WO2002006522A2

WO2002006522A2 - Estrogen receptor gene polymorphisms as markers for determining a predisposition for low bone density

Info

Publication number: WO2002006522A2
Application number: PCT/CA2001/000898
Authority: WO
Inventors: François Rousseau
Original assignee: Signalgene Inc.
Priority date: 2000-07-15
Filing date: 2001-06-15
Publication date: 2002-01-24
Also published as: WO2002006522A3

Abstract

The invention relates to a method of determining genetic predisposition to low or high bone mineral density of a patient, wherein low beone density is indicative of a predisposition to esteoporosis, esteopenia or bone fracture and high bone density is indicative of resistance to osteoporosis, osteopenia or bone fracture. The invention further relates to a marker at the estrogen receptor or equivalents thereof to prognose a response to esteoporosis therapy. As well, the invention relates to a method for determining osteoporosis susceptibility, prognosis and response to therapy based on a determination of the combination of the genotype at the estrogen receptor or at markers in linkage disequilibrium therewith, alone or together with other parameters such as age, or a therapeutic regimen. The invention further relates to screening assays to identify and select agents which can be used in the treatment of osteoporosis.

Description

TITLE OF THE INVENTION

MARKER AT THE ESTROGEN RECEPTOR GENE FOR DETERMINATION OF LOW BONE DENSITY PREDISPOSITION

FIELD OF THE INVENTION The invention relates to a method of determining-genetic predisposition to low or high bone mineral density of a patient, wherein low bone density is indicative of a predisposition to osteoporosis, osteopenia or bone fracture and high bone density is indicative of resistance to osteoporosis, osteopenia or bone fracture. The invention further relates to a marker at the estrogen receptor or equivalents thereof to prognose a response to osteoporosis therapy. As well, the invention relates to a method for determining osteoporosis susceptibility, prognosis and response to therapy based on a determination of the combination of the genotype at the estrogen receptor or at markers in linkage disequilibrium therewith, alone or together with other parameters such as age, or a therapeutic regimen. The invention further relates to screening assays to identify and select agents which can be used in the treatment of osteoporosis.

BACKGROUND OF THE INVENTION

Osteoporosis, a reduction of bone mineral density (BMD), is a multifactorial disease that leads to an increasing risk of fracture and is becoming a major public health problem, especially in post- menopausal women. Its major consequence, hip fracture, has major health consequences with serious social, medical and economical implications in increasingly aging populations. Research on osteoporosis emphasized at either finding new therapeutic approaches or at the characterization of the major determinants of bone mineral density (BMD) in the hopes of finding markers useful in the identification of women at risk for osteoporosis and its complications. Since therapy of established osteoporosis remains far from satisfactory, prevention is the best choice. Heredity has always been considered an important risk factor for osteoporosis, but its role was poorly understood, at least until recently. Indeed, several studies of monozygotic (MZ) and dizygotic (DZ) twins have shown that BMD was better correlated between MZ than DZ twins, indicating that BMD is genetically determined and that heredity could account for up to 80 to 90% of the variability in BMD. Intra and intergeneration correlations were more contradictory, with two studies showing significantly lower BMD in daughters of women with osteoporosis while another mother/daughter pairs study found no such difference. Since a decrease of one standard deviation in BMD within normal range approximately doubles the risk of fracture at different skeletal sites, the search for a marker likely to identify women at risk of post-menopausal osteoporotic fractures is becoming more and more relevant.

Apart from rare genetic mutations that significantly alter the function of a gene, the hypothesis underlying alielic association studies in osteoporosis is that genetic polymorphisms with small functional differences may increase or decrease risk for osteoporosis, resulting in significant differences in bone density (BD) during perimenopause and/or thereafter. A few candidate genes for osteoporosis have been studied so far.

Polymorphisms in the vitamin D receptor (VDR) gene located on chromosome 12 have been reported to be correlated with the levels of osteocalcin (BGP), a marker of bone turnover. Another candidate gene with a potential role on individual variability in BD is the androgen receptor gene (AR), located on chromosome X. Also, recent reports on association between collagen type Iα1 (COLIAI1) variants and BMD in two different populations make this locus a strong candidate as one of the genes involved in the genetic determination of BMD, and possibly the risk of osteoporosis. Also, genes coding for interleukin 1 receptor antagonist, collagen type Iα2, transforming growth factor β1 , α₂HS- glycoprotein, interleukin-6, and apolipoprotein E have been related to osteoporosis as well. Recently, the polymorphic (CAG)_a site in the androgen receptor gene has been associated with bone mineral density of the femoral neck and lumbar spine (Sowers et al. 1999, Journal of Bone Mineral Research 14(8): 1411-1419).

A group of investigators has highlighted that polymorphism in the vitamin D receptor (VDR) gene were significantly correlated with the levels of osteocalcin, a marker of bone turnover. The same Australian group studied a cohort of 250 healthy twins for BMD and a polymorphism at the VDR revealed by the restriction enzyme Bsm I and found that genotype at the VDR could explain up to 75% of the genetic variation in BMD at the lumbar vertebrae and proximal femur. The BB genotype, where B represents the allele with absence of the restriction site and b represents the allele with the polymorphic Bsm I site, is associated with lower BMD and likely to an increased predisposition to osteoporosis. The bb genotype was associated with a higher BMD and the Bb genotype was associated with intermediate BMD. Moreover, they studied 311 unrelated healthy women and confirmed that genotype at the VDR locus was a strong predictor of BMD at both lumbar and femoral sites. The authors used an in vitro model (minigene model) suggesting that the VDR gene allelic variation could influence the rate of the receptor protein synthesis (Morrisson NA et al., Nature, 1994, 367:284-297). Many other groups have now published their results on different populations, which are contradictory. A twin study done in the United Kingdom confirmed the association between VDR genotype and BMD adjusted for body mass index (BMI). Another twin study in Indiana showed that up to 70% of the BMD could be attributed to heredity but did not find any relationship between VDR polymorphism and BMD. Another study concentrated on mother/daughter pairs in a Swiss population and found that VDR alleles contributed to mother/daughter BMD relationship. This study also showed that VDR polymorphism was associated with femoral BMD in teenage girls and pre-menopausal women. Another group from Massachusetts showed that the BB genotype was associated with significantly lower BMD compared to Bb and bb genotypes in both black and white races in a cohort of healthy unrelated pre-menopausal women aged 20 to 40. This suggested that the VDR polymorphism may limit peak bone mass. Two studies from Japan on healthy unrelated women concluded that there was a difference in allele frequencies between Caucasian and Asian populations. One group found an association between VDR genotype and BMD at the lumbar vertebrae but the trend was more apparent in pre than post-menopausal women. The other Japanese group concentrated on post-menopausal women and confirmed the association between VDR polymorphism and lumbar BMD but the genotype could not predict total BMD and had little clinical significance in the evaluation of bone status in Japanese women. Recently, a group from the Netherlands found an association between VDR alleles and BMD, but the allele previously described as "protective" against osteo- porosis was associated with lower BMD at the femoral neck and Ward's triangle, suggesting allelic heterogeneity at the VDR locus.

Two studies looked at allelic frequencies in both normal and osteoporotic women. One group from Sweden found a 2.2 fold increase in the prevalence of the predisposing BB genotype in severely osteoporotic women compared to normal healthy controls but the relationship did not seem to reach statistical significance. The other group from Minnesota, did not find a significant difference in genotype prevalence. They also noted that the effect of VDR genotype on BMD was modulated by age, with a greater effect in pre-menopausal women, reinforcing the hypothesis that allelic variations at the VDR locus may influence peak bone mass.

Finally, a longitudinal study was recently published where lumbar and proximal femoral BMD were measured every six months for eighteen months in a cohort of elderly Swiss men and women. They concluded that the rate of bone loss was associated, with VDR genotype at the lumbar spine but not at the femoral neck. The BB genotype showed greater rate of bone loss, irrespective of calcium intake or supplement, but the rate of bone change for the Bb genotype was influenced by overall calcium intake.

International Patent application No. WO 94/03633 (published on February 17, 1994) discloses a genetic test for assaying a predisposition to and/or resistance to high rates of bone turnover, development of low bone mass and responsiveness to therapeutic treatment. This test can be used for predicting osteoporosis and likely response to preventive or therapeutic modalities. The test essentially consists of assessing the allelic variations in the vitamin D receptor gene.

Taken together, there remains a need to provide a method of determining predisposition to lower high bone density in a patient. Moreover, there also remains a need to identify a marker or a combination of markers which accounts for a higher percent of osteoporosis in patients than the best reported such marker (COLIAI1 ). COL1AI1 has indeed been shown to contribute in a proportion of around 2% of the total variation observed in BMD in patients.

