WO2006066340A1 - A method for the high expression of immunoglobulin in plants - Google Patents

Abstract

The invention relates generally to a method for the high expression of immunoglobulin in plants. In particular, the invention relates to a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin.

Description

A METHOD FOR THE HIGH EXPRESSION OF IMMUNOGLOBULIN IN PLANTS

RELATED APPLICATION

[0001] This application is based on and claims the benefit of the filing date of Australian provisional patent application 2004907233 filed 21^st December 2004.

FIELD

[ 0002 ] The invention relates generally to a method for the high expression of immunoglobulin in plants . In particular, the invention relates to the high expression of immunoglobulin molecules in monocotyledonous plants like cereals .

BACKGROUND

[ 0003 ] Immunoglobulin molecules , in particular antibodies represent a large proportion of therapeutic drugs currently in development . In most cases, they are produced in mammalian cell lines or transgenic animals because these have been shown to fold and assemble the proteins correctly and generate authentic glycosylation patterns . However, such expression systems are expensive, difficult to scale up and there are safety concerns due to potential contamination with pathogenic organisms or oncogenic DNA sequences .

[ 0004 ] Plants represent an inexpensive, efficient and safe alternative for the production of recombinant immunoglobulin molecules such as antibodies . Indeed, research into using transgenic plants to produce industrial or therapeutic biomolecules is one of the fastest developing areas in biotechnology. Over the last 10 years has shown that plants can produce a variety of functional antibodies and there is now intense interest in scaling up production to commercial levels .

[ 0005] Plants provide several advantages for the production of antibodies, including lack of contamination with animal pathogens, relative ease of genetic manipulation, eukaryotic protein modification machinery and economical production . Plant genetic material is indefinitely stored in seeds, which require little or no maintenance . In particular, transgenic plants offer a number of advantages for production of recombinant/monoclonal antibodies . Plants have no immune system, therefore only one antibody species is expressed, and the absence of mammalian viruses and other pathogens provides maximum safety for humans and animals . Some types of monoclonal antibodies, such as secretory IgA (SIgA) can be produced in large quantities only in plants (Ma et al . , (1995) , Science, 268 : 716-719) .

[ 0006] The first report of antibodies produced in plants [plantibodies) was published by Hiatt in 1989 (Hiatt et al . , ( 1989 ) , Nature, 342 : 76-78 ) and subsequently by many others (During et al . , ( 1990) , Plant Molecular Biology, 15 : 281-293 ; Ma et al . , ( 1994 ) , Eur. J. Immunol . , 24 : 131- 138 ; Ma et al . , (1995) supra; Ma et al . , (1998 ) , Nat. Med. , 4 : 601-606; Verch et al . , ( 1998 ) , J Immunol . Meth. 220 : 69- 75; Zeitlin et al . , (1998 ) , Nature Biotechnology, 16 : 1361- 1364. Sexual crosses between plants individually expressing immunoglobulin heavy and light chains are the classical method to obtain transgenic plants expressing full-length assembled antibody. This method, however, is time consuming. An alternative method is co-transformation with two different Agrobacterium strains, one carrying heavy and one carrying light chain, along with two different selectable markers, although efficiency of co- transformation is low (De Neve et al . , ( 1993 ) , Transgenic Research, 2 : 227-237 ) . Expression and assembly of a full- length monoclonal antibody (mAb) in Nicotiana benthamina plants using a plant virus vector has also been reported (Verch et al . , 1998 , supra) .

[ 0007] Despite the many attractive features of current plant expression systems, however, a maj or limitation in producing antibodies in plants has been their generally low level of expression . The highest accumulation levels reported for full-size antibodies in plants are less than 1% of total soluble protein (De Neve et al . , (1999 ) , MoI . Gen. Genet. , 260 : 582-592 ; Ma et al . , (1994 ) , supra; van Engelen et al . , (1994 ) , Plant MoI . Biol . , 26 : 1701-1710 ) . Levels as high as 5% to 6% have been reported for secretory IgA (SIgA) (Ma et al . , (1995) , supra) and for single chain antibodies ( ScFv) (Artsaenko et al . , ( 1995) , The Plant Journal, 8 : 745-750 ; Fiedler et al . , ( 1997 ) , Immunotechnology, 3 : 205-216) . However, these numbers probably include non-functional antibody. Indeed, it would appear that SIgA-producing plants have levels of functional antibody in a recoverable form very much lower than the total amount of antibody that can be detected by western blotting . The highest yield of soluble, functional antibody from transgenic tobacco was 10-80 mg/kg fresh weight of transgenic leaves (Ma et al . , (1998,) , Nature Medicine, 4 (5 ) : 601-607 ) . This may reflect, in part, an insolubilisation of antibody in the apoplastic space when secreted from the plant cell . In addition, a phenomenon known as post-transcriptional gene silencing may place an upper limit on the expression of nuclear transgenes in plants, including antibody genes (De Neve et al . , ( 1999) , supra) .

[0008 ] While the plantibody work to date has been encouraging it has almost been exclusively carried out in dicotyledonous plants . See, for example, International

Patent Application No . WO 01/64929. Dicotyledonous plants have the disadvantage that they are not traditional crop plants and often contain non-desirable contaminates such as alkaloids . For example, the plant used most frequently is tobacco . Tobacco is a relatively easy plant to transform but antibodies produced in such plants would be difficult to purify, thereby adding the overall cost . Therefore, the production of antibodies in monocotyledonous plant such as rice and wheat would be useful . By using monocot crop plants like wheat the possibility of producing "functional foods", which might have potential health benefits would be increased. International Patent Application No . WO99/66026, describes the expression of transgenes in monocot plants . However, as described above, the antibodies produced in the plants disclosed by the methods described are extremely low e . g. less than 1.5 mg per kg of plant material . These levels of antibodies would not be commercially viable .

[ 0009] Another area in which the currently available expressions systems are deficient is the use of promoters, terminators and other expression cassette elements that are not of plant origin. Generally, the reported expression systems use a combination of promoters, terminators and the like that are know to have high levels of expression in bacterial or mammalian cells . However, the maj or of these elements are of mammalian, viral or bacterial origin . These "non-plant" derived expression cassette elements generally produce very low yields of expressed proteins in plants, especially monocotyledonous plants . See, for example, International Patent Application Nos . WO02/05747 , WO97/04122, and WO00/70066.

[0010 ] Thus, what is required is a method of expression that can produce commercial quantities of immunoglobulin molecules such as antibody in a plant . Moreover, the production of antibodies in a commercially sustainable crop plant such as one of the cereals would be highly desirable . SUMMARY OF THE INVENTION

[0011] The inventors have now developed a method for producing high levels of immunoglobulin in monocotyledonous plants .

[0012] Accordingly, in a first aspect the present invention provides a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

[ 0013] In some embodiments , the plant expression vector comprises an expression cassette consisting essentially of a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter isolated from a plant which is capable of promoting expression of said first polynucleotide sequence in a plant and a second polynucleotide sequence coding for a terminator of plant origin.

[0014 ] In some embodiments , the immunoglobulin molecule comprises a heavy chain, while in another embodiment the immunoglobulin molecule comprises a light chain. In yet further embodiments, the immunoglobulin molecule comprises both a heavy and a light chain . Preferably, the immunoglobulin molecule comprises a single-chain variable fragment (scFv) .

[0015] One of the more important features of the present invention is the promoter used to drive the expression of the immunoglobulin molecule . Preferably, the promoter is selected from the group consisting of light-inducible promoter from ssRUBISCO, MAS promoter, rice actin promoter, maize ubiquitin promoter, UBI 3 promoter, PR-I promoter, CZ19B1 promoter, milps promoter, CesA promoter, Gama-zein promoter, Glob-1 , maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2, globulin 1, pEMU promoter and maize H3 histone promoter . More preferably, the promoter is maize ubiquitin promoter .

[0016] Another important feature of the present invention is the terminator. Preferably, the terminator is selected from the group consisting of t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator . More preferably, the terminator is the zein gene terminator .

[0017 ] In some embodiments, the plant expression vector consists essentially of the maize ubiquitin promoter, the zein gene terminator and a first polynucleotide sequence coding for an immunoglobulin molecule .

[0018 ] In some embodiments , the present invention provides a plant expression vector for the expression of immunoglobulin in a monocot plant comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin and wherein the vector is capable of producing greater than about 50mg of the immunoglobulin molecule per kilogram of transformed plant, plant cell or seed.

[0019] In some embodiments, the plant expression vector is selected from the group consisting of GBA2CD4 , GBA2CD28 , GBA2CDHSV and GBA2cah as shown in Figures 1 to 4 , respectively. [0020] It will be appreciated by those skilled in the art that the immunoglobulin molecule expressed in the plant expression vector of the present invention can be any immunoglobulin molecule . Preferably, the immunoglobulin molecule binds specifically to antigens selected from the group consisting of CD58 , VCAM, VLA4 , CD2, LFA3, ELAM, LAM, CD25, CD4 , CD19, CD20, CD23, CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I , IL-8 , human T-cell receptor, CD3 , CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45 , neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71. More preferably, the immunoglobulin molecule binds specifically to CD4 or CD28.

[0021] In a second aspect the present invention provides , a plant cell comprising a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

[0022] In some embodiments, the plant expression vector comprises an expression cassette consisting essentially of a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence in a plant and a second polynucleotide sequence coding for a terminator; wherein at least the promoter and second polynucleotide sequence are of plant origin .

[ 0023] In some embodiments , the plant expression vector consists essentially of the maize ubiquitin promoter, the zein gene terminator and a first polynucleotide sequence coding for an immunoglobulin molecule . [0024 ] Preferably, the plant cell is isolated from a monocotyledonous plant of a plant family selected from the group consisting of Agavaceae; Alliaceae; Alstroemeriaceae; Amaryllidaceae; Araceae; Asparagaceae; Calochortaceae; Cannaceae; Commellnaceae; Dioscoreaceae; Gramineae; Hyacinthaceae; Iridaceae; Liliaceae; Melanthiaceae; Musaceae; Orchidaceae and Zingiberaceae. More preferably, the plant is from the family Gramineae. Even more preferably, the plant or plant cell is selected from the group consisting of wheat, sorghum, rice, barley, maize, rye, triticale and oat . Most preferably, the plant is wheat .

[ 0025] In a third aspect, the present invention provides a plant seed transformed with a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin.

[0026] In a fourth aspect, the present invention provides a transgenic plant, plant material, seeds or progeny thereof, comprising a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin and wherein the expression of said expression vector results in a transgenic plant, plant material, seeds or progeny thereof that produces an immunoglobulin molecule . [ 0027 ] In some embodiments of the present invention, the plants, plant cells or seeds produce greater than about 50mg of expressed immunoglobulin molecule per kilogram of plant, plant cell or seed. More preferably, the plants, plant cells or seeds produce greater than 70mg of expressed immunoglobulin molecule per kilogram of plant, plant cell or seed.

[ 0028 ] In a fifth aspect, the present invention provides a method for introducing DNA encoding immunoglobulin genes into a monocotyledonous plant, said method comprising: i) . introducing into a plant cell a plant expression vector adsorbed on to a microproj ectile, said plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

[ 0029] In a sixth aspect, the present invention provides a method for producing an immunoglobulin molecule in a monocotyledonous plant, comprising the step : i) introducing into a plant cell an expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

[ 0030] In some embodiments, the plant expression vector is integrated into the host cell genome, while in other embodiments the expression vector is extrachromosomal . [ 0031] In a seventh aspect, the present invention provides a method for expressing an immunoglobulin molecule in a monocotyledonous plant, comprising: i) transforming plant tissue with an expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin, wherein said an expression vector is capable of expressing antibody in cells and/or intercellular spaces of the plant tissue; and ii) incubating the plant tissue under conditions suitable for expressing the immunoglobulin molecule .

[0032] In an eighth aspect, the present invention provides a method for expressing an immunoglobulin molecule in a monocotyledonous plant, comprising : i) transforming plant tissue with a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin, wherein said an expression vector is capable of expressing an immunoglobulin molecule in cells and/or intercellular spaces of the plant tissue; ii) incubating the plant tissue under conditions suitable for expressing the immunoglobulin molecule; and iii) isolating greater than about 50 mg of the immunoglobulin molecule from a kilogram of plant tissue .

[0033] It will be appreciated by those skilled in the art that any method of transformation may be used to produce the monocotyledonous plant of the present invention. Preferably, the expression vector is introduced into the plant tissue by a technique selected from the group consisting of transfection, microinj ection, biolistics , electroporation and lipofection . More preferably, the technique used is a biolistic bombardment .

[0034 ] The collection and/or isolation of the immunoglobulin molecule can utilize any method known in the art . Preferably, the method is by grinding whole plants, seeds or leaves .

[0035] It will be appreciated that the immunoglobulin molecules produced by the methods of the present invention may be used to treat various disease or disorders or used to develop assays and/or diagnostic tests .

[ 0036] Accordingly, in a ninth aspect, the present invention provides an immunotherapeutic composition comprising a plant, a plant cell or seed according to the second, third or fourth aspects .

[0037 ] Preferably, the immunotherapeutic composition comprises a plant tissue selected from the group consisting of a fruit, leaf, tuber, plant organ, seed protoplast, and callus .

[0038] In a tenth aspect the present invention provides a method of treating a disease or disorder in a subj ect in need of such treatment comprising the step of administering a plant, a plant cell or seed according to the second, third or fourth aspects of the present invention or an extract from said plant, plant cell or seed.

[0039] Preferably, the plant, plant cell, seed or plant extract is administered intramuscularly, orally, intradermally, intraperitoneally, subcutaneously, and intranasally. More preferably, the administration comprises consuming the plant, plant cell, seed or plant extract .

[0040] It will be appreciated that modified and variant forms of the plant expression vectors may be produced in vitro, by means of chemical or enzymatic treatment, or in vivo by means of recombinant DNA technology. Such vectors may differ from those disclosed, for example, by virtue of one or more nucleotide substitutions, deletions or insertions, but substantially retain a biological activity of the construct or nucleic acid molecule of this invention.

BRIEF DESCRIPTION OF THE FIGURES

[ 0041] Figure 1 shows a schematic of GBA2CD4 , a plant expression vector of the present invention capable of expressing immunoglobulin molecule capable of binding CD4.

[ 0042] Figure 2 , shows a schematic of GBA2CD28 , a plant expression vector of the present invention capable of expressing immunoglobulin molecule capable of binding CD28.

[ 0043] Figure 3 shows a schematic of GBA2CDHSV, a plant expression vector of the present invention capable of expressing an immunoglobulin molecule capable of binding HSV.

[ 0044 ] Figure 4 shows a schematic of GBA2cah, a plant expression vector of the present invention capable of expressing the enzyme cyanamide hydratase which detoxifies cyanamide to urea and water .

[0045] Figure 5 shows plasmids of pGBA2-CD4 , -CD28 and - HSV digested With Bam HI showing the scFv genes in the sense orientation . M marks a lkb plus DNA molecular marker, while lanes 1 and 2 show pGBA2-CD4 in sense orientation. Lanes 3 and 4 show pGBA2CD28 in sense orientation and lanes 5 and 6 show pGBA2HSV in sense orientation.

[0046] Figure 6 shows PCR products for scFv genes (CD4 , CD28 and HSV) amplified with primers 5' CD/3' CD from transgenic T₀ wheat plants mixed in with non-transgenic plants .

[0047 ] Figure 7 shows Western blot of ScFv with His tag antibodies . Lane (1) 2940.1-11 (CD4 ) positive; (2 ) 2912.2-2 (CD4 ) negative; (3) 2912.2-3 (CD4 ) negative; ( 4 ) 2767.1- 17 (CD28 ) positive; ( 5) 2767.1-36 (CD28 ) negative and ( 6) 3143.1 (CD28 ) positive .

[0048 ] Figure 8 shows flow cytometry comparison of extracts from transgenic anti-CD4 lines (2940.1, 2940.1.2 , 2940.1.6, 2940.1.12 and 2940.1.25 ) , Westonia control and diluted 1/1000 purified bacterial scFv.

[0049] Figure 9 shows flow cytometry comparison of extracts from transgenic anti-CD28 lines including Westonia control and 1/50 diluted positive control .

[0050] Figure 10 shows titration of purified scFv.

