WO2006032087A1 - Infection resistant plants and methods for their generation - Google Patents

Abstract

The invention relates generally to virus resistant plants, wherein the plants are resistant to aphid transmitted viruses. In particular, the invention relates to a method for protecting a plant from aphid-borne viral infection, comprising the step of introducing a nucleic acid molecule into a plant, which nucleic acid molecule codes for an aphid transmission factor.

Description

INFECTION RESISTANT PLANTS AND METHODS FOR THEIR GENERATION

This application is based on and claims the benefit of the filing date of Australian provisional patent application 2004905414 filed 21^st September 2004.

FIELD OF THE INVENTION

The invention relates generally to virus resistant plants, wherein the plants are resistant to aphid transmitted viruses. In particular, the invention relates to the expression of the coding region for aphid transmission factor, wherein the plant becomes resistant to aphid-borne viruses. In one embodiment, the coding region for aphid transmission factor is modified such that untranslatable mRNA is produuced in a plant.

The invention further relates to methods of inducing resistance to aphid-borne viruses, and plants that are transformed with an aphid transmission factor gene.

BACKGROUND OF THE INVENTION

One of the most significant problems associated with agriculture is viral-induced crop damage. Plant viruses are capable of infecting many of the agriculturally important crops, and the damage caused by these infections result in significant losses in crop yield each year. These crop losses reduce the economic value of these crops to the grower, and these losses are eventually passed on to the consumer as higher prices.

Many of the most damaging plant viruses are transmitted to host plants by insects such as plant hoppers eg leaf hoppers and tree hoppers, thrips, beetles, fleas, flies, bugs like the sugarcane lace bug, avocado lace bug, and M. O -_

mealy bug and aphids. However, of all the insect pests none is more problematic than the aphids. There are about 4,000 species of aphids in the world, of which about 250 are serious pests. Twenty-five percent of all plant species are infested with aphids, and though it is believed that the speciation of aphids has followed that of plants not all groups of plants are equally parasitised. The Compositae, the 3rd most specious plant family, supports the most aphid species (605 species), but the Orchidacea, the 2nd most specious plant family, only support 9 species of aphids. Rosaceae, which is only the 22nd most specious plant family, supports the 3rd highest number of aphid species (293 species) . The plant family which supports the 2nd highest number of aphids is Coniferae (363 species) , but these are non-flowering plants.

Aphids have a world-wide distribution but there are far more species in temperate zones. Aphids are part of the Superfamily Aphidoidae, which is divided up into 10 families. Two families, the Aphididae and the

Drepanosiphidae make up 70% of the species. Members of the Superfamily Aphidoidea include Pemphigidae, Anoeciidae, HormAphididae, Mindaridae, Thelaxidae, Drepanosiphidae, Phloeomyzidae, Greenideidae, Aphididae and Lachnidae.

Perhaps the most important aphid pest is Myzus persicae the peach-potato aphid. M. persicae is a green or slightly reddish aphid which has peach as its primary host and a wide range of secondary hosts including many brassicas. M. persicae is cosmopolitan in temperate climates occurring in USA and a fair portion of Europe including the UK. Though it seldom occurs in numbers large enough to cause direct damage from feeding pressure it is capable of transmitting over 100 viruses, including the potato leaf roll and Y viruses of potatoes, mosaic, yellow net and yellows viruses of sugar-beet, cauliflower mosaic plum pox, cucumber mosaic, lettuce mosaic, and turnip mosaic. The black bean aphid Aphis fabae is another major pest which can if unchecked cause losses of up to 46% on broad bean crops. The pea aphid Acyrthosiphum pisum, is a large green aphid with long antennae and legs. The pea aphid is found on many leguminous plants and transmits lucerne mosaic virus, pea leaf roll virus, pea enation mosaic virus, pea mosaic virus and pea enation mosaic virus. Cabbage aphid Bzevicoryne brassicae is a serious pest of the major cabbage crops, cabbages, cauliflowers and brussel sprouts, like the pea aphid, the cabbage aphid is a one host species spending all its life on Brassicas.