The present invention seeks to meet these and other needs. The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.

SUMMARY OF THE INVENTION One aim of the present invention is to provide a method of determining predisposition to low or high bone density of a patient, which comprises determining estrogen receptor polymorphism in a biological sample of the patient, wherein the genotypes of the estrogen receptor can be correlated with high bone density or with low bone density. Another aim of the present invention is to provide means to screen women to identify those for whom the more expensive formal measurement of BMD is indicated.

Another aim of the present invention is to provide means of identifying women who have a predisposition toward low bone density at menopause and hence have a predisposition toward osteopenia, osteoporosis or bone fracture.

Another aim of the present invention is to provide means of identifying women that will be at risk of osteoporosis after their menopause so that they can attempt to increase their BMD to reach a higher peak bone mass. In a particular embodiment, young (or at least pre-menopausal) women are tested to assess their risk of low bone density (e.g., osteoporosis) after menopause.

Another aim of the present invention is to provide means of identification of target sub-groups of women for low bone density prevention measures/programs and in particular osteoporosis prevention measures/programs.

Another aim of the present invention is to provide means to determine which sub-group of post menopausal women will most benefit from osteoporosis treatment(s) and eventually predict their response to therapy or aid in choosing the optimal preventive pharmacotherapy. Another aim of the present invention is to identify means of prediction and management of BMD as well as biological parameters for the establishment of population-based osteoporosis prevention and intervention programs. One of a polymorphism of the estrogen receptor (ESR) gene, or any polymorphism in linkage disequilibrium therewith, can further be used as a test for screening drugs for osteoporosis or for determining the best treatment for osteoporosis.

The present invention also relates to vectors, including expression vectors harboring an ESR gene (or fragment or fusion thereof) having genotypes and combination of genotypes in accordance with the present invention (e.g., prognosing low mineral bone density, ESR-PP or other genotypes isolated from patients or genetically engineered), cells harboring such vectors, and non-human animals harboring such vectors or cells.

Another aim of the present invention is to provide means of identifying young women that will be at risk of osteoporosis after their menopause and to categorize those that are likely to respond significantly to a therapeutic regimen such as HRT, or corticosteroid treatment by displaying a significant modulation of their BMD. An aim of the present invention is thus to provide means of identification of target sub-groups of women for osteoporosis prevention measures/programs.

Another aim of the present invention is to provide means to determine which sub-group of post menopausal women will most benefit from osteoporosis treatment(s) and eventually predict their response to therapy or choose the optimal preventive pharmacotherapy. Another aim of the present invention is to identify means of prediction and management of BMD as well as biological parameters for the establishment of population-based osteoporosis prevention and intervention programs. In addition, it is an aim of the present invention to provide a method of selecting a combination of alleles which is suitable for designing an assay to screen compounds which could modulate ESR function and thus promote BMD and bone mass, thereby potentially protecting against osteoporosis. Another aim of the present invention is to provide an assay to screen for drugs for the treatment and/or prevention of osteoporosis. Having identified a polymorphism in ESR which is associated with bone density, assays can be set-up to screen agents and select drugs which could be used in the treatment or prevention of osteoporosis, thereby increasing the proportion of women which can be treated in order to increase very significantly their bone density, bone mass and protect against osteoporosis.

In a particular embodiment, such assays can be designed using cells from patients having a known genotype at the loci of the present invention; these cells harboring recombinant vectors enabling an assessment of the functionality of the ESR . Non-limiting examples of assays that could be used in accordance with the present invention include cis-trans assays similar to those described in U.S. Pat. No. 4,981 ,784. Of course, it will be understood that such assays could be performed in the presence or in the absence of a compound such as corticosteroid to test a functionality of the estrogen receptor. It shall be understood that the determination of the combinations of allelic variations in the ESR gene can be combined with the determination of allelic variations in other genes/markers linked to the predisposition to osteoporosis and/or low bone density and/or responsiveness to therapy for osteoporosis or for the prevention of low bone density. This combination of genotype analyses could lead to better diagnoses programs and/or treatment of osteoporosis and low bone density related diseases. Non-limiting examples of such markers include, COLIAI1 , interleukin 1 receptor antagonist, collagen type Iα1 and Iα2, transforming growth β1 , α₂HS-glycoprotein, interleukin-6, and apolipoprotein E (WO 94/03633).

It shall also be understood that although osteoporosis is significantly more preponderant in women, it can also be a morbidity- inducing disease in men. Thus, the present invention is meant to also cover men.

In accordance with the present invention there is provided a method of determining predisposition to low or high bone mineral density and to development of osteoporosis of a patient, which comprises determining estrogen receptor polymorphism in a biological sample of the patient, wherein a determination of heterozygosity or homozygosity can be correlated to low or high bone density, and hence to osteoporosis.

In some embodiments, the method of the present invention includes detecting the estrogen receptor polymorphism by analysing the restriction fragment length polymorphism using an endonuclease digestion. The method can further include a step prior to the estrogen receptor gene digestion, wherein at least a fragment of the estrogen receptor is amplified, for example, by polymerase chain reaction.

In some other embodiments, the method of the present invention involves the determination of the estrogen receptor polymorphism or of a marker in linkage disequilibrium therewith, together with at least another parameter such as the age of the patient, and/or the taking thereby of a corticosteroid regimen; and/or the prevalence of another condition or disease (e.g., rheumatoid arthritis).

In accordance with the present invention, the estrogen receptor polymorphism, without limitation, is selected from the group consisting of a Pvull polymorphic site located in the first intron of the ESR-1 gene or any DNA variant or mutation which shows some degree of linkage disequilibrium with one of the alleles of the Pvull polymorphism.

The polymorphism of the estrogen receptor gene can be detected using at least one oligonucleotide specific to the normal or variant estrogen receptor gene allele.

Numerous methods for determining a genotype are known and available to the skilled artisan. All these genotype determination methods are within the scope of the present invention. In accordance with the present invention, low bone density is indicative of a predisposition to osteoporosis and/or bone fracture of the patient post-menopause, while high bone density is indicative of a resistance to osteoporosis and/or bone fracture of the patient post-menopause. In accordance with the present invention, estrogen receptor genotyping is indicative of response to therapy and/or to preventive treatments against low bone mineral density and bone and vertebrae fractures.

The present invention also provides a kit for determining predisposition to low or high bone mineral density of a patient, which includes at least a probe specific for the estrogen receptor; and an endonuclease selected from the group consisting of Pvull, Pssl, Sad, and Xbal.

Also, in accordance with the present invention, there is provided a method of determining predisposition to estrogen hormone- related medical conditions of a patient, including the steps of: a) isolating nucleic acid of the patient from a biological sample; and b) determining the genotype in said isolated nucleic acid of step a), wherein said genotype corresponds to a region including the gene encoding the estrogen receptor, and wherein heterozygosity or homozygosity is indicative of predisposition of said estrogen hormone- related medical conditions and homozygosity or heterozygosity is indicative of likelihood of protection against said estrogen hormone- related medical conditions.

In accordance with one particular embodiment of the present invention, the Pvull polymorphism of ESR-1 or a polymorphic variant in linkage disequilibrium therewith is used in pre- or early- menopausal women as a marker to prognose bone mineral density. In accordance with yet another particular embodiment, the Pvull polymorphism of ESR-1 , or a polymorphic variant site in linkage disequilibrium therewith, is used as a marker together with another parameter in the patients to prognose, assess or diagnose osteoporosis or osteoporosis susceptibility. In a particularly preferred embodiment, such parameter is the taking of corticosteroids. For the purpose of the present invention the following abbreviations and terms are defined below.

The abbreviation "RFLP" refers to restriction fragment length polymorphism.

The terms "DNA polymorphism" or "polymorphic DNA sequence" and the like refer to any sequence in the human genome that exists in more than one variant (or version) in the population.

The terminology "low bone density" or "low mineral bone density" or "low BMD" are well-known in the art. For example, according to the World Health Organisation (WHO), "osteopenia" is defined as having a bone mineral density (BMD) more than 1.5 standard deviation

(SD) below the young adult mean (peak bone mass), while "osteoporosis" is defined as having a BMD more than 2.5 SD below the young adult mean (peak bone mass).

The term "estrogen hormone-related medical conditions" refers to, without limitation, any estrogen-dependent diseases such as osteoporosis, endometriosis, arteriosclerosis, breast cancer, ovarian cancer and other estrogen-dependent cancers, among others.