[0051] Figure 11 shows the titration of 36/2 purified anti-CD4 scFv

[ 0052] Figure 12 shows SEQ ID NO . : 1 - Anti-CD4 plus associated genetic elements .

DEFINITIONS

[ 0053 ] The description that follows makes use of a number of terms used in recombinant DNA technology. Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs . The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton, et al . , Dictionary of Microbiology and Molecular Biology (2nd ed. 1994 ) ; The Cambridge Dictionary of Science and Technology (Walker ed. , 1988 ) ; The Glossary of

Genetics , 5^th Ed. , Rieger, R. , et al . (eds . ) , Springer Verlag (1991) ; and Hale & Marham, The Harper Collins Dictionary of Biology ( 1991) . However, in order to provide a clear and consistent understanding of the specification and claims , including the scope given such terms, the following definitions are provided.

[0054 ] The term "cell" can refer to any cell from a plant, including but not limited to, somatic cells, gametes or embryos .

[ 0055] "Embryo" refers to a sporophytic plant before the start of germination. Embryos can be formed by fertilisation of gametes by sexual crossing or by selfing . A "sexual cross" is pollination of one plant by another . "Selfing" is the production of seed by self-pollination, i . e . , pollen and ovule are from the same plant . The term "backcrossing" refers to crossing a Fl hybrid plant to one of its parents . Typically, backcrossing is used to transfer genes, which confer a simply inherited, highly heritable trait into an inbred line . The inbred line is termed the recurrent parent . The source of the desired trait is the donor parent . After the donor and the recurrent parents have been sexually crossed, F, hybrid plants which possess the desired trait of the donor parent are selected and repeatedly crossed (i . e . , backcrossed) to the recurrent parent or inbred line .

[0056] Embryos can also be formed by "embryo somatogenesis" and "cloning . " Somatic embryogenesis is the direct or indirect production of embryos from either cells, tissues or organs of plants . [0057 ] Indirect somatic embryogenesis is characterised by growth of a callus and the formation of embryos on the surface of the callus .

[0058] Direct somatic embryogenesis is the formation of an asexual embryo from a single cell or group of cells on an explant tissue without an intervening callus phase . Because abnormal plants tend to be derived from a callus , direct somatic embryogenesis is preferred.

[0059] The common term, "grain" is the endosperm present in the ovules of a plant .

[0060] The phrase "introducing into a plant cell an expression vector" refers to the step of introducing a plant expression vector carrying a nucleic acid sequence into a plant by recombinant means, including but not limited to, Agrobacterlum-mediated transformation, biolistic methods , electroporation, in planta techniques, and the like . The term "nucleic acid sequence" is synonymous with DNA, RNA, and polynucleotides . Such a plant containing the nucleic acid sequences is referred to here as an R, generation plant . Rl plants may also arise from cloning, sexual crossing or selfing of plants into which the nucleic acids have been introduced.

[0061] A "nucleic acid molecule" or "polynucleic acid molecule" refers herein to deoxyribonucleic acid and ribonucleic acid in all their forms , ie . , single and double-stranded DNA, cDNA, mRNA, and the like .

[0062] A "double-stranded DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms . Thus this term includes double- stranded DNA found, inter alia_r in linear DNA molecules

(e . g . , restriction fragments ) , viruses , plasmids, and chromosomes . In discussing the structure of particular double-stranded DNA molecules , sequences may be described herein according to the normal convention of giving only the sequence in the 5 ' to 3 ' direction along the non- transcribed strand of DNA (i . e . , the strand having a sequence homologous to the mRNA) .

[ 0063] A DNA sequence "corresponds" to an amino acid sequence if translation of the DNA sequence in accordance with the genetic code yields the amino acid sequence (i . e . , the DNA sequence "encodes" the amino acid sequence) .

[0064 ] One DNA sequence "corresponds" to another DNA sequence if the two sequences encode the same amino acid sequence .

[ 0065] Two DNA sequences are "substantially similar" when at least about 85%, preferably at least about 90% , and most preferably at least about 95% , of the nucleotides match over the defined length of the DNA sequences .

[ 0066] A "heterologous" region or domain of a DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature . Thus, when the heterologous region encodes a plant gene, the gene will usually be flanked by DNA that does not flank the plant genomic DNA in the genome of the source organism. Another example of a heterologous region is a construct where the coding sequence itself is not found in nature (e . g. , a cDNA where the genomic coding sequence contains introns or synthetic sequences having codons different than the native gene) .

Allelic variations or naturally occurring mutational events do not give rise to a heterologous region of DNA as defined herein .

[ 0067 ] A "coding sequence" is an in-frame sequence of codons that correspond to or encode a protein or peptide sequence . Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences . A coding sequence in association with appropriate regulatory sequences may be transcribed and translated into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3 ' to the coding sequence .

[ 0068 ] Polynucleotide "homologs" refers to DNAs or RNAs and polymers thereof in either single- or double-stranded form containing known analogues of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolised in a manner similar to naturally occurring nucleotides .

[ 0069] "Transgenic plants" are plants into which a nucleic acid has been introduced through recombinant techniques , e . g. , nucleic acid-containing vectors . A "vector" is a nucleic acid composition which can transduce, transform or infect a cell, thereby causing the cell to express vector-encoded nucleic acids and, optionally, proteins other than those native to the cell, or in a manner not native to the cell . A vector includes a nucleic acid (ordinarily RNA or DNA) to be expressed by the cell . A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a retroviral particle, liposome, protein coating or the like . Vectors contain nucleic acid sequences that allow their propagation and selection in bacteria or other non-plant organisms . For a description of vectors and molecular biology techniques, see Current Protocols in Molecular Biology, Ausubel, et al . , (eds . ) , Current Protocols, a joint venture between Greene Publishing Associates , Inc . and John Wiley & Sons, Inc . , (through and including the 1998 Supplement) (Ausubel) .

[0070 ] "Plasmids" are one type of vector which comprises DNA that is capable of replicating within a plant cell, either extra-chromosomally or as part of the plant cell chromosome ( s ) , and are designated by a lower case "p" preceded and/or followed by capital letters and/or numbers . The starting plasmids herein are commercially available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids by methods disclosed herein and/or in accordance with published procedures . In certain instances, as will be apparent to the ordinarily skilled worker, other plasmids known in the art may be used interchangeably with plasmids described herein .

[ 0071] The phrase "expression cassette" refers to a nucleic acid sequence within a vector, which is to be transcribed, and a control sequence to direct the expression . The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked nucleotide coding sequence in a particular host cell . The control sequences suitable for expression in prokaryotes , for example, include origins of replication, promoters , ribosome binding sites, and transcription termination sites . The control sequences that are suitable for expression in eukaryotes , for example, include origins of replication, promoters, ribosome-binding sites , polyadenylation signals , and enhancers . One of the most important control sequences is the promoter .

[0072 ] A "promoter" is an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element . [0073] A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. The promoter can either be homologous, i . e . , occurring naturally to direct the expression of the desired nucleic acid or heterologous, i . e . , occurring naturally to direct the expression of a nucleic acid derived from a gene other than the desired nucleic acid. Fusion genes with heterologous promoter sequences are desirable, e . g . , for regulating expression of encoded proteins . A "constitutive" promoter is a promoter that is active in a selected organism under most environmental and developmental conditions . An "inducible" promoter is a promoter that is under environmental or developmental regulation in a selected organism.

[ 0074 ] Selection of a suitable plant promoter may include several considerations , for example, recipient cell type (such as, for example, leaf epidermal cells, mesophyll cells , root cortex cells ) , tissue- or organ-specific (e . g . , roots, leaves or flowers ) expression of genes linked to the promoter, and timing and level of expression (as may be influenced by constitutive vs . regulatable promoters and promoter strength) . Some of the promoters that are useful in the present invention include, but are not limited to, the light-inducible promoter from the small subunit of ribulose bis-phosphate carboxylase (ssRUBISCO, an abundant plant polypeptide) , pEMU (Last, et al . , (1991) , Theor. Appl . Genet . , 81 : 581-588 ) , the mannopine synthase (MAS ) promoter ( see, e . g. , Velten et al . , ( 1984 ) , EMBO J. 3 : 2723- 2730; and Velten & Schell, (1985) , Nuc. Acids Res. 13 : 6981- 6998 ) , the rice actin promoter (McElroy et al . , (1990 ) , Plant Cell, 163-171) , the maize ubiquitin promoter (see e . g. , Christensen et al. , (1992) , Plant MoI . Biol. 12 : 619- 632 ; Christensen, et al . , ( 1992 ) , Plant MoI . Biol . 18 : 675- 689 ; PCT Application Publication No . WO00/60061) , Arabidopsis thaliana UBI 3 promoter ( see e . g . , Norris et al . _f (1993) , Plant MoI . Biol . , 22 : 895-906) , maize H3 histone (Lepetit et al . , ( 1992) , MoI . Gen . Genet. 231 : 276- 285 ; and Atanassvoa et al . , (1992 ) , Plant Journal, 2 ( 3) : 291-300 ) and the chemically inducible PR-I promoter from tobacco or Arabidopsis (see e . g . , U . S . Pat . No . 5, 689, 044) .

[0075] "Seed-preferred" promoters include both "seed- specific" promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as "seed-germinating" promoters (those promoters active during seed germination) . See Thompson et al . ( 1989) , BioEssays , 10 : 108 , herein incorporated by reference . Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message) ; CZ19B1 (maize 19 kDa zein) ; milps (myo-inositol-1-phosphate synthase) ; and CesA (cellulose synthase) (see WO00/11177 , herein incorporated by reference) . Gama-zein is a preferred endosperm-specific promoter . Glob-1 is a preferred embryo- specific promoter . Seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO00/12733, where seed-preferred promoters from endl and end2 genes are disclosed; herein incorporated by reference .

[0076] Additional sequences that may also be included in the expression vector include, but are not restricted to, selectable markers, transcription terminators and extraneous sequences to enhance expression such as introns . A variety of transcription terminators may be used which are responsible for termination of transcription beyond a coding region and correct polyadenylation .

[ 0077] The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signal termination of transcription. Terminators are 3 ' -non-translated DNA sequences containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3 ' -end of a primary transcript .

[ 0078 ] Examples of terminators particularly suitable for use in the plant expression vectors of the present invention include the Oryza sativa ADP-glucose pyrophosphorylase terminator sequence (t3 ' Bt2 ) , the Zea mays zein gene terminator sequence, the rbcs-lA gene terminator, the pin II terminator from potato (Keil, et al . , ( 1986) , Nucl . Acids Res. 14 : 5641-5650 ; and An et al . , (1989) , Plant Cell, 1 : 115-122 ) and the pea rbcs-3A gene terminator sequences, amongst others .

[ 0079] Plant signal sequences , including, but not limited to, signal-peptide encoding DNA/RNA sequences which target proteins to the extracellular matrix of the plant cell (Dratewka-Kos et al . , ( 1989 ) , J. Biol . Chem. , 264 : 4896-4900 ) , the Nicotiana plumbaginifolia extension gene (DeLoose et al . , ( 1991 ) , Gene, 99 : 95-100 ) , signal peptides which target proteins to the vacuole like the sweet potato sporamin gene (Matsuka et al . , (1991) , PNAS, 88 : 834 ) and the barley lectin gene (Wilkins et al . , ( 1990 ) , Plant Cell, 2 : 301-313) , signal peptides which cause proteins to be secreted such as that of PRIb (Lind et al . , ( 1992 ) , Plant MoI . Biol . , 18 : 47-53 ) , or the barley alpha amylase (BAA) (Rahmatullah et al . , (1989) , Plant MoI . Biol . , 12 : 119 and hereby incorporated by reference) .

[ 0080 ] For the purposes of the present invention, the promoter sequence is bounded at its 3 ' terminus by the translation start codon of a coding sequence, and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease Sl) , as well as protein binding domains (consensus sequences ) responsible for the binding of RNA polymerase .

[0081] A "glycosylation signal sequence" is a three- amino acid sequence within a polypeptide, of the sequence N-X-S/T, where N is asparagine, X is any amino acid (except proline) , S is serine, and T is threonine . The presence of this amino acid sequence on secreted proteins normally results , within the endoplasmic reticulum, in the covalent attachment of a carbohydrate group to the asparagine residue .

[ 0082 ] An "exogenous" element is one that is foreign to the host cell, or is homologous to the host cell but in a position within the host cell in which the element is ordinarily not found.

[0083] "Digestion" of DNA refers to the catalytic cleavage of DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes or restriction endonucleases , and the sites within DNA where such enzymes cleave are called restriction sites . If there are multiple restriction sites within the DNA, digestion will produce two or more linearised DNA fragments (restriction fragments) . The various restriction enzymes used herein are commercially available, and their reaction conditions , cofactors , and other requirements as established by the enzyme manufacturers are used. Restriction enzymes are commonly designated by abbreviations composed of a capital letter followed by other letters representing the microorganism from which each restriction enzyme originally was obtained and then a number designating the particular enzyme . In general, about Iμg of DNA is digested with about 1-2 units of enzyme in about 20μl of buffer solution . Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer, and/or are well known in the art .

[0084] "Recovery" or "isolation" of a given fragment of DNA from a restriction digest typically is accomplished by separating the digestion products, which are referred to as "restriction fragments , " on a polyacrylamide or agarose gel by electrophoresis, identifying the fragment of interest on the basis of its mobility relative to that of marker DNA fragments of known molecular weight, excising the portion of the gel that contains the desired fragment, and separating the DNA from the gel, for example by electroelution .

[0085] "Ligation" refers to the process of forming phosphodiester bonds between two double-stranded DNA fragments . Unless otherwise specified, ligation is accomplished using known buffers and conditions with 10 units of T4 DNA ligase per 0.5μg of approximately equimolar amounts of the DNA fragments to be ligated.

[0086] "Oligonucleotides" are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesised by known methods (involving, for example, triester, phosphoramidite, or phosphonate chemistry) , such as described by Engels et al . , ( 1989 ) , Agnew. Chem . Int . Ed. Engl . , 28 : 716-734. The oligonucleotides are then purified, for example, by polyacrylamide gel electrophoresis .

[0087 ] "Polymerase chain reaction, " or "PCR, " as used herein generally refers to a method for amplification of a desired nucleotide sequence in vitro, as described in U. S . Patent No . 4 , 683 , 195. In general, the PCR method involves repeated cycles of primer extension synthesis , using two oligonucleotide primers capable of hybridising preferentially to a template nucleic acid. Typically, the primers used in the PCR method will be complementary to nucleotide sequences within the template at both ends of or flanking the nucleotide sequence to be amplified, although primers complementary to the nucleotide sequence to be amplified also may be used. Wang, et al . , in PCR

Protocols , pp .70-75 (Academic Press , 1990 ) ; Ochman, et al . , in PCR Protocols , pp . 219-227 ; Triglia, et al . , Nucl . Acids Res. 16 : 8186 (1988 ) .

[0088 ] "PCR cloning" refers to the use of the PCR method to amplify a specific desired nucleotide sequence that is present amongst the nucleic acids from a suitable cell or tissue source, including total genomic DNA and cDNA transcribed from total cellular RNA. See, for example, Frohman et al . , ( 1988 ) , Proc. Nat . Acad. Sex . USA, 85 : 8998- 9002 ; Saiki et al . , ( 1988 ) , Science, 239 : 487-492 ; Mullis et al . , (1987 ) , Meth. Enzymol . , 155 : 335-350.

[0089] As used herein, "homologous recombination" refers to a process whereby two homologous double-stranded polynucleotides recombine to form a novel polynucleotide .

[ 0090 ] The phrase "operably encodes" refers to the functional linkage between a promoter and a second nucleic acid sequence, wherein the promoter sequence initiates transcription of RNA corresponding to the second sequence .

[ 0091] The term "progeny" refers to the descendants of a particular plant ( self-cross) or pair of plants (crossed or backcrossed) . The descendants can be of the Fl, the F2 , or any subsequent generation .

[0092] Typically, the parents are the pollen donor and the ovule donor which are crossed to make the progeny plant of this invention .

[ 0093] Parents also refer to Fl parents of a hybrid plant of this invention (the F2 plants) . Finally, parents refer to a recurrent parent which is backcrossed to hybrid plants of this invention to produce another hybrid plant of this invention .

[0094] The phrase "producing a transgenic plant" refers to producing a plant of this invention . The plant is generated through recombinant techniques, i . e . , cloning, somatic embryogenesis or any other technique used by those of skill to produce plants .

