the formula (I)

wherein Rl is H, halogen, OCH₃, or OH; and R2 is

where X is O, NH or S; and n is an integer from 1 to 4; and

R4 and R5, which are the same or different, are a 1 to 4 carbon alkyl, H, -CH₂C=CH Or -CH₂CH₂OH; or

R4 and R5 form an N-containing five- or six-membered ring or heteroaromatic ring; or b) -Y-(CH₂)_nCH₂-O-R6 005/000508

31 where Y is O, NH or S and n is an integer from 1 to 4; and R6 is H, -CH₂CH₂OH₅ or -CH₂CH₂Cl; or c) 2,3-dihydroxypropoxy, 2-methylsulfamylethoxy, 2-chloroethoxy, l-ethyl-2- hydroxyethoxy, 2,2-diethyl-2-hydroxyethoxy or carboxymethoxy; and R3 is H, halogen, OH or -OCH₃ or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

25. The use according to claim 23 wherein the selective estrogen receptor modulator is selected from the group consisting of (Z)-2-[3-(4-Chloro-l,2-diρhenyl-but-l-enyl)ρhenoxy]ethanol,

(Z)-2- {2-[4-(4-Chloro- 1 ,2-diphenylbut- 1 -enyl)phenoxy] ethoxy } ethanol (fispemifene),

(Z)-{2-[3-(4-Chloro-l,2-diphenylbut-l-enyl)phenoxy]ethyl}dimethylamine, (E)-3-{4-Chloro-l-[4-(2-hydroxyethoxy)phenyl]-2-phenyl-but-l-enyl}-phenol, (E)-3 - {4-Chloro- 1 - [4-(2-imidazol- 1 -yl-ethoxy)phenyl]-2-phenyl-but- 1 -enyl} - phenol,

(Z)-3-{4-Chloro-l-[4-(2-imidazol-l-yl-ethoxy)ρhenyl]-2-ρhenyl-but-l-enyl}- phenol,

(Z)-2-[4-(4-chloro- 1 ,2-diphenyl-but- 1 -enyl)phenoxy]ethanol (ospemifene), raloxifene, and lasofoxifene or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof.

26. The use according to claim 25 wherein the selective estrogen receptor modulator is ospemifene or metabolite or a pharmaceutically acceptable salt thereof.