The term "linkage disequilibrium" refers to any degree of non-random genetic association between one or more allele(s) of two different polymorphic DNA sequences, that is due to the physical proximity of the two loci. Linkage disequilibrium is present when two DNA segments that are very close to each other on a given chromosome will tend to remain unseparated for several generations with the consequence that alleles of a DNA polymorphism (or marker) in one segment will show a non-random association with the alleles of a different DNA polymorphism (or marker) located in the other DNA segment nearby.

Hence, testing of one marker in linkage disequilibrium with the DNA polymorphism (or marker) of the present invention at the ESR gene (indirect testing) will give almost the same information as testing for the ESR polymorphism directly. This situation is encountered throughout all the human genome when two DNA polymorphisms that are very close to each other are studied. Such a linkage disequilibrium with several polymorphisms in the vitamin D receptor gene are reported in Morrisson et al., 1994, supra. Various degrees of linkage disequilibrium can be encountered between two genetic markers so that some are more closely associated than others.

The terms "estrogen receptor polymorphism" or "genetic marker" are intended to include, without limitation, Pvull (GDB (Genome Data Base) #G00-155-446), Pssl (GDB #G00-155-447), SAcl (GDB #G00-155-448), Xbal (GDB #G00-155-449) as well as the following ESR non-RFLP polymorphisms: GDB #G00-162-450, #G00-162-541 , and any other allelic variant of the estrogen receptor gene that shows some degree of linkage disequilibrium in any population sub-group with at least one of the above-mentioned estrogen receptor gene polymorphisms. The estrogen receptor gene polymorphism site in accordance with the present invention can be located within the estrogen receptor gene, or on each side thereof, provided that they are on the same chromosome and in linkage disequilibrium with the ESR polymorphism of the present invention. Distances between markers in linkage disequilibrium can vary widely (below 50 kb to more than 1 mega base) depending on the genetic structure of the population and is ascertainable by a statistically significant association between the markers.

The findings described herein may have important repercussions on the screening for the predisposition to low BMD in post- menopausal women but also for the implementation of screening programs aimed at preventing low BMD in women and for identification of women which would benefit from available therapies before and after menopause.

It shall be recognized by the person skilled in the art to which the present invention pertains, that since some of the polymorphisms herein identified in the ESR gene can be within the coding region of the gene and therefore expressed, that the present invention should not be limited to the identification of the polymorphisms at the DNA level (whether on genomic DNA, amplified DNA, cDNA or the like). Indeed, the herein-identified polymorphisms could be detected at the mRNA or protein level. Such detections of polymorphism identification on mRNA or protein are known in the art. Non-limiting examples include detection based on oligos designed to hybridize to mRNA or ligands such as antibodies which are specific to the encoded polymorphism (i.e. specific to the protein fragment encoded by the distinct polymorphisms). Since the polymorphisms of the present invention are expressed, one of the advantages of the present invention is to enable a determination of the polymorphisms in the ESR gene, in easily obtainable cells which express this gene. A non-limiting example thereof is lymphocytes, thereby enabling a genotyping from a simple blood sample. Nucleotide sequences are presented herein by single strand, in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-1UB Biochemical Nomenclature Commission.

Unless defined otherwise, the scientific and technological terms and nomenclature used herein have the same meaning as commonly understood by a person of ordinary skill to which this invention pertains. Generally, the procedures for cell cultures, infection, molecular biology methods and the like are common methods used in the art. Such standard techniques can be found in reference manuals such as for example Sambrook et al. (1989, Molecular Cloning -A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et al. (1994, Current Protocols in Molecular Biology, Wiley, New York).

The present description refers to a number of routinely used recombinant DNA (rDNA) technology terms. Nevertheless, definitions of selected examples of such rDNA terms are provided for clarity and consistency.

As used herein, "nucleic acid molecule", refers to a polymer of nucleotides. Non-limiting examples thereof include DNA (i.e. genomic DNA, cDNA) and RNA molecules (i.e. mRNA). The nucleic acid molecule can be obtained by cloning techniques or synthesized. DNA can be double-stranded or single-stranded (coding strand or non-coding strand [antisense]).

The term "recombinant DNA" as known in the art refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.

The term "DNA segment", is used herein, to refer to a DNA molecule comprising a linear stretch or sequence of nucleotides. This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.

The terminology "amplification pair" refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction. Other types of amplification processes include ligase chain reaction, strand displacement amplification, or nucleic acid sequence-based amplification, as explained in greater detail below. As commonly known in the art, the oligos are designed to bind to a complementary sequence under selected conditions.

The nucleic acid (i.e. DNA or RNA) for practicing the present invention may be obtained according to well known methods.

Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular^' assay format and the particular needs and targeted genomes employed. In general, the oligonucleotide probes or primers are at least 12 nucleotides in length, preferably between 15 and 24 molecules, and they may be adapted to be especially suited to a chosen nucleic acid amplification system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (see below and in Sambrook et al., 1989, Molecular Cloning -A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).

The term "oligonucleotide" or "DNA" molecule or sequence refers to a molecule comprised of the deoxyribonucleotides adenine (A), guanine (G), thymine (T) and/or cytosine (C), in a double-stranded form, and comprises or includes a "regulatory element" according to the present invention, as the term is defined herein. The term "oligonucleotide" or "DNA" can be found in linear DNA molecules or fragments, viruses, plasmids, vectors, chromosomes or synthetically derived DNA. As used herein, particular double-stranded DNA sequences may be described according to the normal convention of giving only the sequence in the 5' to 3' direction.

"Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989, supra) and are commonly known in the art. In the case of a hybridization to a nitrocellulose filter, as for example in the well known Southern blotting procedure, a nitrocellulose filter can be incubated overnight at 65°C with a labelled probe in a solution containing 50% formamide, high salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 μg/ml denatured carrier DNA (i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency). The selected temperature is based on the melting temperature (Tm) of the DNA hybrid. Of course, RNA-DNA hybrids can also be formed and detected. In such cases, the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. Stringent conditions will be preferably used (Sambrook et al.,1989, supra).

Probes of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and α- nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14.5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.

The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds. More recently, PNAs have been described (Nielsen et al. 1999, Current Opin. Biotechnol. 10:71-75). PNAs could also be used to detect the polymorphisms of the present invention. Other detection methods include kits containing probes on a dipstick setup and the like. Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include ³H, ¹⁴C, ³²P, and ³⁵S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.

As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma ³²P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (i.e. uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like. As used herein, "oligonucleotides" or "oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The size of the oligo will be dictated by the particular situation and ultimately on the particular use thereof and adapted accordingly by the person of ordinary skill. An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.

As used herein, a "primer" defines an oligonucleotide which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions.

Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14-25. Numerous amplification techniques have been described and can be readily adapted to suit particular.needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Qβ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably, amplification will be carried out using PCR.

Polymerase chain reaction (PCR) is carried out in accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S.

Patents are incorporated herein by reference). In general, PCR involves, treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analysed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophores, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al. Eds, Acad. Press, 1990).

Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392- 396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).

As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A "structural gene" defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skill, that the nucleic acid sequence of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.

A "heterologous" (i.e. a heterologous gene) region of a DNA molecule is a subsegment segment of DNA within a larger segment that is not found in association therewith in nature. The term "heterologous" can be similarly used to define two polypeptidic segments not joined together in nature. Non-limiting examples of heterologous genes include reporter genes such as luciferase, chloramphenicol acetyl transferase, β-galactosidase, and the like which can be juxtaposed or joined to heterologous control regions or to heterologous polypeptides. The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art. The term "expression" defines the process by which a gene is transcribed into mRNA (transcription), the mRNA is then translated (translation) into one polypeptide (or protein) or more.

The terminology "expression vector" defines a vector or vehicle as described above but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences. The placing of a cloned gene under such control sequences is often refered to as being operably linked to control elements or sequences.

Operably linked sequences may also include two segments that are transcribed onto the same RNA transcript. Thus, two sequences, such as a promoter and a "reporter sequence" are operably linked if transcription commencing in the promoter will produce an RNA transcript of the reporter sequence. In order to be "operably linked" it is not necessary that two sequences be immediately adjacent to one another. Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites. Prokaryotic expressions are useful for the preparation of large quantities of the protein encoded by the DNA sequence of interest. This protein can be purified according to standard protocols that take advantage of the intrinsic properties thereof, such as size and charge (i.e. SDS gel electrophoresis, gel filtration, centrifugation, ion exchange chromatography...). In addition, the protein of interest can be purified via affinity chromatography using polyclonal or monoclonal antibodies. The purified protein can be used for therapeutic applications.