Grain aphid Sitobion avenae, carrot aphid Cavariella aegopodli, groundnut aphid Aphis craccivora a polyphagus species that prefers legumes, cotton aphid Aphis gossypii a polyphagus species found in warmer regions, black citrus aphid Toxoptera aurantii a polyphagus in warmer regions, willow aphid Cavariella spp. on willows, holarctic willow leaf aphids Chaitophorus spp. on willows and poplars in Europe, black pine aphids Cinara spp. on a variety of conifers widespread in America, Africa, Asia and Europe, Sycamore Aphid Drepanosiphum platanoides on sycamore only in Europe and North America, spruce aphids Elatobium spp. on Picea in North America and Europe.

The mechanism by which aphids firstly, carry different types of viruses, and secondly transmit these viruses to host plants is poorly understood. However, what is known is that virus is usually transmitted mechanically by aphid mouthparts in a non-persistent, non-circulative, stylet borne manner. Aphids can obtain the virus after only brief contact with an infected host and usually retain the virus for less than an hour, though a few viruses can survive up to 40 hours. Because of the brief retention of the virus, aphids can normally only carry it for relatively short distances. However, with strong winds the virus can be spread great distances from other infected hosts. One speculation of how aphids retain the virus is that during feeding the virus adheres to the sucking pump and foregut. In subsequent feedings sap from the foregut is regurgitated, carrying the virus to a new host.

Transmission of the virus by aphids is dependent on a 53-58 kDa helper component protein, HC-Pro. HC-Pro functions as a dimer and is translated from an area located near the 5' end of RNA. HC-Pro aids in the binding of virus to the maxillary stylets. It also acts as a proteinase and is speculated to assist in cell to cell movement.

Aphid transmissibility and specificity are also dependent upon the coat protein.

Another factor involved in aphid transmission of plant viruses is the aphid transmission factor or protein. Lung and Pirone {Phytopathology 63, 912-914, 1973; Virology 60, 260- 264, 1974) demonstrated that aphid transmission is regulated by an aphid transmission factor (ATF) . In the cauliflower mosaic virus (CaMV) , the ATF is presumed to interact with both virus particles and vector mouthparts, thereby mediating virus aphid transmission (Schmidt et al., 1994, Proc Natl Acad Sci U S A. 13: 91 (19) : 8885-9) . To date there has been no demonstration that the ATF has a role to play within the plant.

After the aphid deposits the virus on the host, it enters the cell and the coat protein is removed. A replicase is then assembled and the virus is copied many times. Some of these copies remain as uncoated RNA molecules and move into adjacent cells to promote further infection. Primary infection then occurs when other copies are coated with the protein and ascend into the upper regions of the plant without causing serious harm to the plant. These virus particles remain in the upper regions throughout the vegetative cycle of the plant.

Past attempts at controlling or preventing aphid-borne viral infection of plants have concentrated upon either cultivating resistant plant lines that exhibit genetic resistance to virus infection, or controlling the aphids per se. However, while these methods have partially succeeded in reducing the incidence of viral infection, there have been a number of major environmental and agricultural impacts. In particular the indiscriminate use of insecticides has resulted in the death of many species of insects' not just aphids, with some of these insects being beneficial species. Moreover, there has been an increase in significant health risks to humans that are allergic to agricultural chemicals.

With the advent of molecular techniques, a number of approaches for combating plant viruses have been developed. The obvious advantage of such approaches is that the use of expensive and indiscriminate insecticides is reduced. However, there is a further advantage in that the means of providing the protection is incorporated into the plant itself, thereby becoming an inheritable trait which is passed on to its progeny.

The inventors have now developed a molecular-based method for protecting plants from aphid-borne virus, which alleviates or obviates the use of insecticides.

SUMMARY OF THE INVENTION

Accordingly, in its most general aspect, the invention disclosed herein provides a method for protecting plants from aphid-borne viral infection. The method utilises a nucleic acid molecule, which codes for an aphid transmission factor, wherein the aphid transmission factor provides protection against aphid-borne viral infection.

In a first aspect, the present invention provides a method for protecting a plant from aphid-borne viral infection, comprising the step of introducing a nucleic acid molecule into a plant, which nucleic acid molecule codes for an aphid transmission factor.

Preferably, the aphid transmission factor is an untranslatable nucleic acid molecule, wherein the nucleic acid molecule is transcribed but not translated.