[ 0095] The common names of some plants used throughout this disclosure refer to varieties of plants of the following genera :

Common Name Genera

Wheat ( soft, hard and durum varieties) Triticum

Sorghum Sorghum

Rice Oryza

Barley Hordeum

Maize or corn Zea

Rye Secale

Triticale Triticale

Oat Avena

[0096] "Integration" of the DNA may be effected using non-homologous recombination following mass transfer of DNA into the cells using microinj ection, biolistics, electroporation or lipofection . Alternative methods such as homologous recombination, and or restriction enzyme mediated integration (REMI) or transposons are also encompassed, and may be considered to be improved integration methods .

[0097 ] A "clone" is a population of cells derived from a single cell or common ancestor by mitosis . [ 0098 ] "Nucleic acid sequence homologs" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-or double-stranded form containing known analogues of natural nucleotides , which have similar binding properties as the reference nucleic acid and are metabolised in a manner similar to naturally occurring nucleotides .

[0099] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e . g . , degenerate codon substitutions) and complementary sequences , as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al . , (1991) , Nucleic Acid Res . , 19 : 5081 ; Ohtsuka et al . , ( 1985 ) , J. Biol . Chem. , 260 : 2605-2608 ; and Rossolini et al . , ( 1994 ) , MoI . Cell . Probes 8 : 91-98 ) . The term "nucleic acid" is used interchangeably with gene, cDNA, and iriRNA encoded by a gene .

[0100] The term "polypeptide" is used in its broadest sense to refer to a compound of two or more subunit amino acids . The subunits may be linked by peptide bonds . As used herein the term "amino acid" refers to natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers . A peptide of three or more amino acids is commonly called an oligopeptide if the peptide chain is short . If the peptide chain is long, the peptide is commonly called a polypeptide or a protein.

[ 0101] The term "amino acid sequence homolog" refers to a protein with a similar amino acid sequence . One of skill will realise that the critical amino acid sequence is within a functional domain of a protein. Thus, it may be possible for a homologous protein to have less than 40% homology over the length of the amino acid sequence, but greater than 90% homology in one functional domain . In addition to naturally occurring amino acids, homologs also encompass proteins in which one or more amino acid residue is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring proteins .

[0102 ] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[ 0103] Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes .

[0104] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences . With respect to particular nucleic acid sequences , conservatively modified variants refers to those nucleic acids that encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences .

[0105] Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine . Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide . Such nucleic acid variations are "silent variations , " which are one species of conservatively modified variations . Every nucleic acid sequence herein, which encodes a polypeptide, also describes every possible silent variation of the nucleic acid. One of skill will recognise that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule . Accordingly, each silent variation of a nucleic acid, which encodes a polypeptide, is implicit in each described sequence .

[0106] As to amino acid sequences, one of skill will recognise that individual substitutions , deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art .

[ 0107 ] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A) , Serine (S) , Threonine (T) ;

2 ) Aspartic acid (D) , Glutamic acid (E) ;

3) Asparagine (N) , Glutamine (Q) ;

4 ) Arginine (R) , Lysine (K) ;

5) Isoleucine (I) , Leucine (L) , Methionine (M) , Valine (V) ; and 6) Phenylalanine (F) , Tyrosine (Y) , Tryptophan (W) .

(See, e . g . , Creighton, Proteins ( 1984 ) ) .

[0108 ] A "variable region" of an antibody refers to the variable region of the antibody' s light chain or the variable region of the heavy chain either alone or in combination.

[ 0109] A "multimeric protein" as used herein refers to a globular protein containing more than one separate polypeptide or protein chain associated with each other to form a single globular protein in vitro or in vivo. The multimeric protein may consist of more than one polypeptide of the same kind to form a homodimeric or homotrinmeric protein; the multimeric protein may also be composed of more than one polypeptide having distinct sequences to form, e . g . , a heterodimer or a heterotrimer . Non-limiting examples of multimeric proteins include immunoglobulin molecules, receptor dimer complexes, trimeric G-proteins, and any enzyme complexes .

[ 0110] An "immunoglobulin molecule" or "antibody" is a polypeptide or multimeric protein containing the immunologically active portions of an immunoglobulin heavy chain and immunoglobulin light chain covalently coupled together and capable of specifically combining with antigen . The immunoglobulins or antibody molecules are a large family of molecules that include several types of molecules such as IgD, IgG, IgA, secretory IgA (SIgA) , IgM, and IgE . The term "immunoglobulin molecule" includes for example hybrid antibodies or altered antibodies and fragments thereof, including but not limited to Fab fragment (s ) and single-chain variable fragments (ScFv) .

[ 0111] An "Fab fragment" of an immunoglobulin molecule is a multimeric protein consisting of the portion of an immunoglobulin molecule containing the immunologically active portions of an immunoglobulin heavy chain and an immunoglobulin light chain covalently coupled together and capable of specifically combining with an antigen . Fab fragments can be prepared by proteolytic digestion of substantially intact immunoglobulin molecules with papain using methods that are well known in the art . However, a Fab fragment may also be prepared by expressing in a suitable host cell the desired portions of immunoglobulin heavy chain and immunoglobulin light chain using methods disclosed herein or any other methods known in the art .

[ 0112 ] An "ScFv fragment" of an immunoglobulin molecule is a protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region covalently coupled together and capable of specifically combining with an antigen. ScFv fragments are typically prepared by expressing a suitable host cell the desired portions of immunoglobulin heavy chain variable region and immunoglobulin light chain variable region using methods described herein and/or other methods known to artisans in the field.

[0113] "Secretory component" is a fragment of an immunoglobulin molecule comprising secretory IgA as defined in U . S . Pat . Nos . 5, 202 , 422 and 5, 959 , 177 , incorporated here by reference .

[ 0114 ] The term "immunologically active, " as used herein, refers to an immunoglobulin molecule having structural, regulatory or biochemical functions of a naturally occurring molecule expressed in its native host cell . For instance, an immunologically active immunoglobulin produced in a plant cell by the methods of this invention has the structural characteristics of the naturally occurring molecule, and/or exhibits antigen binding specificity of the naturally occurring antibody that is present in the host cell in which the molecule is normally expressed.

[0115] The term "humanised, " as used herein, refers to a construct in which coding sequences for heavy and light chain variable regions from a species other than human have been fused, via genetic engineering to the coding sequences of the respective constant regions of human heavy and light chains . It also refers to the resulting antibodies .

[0116] As used herein, the terms "transformation" and "transfection" refer to the process of introducing a desired nucleic acid, such a plant expression vector of the present invention, into a plant cells , either in culture or in the organs of a plant by a variety of techniques used by molecular biologists . Accordingly, a cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell wall . Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell . In prokaryotes and yeast, for example, the exogenous DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the exogenous DNA is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.

[ 0117 ] Numerous methods for introducing foreign genes into plants are known and can be used to insert a modified nucleic acid into a plant host, including biological and physical plant transformation protocols . See, for example, Miki et al . , ( 1993 ) , "Procedure for Introducing Foreign DNA into Plants", In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds . , CRC Press, Inc . , Boca Raton, pages 67-88. The methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, microorganism-mediated gene transfer such as Agrobacterium (Horsch et al . , ( 1985 ) , Science, 227 : 1229-31 ) , electroporation, micro-inj ection, and biolistic bombardment .

[ 0118 ] Expression cassettes and vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are known and available . See, for example, Gruber et al . , ( 1993 ) , "Vectors for Plant Transformation" In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds . CRC Press, Inc . , Boca Raton, pages 89-119. [0119] The most widely utilised method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria which genetically transform plant cells . The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectfully, carry genes responsible for genetic transformation of plants . See, for example, Kado, ( 1991) , Crit . .Rev. Plant Sci . , 10 : 1. Descriptions of the Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided in Gruber et al . _r supra; Miki et al . , supra; and Moloney et al . , ( 1989) , Plant Cell Reports, 8 : 238.

[ 0120] Similarly, the gene coding for an immunoglobulin molecule of the present invention can be inserted into the T-DNA region of a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes, respectively. Thus , expression cassettes can be constructed as above, using these plasmids . Many control sequences are known which when coupled to a heterologous coding sequence and transformed into host organisms show fidelity in gene expression with respect to tissue/organ specificity of the original coding sequence . See, e . g . , Benfey and Chua, ( 1989) , Science, 244 : 174-181.

[0121] Once constructed, these plasmids can be placed into A. rhizogenes or A. tumefaciens and these vectors used to transform cells of monocot plants . Plants that are contemplated by the present invention have been discussed supra; however, they include but are not limited to corn, sorghum, wheat, rice, barley, rye and triticale . The selection of either A. tumefaciens or A. rhizogenes will depend on the plant being transformed thereby. In general A. tumefaciens is a preferred organism for transformation . A few monocotyledons (e . g . certain members of the Liliales and Arales) are susceptible to infection with A. tumefaciens. A. rhizogenes also has a wide host range . Alternative techniques, which have proven to be effective in genetically transforming plants, include particle bombardment and electroporation. See e . g . Rhodes et al . , ( 1988 ) , Science, 240 : 204-207 ; Shigekawa and Dower, ( 1988 ) , Bio/Techniques, 6 : 742-751; Sanford et al . , (1987 ) , Particulate Science & Technology, 5 : 27-37 ; and McCabe, ( 1988 ) , Bio/Technology, 6 : 923-926.

[ 0122 ] Once transformed, these cells can be used to regenerate transgenic plants by standard techniques that are capable of expressing high levels of antibody. Examples of such methods for regenerating plant tissue are disclosed in Shahin, (1985) , Theor. Appl . Genet. , 69 : 235-240 ; U . S . Pat . No . 4 , 658 , 082 ; Simpson et al . , ( 1986) , Plant MoI . Biol . , 6 : 403-415; the entire disclosures therein incorporated herein by reference .

[ 0123 ] Despite the fact that the host range for Agrobacterium-mediated transformation is broad, some maj or cereal crop species have generally been recalcitrant to this mode of gene transfer, even though some success has recently been achieved in rice (Hiei et al . , ( 1994 ) , The Plant Journal, 6 : 271-282 ) . Several methods of plant transformation have been developed, collectively referred to as direct gene transfer, as an alternative to Agrojbacteriuin-mediated transformation.

[0124 ] A generally applicable method of plant transformation is microprojectile-mediated transformation, where DNA is carried on the surface of microproj ectiles measuring about 1 to 4μm. A plant expression vector of the present invention is introduced into plant tissues with a biolistic device that accelerates the microproj ectiles to speeds of 300 to 600m/s which is sufficient to penetrate the plant cell walls and membranes . (Sanford et al . , (1987 ) , Part . Sci . Technol . , 5 : 27 ; Sanford, ( 1988 ) , Trends Biotech, 6 : 299; Sanford, ( 1990 ) , Physiol . Plant, 79 : 206; Klein et al . , ( 1992 ) , Biotechnology, 10 : 268 ) .

[ 0125 ] Another method for physical delivery of DNA to plants is sonication of target cells as described in Zang et al . , ( 1991 ) , Bio/Technology, 9 : 996. Alternatively, liposome or spheroplast fusions have been used to introduce expression vectors into plants . See, for example, Deshayes et al . , ( 1985 ) , EMBO J. , 4 : 2731 ; and Christou et al . , ( 1987 ) , PNAS USA, 84 : 3962. Direct uptake of DNA into protoplasts, using CaCl₂ precipitation, polyvinyl alcohol or poly-L-ornithine, have also been reported. See, for example, Hain et al . , ( 1985) , MoI . Gen . Genet. , 199 : 161; and Draper et al . , ( 1982 ) , Plant Cell Physiol . , 23 : 451.

[0126] Electroporation of protoplasts and whole cells and tissues has also been described. See, for example, Donn et al . , ( 1990 ) , In: Abstracts of the VII^th Int 'l . Congress on Plant Cell and Tissue Culture IAPTC, A2-38 , page 53 ; D ' Halluin et al . , ( 1992 ) , Plant Cell, 4 : 1495-1505 ; and Spencer et al . , (1994 ) , Plant MoI . Biol . , 24 : 51-61.

[ 0127 ] Alternatively the DNA constructs are combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector . The virulence function of the Agrobacterium tumefaciens host directs the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria .

[ 0128 ] Microinj ection techniques are known in the art and well described in the scientific and patent literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al . , ( 1984 ) , EMBO J. , 3 : 2717. Electroporation techniques are described in Fromm et al . , ( 1985 ) , Proc. Nat 'l . Acad. Sci . USA, 82 : 5824. Biolistic transformation techniques are described in Klein et al . , ( 1987 ) , Nature, 327 : 70-73.

[0129] Agrobacterium tumefaciens-medxated transformation techniques, including disarming and use of binary vectors, are also well described in the scientific literature . See, for example Horsch et al . , ( 1984 ) , Science, 233 : 496-498 , and Fraley et al . , ( 1983) , PNAS. USA, 80 : 4803.

[ 0130 ] One preferred method of transforming plants of the invention is microproj ectile bombardment . In this method target tissues are treated with osmoticum. Then DNA coding for the immunoglobulin molecule of interest is precipitated, and coated onto tungsten or gold microparticles . The microparticles are then loaded into microproj ectile or biolistic device and the treated cells are bombarded (Bower et al . , ( 1996) , Molecular Breeding, 2, 239-249 ) .

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[ 0131] All publications mentioned herein are cited for the purpose of describing and disclosing the protocols and reagents which are reported in the publications and which might be used in connection with the invention . Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention .

[ 0132 ] The practice of the present invention employs, unless otherwise indicated, conventional molecular biology, plant biology, and recombinant DNA techniques within the skill of the art . Such techniques are well known to the skilled worker, and are explained fully in the literature . [0033 ] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art . See, e . g. , Sambrook, Fritsch and Maniatis , Molecular Cloning: A Laboratory Manual, 2^nd edition ( 1989) ; "DNA Cloning: A Practical Approach, " Volumes I , II & III (D . N . Glover, Ed. , 1985 ) ; "Oligonucleotide Synthesis" (M. J. Gait, Ed. , 1984 ) ; "Nucleic Acid Hybridization" (B . D . Hames & S . J. Higgins , eds . , 1985 ) ; "Transcription and Translation" (B . D . Hames & S . J. Higgins, eds . , 1984 ) ; B . Perbal, "A Practical Guide to Molecular Cloning" ( 1984 ) ; Current Protocols In Molecular Biology (Ausubel, et al . Eds . , ( 1987 ) ) ; the series Methods In Enzymology (Academic Press , Inc . ) ; PCR 2 : A Practical Approach (MacPherson, Hams and Taylor Eds . , (1995 ) ) ; Harlow and Lane, Eds, ( 1988 ) , Antibodies : A Laboratory Manual, and Methods In Molecular Biology Vol . 49, "Plant Gene Transfer And Expression Protocols, " Jones ( 1995 ) .

[0133] It is understood that the invention is not limited to the particular materials and methods described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and it is not intended to limit the scope of the present invention which will be limited only by the appended claims . It must be noted that as used herein and in the appended claims , the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise . Thus, for example, a reference to "a polynucleotide" includes a plurality of such polynucleotides , and a reference to "an enhancer element" is a reference to one or more enhancer elements . Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are now described.

[0134 ] One of the broadest aspects of the present invention contemplates the use of a transgene engineered so as to produce a transgenic monocotyledonous plant, which expresses an immunological molecule such as an antibody at high levels . Therefore, as used herein, the term "transgenic plant" is intended to refer to a plant that has incorporated therein a polynucleotide sequence coding for an immunoglobulin molecule of interest .

[0135 ] The terms "monocotyledonous plant" or "monocot plant" as used herein, includes , for example, any plant found in the a family selected from the group consisting of Acanthaceae; Agavaceae; Alliaceae; Alstroemeriaceae;

Amaryllidaceae; Araceae; Asparagaceae; Calochortaceae; Cannaceae; Commelinaceae; Dioscoreaceae; Gramineae; Hyacinthaceae; Irldaceae; Liliaceae; Melanthiaceae; Musaceae; Orchidaceae; and Zingiberaceae.