The DNA construct can be a vector comprising a promoter that is operably linked to an oligonucleotide sequence of the present invention, which is in turn, operably linked to a heterologous gene, such as the gene for the luciferase reporter molecule. "Promoter" refers to a DNA regulatory region capable of binding directly or indirectly to RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of the present invention, the promoter is bound at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter will be found a transcription initiation site (conveniently defined by mapping with S1 nuclease), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CCAT" boxes. Prokaryotic promoters contain Shine-Dalgamo sequences in addition to the -10 and -35 consensus sequences.

In accordance with one embodiment of the present invention, an expression vector can be constructed to assess the functionality of specific alleles of the ESR gene. Non-limiting examples of such expression vectors include a vector comprising the estrogen responsive element (the cis sequences [i.e. DNA sequence to which a factor binds] enabling estrogen-dependent modulating effects of promoter activity are known in the art) operably linked to a chosen promoter and modulating the activity thereof, the promoter driving the expression of a reporter gene. When such a vector is tranfected in a cell expressing ESR, the modulating effect of the promoter activity can be assessed by determining the level of expression of the reporter gene. In one embodiment, the vector is transfected into a cell of a patient having a genotype of ESR gene shown herein to predict a high mineral bone density, or in a cell from a patient having a genotype of ESR shown herein to predict low mineral bone density. These cells can serve to screen for compounds that modulate the promoter activity, in order to identify compounds that could be used to treat especially, patients predicted to be predisposed to low bone density. In a particular embodiment, the cells can be incubated in the presence and in the absence of a corticosteroid. Of course, it will be understood that the ESR gene expressed by these cells can be modified at will (i.e. by in vitro mutagenesis or the like).

As used herein, the designation "functional derivative" denotes, in the context of a functional derivative of a sequence whether an nucleic acid or amino acid sequence, a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence. This functional derivative or equivalent may be a natural derivative or may be prepared synthetically. Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity of the protein is conserved. The same applies to derivatives of nucleic- acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained. When relating to a protein sequence, the substituting amino acid as chemico-physical properties which are similar to that of the substituted amino acid. The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term "functional derivatives" is intended to include "fragments", "segments", "variants", "analogs" or "chemical derivatives" of the subject matter of the present invention. Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and/or biological activity to the protein or nucleic acid of the present invention.

The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA technology, all these methods are well known in the art.

As used herein, "chemical derivatives" is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physico-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease of toxicity). Such moieties are examplified in Remington's Pharmaceutical Sciences (1980). Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.

The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.

As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotides. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position.

Spontaneous mutations and experimentally induced mutations exist. The result of a mutations of nucleic acid molecule is a mutant nucleic acid molecule. A mutant polypeptide can be encoded from this mutant nucleic acid molecule. As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein" has been purified to a level not found in nature. A "substantially pure" molecule is a molecule that is lacking in all other cellular components.

As used herein, the terms "molecule", "compound", or "agent" are used interchangeably and broadly to refer to natural, synthetic or semi-synthetic molecules or compounds. The term "molecule" therefore denotes, for example, chemicals, macromolecules, cell or tissue extracts (from plants or animals) and the like. Non limiting examples of molecules include nucleic acid molecules, peptides, ligands, including antibodies, carbohydrates and pharmaceutical agents. The agents can be selected and screened by a variety of means including random screening, rational selection and by rational design using, for example, protein or ligand modelling methods such as computer modelling. The terms "rationally selected" or "rationally designed" are meant to define compounds which have been chosen based on the configuration of the interaction domains of the present invention. As will be understood by the person of ordinary skill, macromolecules having non-naturally occurring modifications are also within the scope of the term "molecule". For example, peptidomimetics, well known in the pharmaceutical industry and generally referred to as peptide analogs can be generated by modelling as mentioned above. Similarly, in a preferred embodiment, the polypeptides of the present invention are modified to enhance their stability. It should be understood that in most cases this modification should not alter the biological activity of the protein. The molecules identified in accordance with the teachings of the present invention have a therapeutic value in diseases or conditions in which the bone density of the animal is compromised by a genotype identified in accordance with the present invention. Alternatively, the molecules identified in accordance with the teachings of the present invention find utility in the development of compounds which can modulate the bone density in an animal (i.e. positively modulate bone density and hence protect and/or treat against osteoporosis).

It shall be understood that the "in vivo" experimental model can also be used to carry out an "in vitro" assay. For example, cellular extracts from the indicator cells can be prepared and used in an "in vitro" 'test. A non-limiting example thereof include binding assays. As used herein the recitation "indicator cells" refers to cells that express a genotype of ESR according to the present invention. As alluded to above, such indicator cells can be used in the screening assays of the present invention. In certain embodiments, the indicator cells have been engineered so as to express a chosen derivative, fragment, homolog, or mutant of a genotype of the present invention. The cells can be yeast cells or higher eukaryotic cells such as mammalian cells. In one particular embodiment, the indicator cell would be a yeast cell harboring vectors enabling the use of the two hybrid system technology, as well known in the art (Ausubel et al., 1994, supra) and can be used to test a compound or a library thereof. In another embodiment, the cis-trans assay as described in USP 4,981 ,784, can be adapted and used in accordance with the present invention. Such an indicator cell could be used to rapidly screen at high-throughput a vast array of test molecules. In a particular embodiment, the reporter gene is luciferase or β-Gal. In some embodiments, it might be beneficial to express a fusion protein. The design of constructs therefor and the expression and production of fusion proteins and are well known in the art (Sambrook et al., 1989, supra; and Ausubel et al., 1994, supra).

Non-limiting examples of such fusion proteins include a hemaglutinin fusions and Gluthione-S-transferase (GST) fusions and Maltose binding protein (MBP) fusions. In certain embodiments, it might be beneficial to introduce a protease cleavage site between the two polypeptide sequences which have been fused. Such protease cleavage sites between two heterologously fused polypeptides are well known in the art. In certain embodiments, it might also be beneficial to fuse the protein of the present invention to signal peptide sequences enabling a secretion of the fusion protein from the host cell. Signal peptides from diverse organisms are well known in the art. Bacterial OmpA and yeast Suc2 are two non limiting examples of proteins containing signal sequences. In certain embodiments, it might also be beneficial to introduce a linker (commonly known) between the interaction domain and the heterologous polypeptide portion. Such fusion proteins find utility in the assays of the present invention as well as for purification purposes, detection purposes and the like. For certainty, the sequences and polypeptides useful to practice the invention include without being limited thereto mutants, homologs, subtypes, alleles and the like. It shall be understood that generally, the sequences of the present invention should encode a functional (albeit defective) ESR. It will be clear to the person of ordinary skill that whether the ESR sequence of the present invention, variant, derivative, or fragment thereof retains its function, can be determined by using the teachings and assays of the present invention and the general teachings of the art.

It should be understood that the ESR protein of the present invention can be modified, for example by in vitro mutagenesis, to dissect the structure-function relationship thereof and permit a better design and identification of modulating compounds. However, some derivatives or analogs having lost their biological function may still find utility, for example for raising antibodies. These antibodies could be used for detection or purification purposes. In addition, these antibodies could also act as competitive or non-competitive inhibitors and be found to be modulators of the activity of the ESR protein of the present invention. A host cell or indicator cell has been "transfected" by exogenous or heterologous DNA (e.g., a DNA construct) when such DNA has been introduced into the cell. The transfecting DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells, for example, the transfecting DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transfected cell is one in which the transfecting DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transfecting DNA. Transfection methods are well known in the art (Sambrook et al., 1989, supra; Ausubel et al., 1994 supra). The use of a mammalian cell as indicator can provide the advantage of furnishing an intermediate factor, which permits, for example, the interaction of two polypeptides which are tested, that might not be present in lower eukaryotes or prokaryotes. It will be understood that extracts from mammalian cells, for example, could be used in certain embodiments, to compensate for the lack of certain factors. In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody-A Laboratory Manual, CSH Laboratories). The present invention also provides polyclonal, monoclonal antibodies, or humanized versions thereof, chimeric antibodies and the like which inhibit or neutralize their respective interaction domains and/or are specific thereto. From the specification and appended claims, the term therapeutic agent should be taken in a broad sense so as to also include a combination of at least two such therapeutic agents. Further, the DNA segments or proteins according to the present invention could be introduced into individuals in a number of ways. For example, cells can be isolated from the afflicted individual, transformed with a DNA construct according to the invention and reintroduced to the afflicted individual in a number of ways. Alternatively, the DNA construct can be administered directly to the afflicted individual. The DNA construct can also be delivered through a vehicle such as a liposome, which can be designed to be targeted to a specific cell type, and engineered to be administered through different routes. For administration to humans, the prescribing medical professional will ultimately determine the appropriate form and dosage for a given patient, and this can be expected to vary according to the chosen therapeutic regimen (i.e. DNA construct, protein, cells), the response and condition of the patient as well as the severity of the disease.

Composition within the scope of the present invention should contain the active agent (i.e. molecule, hormone) in an amount effective to achieve the desired therapeutic effect while avoiding adverse side effects. Typically, the nucleic acids in accordance with the present invention can be administered to mammals (i.e. humans) in doses ranging from 0.005 to 1 mg per kg of body weight per day of the mammal to be treated. Pharmaceutically acceptable preparations and salts of the active agent are within the scope of the present invention and are well known in the art (Remington's Pharmaceutical Science, 16th Ed., Mack Ed.). For the administration of polypeptides, antagonists, agonists and the like, the amount administered should be chosen so as to avoid adverse side effects. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 50 mg/kg/day will be administered to the mammal.

The present invention relates to a kit for predicting bone density at menopause comprising an assessment of the genotype at the ESR loci (or loci in linkage desiquilibrium therewith) using a nucleic acid fragment, a protein or a ligand, or a restriction enzyme in accordance with the present invention. For example, a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include in one particular embodiment a container which will accept the test sample (DNA protein or cells), a container which contains the primers used in the assay, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to detect the extension products.

BRIEF DESCRIPTION OF THE DRAWINGS

Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a preferred embodiment thereof, and in which:

Fig. 1A is a box plot graph of the ER/Pvull RFLP genotyping results correlated with bone mineral density at the L2-L4 vertebraes; and Fig. 1 B is a box plot graph of the ER/Pvull RFLP genotyping results correlated with bone mineral density at the hip.

Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments with reference to the accompanying drawing which is exemplary and should not be interpreted as limiting the scope of the present invention. DESCRIPTION OF THE PREFERRED EMBODIMENT

The balance between bone formation and resorption is very complex and is a consequence of many factors (calcium and phosphor intake, PTH, estrogens and androgens and 1 ,25-dihydroxy vitamin D amongst others). Accelerated bone resorption is seen in the first few years after menopause, characterized by ovarian failure and estrogen deficiency. We hypothesized that allelic variation at the estrogen receptor (ER) gene could be related to BMD. A cohort of 88 healthy unrelated post- menopausal women aged between 60 and 70 were genotyped for a known Pvull DNA polymorphism in the first intron of the estrogen receptor (ER) gene (Yaich, Cancer Res., 1992, 52:77-83). A strong relationship between the estrogen receptor (ER) genotype status and BMD was found, the heterozygotes for this RFLP having a significantly higher BMD than the two homozygote groups. This suggests that heterodimer rather than homodimer ER formation of this trans-acting element would confer a selective advantage against osteoporosis either through its interaction with the ligand and/or with DNA where it acts as a transcription factor. Furthermore, genotyping of the same subjects for a dinucleotide repeat (TA)_n 5' to the ER locus (del Senno L et al., Hum. Mol. Genet, 1992, 1 (5):354) showed a strong bimodal allelic distribution and confirmed a decreased BMD in a subgroup of post-menopausal women but with less statistical power.

These findings may have important repercussions on the screening for low BMD in post-menopausal women and also for the implementation of screening programs aimed at preventing low BMD in women and for the identification of women who would benefit from estrogen replacement therapy at their menopause. Also, these findings may be useful for other applications in the prevention and treatment of osteoporosis as well as for other important diseases or conditions showing an estrogen-dependent behaviour (cancer, arteriosclerosis and endometriosis amongst others).

Subjects

88 healthy unrelated post-menopausal women aged between 60 and 70 were recruited. They were all Caucasian French- Canadian women from a French background and were all living in the Quebec city metropolitan area. Recruitment was achieved through voluntary response to local newspaper advertisements for a study on factors affecting BMD in healthy post-menopausal women, including genetic factors. The subjects had to answer a detailed questionnaire covering family, medical, surgical, genealogical and obstetrical history. The survey also included information about medications and life habits (exercise, tobacco, alcohol, etc.). All women between 60 to 70 who had accepted to sign a consent form, answer adequately the questionnaire, have bone- mass measurement and a 30mL blood puncture were included unless they had a medical condition affecting bone homeostasis, or had used medications that modify bone metabolism.

Bone density BMD was measured at both the lumbar spine (L2-L4) and the femoral neck by dual-energy X-ray absorptimetry (DEXA, DPX-L Lunar Radiation Corporation, Madison, Wisconsin, USA, Software version 3.2). This technique is rapid, reliable and precise with a coefficient of variation of 1-2%.

DNA isolation

Blood samples were drawn into VACUTAINER containing EDTA and 200L was aliquoted in 1.5mL EPPENDORF tubes within 48 hours and stored at -20°C until DNA purification. Genomic DNA was isolated from peripheral blood leukocytes with a minimethod necessitating only 200 μL of whole blood where all steps are processed in a single

1.5mL tube as described below. Isolated DNA (5-7 μg) was resuspended into 100 μL of TE 20:5 buffer (20mM Tris, 5mM EDTA), heated at 65°C for 4 hours and stored at 4°C.

The whole procedure of DNA extraction takes place in a single 1.5 mL EPPENDORF tube, minimizing sample identification errors and sample mixing. All reagent concentrations and volumes added to the tube are set in order to use a pipette repeat dispenser all through the procedure. The number of samples processed in a single DNA extraction/digestion procedure depends only on the availability of places in centrifuges turning at 13,000 RPM. BIOFUGE 15 (Heraus) benchtop centrifuges in a 4°C room has a capacity of 80 x 1.5 mL EPPENDORF tubes. The tubes remain in the centrifuge's 10-tube holders all through the procedure which eliminates a lot of tube manipulation.

200 μL of whole blood (collected on EDTA) is placed in an appropriately identified 1.5 mL EPPENDORF tube. The same tube will be used until gel loading so it must be identified with a very resistant marking tool. A slightly heated metal tool may be used to engrave the number on the tube, this allows for permanent labelling.

1 mL of a 20 mM TRIS buffer + 5 mM EDTA + 0,5% NP- 40 solution (TE20:5+NP40) is added to the samples and they are left on ice for 30 minutes to allow for membrane disruption. Then the tubes are centrifuged at 4,000 RPM for 15 minutes and the supernatant is removed by gently shaking the tubes upside down over a sink. The pellets are then broken down by vortexing vigorously in a multitube vortex for a few minutes followed by two more washes with 1 mL of TE20:5+NP40 and 15 minutes at 4,000 RPM followed by vortexing of the pellets at each time. Afterwards, the pellets are resuspended in 100μL of TE20:5 (20 mM TRIS buffer + 5 mM EDTA) and 10μL of 10% sarcosine are added followed by 10μL of 2 mg/mL Proteinase K (BMC). The samples are incubated at 37°C overnight or 3 hours at 65°C. After the proteinase K digestion is completed 100 μL of ammonium acetate 7.5 M are added and well mixed. Then 500 μL of pure ethanol (cooled at -20°C) are added to each tube and mix well, allowing for DNA precipitation. There is enough DNA in each tube to actually see it precipitate when the cold ethanol is added. The tubes are centrifuged for 10 minutes at 13,000 RPM and the supernatant removed by gentle shaking over the sink. The pellet is then resuspended in 100 μL of TE20:5 (without NP40) and reprecipitated with 100 μL of ammonium acetate (7.5 M) and 500 μL of pure ethanol (cooled at -20°C). Tubes are centrifuged for 10 minutes at 13,000 RPM and the supernatant is again discarded. The DNA pellet is dried under negative pressure for 10 minutes (in a dessicator), then resuspended in 200 μL of TE20:1 (20 mM TRIS buffer + 1 mM EDTA) and left at 37°C for a few hours to allow for dissolution of the final DNA pellet.

Pvull polymorphism analysis From the resuspended DNA, 200 ng of genomic DNA was amplified in a 100 μL volume containing 0.5 μM of both forward 5TGCCACCCTATCTGTATCTTTTCC3' (SEQ ID NO:1 ) and reverse S'TCTTTCTCTGCCACCCTCGCGTCS' (SEQ ID NO:2) primers derived from Yaich (Yaich, Cancer Res., 1992, 52:77-83), 200 μM of each of the four deoxyribonucleotides and 2.5U of Taq polymerase and buffer

(Promega) in 1.5 mM MgCI₂. PCR amplification included the following steps: initial denaturation for 7 minutes at 96°C followed by 35 cycles of amplification with denaturation at 94°C for 60 seconds, annealing at 60°C for 60 seconds and polymerase extension at 72°C for 4 minutes. A final extension at 72°C for 10 minutes, was also included.