[ 0136] In some embodiments, the plant is either Aglaonema or Agrostis alba or Allium or Allium cepa or Allium cepa var . ascalonicum or Allium cepa var . cepa or Allium chinense or Allium fistulosum or Allium porrum or Allium sativum or Allium tuberosum or Allium vineale or Alocasia or Alstroemeria caryophylla or Alstroemeria psittacina or Amorphophallus or Amorphophallus konjac or Anthoxanthum odoratum or Arisaema or Arundinaria amabilis or Arundo donax or Asparagus officinalis or Avena byzantina or Avena fatua or Avena sativa or Avena strigosa or

Belamcanda chinensis or Brachiaria miliiformis or Bromus inermis or Bromus macrostachys or Bromus mollis or Bromus racemosus or Bromus secalinus or Bromus sterilis or Bromus tectorum or Caladium hortulanum or Calanthe or Canna or Chloris gayana Colocasia esculenta or Commelina or Commelina diffusa or Crinum or Crocus vernus or Cryptocoryne or Curcuma longa or Curcuma zedoaria or Cynodon dactylon or Cyrtosperma or Dendrobium or Dieffenbachia picta or Digitaria decumbens or Dioscorea alata or Dioscorea cayenensis or Dioscorea dumetorum or

Dioscorea praehensilis or Dioscorea preussii or Dioscorea rotundata or Elaeis guineensis or Elaeis oleifera or Echinochloa crus-galli or Elettaria cardamomum or Eleusine coracana or Elytrigia intermedia or Elytrigia repens or Eragrostis cilianensis or Eucharis grandiflora or Festuca pratensis or Freesia or Freesia refracta or Fritillaria pudica or Gladiolus or Hippeastrum equestre or Hippeastrum hybridum or Hordeum vulgare or iϊyacinthus orientalis or Imperata cylindrica or Jris or Iris danfordiae or Iris fulva or Iris brevicaulis or Iris hollandica or Jris reticulata or Iris sibirica or Iris tingitana or Iris xiphium or Iris xiphoides or Lachenalia or Lagarus ovatus or Lilium or Lilium formosanum or Lilium longiflorum or Lolium multiflorum or Lolium perenne or Lolium temulentum or Musa sapientum Musa acuminate or Musa balbisiana or Musa paradisiacal or Musa textiles or Narcissus or Nerine bowdenii or Nerine sarniensis or Oplismenus compositus or Ornithogalum thyrsoides or Oryza sativa or Panicum capillare or Panicum dichotomiflorum or Panicuzn maximum or Panicum miliaceum or Paspalum dilatatum or Paspalum orbiculare or Pennisetum americanum or Pennisetum typhoides or Phalaris arundinacea or Phalaris paradoxa or

Philodendron oxycardium or Philodendron selloum or Philodendron verrucosum or Phleum pratense or Phragmites australis or Poa annua or Poa pratensis or Poa trivialis or Polianthes tuberosa or Rottboellia exaltata or Saccharum officinarum or Sacciolepis indica or Secale cereale or Setaria italica or Setaria viridis or Sorghum almum or Sorghum bicolor or Sorghum or Sorghum halepense or Sorghum laxiflorum or Sorghum macrospermum or Sorghum miliaceum or Sorghum stipoideum or Sorghum sudanense or Sorghum verticilliflorum or Sorghum vulgare or Spathiphyllum or

Stenotaphrum secundatum or Tinantia erecta or Tradescantia albiflora or Tradescantia blossfeldiana or Tradescantia fluminensis or Tradescantia navicularis or Tradescantia spathacea or Tradescantia zebrina or Triticum aestivum or Triticum durum or Tulipa or Tulipa hybrids or Vallota speciosa or Vanilla fragrans or Vanilla pompona or Vanilla tahitensis or Xanthosoma caracu or Zantedeschia or Zantedeschia elliottiana or Zea mays or Zigadenus fremontii or Zingiber officinale or Zingiber zerumbet or Zinnia elegans .

[ 0137 ] Any of these plants may be used, because the techniques disclosed herein are directly applicable to any monocot plant . Therefore, although the present specification provides experimental evidence in respect of one species of monocotyledon plant and four immunoglobulin molecules , it will be clearly appreciated by a person skilled in the art that the transgenic plant of the invention may be any monocotyledonous plant and the immunoglobulin molecule may be any immunoglobulin molecule .

[0138 ] However, in some preferred embodiments, the monocotyledonous plant is selected from the group consisting of wheat, sorghum, rice, barley, maize, rye, triticale and oat . All of these "cereals" have sufficient characteristics in common that a person skilled in art would appreciate that the effects observed in one plant could be attributed to other plants in the cereal family.

[0139] The term "transgene" as used herein refers to any polynucleotide sequence, which codes for an immunoglobulin molecule, which is introduced into the genome of a monocotyledonous plant cell by experimental manipulations . The transgene will be a "heterologous DNA sequence" ( i . e . , "foreign DNA") , which has been ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature .

[0140] Thus, once an appropriate monocotyledonous host plant has been identified as discussed above, a transgene is constructed which comprises a polynucleotide which codes for an immunoglobulin molecule of interest or functionally active fragments thereof. The immunoglobulin molecule can be directed against any antigen known. However, preferred antigens include, but are not limited to, CD58 , VCAM, VLA4 , CD2 , LFA3, ELAM, LAM, CD25, CD4 , CD19, CD20 , CD23 , CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I , IL-8 , human T- cell receptor, CD3, CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45, neu oncogene product, MDR-I , TGFα, TGFα receptor, PDGF, and CD71.

[ 0141] The term "functionally active, " when used in reference to the antibody polynucleotides of the present invention, refers to the paradigm in which an alteration to a nucleotide sequence does not necessarily affect the sequences ability to code for a polypeptide capable of performing substantially the same function as the unaltered "parent" polypeptide . For example, a nucleotide sequence may be truncated, elongated, or mutated in such a way that the polypeptide coded by the nucleotide sequence differs from the "parent" sequence, but still codes for a polypeptide that is capable of functioning in a substantially similar way to the "parent" molecule .

Consequently, a functionally active derivative, analog, homolog or variant of the antibody polynucleotide of the present invention will have a nucleotide sequence which differs from the ^Λwild-type' nucleotide sequence, but the polypeptide coded for by the functionally active derivative, analog, homolog or variant is capable of displaying one or more known functional activities associated with the antibody. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous .

[0142] It will be appreciated by those skilled in the art that a functionally active derivative, analog, homolog or variant of the immunoglobulin molecule polynucleotide of the present invention can vary substantially outside regions of importance e . g. receptor binding sites; however, regions of high importance are likely to have degrees of sequence conversation and these need to be preserved. Accordingly, it is likely that mutations in these highly conserved regions will not generate functionally active derivatives, analogs, homologs or variants .

[0143] Sequences that are substantially similar can be identified in a Southern hybridisation experiment, for example under high, medium or low stringency conditions as defined for that particular system. Defining appropriate hybridisation conditions is within the skill of the art . See e . g. , Sambrook et al . supra . However, ordinarily, "stringent conditions" for hybridisation or annealing of nucleic acid molecules are those that

(1) employ low ionic strength and high temperature for washing, for example, 0.015M NaCl/0.0015M sodium citrate/0.1% sodium dodecyl sulphate (SDS) at 50⁰C, or

(2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 75OmM NaCl, 75mM sodium citrate at 42°C.

[0144] An example of medium stringency conditions for hybridisation is the use of 50% formamide, 5 X SSC (0.75M NaCl, 0.075M sodium citrate) , 5OmM sodium phosphate (pH 6.8 ) , 0.1% sodium pyrophosphate, 5 X Denhardt ' s solution, sonicated salmon sperm DNA (50μg/mL) , 0.1% SDS, and 10% dextran sulphate at 42°C, with washes at 42°C in 0.2 X SSC and 0.1% SDS .

[0145] By way of further example, and not intended as limiting, low stringency conditions include those described by Shilo and Weinberg in 1981 {PNAS. USA, 78 : 6789-6792 ) . When filters containing DNA are treated using these conditions they are usually pre-treated for 6h at 40⁰C in a solution containing 35% formamide, 5 X SSC, 5OmM Tris-HCl (pH 7.5 ) , 5mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500μg/ml denatured salmon sperm DNA. Hybridisation' s are carried out in the same solution with the following modifications : 0.02% PVP, 0.02% Ficoll, 0.2% BSA, lOOμg/ml salmon sperm DNA, 10% (wt/vol) dextran sulphate, and 5-20 X 10⁶ cpm ³²P-labeled probe is used. Filters are incubated in hybridisation mixture for 18-2Oh at 40⁰C , and then washed for 1.5h at 55°C in a solution containing 2 X SSC, 25mM Tris-HCl (pH 7.4 ) , 5mM EDTA, and 0.1% SDS . The wash solution is replaced with fresh solution and incubated an additional 1.5h at 6O⁰C . Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re-exposed to film. Other conditions of low stringency, which may be used, are well known in the art (e . g . , as employed for cross-species hybridisation' s) .

[ 0146] The antibody polynucleotides , functionally active derivatives , analogs or variants of the invention can be produced by various methods known in the art . For example, cloned antibody polynucleotides can be modified by any of numerous strategies known in the art (See, for example, Maniatis , T . , 1990 , Molecular Cloning, A Laboratory Manual, 2d ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, N . Y . ) . The sequence can be cleaved at appropriate sites with restriction endonuclease ( s ) , followed by further enzymatic modification if desired, isolated, and ligated in vitro.

[ 0147 ] Additionally, the antibody encoding polynucleotide sequences can be mutated in vitro or in vivo, to create or destroy functional regions or create variations in functional regions and/or form new restriction endonuclease sites or destroy pre-existing ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including, but not limited to, chemical mutagenesis, in vitro site-directed mutagenesis (Hutchinson et al . , ( 1978 ) , J. Biol . Chem. , 253 : 6551) .

[ 0148 ] Alternatively, polynucleotide variants of the antibody polynucleotides may result from degenerate codon substitutions or complementary sequences . Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed- base and/or deoxyinosine residues (Batzer et al . , (1991) , Nucleic Acid Res. , 19 : 5081 ; Ohtsuka et al . , ( 1985 ) , J. Biol . Chem . , 260 : 2605-2608 ; and Rossolini et al . , (1994 ) , MoI . Cell . Probes, 8 : 91-98 ) .

[ 0149] In one embodiment, the antibody polynucleotide is a double-stranded DNA molecule having at least 85% nucleotide sequence identity with SEQ ID NO 1. Once the appropriate transgene has been identified and either isolated or constructed, it is incorporated into an expression vector by standard techniques . Accordingly, the present invention also contemplates an expression vector comprising the transgene of the present invention. Thus, in one embodiment an expression vector is constructed which comprises an isolated and purified DNA molecule comprising a plant promoter operably linked to the coding region for the antibody, which coding region is operatively linked to a transcription-terminating region of plant origin, whereby the promoter drives the transcription of the coding region . The coding region may include a segment or sequence encoding the antibody. The DNA molecule comprising the expression vector may also contain a plant intron, and may also contain other plant elements such as sequences encoding untranslated sequences (UTL ¹ s ) and sequences which act as enhancers of transcription or translation. However, it is important that at least the promoter, signal peptide and the terminator are of plant origin. Indeed, in one preferred embodiment, the expression vector of the present invention consists essentially of a plant derived promoter (e . g. maize Ubi) , a plant derived intron (e . g . Actl ) a plant derived signal peptide (e . g. barley α-amylase) , antibody construct and a universal retention signal (e . g . his tag) .

[0150 ] As the expression vectors of the present invention are used to transform a monocotyledonous plant, a promoter is selected that has the ability to drive expression in that particular species of plant . Promoters that function in different plant species are well known in the art . Promoters useful in expressing the immunoglobulin molecules of the present invention in monocotyledonous plants can either be inducible or constitutive as described (Odell et al . , 1985 ) , and/or temporally regulated, spatially regulated, and spatio-temporally regulated. Preferred promoters include the light-inducible promoter from ssRUBISCO, the MAS promoter, the rice actin promoter, the maize ubiquitin promoter, the UBI 3 promoter, the PR-I promoter, the cZ19Bl promoter, the milps promoter, the CesA promoter, the Gama-zein promoter, the Glob-1 promoter, the maize 15 kDa zein promoter, the 22 kDa zein promoter, the 27 kDa zein promoter, the δ-zein promoter, the waxy promoter, the shrunken 1 promoter, the shrunken 2 promoter, the globulin 1 promoter, the pEMU promoter and the maize H3 histone promoter .

[0151] In addition, it may also be preferred to bring about expression of the antibody polynucleotide by using plant integrating vectors containing a tissue-specific promoter . Specific target tissues may include the leaf, stem, root, tuber, seed, fruit, etc . , and the promoter chosen should have the desired tissue and developmental specificity. Therefore, promoter function should be optimised by selecting a promoter with the desired tissue expression capabilities and approximate promoter strength, and selecting a transformant, which produces the desired level of resistance in the target tissues . This selection approach from the pool of transformants is routinely employed in expression of heterologous structural genes in plants since there is variation between transformants containing the same heterologous gene due to the site of gene insertion within the plant genome (commonly referred to as "position effect") . In addition to promoters which are known to cause transcription (constitutive or tissue- specific) of DNA in plant cells, other promoters may be identified for use in the current invention by screening a plant cDNA library for genes which are selectively or preferably expressed in the target tissues , then determining the promoter regions .

[0152 ] Other exemplary tissue-specific promoters are corn sucrose synthetase 1 (Yang et al . , 1990 , Proc. Natl . Acad. Sci . , USA, 87 : 4144-4148 ) , corn alcohol dehydrogenase 1 (Vogel et al . , ( 1989 ) , J. Cell Biochem. , (supplement 13D, 312 ) , corn light harvesting complex (Simpson et al . , ( 1986) , Science, 233 : 34-38 ) , corn heat shock protein (Odell et al . , 1985 ) , pea small subunit RuBP carboxylase ( Poulsen et al . , (1986) , MoI . Gen . Genet . , 205 : 193-200 ; Cushmore et al . , (1983 ) , Gen . Eng. of Plants, Plenum Press, New York, 29-38 ) , petunia chalcone isomerase (Van Tunen et al . , ( 1988 ) , EMBO J. , 7 : 1257 ) , bean glycine rich protein 1

(Keller et al . , ( 1989) , EMBO J. , 8 : 1309-1314 ) and Potato patatin (Wenzler et al . , 1989, Plant MoI . Biol . , 12 : 41-50 ) promoters .

[ 0153] The promoters used in the expression vectors of the present invention may be modified, if desired, to affect their control characteristics . For example, the maize ubiquitin promoter may be ligated to the portion of the ssRUBISCO gene that represses the expression of ssRUBISCO in the absence of light, to create a promoter which is active in leaves but not in roots . Furthermore, the promoters may be altered to contain multiple "enhancer sequences" to assist in elevating gene expression . Examples of such enhancer sequences have been reported by Kay et al . ( 1987 ) , supra .

[ 0154 ] A transgenic plant of the present invention produced from a plant cell transformed with a tissue specific promoter can be crossed with a second transgenic plant developed from a plant cell transformed with a different tissue specific promoter to produce a hybrid transgenic plant that shows the effects of transformation in more than one specific tissue .

[ 0155] The RNA produced by an expression vector of the present invention may also contain a 5 ' non-translated leader sequence ( 5 ' UTL) . This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA. However, the present invention is not limited to constructs wherein the non-translated region is derived from the 5 ' non-translated sequence that accompanies the promoter sequence . One plant gene leader sequence for use in the present invention is the petunia heat shock protein 70 (hsp70 ) leader (Winter et al . , 1988 , MoI . Gen . Genet . , 221 (2 ) : 315-319) .

[0156] 5 ' UTL ' s are capable of regulating gene expression when localised to the DNA sequence between the transcription initiation site and the start of the coding sequence . Compilations of leader sequences have been made to predict optimum or sub-optimum sequences and generate "consensus" and preferred leader sequences (Joshi, ( 1987 ) , Nucl . Acids Res. , 15 : 6643-6653 ) . Preferred leader sequences are contemplated to include those, which comprise sequences predicted to direct optimum expression of the linked structural gene, i . e . to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure . Sequences that are derived from genes that are highly expressed in plants , and in maize in particular, will be most preferred. One particularly useful leader may be the petunia HSP70 leader .

[ 0157 ] For optimised expression an intron may also be included in the DNA expression construct . Such an intron is typically placed near the 5 ' end of the mRNA in untranslated sequence . This intron could be obtained from, but not limited to, a set of introns consisting of the maize heat shock protein (HSP) 70 intron (U. S . Pat . No . 5 , 424 , 412 ; 1995) , the rice Actl intron (McElroy et al . , 1990, supra) , the Adh intron 1 (Callis et al . , ( 1987 ) , Genes and Development, 1 : 1183 ) , or the sucrose synthase intron (Vasil et al . , ( 1989) , Plant Physiol 91 : 1575-1579 ) .

[ 0158 ] The 3 ' non-translated region of the immunoglobulin molecule genes of the present invention which are localised to the plant nuclear genome also contain a polyadenylation signal which functions in plants to cause the addition of adenylate nucleotides to the 3 ' end of the mRNA. RNA polymerase transcribes a nuclear genome coding DNA sequence through a site where polyadenylation occurs . Typically, DNA sequences located a few hundred base pairs downstream of the polyadenylation site serve to terminate transcription. Those DNA sequences are referred to herein as transcription-termination regions . Those regions are required for efficient polyadenylation of transcribed mRNA. Examples of preferred 3 ' regions are t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator .

[ 0159] Transcription enhancers or duplications of enhancers could be used to increase expression . These enhancers often are found 5 ' to the start of transcription in a promoter that functions in eukaryotic cells, but are often inserted in the forward or reverse orientation 5 ' or 3 ' to the coding sequence . An example of an enhancer includes elements from the rice actin gene ( see, e . g . , Ma et al . , (1988 ) , Nature, 334 : 631-633) .

[ 0160 ] In some embodiments, the expression vector used to express the immunoglobulin molecules of the present invention includes a selection marker that is effective in a plant cell . In another embodiment, the genes coding for the antibody polynucleotide and/or selection marker are on two or more separate vectors . Selection markers can be drug resistance selection markers or metabolic selection markers . One preferred drug resistance marker is the gene whose expression results in kanamycin resistance; ie . the chimeric gene containing the nopaline synthase promoter, Tn5 neomycin phosphotransferase II (nptll ) and nopaline synthase 3 ' non-translated region described (Rogers & Bendich, 1988 , supra) .

[ 0161] Without wishing to be bound by any particular theory or hypothesis the inventors believe that previous methods of producing immunoglobulin molecules in plants and in particular cereals have produced very low yields because the expression vectors used were not appropriate . For example, in International Patent Application No . WO99/66026 ("the ' 026 application") , the patentees described the use of expression vectors to produce scFv in rice and wheat . The vectors used comprised a number of elements including a plant derived promoter, Chalcone synthase 5' UTR from Petunia, mouse "leader peptides" with an enhancer region isolated from a virus, endoplasmic reticulum retention signal and a bacterial terminator . The yields from these expression vectors were very low and not commercially viable . Inventors believe that the patentees of the ' 026 application were attempting to stabilise the scFv produced, which was essentially a mammalian product, by using elements that had proven in the past to be useful in the expression of biological molecules other than immunoglobulin . However, the inventors now believe that the presence of control sequences that are of a "non-plant" origin is detrimental to the production of high yields of immunoglobulin molecules in monocotyledonous plants .

[ 0162 ] A monocotyledonous plant transformed with an expression vector of the present invention is also contemplated. A transgenic plant derived from such a transformed or transgenic cell is also contemplated. Those skilled in the art will recognise that a chimeric plant gene containing a structural coding sequence of the present invention can be inserted into the genome of a plant by methods well known in the art . Such methods for DNA transformation of plant cells include Agrobacterium- mediated plant transformation, the use of liposomes, transformation using viruses or pollen, electroporation, protoplast transformation, gene transfer into pollen, inj ection into reproductive organs, inj ection into immature embryos and particle bombardment . Each of these methods has distinct advantages and disadvantages . Thus, one particular method of introducing genes into a particular plant strain may not necessarily be the most effective for another plant strain, but it is well known which methods are useful for a particular plant strain.

[ 0163] There are many methods for introducing transforming DNA segments into cells , but not all are suitable for delivering DNA to plant cells . Suitable methods are believed to include virtually any method by which DNA can be introduced into a cell, such as infection by A. tumefaciens and related Agrobacterium strains, direct delivery of DNA such as, for example, by PEG-mediated transformation of protoplasts (Omirulleh et al . , (1993) , Plant Molecular Biology, 21 : 415-428 ) , by desiccation/inhibition-mediated DNA uptake, by electroporation, by agitation with silicon carbide fibres, by acceleration of DNA coated particles, etc . In certain embodiments, acceleration methods are preferred and include, for example, microproj ectile bombardment and the like .

[ 0164 ] Technology for introduction of DNA into cells is well-known to those of skill in the art . Four general methods for delivering a gene into cells have been described: ( 1 ) chemical methods (Graham & van der Eb, ( 1973 ) , Virology, 54 (2 ) : 536-539) ; (2 ) physical methods such as microinj ection (Capecchi, ( 1980 ) , Cell, 22 (2 Pt 2 ) : 479- 88 ) , electroporation (Wong & Neumann, 1982 , Biochim . Biophys . Res . Commun . 107 (2 ) : 584-587 ; From et al . , 1985 , supra) and the gene gun (Johnston & Tang, (1994 ) , Methods Cell . Biol . , 43 (A) : 353-365 ; Fynan et al . , ( 1993 ) , PNAS. USA, 90 (24 ) : 11478-11482 ) ; ( 3 ) viral vectors (Clapp, ( 1993 ) , Clin . Perinatol . 20 ( 1 ) : 155-168 ; Lu et al . , ( 1993 ) , J. Exp. Med. , 178 ( 6) : 2089-2096; Eglitis & Anderson,

( 1988 ) (a) , Biotechniques, 6 ( 7 ) : 608-614 ; Eglitis et al . , 1988 (b) , Adv. Exp. Med. Biol . 241 : 19-27 ) ; and ( 4 ) receptor- mediated mechanisms (Curiel et al . , ( 1991) , PNAS. USA, 88 ( 19) : 8850-8854 ; Curiel et al . , ( 1992 ) , Hum. Gen . Ther. 3 (2 ) : 147-154 ; Wagner et al . , 1992 , PNAS. USA, 89 ( 13) : 6099- 6103 ) .

[ 0165] The application of brief, high-voltage electric pulses to a variety of animal and plant cells leads to the formation of nanometer-sized pores in the plasma membrane . DNA is taken directly into the cell cytoplasm either through these pores or as a consequence of the redistribution of membrane components that accompanies closure of the pores . Electroporation can be extremely efficient and can be used both for transient expression of cloned genes and for establishment of cell lines that carry integrated copies of the gene of interest . Electroporation, in contrast to calcium phosphate-mediated transfection and protoplast fusion, frequently gives rise to cell lines that carry one, or at most a few, integrated copies of the foreign DNA.

[0166] The introduction of DNA by means of electroporation is well-known to those of skill in the art . To effect transformation by electroporation, one may employ either friable tissues such as a suspension culture of cells , or embryogenic callus , or alternatively, one may transform immature embryos or other organised tissues directly. One would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases ) or mechanically wounding in a controlled manner, rendering the cells more susceptible to transformation. Such cells would then be recipient to DNA transfer by electroporation, which may be carried out at this stage, and transformed cells then identified by a suitable selection or screening protocol dependent on the nature of the newly incorporated DNA.

[0167 ] A further advantageous method for delivering transforming DNA segments to plant cells is microproj ectile bombardment . In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force . Exemplary particles include those comprised of tungsten, gold, platinum, and the like . Using these particles, DNA is carried through the cell wall and into the cytoplasm on the surface of small metal particles as described (Klein et al . , ( 1987 ) , supra; Klein et al . _f

( 1988 ) , PNAS. , USA, 85 : 8502-8505 ; Kawata et al . , ( 1988 ) ) . The metal particles penetrate through several layers of cells and thus allow the transformation of cells within tissue explants .

[0168 ] An advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly stably transforming plant cells , is that neither the isolation of protoplasts (Cristou et al . _r (1988 ) , Plant Physiol, 87 : 671-674) nor the susceptibility to Agrobacterium infection is required. An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with the plant cultured cells in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates . It is believed that a screen intervening between the proj ectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient cells by proj ectiles that are too large .

[0169] For the bombardment, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microproj ectile stopping plate . If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein one may obtain up to 1000 or more foci of cells transiently expressing a marker gene . The number of cells in a focus which express the exogenous gene product 48 hours post-bombardment often range from 1 to 10 and average 1 to 3.

[0170 ] In bombardment transformation, one may optimise the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants . Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microproj ectile precipitate or those that affect the flight and velocity of either the macro- or microproj ectiles . Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearised DNA or intact supercoiled plasmids . It is believed that pre-bombardment manipulations are especially important for successful transformation of immature plant embryos .

[ 0171] Accordingly, it is contemplated that one may desire to adj ust various bombardment parameters in small scale studies to fully optimise the conditions . One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure . One may also minimise the trauma reduction factors (TRFs ) by modifying conditions which influence the physiological state of the recipient cells and which may therefore influence transformation and integration efficiencies . For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation . The execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure .

[ 0172] The methods of particle-mediated transformation is well-known to those of skill in the art . U . S . Pat . No . 5, 015 , 580 ( specifically incorporated herein by reference) describes the transformation of soybeans using such a technique .

[ 0173] Agrobacteriurn-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast . The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art . See, for example, the methods described ( Fraley et al . , ( 1985 ) , Biotechnology, 3 : 629 ; Rogers & Bendich, 1988 , supra) . The genetic engineering of cotton plants using Agrojbacteriura-mediated transfer is described in U . S . Pat . No . 5, 004 , 863 ( specifically incorporated herein by reference) ; like transformation of lettuce plants is described in U . S . Pat . No . 5, 349, 124 (specifically incorporated herein by reference) ; and the Agrobacterium-medi&ted transformation of soybean is described in U . S . Pat . No . 5, 416, 011 ( specifically incorporated herein by reference) . Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements . The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome as described (Spielmann et al . , ( 1988 ) , Nucleic Acids Res. , 16 : 1199 ;

Jorgensen et al . , ( 1987 ) , MoI . Gen . Genet . , 207 : 471-477 ) .

[ 0174 ] Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al . , 1985, supra) . Moreover, recent technological advances in vectors for Λgrojbacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various polypeptide coding genes . The vectors described (Rogers & Bendich, 1988 , Plant MoI Biol . A6 : 1- 10) , have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes . In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations . In those plant varieties where Agrobacterium-med±ated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer .

[0175] Agrobacterium-med±&ted transformation of leaf disks and other tissues such as cotyledons and hypocotyls appears to be limited to plants that Agrobacterium naturally infects . Agrobacterium-med±ated transformation is most efficient in dicotyledonous plants . Few monocots appear to be natural hosts for Agrobacterium, although transgenic plants have been produced in asparagus using Agrobacterium vectors as described (Bytebier et al . , (1987 ) , PNAS. , USA, 84 : 5345-5349) . Other monocots recently have also been transformed with Agrobacterium. Included in this group are corn (Ishida et al . , ( 1996) , Nature

Biotechnology, 14 ( 6) : 745-50 ) and rice (Cheng et al . , ( 1998 ) , Applied Biological Sciences, 95 : 6, 2767-2772 ) .

[0176] A transgenic plant formed using Agrobacterium transformation methods typically contains a single gene on one chromosome . Such transgenic plants can be referred to as being heterozygous for the added gene . However, inasmuch as use of the word "heterozygous" usually implies the presence of a complementary gene at the same locus of the second chromosome of a pair of chromosomes , and there is no such gene in a plant containing one added gene as here, it is believed that a more accurate name for such a plant is an independent segregant ("hemizygous") , because the added, exogenous gene segregates independently during mitosis and meiosis .

[ 0177 ] An independent segregant may be preferred when the plant is commercialised as a hybrid, such as corn. In this case, an independent segregant containing the gene is crossed with another plant, to form a hybrid plant that is heterozygous for the gene of interest . [ 0178 ] An alternate preference is for a transgenic plant that is homozygous for the added antibody polynucleotide; i . e . a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair . A homozygous transgenic plant can be obtained by sexually mating ( selfing) an independent segregant transgenic plant that contains a single added gene, germinating some of the seed produced and analysing the resulting plants produced for gene of interest activity and Mendelian inheritance indicating homozygosity relative to a control (native, non-transgenic) or an independent segregant transgenic plant .

[ 0179] Two different transgenic plants can be mated to produce offspring that contain two independently segregating added, exogenous genes . Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes that encode a polypeptide of interest . Back-crossing to a parental plant and out- crossing with a non-transgenic plant are also contemplated.

[ 0180 ] Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments ( see e . g . , Potrykus et al . , ( 1985 ) , Plant Molecular Biology Reporter, 3 : 117-128 ; Lorz et al . , ( 1985) , MoI . Gen . Genet. , 199 : 178 ; Fromm et al . , ( 1985 ) , supra; Uchimiya et al . , ( 1986) , MoI . Gen . Genet . 204 : 204-207 ; Callis et al . , ( 1987 ) , supra; Marcotte et al . , ( 1988 ) , Nature, 335 : 454 ) .

[ 0181] Application of these systems to different plant germplasm depends upon the ability to regenerate that particular plant variety from protoplasts . Illustrative methods for the regeneration of cereals from protoplasts are described (see, e . g . , Fuj imura et al . , ( 1985 ) , Plant Tissue Culture Letters, 2 : 74 ; Toriyama et al . , ( 1987 ) , Plant ScL , 48 : 123-128 ; Yamada et al . , 1986, Plant Cell Rep . , 4 : 85 ; Abdullah et al . , 1986, Bio/Technology, 4 : 1087- 1090) .

[ 0182 ] To transform plant germplasm that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilised. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, 1988 , supra) .

[ 0183] DNA can also be introduced into plants by direct DNA transfer into pollen as described ( Zhou et al . , 1983 , Methods in Enzymology, 101 : 433; Hess, (1987 ) , Intern Rev. Cytol . , 107 : 367 ) . Expression of polypeptide coding genes can be obtained by inj ection of the DNA into reproductive organs of a plant as described (Pena et al . , 1987 ) . DNA can also be inj ected directly into the cells of immature embryos and introduced into cells by rehydration of desiccated embryos as described (Neuhaus et al . , ( 1987 ) , Theor. Appl . Genet . , 75 : 30 ; Benbrook et al . , (1986) , In: Proceedings Bio Expo 1986, Butterworth, Stoneham, Mass . , pp . 27-54. ) .

[0184] After effecting delivery of the antibody polynucleotides to recipient monocot cells, the next step to obtain the transgenic plants of the present invention generally concerns identifying the transformed cells for further culturing and plant regeneration . As mentioned herein, in order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene as , or in addition to, the antibody polynucleotide . In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents , or one would screen the cells for the desired marker gene trait . [0185] An exemplary embodiment of methods for identifying transformed cells involves exposing the transformed cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, herbicide or the like . Cells that have been transformed and have stably integrated a marker gene conferring resistance to the selective agent used, will grow and divide in culture . Sensitive cells will not be amenable to further culturing. One example of a preferred marker gene confers resistance to glyphosate . When this gene is used as a selectable marker, the putatively transformed cell culture is treated with glyphosate . Upon treatment, transgenic cells will be available for further culturing while sensitive, or non- transformed cells, will not . This method is described in detail in U . S . Pat . No . 5, 569, 834 , which is specifically incorporated herein by reference . Another example of a preferred selectable marker system is the neomycin phosphotransferase (nptll ) resistance system by which resistance to the antibiotic kanamycin is conferred, as described in U . S . Pat . No . 5 , 569, 834 ( specifically incorporated herein by reference) . Again, after transformation with this system, transformed cells will be available for further culturing upon treatment with kanamycin, while non-transformed cells will not . Yet another preferred selectable marker system involves the use of a gene construct conferring resistance to paromomycin . Use of this type of a selectable marker system is described in U. S . Pat . No . 5, 424, 412 (specifically incorporated herein by reference) .

[0186] It is further contemplated that combinations of screenable and selectable markers will be useful for identification of transformed cells . In some cell or tissue types a selection agent, such as glyphosate or kanamycin, may either not provide enough killing activity to clearly recognise transformed cells or may cause substantial nonselective inhibition of transformants and non-transformants alike, thus causing the selection technique to not be effective . It is proposed that selection with a growth inhibiting compound, such as glyphosate at concentrations below those that cause 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as a gene that codes for kanamycin resistance would allow one to recover transformants from cell or tissue types that are not amenable to selection alone . It is proposed that combinations of selection and screening may enable one to identify transformants in a wider variety of cell and tissue types .