About 500 ng of the PCR product were digested with 10U of Pvu II (New England Biolabs) overnight at 37°C and the polymorphism was visualized by ethidium bromide staining after a 2% agarose gel electrophoresis. Absence of the site (P) resulted into a 1.3 Kb fragment whereas presence of the Pvu II site (p) resulted into 850 bp and 450 bp fragments which was consistent with published data (Yaich, Cancer Res., 1992, 52:77-83). TABLE 1 DNA extraction protocol for miniprep of genomic DNA

• Place 200μL of whole blood (collected on EDTA) in a 1.5 mL EPPENDORF tube;

• Add 1 mL of TE20:5 + NP40 (20 mM TRIS buffer + 5 mM EDTA + 0,5% NP-40), leave 30 minutes on ice and centrifuge for 15 minutes at 4,000 RPM;

• Throw away the supernatant; • Perform one more wash with 1 mL of TE20:5+NP40, vortex and centrifuge for 15 minutes at 4,000 RPM;

• Resuspend the pellet in 100 μL of TE20:5 and vortex well;

Add 10μL of 10% sarcosine and then 10 μL of Proteinase K(BMC) at 2.5 mg/mL and incubate at 37°C overnight or 3 hours at 65°C; • Add 100μL of ammonium acetate 7.5 M, mix well and then add

500μL of pure ethanol (cooled at -20°C), mix well and centrifuge for 10 minutes at 13,000 RPM;

Remove the supernatant and resuspend the pellet in 100μL of TE20:5 (without NP40); • Reprecipitate with 100 μL of ammonium acetate (7.5M), mix well and 500μL of pure ethanol (cooled at -20°C), mix well and centrifuge 10 minutes at 13,000 RPM;

Remove the supernatant and dry the pellet by reversing the tubes (dry the cap of the EPPENDORF); and • Detach the pellet in 400 μL of TE20:1 (20 mM TRIS buffer + 1 mM EDTA). If the restriction enzyme to be used does not have a high Table 1 (cont.) temperature of digestion (50°C or more), incubate the tube at 65°C for a few hours before adding the restriction enzyme.

Note: It is possible to use the same 1.5 mL EPPENDORF tube from the beginning to the end of the procedure.

Microsatellite (TA)_n polymorphism analysis The 88 subjects were subsequently genotyped for a known dinucleotide microsatellite (TA)_n 5' to the ER gene (GDB # G00-162-541) that had 17 alleles and showed 82% heterozygosity in a previous report. PCR was carried out in an MJ PTC-100 thermocycler with hot-bonnet (MJ Research Inc, Watertown, Ma). Each 50μL reaction contained 250 ng of genomic DNA, 40 nM of end-labelled with [gamma ³²P]dATP forward primer 5' GACGCATGATATACTTCACC 3' (SEQ ID NO:3) and 200 nM of reverse primer 5" GCAGAATCAAATATCCAGATG 3" (SEQ ID NO:4), 200 μM of each dNTP, 3.5 mM MgCI₂, 15% giycerol and 2.5U of ULTRATHERM DNA polymerase and buffer (Biocan Scientific Inc, Missis- sauga, Ont). Amplification conditions were: initial denaturation for 7 minutes at 96 °C followed by 30 cycles of amplification with denaturation at 94°C for 30 seconds, annealing at 50°C for 45 seconds and polymerase extension at 72°C for 60 seconds. A final extension at 72°C for 2 minutes was included. 5 μL of the PCR reaction were then mixed in the same volume of loading buffer (Bromophenol blue) and 5-6 μL of the mixture were deposited and the radiolabeled products were resolved on a 6% denaturing polyacrylamide gel electrophoresis, exposed overnight at room temperature and visualized by autoradiography.

Statistical analysis ANOVA analyses were performed given the fact that the dependent variables were continuous (bone density measurements at different sites) and the independent variables were ordinal (genotypes at the VDR and ER genes). The significance level was set at alpha= 0.05. A Chi square analysis was performed to study the level of linkage disequilibrium between the two different ER polymorphisms.

Results Pvull RFLP

Typing of the ER receptor gene alleles using PCR followed by Pvull digestion of the PCR products was performed on the 88 samples of women between 60 and 70 years old. This RFLP has two alleles, namely p and P and each individual having two chromosomes 6 carries two copies of the ER gene and hence, two alleles of the RFLP. The various combinations of these two possible alleles generates three different genotypes at this locus: pp, pP and PP. Where "pp" designates homozygotes for the presence of the Pvull site, "PP" is for homozygotes for the absence of the Pvull site, and "pP" is for heterozygotes for the Pvull site with one allele with the presence of the site and the other with the absence of the site. ER/Pvull RFLP genotyping results were correlated with bone mineral density as determined by DEXA at the L2-L4 vertebrae (Fig. 1A) as well as at the hip (Fig. 1 B). ANOVA analysis showed that the ER genotype was a strong predictor of BMD at the L2-L4 level (p=0.0097) composed mainly of trabecular bone as well as at the hip (p=0.0387), which is composed principally of cortical bone. In fact, the ER genotype could divide women in two groups with a mean difference in BMD at L2-L4 of 0.12 g/cm³ (11 %) and at the hip of 0.08 g/cm3 (10%). This represents a one standard deviation difference between the mean BMD at each site between the two groups of women as specified by the ER genotyping.

Unexpectedly, individuals homozygous for either of the ER alleles (pp or PP) had comparable mean BMD (no statistical difference, p>0.05) at both sites studied. However, their BMD was one standard deviation below those women heterozygous for the ER genes (pP). A one standard deviation difference in bone mineral density in elderly women is well known to be associated with an increased relative risk of bone fracture of about 2.4.

Hence, ER genotyping using the Pvull RFLP system allows to classify women in two groups (homozygotes vs. heterozygotes) that have a more than two-fold difference in the risk of bone fracture.

Microsatellite

In order to test for the hypothesis of a founder effect in the variation at the ER genotype observed in the population, all samples were retested with a ER gene microsatellite. This highly polymorphic genetic marker had a bimodal allele distribution (Table 2) and hence the alleles were grouped into two categories (E=alleles D to G; M = alleles H to P) to form a biallelic system generating three possible genotypes (EE, EM, MM). The microsatellite genotypes were highly correlated with the RFLP genotypes (Table 3) (p<0.0001) confirming a limited number of ER alleles present in the population. However, the linkage disequilibrium observed was not absolute (Table 2). When the microsatellite genotypes were correlated with BMD measurements, only a trend was observed (p=0.11), one of the between group comparisons was barely significant (EM vs. MM: p=0.05, mean difference in BMD=0.09 g/cm²) but in the same direction as the strong correlation observed with the Pvull RFLP.

TABLE 2

Allelic freqi encies for ER -MS

Allele

D E F G H I J K L M N O P

Absolute 10 45 10 1 3 3 6 8 13 17 11 7 4

Relative 7 33 7 1 2 2 4 6 9 12 8 5 3

(%)

TABLE 3

Contingency table of Pvull RFLP vs ER -MS

Observed Freqi jencies for ER, ERms

EE EM MM Totals

PP 20 6 2 28 pP 3 25 4 32

PP 2 2 19 23

Totals 25 33 25 83

There is shown in Table 3 an example of the linkage disequilibrium between the alleles p and E, where the homozygotes EE are associated with the homozygotes pp. Discussion

Previous studies have reported the effect of genetic variation of the VDR gene on BMD in women and the results appear contradictory. Whether these discrepancies are due to differences in the samples studied, or differences in methodological or data analysis approaches, or correspond to real differences between the populations studied has to be resolved. We did not find any effect of the VDR genotype on BMD of those women included in the present study but the effects of genetic variation of another important steroid receptor gene, namely the estrogen receptor (ER), were also analyzed.

In accordance with the present invention, it is demonstrated that genotyping at the ER gene allows one to predict whether women will be at increased risk of osteoporosis and bone fracture when they reach 60 years old. Because the ER genotype is genetically determined and remains the same throughout life, it is possible to genotype at the ER gene young women who have not yet reached their peak bone mass and concentrate preventive actions to increase BMD or diminish bone loss for those women which have a homozygous ER genotype as they will have, as a group, a BMD one S.D. below het- erozygotes (i.e., more than twice the risk of osteoporosis) when they reach 60 years of age.

It is also important that the ER genotype was correlated with both BMD of trabecular bone and cortical bone which are two metabolically different types of bone. Furthermore, the intensity of the effect of the ER genotype was similar (i.e. one Standard Deviation) for each type of bone. ER genotyping thus may be a good marker of the homeostatic set point of general bone metabolism.