[ 0187 ] The development or regeneration of plants from either single plant protoplasts or various explants is well known in the art (Weissbach & Weissbach, 1988 , In: Methods for Plant Molecular Biology, Academic Press, Inc . , San Diego, Calif . ) . This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualised cells through the usual stages of embryonic development through the rooted plantlet stage . Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil .

[ 0188 ] The development or regeneration of plants containing the foreign, exogenous gene that encodes a polypeptide of interest introduced by Agrobacterium from leaf explants can be achieved by methods well known in the art such as described (Horsch et al . , 1985 , supra) . In this procedure, transformants are cultured in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant strain being transformed as described ( Fraley et al . , 1983 , supra) . In particular, U . S . Pat . No . 5, 349, 124 ( specification incorporated herein by reference) details the creation of genetically transformed lettuce cells and plants resulting therefrom which express hybrid crystal proteins conferring insecticidal activity against Lepidopteran larvae to such plants .

[ 0189] This procedure typically produces shoots within two to four months and those shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth . Shoots that rooted in the presence of the selective agent to form plantlets are then transplanted to soil or other media to allow the production of roots . These procedures vary depending upon the particular plant strain employed, such variations being well known in the art .

[ 0190] Preferably, the regenerated plants are self- pollinated to provide homozygous transgenic plants , or pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines . These lines can be either inbred or out bred lines . Conversely, pollen from plants of those important lines is used to pollinate regenerated plants . A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art .

[0191] In one embodiment, a transgenic plant of this invention thus has an increased amount of genes for antibody inRNA. A preferred transgenic plant is an independent segregant and can transmit these genes and their activities to its progeny. A more preferred transgenic plant is homozygous for the antibody polynucleotide, and transmits these to its entire offspring on sexual mating. Seed from a transgenic plant may be grown in the field or greenhouse, and resulting sexually mature transgenic plants are self-pollinated to generate true breeding plants . The progeny from these plants become true breeding lines that are evaluated for expression of the antibody transgene .

[ 0192 ] It is contemplated that in some instances the genome of a transgenic plant will have been augmented through the stable introduction of one or more antibody transgenes, either native, synthetically modified, or mutated. In some instances , more than one transgene will be incorporated into the genome of the transformed host plant cell . Such is the case when more than one antibody-encoding DNA segments are incorporated into the genome of such a plant . In certain situations , it may be desirable to have one, two, three, four, or even more antibody genes (either native or recombinantly-engineered) incorporated and stably expressed in the transformed transgenic plant .

[ 0193] Once plants carrying the expression vectors of the present invention have been produced, it is possible to harvest the plants and isolate the expressed immunoglobulin molecules .

[0194 ] The presence of immunoglobulin molecule produced by the plants and/or seeds of the present invention can be assayed by known techniques such as ELISA. A person skilled in the art would appreciate how to undertake an ELISA. However, briefly, a 96-well flat bottom plate (Dynatech) is coated with goat anti-human IgG at 200ng/well in coating buffer ( sodium carbonate 0.8mg/ml, sodium bicarbonate 1.55mg/ml, pH 9.6) . After incubation at least 16 hr at 4°C, the coating buffer is removed. The wells are then blocked with 120μl of blocking buffer ( 1% bovine serum albumin in phosphate buffered saline ( PBS) containing 0.2% sodium azide) . After incubation at 37°C for 1 hr, about 125μl of plant or seed extract is added to the wells and incubated 2 hrs at 37°C . The plate is then washed five times with PBS . Then lOOμl of horseradish peroxidase-labeled goat anti- human IgG diluted 1 : 1000-1 : 5000 in dilution buffer ( 1% bovine serum albumin, 0.05% Tween-20 , 0.02% sodium azide in PBS) is added. The plate is then incubated at 37°C for 1 hr then washed five times with PBS . Plant immunoglobulin molecule is detected with lOOμl of hydrogen peroxide and the substrate, 3, 3 ' , 5, 5 ' -tetramethylbenzidine (1 : 1 v/v) per well . The colour reaction is terminated after 2 to 5 min . with lOOμl of 2M sulphuric acid per well .

[0195] Once isolated the immunoglobulin molecules of the present invention may be used in any methodologies for which antibodies are typically used. Examples of methods using antibodies and/or immunoglobulin molecules include, but are not limited to, fluorescent antibody technique, ELISA, radioimmunoassay (RIA) , immunohistochemical staining such as immunological tissue staining or immunological cell staining (ABC technique, CSA technique, etc . ) , Western blotting, immunoprecipitation, enzyme immunosorbent assay, and sandwich ELISA (Monoclonal Antibody Experiment Manual, Kodansha Scientific (1987 ) ; (2nd Series) Biochemistry Experiment Course No . 5 : Methods for Immuno-Biochemical Researches , Tokyo Kagaku Doj in, Co . ( 1986) ) .

[0196] Fluorescent antibody technique is a technique in which a sample such as separated cells or liquid containing disrupted cells , separated tissue or liquid containing disrupted tissue, cell culture supernatant, serum, pleural effusion, abdominal dropsy or ocular fluid is reacted with the immunoglobulin molecule of the present invention and then reacted with an anti-immunoglobulin antibody or a binding fragment thereof labelled with a fluorescent substance such as fluorescein isothiocyanate (FITC) , followed by measurement of the fluorescent with a flow cytometer .

[0197 ] ELISA is a technique in which a sample such as separated cells or liquid containing disrupted cells, separated tissue or liquid containing disrupted tissue, cell culture supernatant, serum, pleural effusion, abdominal dropsy or ocular fluid is reacted with the immunoglobulin molecule of the present invention and then reacted with an anti-immunoglobulin antibody or a binding fragment thereof labelled with an enzyme such as peroxidase or biotin, followed by measurement of the developed colour with an absorptiometer .

[0198 ] Radioimmunoassay (RIA) is a technique in which a sample such as separated cells or liquid containing disrupted cells , separated tissue or liquid containing disrupted tissue, cell culture supernatant, serum, pleural effusion, abdominal dropsy or ocular fluid is reacted with the immunoglobulin molecule of the present invention and then reacted with a radioactively labelled anti- immunoglobulin antibody or binding fragment thereof, followed by measurement of the radioactivity with a scintillation counter, etc .

[0199] Immunological cell staining or immunological tissue staining is a technique in which a sample such as separated cells or liquid containing disrupted cells , separated tissue or liquid containing disrupted tissue, cell culture supernatant, serum, pleural effusion, abdominal dropsy or ocular fluid is reacted with the immunoglobulin molecule of the present invention and then reacted with an anti-immunoglobulin antibody or a binding fragment thereof labelled with a fluorescent substance such as fluorescein isothiocyanate ( FITC) or an enzyme such as peroxidase or biotin, followed by microscopic observation .

[ 0200 ] In one embodiment of the present invention, the immunoglobulin molecules are used in the treatment of disease . Treatment of disease with antibodies is known as passive immunotherapy. This is distinguished from active immunotherapy, where vaccination stimulates the body ' s own antibody response . The efficacy of passive immunotherapy has been demonstrated in treatment of a number of infectious diseases , in both animals and humans . A maj or impediment to the commercialisation of many types of passive immunotherapy is the need for repetitive delivery of large amounts of antibody to the site of the disease to overcome rapid clearing of the antibodies from the body.

The production of antibodies by traditional methods is much too expensive to be practical for many types of passive immunotherapy. This is why production in plants is such an attractive alternative .

[ 0201] Generally, the terms "treating, " "treatment" and the like are used herein to mean affecting an individual or animal, their tissue or cells to obtain a desired pharmacological and/or physiological effect . The effect may be prophylactic in terms of completely or partially preventing a disease or disorder or sign or symptom thereof, and/or may be therapeutic in terms of a partial or complete cure of a disease or disorder . "Treating" as used herein covers any treatment of, or prevention of an disease or disorder in a vertebrate, a mammal, particularly a human, and includes : (a) preventing the disease or disorder from occurring in an animal that may be predisposed to the disease or disorder, but has not yet been diagnosed as having it; (b) inhibiting the disease or disorder, i . e . , arresting its development; or (c) relieving or ameliorating the symptoms of the disease or disorder, i . e . , cause regression of the symptoms of the disease or disorder .

[ 0202] In one embodiment, the treatment uses an immunoglobulin molecule of the present invention that specifically reacts with the products of CD58 , VCAM, VLA4 , CD2 , LFA3, ELAM, LAM, CD25, CD4 , CD19, CD20 , CD23 , CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I, IL-8 , human T- cell receptor, CD3, CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45, neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71. [ 0203 ] Once an individual afflicted with a disease or disorder has been diagnosed and a potentially useful immunoglobulin molecule of the present invention been produced an "effective amount" of the immunoglobulin molecule is administered to the animal .

[ 0204 ] The terms "administration, " administering, " and "administered" are used herein interchangeably. The immunoglobulin molecule may be administered orally including sublingual, topically, or parenterally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, and vehicles .

[ 0205] In clinical settings, the therapeutic or prophylactic immunoglobulin molecule of the present invention can be introduced into an animal by any of a number of methods, each of which is familiar in the art . For instance, an immunoglobulin molecule can be introduced systemically, e . g . by intravenous inj ection .

[ 0206] Toxicity and therapeutic efficacy of the immunoglobulin molecules of the present invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e . g . , for determining the Ld50 (The Dose Lethal To 50% Of The Population) And the Ed50 (the dose therapeutically effective in 50% of the population) . The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Immunoglobulin molecules which exhibit large therapeutic induces are preferred. While immunoglobulin molecules that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such immunoglobulin molecules to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects . [0207 ] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans . The dosage of such immunoglobulin molecules lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any immunoglobulin molecules used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays . A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i . e . , the concentration of the test immunoglobulin molecule which achieves a half-maximal inhibition of symptoms) as determined in cell culture . Such information can be used to more accurately determine useful doses in humans . Levels in plasma may be measured, for example, by high performance liquid chromatography.

[ 0208 ] By "comprising" is meant including, but not limited to, whatever follows the word comprising" . Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present . By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of" . Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present . By "consisting essentially of" is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements . Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements .

[ 0209] The invention will now be further described by way of reference only to the following non-limiting examples . It should be understood, however, that the examples following are illustrative only, and should not be taken in any way as a restriction on the generality of the invention described above . In particular, while the invention is described in detail in relation to the use of three antibodies in wheat, it will be clearly understood that the findings herein are not limited to these antibodies or wheat .

EXAMPLE 1 ISOLATION OF THE ANTI-CD4 , ANTI-CD28 AND ANTI-HSV SCFV GENES

[0210] Anti rat CD4 (0X38 ) scFv (SEQ ID NO. : 1) , anti rat CD28 (JJ319) scFv, and anti-HSV (VII60) scFv, were provided by Dr Helen Brereton (Department of Ophthalmology, Flinders Medical Central , Flinders University, South Australia) in plasmid pHB400. The full length of the nucleotide sequence of anti-CD4 scFv gene is 759 base pairs (bp) excluding the stop codon and Flag Tag . It includes the variable light chain domain (V_L) (324bp) at the 5' end and the variable heavy chain domain (V_H) ( 375bp) at the 3' end linked by (Gly₄Ser) ₄. Similarly, the nucleotide sequence of anti- CD28 scFv is 777bp in length excluding the stop codon and Flag Tag and is composed of V_L (339bp) followed by the (Gly₄Ser) ₄ linker and the V_H (378bp) at the 3' end. The anti-HSV antibody construct (75βbp) is structured in the same way with a V_L size of 324bp and a V_H size of 372bp . In addition, a 6 x His tag sequence was fused at the 3' end of all three constructs .

[0211] The primer design for amplification of anti-CD4 , anti-CD28 and anti-HSV scFv genes was based on conserved sequences which appear in all 5' and 3' ends, so that one pair of primers was required for amplification of all three scFv constructs . For the upper strand primer, a 72bp barley α-amylase signal peptide was added in front of the scFv construct primer sequence spanning bases 1 to 18 , plus a Kpn I restriction site as adapter at the 5 ' end. The barley α-amylase signal peptide (SP) sequence was based on the sequence of HVAMY152 clone ( from 706 to 777bp) with the accession number of X15226 in Genbank and published by Rahmatullah et al ( 1989) . The complete upper strand primer is 96bp in length :

5' ggtaccatggcgaacaaacatttgtccctctccctcttcctcgtcctccttggcctg tcggccagcttggcctccggggactacaaagacattgtg 3' SEQ ID NO . : 2

[ 0212 ] The lower strand primer ( 43bp) spans the 6x His tag region with a KDEL ER- retention signal peptide at the 3' end and a Kpn I restriction site :

5' ggtaccttatagctcatctttatgatggtgatgatggtgatcg 3' SEQ ID NO . : 3

[0213] The PCR reactions consisted of 4mM MgCl₂, 1 X PCR Buffer II , ImM dNTPs , lOpmol upper and lower strand primers , 2ng plasmids as template, 1.25 U Taq DNA Polymerase and sterilized distilled water to a final volume of 50μl . The PCR cycling run consisted of an initial denaturation period of 3min at 94⁰C followed by 35 cycles of 94⁰C lmin, 58°C lmin, and 72°C 2min, followed by a final extension cycle of 72°C for 7min .

[ 0214 ] PCR products were analysed on 1% agarose gel, and compared with a lkb plus standard DNA molecular marker . The expected sizes of the modified anti-CD4 , anti-CD28 and anti-HSV scFv genes are 885bp, 903bp and 882bp, respectively. Amplified products were purified from agarose gel using SuperClean™ DNA kit (Geneworks) in accordance with the manufacturer' s instructions . The band of interest was excised from the gel, 3 gel volumes of Bresa-Salt™ was added and the mixture incubated at 56°C for 5min to dissolve the agarose . 5-7 μl Bresa-Bind™ silica matrix was added, the solution mixed thoroughly and the tube incubated at room temperature for 5min to bind DNA. The Bresa-Bind™/DNA matrix was pelleted by centrifugation at 20 , 800 g for 17sec, the supernatant discarded and the pellet washed by resuspending the matrix in an equal volume of Bresa-Wash™ solution . The tube was then centrifuged for 17sec, the supernatant discarded and all traces of wash removed by evaporation in a Speedivac. The DNA was eluted from the Bresa-Bind matrix by resuspending the pellet in 2 volumes distilled water and incubating the solution in a water bath for 5min at 56°C . The tube was centrifuged at 20 , 800 g for lmin and the supernatant, containing the purified DNA, was transferred to a new tube .

[ 0215] The core coding DNAs were amplified from the original plasmids and purified for transferring into GBA constructs .

EXAMPLE 2 CLONING OF THE ANTI-CD4 , ANTI-CD28 AND HSV

SCFV GENES INTO pGEMT VECTOR, AND CONFIRMATION OF SEQUENCE

[ 0216] The gel purified PCR products were ligated into pGEMT-vector in accordance with the manufacturer' s instructions, followed by transformation of the ligation product into E. coli competent cells (DHlOB strain) with white/blue screening induced by IPTG and X-gal . Six white colonies were picked from the plate and grown in LB broth with ampicillin at lOOmg/1 over night . The plasmids were purified from the resultant bacterial culture with QIAGEN™ mini spin columns and then screened by digestion with Kpn I .

[0217 ] To confirm the integrity of the isolated gene sequences, sequencing was carried out using the automated sequencer ABI377 (Applied Biosystems Industries) in accordance with the manufacturer' s instructions . Sequencing was performed with the T7 ( 5¹ CTATGACCATGATTACGCCAAGC) and Sp6 (5 ^f CTATGACCATGATTACGCCAAGC) primers from both directions . The SeqEd™ version 1.0.3 software (Applied Biosystems Industries ) was used to analyse raw sequence data and the GCG-programs (Wisconsin Package Version 8.1- unix Genetics Computer Group, Madison WI ) were used for sequence comparison.

[0218 ] Those colonies selected and tested were confirmed to have correct sequence . The integrity of DNA sequence confirmed in order to proceed with cloning into the plant transformation vector .