It is worth mentioning the unexpected relationship between the ER genotypes and BMD at the hip and vertebrae. The results reported by Morrisson et al. on the relationship of VDR genotypes with BMD showed a cumulative (or dosage) effect of one allele over the other i.e. that the BMD increased with the number of copies of a given allelic variant of the VDR gene (Morrisson NA et al., Nature, 1994, 367:284-297). The present analyses of the ER genotypes revealed an interaction (or inverted- "v" shaped) effect instead of a cumulative effect with the best predictor of a low BMD being the presence of identical (homozygous) alleles of the ER gene. This group of women (pp or PP) represented 60% of the sample studied.

This simple genetic test of the ER genotype could also potentially be used to identify, prior to their menopause or later, which women would most benefit from estrogen replacement therapy or preventive pharmacotherapy (such as with biphosphonates). Further studies may also reveal that the clinical response to such therapies could be related to the ER genotype. Also, ER genotyping, as it is inexpensive, may be used to screen post-menopausal women to identify a sub-group which is at higher risk of low BMD and who could benefit from a more formal BMD measurement such as DEXA (which is too expensive to be offered as a screening procedure). Hence genotyping of the ER could become a fundamental parameter in prediction and management of low BMD as well as for the establishment of population-based osteoporosis prevention and intervention programs. Also, typing of both the VDR and ER gene polymorphisms may enable a better prediction of BMD even if we did not find such a performance in the population studied. It is however likely that the association of ER genotyping with other analytical procedures (measurement of bone metabolites, other genotypes, etc.) may allow an even better discrimination between women of high and low risk for osteoporosis.

The biological mechanisms by which this strong effect of the ER genotype on trabecular and cortical BMD take place remains unknown. However, given the very peculiar correlation between the genotypes and the BMD measurements, it is tempting to speculate that the lower BMD in ER homozygotes vs ER heterozygotes may indicate that there is a difference in the physiological performance of heteroduplex estrogen receptors as compared to homoduplex estrogen receptors. One possible mechanism is, hence, that the mutation (or polymorphism) involved affects the dimerization domains of receptor monomers and influences the control of bone metabolism by the steroid hormone. This could be confirmed once the mutation involved in this ER effect on BMD after 60 years of age is identified; probably, the Pvull RFLP is closely associated with the effective ER gene mutation that has yet to be identified by sequencing.

Other mechanisms of action of ER gene polymorphism can also be postulated, including the effect of heterodimeric receptors on hormone or DNA binding or even on binding with other proteins involved in the availability or efficiency of ER receptors for the hormonal control of genes and cellular processes. The present work demonstrating ER genotype effects on a disease clearly associated with estrogen metabolism opens the field of other estrogen-dependent diseases/conditions such as arteriosclerosis, endometriosis, breast cancer, ovarian cancer, and other estrogen- dependent cancers.

It was demonstrated for the first time that estrogen- dependent cellular processes can vary from one individual to the other according to the combination of estrogen receptor variants (or to the estrogen receptor genotype). Since there is only one estrogen receptor gene per haploid human genome (each cell contains two haploid genomes), the differences in biological efficacy of the estrogen hormone via the estrogen receptor genotype disclosed in the present application will also apply to other estrogen dependent diseases or conditions.

Following the study of an ESR-1 polymorphism association with osteoporosis through the study of 88 post-menopausal women described above, 580 healthy unrelated postmenopausal women were genotyped at the estrogen receptor (ESR1 ) loci and the association between genotypes was studied independently and jointly, as the possibility of a modifying effect on the genotype contribution to BD differences. BD was measured at three bone sites with two different bone density measurement methods: BMD at the lumbar and femoral neck was measured by dual-energy X-ray absorptiometry (DXA) while quantitative ultrasound (QUS) of the calcaneal bone was measured by water-immersed heel bone ultrasonometry (and expressed as the stiffness index - SI), a rather simple and inexpensive technique that was recently shown to be a good predictor of the risk of osteoporosis as it gives information on bone structure not evaluated by DXA.

The present invention will be more readily understood by referring to the following example which is given to illustrate the invention rather than to limit its scope.

EXAMPLE I

Polymorphism of the Pvull restriction site of the estrogen receptor (ESR1) as a marker for low bone density susceptibility

Subjects

Recruitment was achieved through voluntary response to local newspaper advertisements for a study on factors affecting BD in healthy postmenopausal women, including genetic and environmental factors (age, height, weight, parity, age at menopause, years of hormone replacement therapy (HRT) and daily calcium intake). After informed and written consent was obtained, the subjects answered a detailed questionnaire covering family, medical and surgical history, medications and life habits (e.g., exercise, tobacco, alcohol and nutrition). The questionnaire was derived from the mediterranean osteoporosis (MEDOS) study questionnaire. All recruited women were included unless they had a medical condition affecting bone homeostasis or had used medications known to influence bone metabolism other than HRT. All women enrolled in the study subsequently had lumbar, femoral neck and heel bone density measured and 10 ml of blood was obtained by venipuncture. 580 healthy unrelated postmenopausal women aged between 42 and 85 years were genotyped at ESR1 genes and included in the study. Every recruited subjects were living in the Quebec city metropolitan area, a region of about 600,000 inhabitants where 93.3% of its inhabitants, consider themselves as French descents and are French-Canadian Caucasians. The project was approved by the Clinical Research Ethics Committee.

Bone density measurements

Bone density was measured at three different sites, using two different techniques. Bone mineral density (BMD) was determined at the lumbar spine, from level L2 to L4 inclusive (L2L4 BMD) and at the femoral neck (FN BMD) by dual-energy X-ray absorptiometry (DXA) (DPX- L Lunar Radiation Corporation, Madison, Wl, Software version 3.2). All BMD measurements were performed by a trained technician from the service of nuclear medicine of the CHUQ, Pavilion St-Francois d'Assise hospital. The long-term reproducibility evaluated on a daily basis using a standard bone phantom, always gave a coefficient of variation less than 1 %.

BD of the right calcaneal bone was determined by broadband ultrasound attenuation (BUA) and the speed of sound (SOS) as measured using the Achilesό ultrasound bone densitometer (Lunar

Corporation, Madison, Wl). The stiffness index (SI), a combination of BUA and SOS, was calculated from the manufacturer's equation and expressed as a percentage of the average young adults' peak SI. The mean coefficient of variation for the SI (which includes errors of both the BUA and SOS) was below 1 %. Acoustic phantoms provided by the manufacturer were scanned daily and showed no drift. Five women were isolated outliers for either BMD or SI results (L2L4 BMD z-score « -4SD, L2L4 BMD z-score > 4SD, FN BMD z-score « -3SD, FN BMD z-score > 4SD and heel SI z-score « -3SD) and were subsequently eliminated from all analyses. Thus all following analyses were performed on the remaining 575 women.

DNA purification and PCR amplification

Blood samples were drawn into Vacutaner containing EDTA and 200 μl was aliquoted in 1.5 ml eppendorf™ tubes within 48 hr and stored at -20°C until DNA purification. Genomic DNA was isolated from peripheral blood leukocytes by a mini-method necessitating only 200 μl of whole blood where all steps are processed in a single 1.5 ml tube. Isolated DNA (5-7 μg) was resuspended into 100 μl TE 20:5 buffer (20 mM Tris, 5 mM EDTA), heated at 65°C for 4 hr and stored at 4°C until polymerase chain reaction (PCR) was performed. Genotypes at the Pvull locus was determined for all 580 subjects since genotyping was blind to BD measurements.

Genotypes at the Pvull locus in the ESR gene were obtained with PCR using radiolabeled forward primer 5'- TGCCACCCTATCTGTATCTTTTCC-3' (SEQ ID NO:1 ) and reverse primer 5'-TCTTTCTCTGCCACCCTGGCGTC-3' (SEQ ID NO:2). Primers kination was carried out using 2 pmol of primer, 0.74 U of enzyme kinase, and 1.56 uCI of ATPγ³²P. PCR was carried out in Perkin-Elmer 480 DNA thermal cycler (Perkin-Elmer Corporation, Norwalk, CT). 200 ng of genomic DNA was amplified through 35 cycles in 50 μl containing 1 μM of the two primers, 200 μM of the four deoxyribonucleotides and 2.5 U of Taq polymerase and its buffer (Promega Corporation, Madison, Wl) in 1.5 mM MgCI₂. PCR conditions included an initial denaturation of 7 minutes at 96°C followed by 35 cycles of amplification with denaturation at 94°C for 1 minutes, annealing at 60°C for 1 minute and extension at 72°C for 4 minutes, and a final extension step at 72°C for 10 minutes. About 500 ng of the PCR product were digest with Pvull overnight at 37°C. The digested products were electrophoresed in 2% agarose gels, stained with ethidium bromide, and visualized with UVB transillumination. Absence of the site (P) resulted into a 1.3 kb fragment whereas presence of the Pvull site (p) resulted in two fragment of 850 bp and 450 bp as previously described (Yaich et al. 1992, Cancer Research 52:77-83).

Statistical analyses

BMD, SI (as well as their age and weight adjusted z-score) and other nominal variables were compared between the three genotypes for the Pvull loci by factorial analyses of variance (ANOVA) and differences in proportions were compared by Fisher's exact probability test of Pearson's chi-square analysis.

Since both homozygotes (PP and pp) showed the same response in bone mineral density, they were regrouped and compared with the heterozygotes (Pp). Also, along with the whole cohort analysis, women under 60 years and those over 60 years were analysed separately.

Since the use of permissive criteria in association studies may result in an increase of false positive results, p-values lesser or equal than 0.01 were considered as significant while p-values between 0.01 and 0.05 were considered as trends. Statistical analyses were performed using StatView 5.0 (SAS Institute Inc., Cary, NC).

Results

Polymorphisms at the ESR1 gene, namely, the Pvull restriction site in the intron 1 of the ESR gene located on chromosome 6 was studied. Table 4 presents the frequency of individual and combined genotypes among the women used in this study. Genotypes at the Pvull loci was obtained for 580 women.

TABLE 4

Distribution of the ESR-Pvull genotypes among the cohort of postmenopaused women

Bone mineral density (BMD) was determined at lumbar spines from level L2 to L4 inclusively, femoral neck, and the right calcaneal bone (heel). BMD were adjusted for age and weight from the sampled data so z- scores of the three quantitative variables (L2L4, femoral neck and heel) were used in the statistical analyses. Five women were isolated outliers for either one of the three body site and were subsequently removed from the all analyses. First of all, our result suggest that BMD, at least at the lumbar spines (L2L4) and for women under 60 years, is genetically determined (Table 5). Women bearing one of the homozygotes genotypes have a significantly higher bone density than those bearing the heterozygote genotype (Table 6). Second, for this body site, the estrogen receptor (ESR1) gene contributes in a proportion of around 4% of the total variation observed in BMD among the subjects analysed (Table 5).

TABLE 5

Factorial analysis of variance for age- and weight-adjusted lumbar

(L2L4) bone mineral density between estrogen receptor genotypes at Pvull loci including women under 60 years

TABLE 6

Means z-score and standard error for age- and weight-adjusted lumbar (L2L4) bone mineral density for ESR-Pvull loci and women under 60 years

^* p=0.008 for difference between these two means 4% of variance in L2L4 is explained by ESR gene

Interactions between risk factors and genotypes were also investigated. It appeared that two factors interact with the genotypes to modulated bone mineral density at lumbar (L2L4) and hip (femoral neck). In the whole questionnaire, women were asked if they suffered once of rhumatoid arthritis (RHU.ART). Second, they were asked if they made used of corticosteroid, in the past or presently. For both questions, the possible answers were yes or no.

First, it appeared that for women under 60 years who suffered once of rhumatoid arthritis, those bearing one of the homozygote genotypes (PP or pp) have a significantly higher lumbar and hip mineral density than those bearing the heterozygote genotype (Pp) (Tables 7 and 8). For these two body sites, the interaction between ESR gene and rhumatoid arthritis factor contribute for at least 4% of the total variation of bone mineral density observed.

TABLE 7

Means z-score and standard error for age- and weight-adjusted lumbar (L2L4) bone mineral density for interaction between

Pvull loci and rhumatoid arthritis prevalence including only subjects under 60 years

* p=0.05 for difference between these two means

§ p=0.04 for difference between these two means

4% of variance in L2L4 mineral density is explained by interaction between rhumatoid arthritis factor and ESR1 gene (p=0.02)

TABLE 8

Means z-score and standard error for age- and weight-adjusted hip (femoral neck) bone mineral density for interaction between

* p=0.06 for difference between these two means

3.4% of variance in hip mineral density is explained by interaction between rhumatoid arthritis factor and ESR1 gene (p=0.03)

Second, it appeared that for the whole cohort women who made use of corticosteroid, those bearing one of the homozygote genotypes (PP or pp) have a significantly lower lumbar and hip mineral density than those bearing the heterozygote genotype (Pp) (Tables 9 and 10). Also, for women who did not use corticosteroid, lumbar mineral density is significantly higher for homozygotes genotypes (PP or pp) than for heterozygotes (Pp) (Table 9). The contribution of the interaction between the gene and the corticosteroid consumption in the bone mineral density variation observed is 1 % for the lumbar and for the hip. TABLE 9

Pvull loci and corticosteroid consumption including all subjects

* p=0.047 for difference between these two means

** p=0.040 for difference between these two means

0 p=0.012 for difference between these two means

1% of variance in L2L4 mineral density is explained by interaction between corticosteroid consumption factor and ESR1 gene (p=0.01 )

TABLE 10

Pvull loci and corticosteroid consumption including all subjects

^* p=0.05 for difference between these two means

1 % of variance in femoral neck mineral density is explained by interaction between corticosteroid consumption factor and ESR1 gene (p=0.03)

Thus it appeared that the estrogen receptor taken alone and in interactions with other factors, in this case, rhumatoid arthritis prevalence and corticosteroid consumption history, modulates the bone mineral density at lumbar and hip. These observations suggest an important effect of ESR1 genotypes on lumbar and hip BMD in postmenopausal women. While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, as follows in the scope of the appended claims.

What is claimed is:

Claims

1. A method of determining predisposition to low or high bone density of a patient below 60 years of age, which comprises determining estrogen receptor polymorphism or a polymorphism in linkage disequilibrium therewith, in a biological sample of said patient, wherein heterozygosity or homozygosity at said estrogen receptor polymorphism can be correlated with a significantly different predisposition to low bone density, said estrogen receptor polymorphism being selected from the group consisting of Pvull polymorphic site located in the first intron of the ER gene or any DNA variant or mutation which shows some degree of linkage disequilibrium with one of the alleles of said Pvull polymorphism.

2. The method of claim 1 , wherein homozygosity is associated with high bone density and heterozygosity is associated with low bone density.

3. The method of claim 2, wherein detecting said estrogen receptor polymorphism comprises analysis of a restriction fragment length polymorphism using endonuclease digestion.

4. The method of claim 3, which further comprises a step prior to said estrogen receptor gene digestion, wherein at least a fragment of said estrogen receptor is amplified.

5. The method of claim 4, wherein said polymorphism of the estrogen receptor gene is detected using at least one oligonucleotide specific to the normal or variant estrogen receptor gene allele.

6. The method of claim 3, wherein said fragment of said estrogen receptor is amplified by polymerase chain reaction.

7. The method of claim 1 , wherein low bone density is predisposition to osteoporosis and/or bone fracture of said patient during post-menopause.

8. The method of claim 1 , wherein high bone density is indicative of resistance to osteoporosis and/or bone fracture of said patient during post-menopause.

9. The method of claim 1 , wherein estrogen receptor genotyping is indicative of response to therapy and/or to preventive treatments against low bone mineral density and bone and vertebrae fractures.

10. The method of claim 1 , wherein said bone density can be measured at at least two bone mineral density measuring sites.

11. The method of claim 10, wherein said patient is using or has used an anti-inflammatory drug and wherein homozygosity is associated with low bone density and heterozygosity is associated with high bone density.

12. The method of claim 11 , wherein said drug is a corticosteroid.

13. The method of claim 10, wherein said patient is not using or has not used an anti-inflammatory drug and wherein heterozygosity is associated with low bone density and homozygosity is associated with high bone density.

14. The method of claim 13, wherein said drug is a corticosteroid.

15. The method of claim 10, wherein said patient has suffered at least once of rheumatoid arthritis and wherein heterozygosity is associated with low bone density and homozygosity is associated with high bone density.

16. A prognosis kit for determining predisposition to low or high bone mineral density of a patient, which comprises at least a probe specific for estrogen receptor; an endonuclease selected from the group consisting of Pvull, Pssl, Sacl, and Xbal.

17. An assay for screening and selecting an agent which modulates bone density comprising: a) an expression vector comprising a promoter operably linked to a reporter gene, said promoter comprising an estrogen receptor response element, said response elements affecting the activity of said promoter upon binding thereto of estrogen; b) a cell expressing a chosen allele of an estrogen receptor, and harboring said vector of a); c) submitting said cell to at least one agent; and d) assaying a level of said reporter gene, whereby an agent can be selected when the level of said reporter gene is significantly modulated by the presence of said agent.

18. The assay of claim 17, wherein said agent is incubated with said cells in the presence or in the absence of an anti- inflammatory drug.

19. The assay of claim 18, wherein said anti-inflammatory drug is a corticosteroid.