EXAMPLE 3 CLONING OF SCFV GENES INTO PGBA2cah PLANT

TRANSFORMATION VECTOR

[0219] The pGBA2 vector consists of a cassette with maize ubiquitin promoter (plus intron) , multiple cloning site (MCS) and zein terminator (from maize) , with pUC118 as backbone . The sequence confirmed scFv genes were digested with Kpn I from pGEMT vector and were ligated into the MCS of pGBA2 vector, followed by transformation of the ligation products into E. coli competent cells (DHlOB strain) . Ten colonies were picked from each of the plates of pGBA2CD4 , pGBA2CD28 , pGBA2HSVI , and grown in LB broth with ampicillin at lOOmg/1 over night . The plasmids were purified from bacterial culture with QIAGEN™ mini spin columns, and screened by digestion with Kpn I to identify positive colonies . The orientations of the inserts were confirmed by Bam HI digestions . Sense orientation of CD4 scFv in pGBA2 cut by Bam HI will present the fragment sizes as : 5788bp, 268bp and 209bp; the sense orientation of CD28 in pGBA2 cut Bam HI will give two fragments with the sizes 5790bp and 492bp and pGBA2HSV also give two fragments with the sizes 5790bp and 512bp ( Figure 5 ) .

[ 0220] Plant transformation vectors with desired sequences were confirmed. Figures 1 to 4 show schematics of four expression vectors of the present invention: pGBA2CD4 , pGBA2CD28 , pGBA2HSV and pGBAcah.

EXAMPLE 4 PRODUCTION OF TRANSGENIC WHEAT PLANTS WITH PGBA2CD4 , pGBA2CD28 and pGBA2HSV CONSTRUCTS

[0221] In order to delete the ampicillin resistance gene and other contaminating bacterial DNA from the backbone of the plasmids, only the core DNA coding cassette (promoter- scFv gene-SP-KDEL-HisTag-terminator) was selected as preferable for transformation into wheat . After plasmid digestion by Hae II , pGBA2CD4 yielded five fragments with sizes of 3548bp, 2194bp, 370bp, 145bp and 8bp . Based on the plasmid sequence information, the 3548bp band is from the linear core coding cassette with 165bp extra in front of the promoter and 253bp additional sequence down stream of the zein terminator . Unfortunately, no suitable restriction enzyme was available for pGBA2CD28 , therefore, the whole plasmid was used for wheat transformation.

[0222 ] Populations of transgenic wheat plants, containing the CD4 core cassette, pGBA2CD28 plasmid construct and anti-HSV core cassette were generated using the following procedures .

Selectable marker DNA preparation

[0223] A linear cyanamide hydratase cassette (which detoxifies the selection agent cyanamide) was prepared from a pCAM plasmid (Weeks et al . , (2000) , Crop Science, 40 : 1749-1754 ) . The plasmid was prepared and digested the same as with the antibody constructs above, except that digestion with Hae II produces a fragment of 3.4kb (Ubi promoter-cah gene-zein terminator) for purification .

[ 0224 ] Alternatively the linear cassette of neomycin phosphotransferase, which detoxifies the selection agent kanamycin, was prepared and digested the same as with the antibody constructs above, except that digestion with Pvu I produces a fragment of 3175bp (Ubi promoter-Npt II gene- zein terminator) for purification .

Target tissues

[ 0225] Wheat plants (cultivar: Westonia) were grown to head at 22-24°C in a glasshouse . Seeds containing immature embryos were harvested at 11-15 days post-anthesis and surface sterilised. Immature embryos were excised and placed on MS Murashige and Skoog agar medium ( 1962 ) containing 2.5 mg/1 2 , 4 dichlorophenoxyacetic acid (2 , 4-D) for seven to sixteen days prior to bombardment .

Microprojectile Bombardment

[0226] Osmoticum treatment of 120 immature embryos as target tissues, DNA precipitation and microproj ectile bombardment was performed as described for sugarcane (Bower et al . , supra) with the exception of the use of tungsten particles . Wheat embryos were bombarded with 150μg of gold particles per bombardment . The selectable marker used was the core linear vector from pGBA2nptII or pCAM. Equimolecular concentrations of the linear core pCAM selectable marker cassette were combined with the linear core cassettes of anti-CD4 , anti-HSV or plasmid of pGBA2CD28.

Selection of cyanamide resistant plants

[0227] Following bombardment the embryos were placed on MS medium containing 2.5mg/l 2 , 4-D for two weeks at 24°C in the dark and transferred to the same medium plus 40mg/l cyanamide (Sigma) for a further two weeks under the same culture conditions . They were then cultured in this same way once again for two weeks . After this they were cultured on the same medium, except with a reduction of 2, 4-D concentration to 0.5mg/l for a further two weeks . Then they were transferred to regeneration medium in which the 2 , 4-D was eliminated and cyanamide concentration elevated to 55mg/l .

[ 0228 ] Subsequently any regenerative tissues were transferred to the same medium containing 65mg/l of cyanamide in tubes to produce roots and then established in soil in pots in the glasshouse .

Selection of kanamycin resistant plants

[0229] Following bombardment the embryos were placed on MS medium containing 2.5mg/l 2 , 4-D for two weeks at 24°C in the dark and transferred to the same medium plus 150mg/l kanamycin sulphate (Sigma) for a further two weeks under the same culture conditions . They were then cultured in this same way once again for two weeks . After this they were cultured on the same medium, except with the omission of 2 , 4-D for a further two weeks . Subsequently any regenerative tissues were transferred to the same medium in tubes still containing 150mg/l of kanamycin to produce roots and then established in soil in pots in the glasshouse.

[ 0230 ] In total 8930 , 13197 and 8015 embryos were bombarded with anti-CD4, anti CD28 and anti-HSV genes , respectively. They yielded 53, 49 and 36 regenerants respectively. EXAMPLE 5 TRANSGENIC ANALYSIS OF YOUNG PLANTS BASED ON

PCR

DNA extraction from wheat leaves

[ 0231 ] This method was adapted from that described by Dellaporta et . al . , ( 1983 ) , Plant Molecular Biology, Reporter 1 : 19-21. Leaves were harvested fresh from the plant to obtain 3cm of leaf tip . Leaves were quickly frozen in liquid nitrogen and then crushed to a powder . The powder was transferred to a 1.5ml microfuge tube and 500μl of extraction buffer added ( 50OmM NaCl, 10OmM Tris- HCl pH8.0 , 5OmM EDTA and 0.6% 2-mercaptoethanol) . Then lOμl of 20% SDS was added to the tube which was incubated at 65⁰C with occasional shaking for lOmin. After incubation, 50μl of 5M potassium acetate was added with shaking and the tube placed on ice for 20min . Following centrifugation at 14 , 000 rpm for 20min the supernatant was transferred to a clean 1.5ml microfuge tube containing lOOμl isopropanol . The tube was then incubated at -20°C for lhr before centrifugation at 20 , 800 g for 20min . The supernatant was removed and the tube drained for a few minutes before resuspending the pellet in 700μl of TE ( 1OmM Tris-HCl pH8.0, 1OmM EDTA) . This was transferred to a microfuge tube containing 7μl of ribonuclease enzyme

( 10mg/ml) and incubated at 37°C for lhr . 75μl of 3M sodium acetate (pH5.3 ) was added and the sample centrifuged at 20 , 800 g for 15min . The supernatant was transferred to a new Eppendorf tube and the DNA precipitated with 500μl of isopropanol at room temperature . After 5min, the DNA was pelleted by centrifugation at 20, 800 g for 15min and the supernatant discarded. The pellet was washed with cold 70% ethanol, the pellet dried in a Speedvac™ and then resuspended in 20 μl TE . PCR reaction

[0232] The PCR conditions were the same as those described in Example 1 , except lμl of genomic DNA was used as the template . The PCR products (anti-CD4 , anti-CD28 anti-HSV scFvs) amplified from a single transgenic To plant were re-ligated into pGEMT vector and sequenced as described in Example 2. No mutation was detected in the scFv region of anti-CD4 , anti-CD28 based on the sequencing of six CD4 and four CD28 PCR positive plants . Figure 6 shows PCR products for scFv genes (CD4 , CD28 and HSV) amplified with primers 5' CD/3' CD from transgenic To wheat plants . The lane marked M is a lkb plus DNA molecular marker, while lane 1 is H₂O negative control . Lane 2 is a non-transgenic negative control, while lanes 3 and 6 show positive PCR for transgenic plants containing CD28 and CD4 , respectively. Lanes 13, 13 and 16 show positive PCR for transgenic plants containing HSV. Lane 20 is PCR positive control (from transgenic HSV line) , while lanes 4 , 5, 8 to 12 , 14 and 17 to 19 show PCR negative results .

[0233] Sixteen, 13 and 10 plants of the anti-CD4 , anti- CD28 and anti-HSV bombarded plants respectively, tested positive for integration of the relevant antibody gene . Indications from the plants from which the gene was sequenced are that the transforming DNA integrated into the plants had maintained the sequence integrity of the antibody genes through the process .

[0234 ] Seeds from one of the plant lines were deposited at the National Collections of Industrial Food and Marine Bacteria, Aberdeen, Scotland, under Accession No . NCIMB 41363 on December 20^th 2005. EXAMPLE 6 TOTAL SOLUBLE PROTEIN EXTRACTED FROM WHEAT LEAF OR SEEDS

[ 0235 ] Ten wheat seeds from a transgenic plant were weighed and then ground to a fine power with a mortar and pestle pre-cooled with liquid nitrogen . ImI of protein extraction buffer ( 5OmM Tris-HCl, pH7.8 , ImM EDTA, 5% W/V polyvinylpolypyrollidone ( PVPP) , and ImM Phenylmethansulfonyl Fluoride ( PMSF) ) was added and the tissue ground again . After centrifugation of the extract

( 30 , 000 x g, 4°C, 20min) , the supernatant was stored on ice ready for down stream analysis (Western blot and Flow Cytometry) . Soluble protein concentration was determined using the Bradford assay (Bio-Rad) according with the manufacturer' s instructions . Sodium azide was added as preservative at 2OmM.

[ 0236] Crude extracts containing soluble protein were produced.

EXAMPLE 7 WESTERN BLOTTING

[ 0237 ] Plant extracts (containing 50μg soluble protein) were analysed in 16% polyacrylami.de gels . Following SDS- PAGE, the protein was transferred to nitrocellulose membrane using the transblot (Bio-Rad) apparatus at 100V for 1 hour at 4°C . The membrane was blocked with 1% BSA in 1 X PBS containing 0.5% Tween-20 for 1 hour at room temperature . After 3 X 15 minutes wash in PBST, the membrane was incubated in anti-His-tag antibody

(CloneTech) , which was conjugated with rabbit anti-sheep horseradish peroxidase (HRP) , solution ( 1 : 10, 000 dilution in 1% BSA/PBST) for lhr at room temperature . After another 3 X 15min washes in PBST, the membrane was then treated with ECL western blotting reagents (Amersham Biosciences ) and exposed to film in accordance with the manufacturer' s instructions (Figure 7 ) . [ 0238 ] Antibody production in wheat plants was confirmed by Western blot . Variability in antibody expression levels was evident between transformants .

EXAMPLE 8 ASSAY OF WHEAT PRODUCED ANTIBODY BINDING ACTIVITY

Measurements of antibody activity against T-cell receptor sites by flow cytometry

[ 0239] Crude extract from transgenic wheat seed was prepared as in Example 6 and antibody activity was measured by flow cytometry in Flinders University using the following protocol :

Isolation of rat thymocytes

[ 0240] Thymus was collected from rat, placed in 20ml of room temperature RPMI (Roswell Park Memorial Institute) media . Seven ml of thymus solution were placed on the medium in 10cm Petri dish operated in a tissue culture hood. Cells were scraped from thymus using 18 G needle mounted on a 5ml syringe and forceps with transferred into a 25ml centrifuge tube . Three ml extra medium were added to the dish to recover as many cells as possible; then let cell suspension settle (residual lumps will fall to the bottom) . After that the cells were pipetted into a fresh centrifuge tube . 5 ml of cell suspension were placed into two flat bottomed 30 ml tubes . Subsequently, 20ml ^Λrat lymphoprep' under cells were pipetted into these two tubes using a 20ml syringe and a mixing cannula . After centrifuged for 20min ( 60Og at 4°C) , the cloudy layer of cells at the medium/lymphoprep interface was collected by using a glass pasteur pipette and put into fresh centrifuge tube . Then washed the cells with 20ml ice-cold PBS/azide, followed by Centrifuge at for lOmin ( 35Og, 4°C) (Meanwhile 50μl samples (protein/scFv extracts ) were set in FACS tubes ) . The cell wash ( supernatant) was poured off and the cell pellet was resuspended in 10ml ice-cold PBS/azide followed by centrifugation of cells for 5min ( 35Og, 4°C) . After pouring off the suspernatant, the cells were resuspended in ice-cold PBS/azide to desired final concentration (usually 2 x 10⁷ cells/ml, can use 1 x 10⁷ if cells are scarce) .

Labelling of rat thymocytes - carry out on ice

[ 0241 ] 50μl of cells ( 1 x 10⁶ cells) were added to each FACS tube containing 50μl of protein/scFv with a brief vortex . Then the FACS tubes were incubated on ice for 30min . After a 3ml PBS/azide wash, the tubes were centrifuged for 5min ( 350g_f 4°C) . After removed the supernatant, 50μl of 1/250 dilution of mouse anti-polyHIS monoclonal Ab (Sigma clone HIS-I ) , 50μl of 1/100 dilution of goat anti-mouse Ig Biotin or 50μl of 1/100 dilution of SAPE ( strepavidin-phycoerythrin, Molecular Probes ) were added into separate FACS tubes which were then incubated in the dark (wrap in foil) for 30min on ice . Finally, 50μl of ^λ FACS-Fix' were added to cells and mixed with a brief vortex then the tubes were covered with foil and stored at 4°C .

[ 0242 ] The instrument ( FACScan (Beckton-Dickinson) ) was set up and operated according to the manufacturer' s instructions .

Measurements of antibody activity against T-cell receptor sites

[ 0243 ] Using crude extract, as antibody source, the traces shown in Figures 8 and 9 show the fluorescence intensity profiles of the anti-CD4 and anti-CD28 transformed wheat grains respectively. It can be seen that several wheat lines match the profile of the commercially sourced purified antibody in that even as crude extract they show an identical saturation profile . Thus it is indicated that they bind to the same population of thymocyte receptor sites that the commercially prepared standard does . The mean fluorescence values are presented in Tables 1 and 2.

TABLE 1

ANTI-CD4 SEED EXTRACTS - MEAN FLUORESCENCE INDEX VALUES

Sample number Transgenic line MFI (all) I MFI (all) II

1 2940.1 58 54

2 2957.1 62 60

3 2957.2 4 4

4 3102.2 94 77

5 3102.3 50 58

6 3106.1 3 3

22 2940.1.2 235 254

23 2940.1.4 252 208

24 2940.1.6 240 236

25 2940.1.12 237 231

26 2940.1.14 266 268

27 2940.1.23 215 250

28 2940.1.25 260 258

30 Westonia 3 4

Buffer SAL5 2

Parent mAb 0X38 183

Purified scFv CSL 36/2 1/1000 206 198

(Cell type - rat thymocytes )

TABLE 2

ANTI-CD28 SEED EXTRACTS - MEAN VALUES

(Cell type - rat thymocytes )

Quantification of antibody activity from grain

[ 0244 ] On another occasion, wheat extracts from anti-CD4 and anti-CD28 lines were similarly tested on thymocytes through a series of dilutions and quantified by their mean fluorescence index (MFI ) using flow cytometry. The dilutions and MFI results are presented in Table 3, and can be quantified using the dilutions of the commercially produced concentrated antibody presented in Figure 10. The top yielding line of 2940.1.25.28. at 1/256 dilution read an average mean of 22 MFI which equates to 0.276μg/ml of purified antibody. Undiluted extract will contain 71μg/ml of purified scFv equivalent in 10.2mg. This equates to 0.7% of total soluble protein .

TABLE 3

TITRATION OF ANTI-CD4 SEED EXTRACTS, PARENT MAB AND

PURIFIED SCFV

Target cells - Rat thymocytes

[ 0245] As 0.55g of seed were extracted, the equivalent of Ig would yield 129μg of active antibody. This equates to lkg of seed yielding 129mg of antibody.

[ 0246] In summary, the antibodies produced from wheat grain are shown to be active against the intended target T- cell receptor sites measured against standardised pure preparations . Using these standards wheat is shown to produce active antibody at the equivalent of 0.7% of total soluble protein or 129μg/g of seed ( 129mg/kg) .

EXAMPLE 9 COMPARISON OF BACTERIAL AND WHEAT CRUDE EXTRACTS FOR ANTI-CD4 BINDING ACTIVITY

The anti-CD4 activity of crude wheat extract from line

2940.1.25.13 was compared with that of a crude extract of a bacterial lysate prepared by standard procedures . Both were measured against the activity of a purified anti-CD4 antibody preparation . The methods followed for assay of activity were the same as in Example 8. The dilutions and MFI results from flow cytometry are presented in Table 4 , and can be quantified against dilutions of the concentrated, purified antibody presented in Figure 11. The crude wheat extract preparation presents a concentration of activity equivalent to approximately 76μg/ml of scFv purified extract, whereas the bacterial lysate presents a concentration of activity equivalent to approximately 44μg/ml of scFv purified extract . This demonstrates a favourable comparison between the production and extraction of antibody from wheat seeds against a standard preparative step with bacteria already employed routinely for the harvest of antibodies . TABLE 4

TITRATION OF SEED EXTRACT AND BACTERIAL LYSATE WITH

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS :

1. A plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

2. A plant expression vector according to claim 1 , wherein the immunoglobulin molecule comprises a heavy chain.

3. A plant expression vector according to claim 1, wherein the immunoglobulin molecule comprises a light chain .

4. A plant expression vector according to claim 1, wherein the immunoglobulin molecule comprises both a heavy and a light chain .

5. A plant expression vector according to claim 1, wherein the immunoglobulin molecule comprises a single- chain variable fragment (scFv) .

6. A plant expression vector according to any one of claims 1 to 5, wherein the promoter is selected from the group consisting of light-inducible promoter from ssRUBISCO, MAS promoter, rice actin promoter, maize ubiquitin promoter, UBI 3 promoter, PR-I promoter, cZ19Bl promoter, milps promoter, CesA promoter, Gama-zein promoter, Glob-1, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2 , globulin 1 , pEMU promoter and maize H3 histone promoter .

7. A plant expression vector according to any one of claims 1 to 5, wherein the promoter is maize ubiquitin promoter .

8. A plant expression vector according to any one of claims 1 to 7 , wherein the terminator is selected from the ^" group consisting of t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator .

9. A plant expression vector according to any one of claims 1 to 7 , wherein the terminator is the zein gene terminator .

10. An expression vector according to claim 1 , wherein said vector is selected from the group consisting of GBA2CD4 , GBA2CD28 , GBA2CDHSV and GBA2cah .

11. An expression vector according to any one of claims 1 to 10 , wherein the immunoglobulin molecule binds specifically to antigens selected from the group consisting of CD58 , VCAM, VLA4 , CD2 , LFA3 , ELAM, LAM, CD25, CD4 , CDl9 , CD20 , CD23, CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I, IL-8 , human T-cell receptor, CD3 , CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45 , neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71.

12. A plant cell comprising at least one plant expression vector according to any one of claims 1 to 11.

13. A plant comprising at least one plant expression vector according to any one of claims 1 to 11.

14. A stably transformed plant which has been transformed by a plant expression vector according to any one of claims 1 to 11.

15. Progeny, including but not limited to seeds, of a stably transformed plant according to claim 14.

16. A plant cell comprising a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin.

17. A plant or plant cell according to any one of claims 12 to 15, wherein the plant is a member of a family selected from the group consisting of Agavaceae; Alliaceae; Alstroemeriaceae; Amaryllidaceae; Araceae; Asparagaceae; Calochortaceae; Cannaceae; Commelinaceae; Dioscoreaceae; Gramineae; Hyacinthaceae; Iridaceae; Llliaceae; Melanthiaceae; Musaceae; Orchidaceae and Zingiberaceae.

18. A plant or plant cell according to any one of claims 12 to 15 , wherein the plant is from the family Gramineae.

19. A plant or plant cell according to any one of claims 12 to 15, wherein the plant is selected from the group consisting of wheat, sorghum, rice, barley, maize, rye, triticale and oat .

20. A plant or plant cell according to claim 19, wherein the plant is wheat .

21. A plant or plant cell according to any one of claims 12 to 19, wherein the plant expression vector is integrated into the nuclear genome of the plant cell .

22. A plant or plant cell according to any one of claims 12 to 21, wherein the immunoglobulin molecule is a two-chain or multi-chain complex which comprises a plurality of polypeptides and is selected from the group consisting of Fv, Fab, F (ab) 2, diabody, dimeric scFv, whole antibody and four-chain secretory antibody.

23. A plant or plant cell according to claim 22 , wherein each polypeptide is said plurality of polypeptides is expressed from a separate expression vector within the plant or plant cell .

24. A suspension culture or callus culture comprising a plant cell according to any one of claims 16 to 23.

25. A plant seed transformed with a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin .

26. A transgenic plant, plant material, seeds or progeny thereof, comprising a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin, wherein the expression of said expression vector results in a transgenic plant, plant material, seeds or progeny thereof produces an immunoglobulin molecule .

27. A plant, plant cell or seed according to any one of claims 16 to 26, wherein the amount of immunoglobulin molecule produced in said plant, plant cell or seed is greater than about 50 mg of expressed immunoglobulin molecule per kilogram of plant, plant cell or seed.

28. A method for introducing DNA encoding immunoglobulin genes into a monocotyledonous plant, said method comprising: i) . introducing into a plant cell a plant expression vector adsorbed on to a microproj ectile, said plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin.

29. A method according to claim 28 , wherein the immunoglobulin molecule comprises a heavy chain.

30. A method according to claim 28 , wherein the immunoglobulin molecule comprises a light chain.

31. A method according to claim 28 , wherein the immunoglobulin molecule comprises both a heavy chain and a light chain .

32. A method according to claim 28 , wherein the immunoglobulin molecule comprises a single-chain variable fragment ( scFv) .

33. A method according to claim 29 , wherein the immunoglobulin molecule comprises a heavy chain constant region fused to an operative ligand.

34. A method according to any one of claims 28 to 33, wherein the promoter is selected from the group consisting of light-inducible promoter from ssRUBISCO, MAS promoter, rice actin promoter, maize ubiquitin promoter, UBI 3 promoter, PR-I promoter, CZ19B1 promoter, milps promoter, CesA promoter, Gama-zein promoter, Glob-1, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2 , globulin 1, pEMU promoter and maize H3 histone promoter .

35. A method according to any one of claims 28 to 33, wherein the promoter is maize ubiquitin promoter .

36. A method according to any one of claims 28 to 35 , wherein the terminator is selected from the group consisting of t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator .

37. A method according to any one of claims 28 to 35, wherein the terminator is the zein gene terminator .

38. A method according to claim 28 , wherein said vector is selected from the group consisting of GBA2CD4 , GBA2CD28 , GBA2CDHSV and GBA2cah.

39. A method according to any one of claims 28 to 38 , wherein the immunoglobulin molecule binds specifically to antigens selected from the group consisting of CD58 , VCAM, VLA4 , CD2 , LFA3, ELAM, LAM, CD25 , CD4 , CD19, CD20, CD23 , CD41 , CD44 , CD54 , TNFcc, TNFβ, Tn antigen, IL-I, IL-8 , human T-cell receptor, CD3, CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45, neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71.

40. A method according to any one of claims 28 to 39, wherein the amount of immunoglobulin molecule produced in said plant, plant cell or seed is greater than about 50 mg of the immunoglobulin molecule from a kilogram of plant, plant cell or seed.

41. A method for producing an immunoglobulin molecule in a monocotyledonous plant, comprising the step: i) introducing into a plant cell an expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin.

42. A method according to claim 41, wherein the expression vector is integrated into the host cell genome .

43. A method according to claim 41, wherein the expression vector is extrachromosomal .

44. A method according to any one of claims 41 to 43, wherein the immunoglobulin molecule comprises a heavy chain.

45. A method according to any one of claims 41 to 43, wherein the immunoglobulin molecule comprises a light chain .

46. A method according to any one of claims 41 to 43, wherein the immunoglobulin molecule comprises both a heavy and a light chain.

47. A method according to any one of claims 39 to 41, wherein the immunoglobulin molecule comprises a single- chain variable fragment ( scFv) .

48. A method according to any one of claims 41 to 47 , wherein the promoter is selected from the group consisting of light-inducible promoter from ssRUBISCO, MAS promoter, rice actin promoter, maize ubiquitin promoter, UBI 3 promoter, PR-I promoter, cZ19Bl promoter, milps promoter, CesA promoter, Gama-zein promoter, Glob-1, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2 , globulin 1, pEMU promoter and maize H3 histone promoter .

49. A method according to any one of claims 41 to 47 , wherein the promoter is maize ubiquitin promoter .

50. A method according to any one of claims 41 to 49, wherein the terminator is selected from the group consisting of t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator .

51. A method according to any one of claims 41 to 49, wherein the terminator is the zein gene terminator .

52. An expression vector according to claim 41, wherein said vector is selected from the group consisting of GBA2CD4 , GBA2CD28 , GBA2CDHSV and GBA2cah.

53. A method according to any one of claims 41 to 52, wherein the immunoglobulin molecule binds specifically to antigens selected from the group consisting of CD58 , VCAM, VLA4 , CD2, LFA3, ELAM, LAM, CD25, CD4 , CDl9, CD20, CD23, CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I, IL-8, human T-cell receptor, CD3, CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45, neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71.

54. A plant produced a method according to any one of claims 41 to 53.

55. A plant cell isolated from a plant produced by a method according to any one of claims 41 to 53.

56. Progeny, including but not limited to seeds, of a plant according to claim 54.

57. A method according to any one of claims 41 to 53 , wherein the monocotyledonous plant is a member of a family selected from the group consisting of Agavaceae; Alliaceae/ Alstroemeriaceae; Amaryllidaceae; Araceae; Asparagaceae; Calochortaceae; Cannaceae; Commelinaceae; Dioscoreaceae; Gramineae; Hyacinthaceae; Iridaceae; Liliaceae;

Melanthiaceae; Musaceae; Orchidaceae and Zingiberaceae.

58. A method according to any one of claims 41 to 53, wherein the monocotyledonous plant is from the family Gramineae.

59. A method according to any one of claims 41 to 53, wherein the monocotyledonous plant is selected from the group consisting of wheat, sorghum, rice, barley, maize, rye, triticale and oat .

60. A method according to any one of claims 41 to 59, wherein the amount of immunoglobulin molecule produced in said plant, plant cell or seed is greater than about 50 mg of the immunoglobulin molecule from a kilogram of plant, plant cell or seed.

61. A method for expressing an immunoglobulin molecule in a monocotyledonous plant, comprising: i) transforming plant tissue with an expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin, wherein said an expression vector is capable of expressing antibody in cells and/or intercellular spaces of the plant tissue; and ii ) incubating the plant tissue under conditions suitable for expressing the immunoglobulin molecule .

62. A method for expressing an immunoglobulin molecule in a monocotyledonous plant, comprising : i) transforming plant tissue with a plant expression vector comprising an expression cassette comprising a first polynucleotide sequence coding for an immunoglobulin molecule, a promoter capable of promoting expression of said first polynucleotide sequence and a second polynucleotide sequence coding for a terminator, wherein said promoter and second polynucleotide sequence are both of plant origin, wherein said an expression vector is capable of expressing an immunoglobulin molecule in cells and/or intercellular spaces of the plant tissue; ii ) incubating the plant tissue under conditions suitable for expressing the immunoglobulin molecule; and iii) isolating greater than about 50 mg of the immunoglobulin molecule from a kilogram of treated plant tissue .

63. A method according to claim 61 or claim 62 , wherein the immunoglobulin molecule is isolated from the plant tissue .

64. A method according to any one of claims 61 to 63 , wherein the expression vector is introduced into the plant tissue by a technique selected from the group consisting of transfection, microinj ection, biolistics, electroporation and lipofection .

65. A method according to any one of claims 61 to 63, in which the immunoglobulin molecule is collected by grinding whole plants, seeds or leaves .

66. A method according to any one of claims 61 to 65, wherein the immunoglobulin molecule comprises a heavy chain .

67. A method according to any one of claims 61 to 65, wherein the immunoglobulin molecule comprises a light chain .

68. A method according to any one of claims 61 to 65 , wherein the immunoglobulin molecule comprises both a heavy and a light chain .

69. A method according to any one of claims 61 to 65 , wherein the immunoglobulin molecule comprises a single- chain variable fragment ( scFv) .

70. A method according to any one of claims 61 to 69, wherein the promoter is selected from the group consisting of light-inducible promoter from ssRUBISCO, MAS promoter, rice actin promoter, maize ubiquitin promoter, UBI 3 promoter, PR-I promoter, cZ19Bl promoter, milps promoter, CesA promoter, Gama-zein promoter, Glob-1, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, δ-zein, waxy, shrunken 1, shrunken 2, globulin 1, pEMU promoter and maize H3 histone promoter .

71. A method according to any one of claims 61 to 69 , wherein the promoter is maize ubiquitin promoter .

72. A method according to any one of claims 61 to 71, wherein the terminator is selected from the group consisting of t3 ' Bt2 terminator, zein gene terminator, rbcs-lA gene terminator, pin II terminator and rbcs-3A gene terminator .

73. A method according to any one of claims 61 to 71, wherein the terminator is the zein gene terminator.

74. An expression vector according to claim 61, wherein said vector is selected from the group consisting of GBA2CD4 , GBA2CD28 , GBA2CDHSV and GBA2cah .

75. A method according to any one of claims 61 to 74 , wherein the immunoglobulin molecule binds specifically to antigens selected from the group consisting of CD58 , VCAM, VLA4 , CD2 , LFA3 , ELAM, LAM, CD25 , CD4 , CD19, CD20 , CD23 , CD41, CD44 , CD54 , TNFα, TNFβ, Tn antigen, IL-I, IL-8 , human T-cell receptor, CD3, CD28 , CD8 , CDlIa, CDlIb, CD18 , CD5a, CDlIc, CD45, neu oncogene product, MDR-I, TGFα, TGFα receptor, PDGF, and CD71.

76. A plant produced a method according to any one of claims 58 to 75.

77. A plant cell isolated from a plant produced by a method according to any one of claims 61 to 75.

78. Progeny, including but not limited to seeds , of a plant according to claim 76.

79. A method according to any one of claims 61 to 78 , wherein the monocotyledonous plant is a member of a family selected from the group consisting of Agavaceae; Alliaceae; Alstroemeriaceae; Amaryllidaceae; Araceae; Asparagaceae; Calochortaceae; Cannaceae; Commelinaceae; Dioscoreaceae; Gramineae; Hyacinthaceae; Iridaceae; Lilϊaceae; Melanthiaceae; Musaceae; Orchidaceae and Zingiberaceae.

80. A method according to any one of claims 61 to 78 , wherein the monocotyledonous plant is from the family Gramineae .

81. A method according to any one of claims 61 to 78, wherein the monocotyledonous plant is selected from the group consisting of wheat, sorghum, rice, barley, maize, rye, triticale and oat .

82. A method according to any one of claims 61 to 78 , wherein the monocotyledonous plant is wheat .

83. A method according to any one of claims 61 to 82 , wherein the amount of immunoglobulin molecule produced in said plant, plant cell or seed is greater than about 50 mg of the immunoglobulin molecule from a kilogram of plant, plant cell or seed.

84. An immunotherapeutic composition comprising a plant, a plant cell or seed according to any one of claims 12 to 27 , 54 to 56, 76 to 78 or an extract from said plant, plant cell or seed.

85 An immunotherapeutic composition according to claim 84 , wherein the plant cell is present in a plant tissue selected from the group consisting of a fruit, leaf, tuber, plant organ, seed protoplast, and callus .

86. A method of treating a disease or disorder in a subj ect in need of such treatment comprising the step of administering a plant, a plant cell or seed according to any one of claims 12 to 27 , 54 to 56, 76 to 78 or an extract from said plant, plant cell or seed.

87. A method according to claim 86, wherein the plant, plant cell, seed or plant extract is administered intramuscularly, orally, intradermally, intraperitoneally, subcutaneously, and intranasally .

88. A method according to claim 86, wherein the administration comprises consuming the plant, plant cell, seed or plant extract .