The nucleic acid molecule may be cDNA, RNA, or a hybrid molecule thereof. Preferably the nucleic acid molecule is a cDNA molecule encoding an aphid transmission factor, wherein said cDNA molecule is substantially that shown in Figure 2 (SEQ ID NO:2) or biologically active fragment thereof. More preferably, the cDNA molecule has been modified so that it is transcribed but not translated within a plant cell. Most preferably, the cDNA molecule is substantially that shown in Figure 1 (SEQ ID NO:1) or biologically active fragment thereof.

The nucleic acid molecule may integrate into the host cell genome, or may exist as an extrachromosomal element.

In a further embodiment, the nucleic acid molecule is additionally modified so that a truncated mRNA is produced upon expression so that the inability to produce functional protein is enhanced.

The aphid transmission factor nucleic acid molecule may be isolated from any aphid-borne viral species. Preferably, the virus is a virus selected from the viral family group consisitng of Luteoviridae, Bromoviridae, Comoviridae, and Potyviridae. More preferably, the virus is a virus selected from the viral family group Luteoviridae. In one embodiment, the virus is selected from the group consisting of alpinia mosaic virus; andean potato mottle virus; apple mosaic virus; arabis mosaic virus; arracacha virus b; artichoke aegean ringspot virus; artichoke vein banding virus; asparagus virus; barley mild mosaic virus; barley yellow dwarf virus (subgroups i & ii) ; barley yellow mosaic virus; bean common mosaic virus; bean leaf roll virus; bean pod mottle virus; bean yellow mosaic virus; beet mild yellowing virus; beet western yellows virus; beet yellow net virus; blueberry shock virus; broad bean mottle virus; broad bean stain virus; broad bean true mosaic virus; broad bean wilt virus; brome streak mosaic virus; cardamom mosaic virus; carrot red lea virus; carrot thin leaf virus; cassava American latent virus; cassia yellow blotch virus; celery yellow spot virus; cereal yellow dwarf virus; cherry leaf roll virus; cherry rasp leaf virus; chickpea stunt virus; chicory yellow mottle virus; citrus enation (woody gall) virus; citrus mosaic virus; clover yellow vein virus; cotton anthocyanosis virus; cowpea

Aphid-borne mosaic virus; cowpea chlorotic mottle virus; cowpea green vein banding virus; cowpea mosaic virus; cowpea stunt virus; cucumber mosaic virus; cucumber vein yellowing virus; cucurbit Aphid-borne yellows virus; elm mottle virus; enamovirus; filaree red leaf virus; grapevine ajinashika virus; grapevine fanleaf virus; groundnut rosette assistor virus; hibiscus latent ringspot virus; indonesian soybean dwarf virus; lamium mild mosaic virus; legume yellows virus; lettuce mosaic virus; maclura mosaic virus; maize dwarf mosaic virus; malva yellow virus;

Michigan alfalfa virus; milk vetch dwarf virus; millet red leaf virus; narcissus latent virus; navel orange infectious mottling virus; oat mosaic virus; olive latent ringspot virus; papaya ringspot virus; patchouli mild mosaic virus; pea enation mosaic virus; pea green mottle virus; pea leaf roll virus; pea seed-borne mosaic virus; peach rosette mosaic virus; peanut mottle virus; pepper mottle virus; peru tomato mosaic virus; physalis mild chlorosis virus; physalis vein blotch virus; plum pox virus; pokeweed mosaic virus; potato black ringspot virus; potato leaf roll virus; potato virus a; potato virus u; potato virus v; potato virus y; prune dwarf virus; prunus necrotic ringspot virus; radish mosaic virus; raspberry leaf curl virus; raspberry ringspot virus; red clover mottle virus; rice necrosis mosaic virus; ryegrass mosaic virus/ shallot yellow stripe virus; solanum yellow virus; sorghum mosaic virus; soybean dwarf virus; spinach latent virus; squash mosaic virus; strawberry latent ringspot virus; strawberry mild yellow edge virus; subterranean clover red lea virus; sweet potato latent virus; sweet potato mild mottle virus; sweet potato yellow dwarf virus; tamarillo mosaic virus; telfairia mosaic virus; tobacco etch virus; tobacco necrotic dwarf virus; tobacco streak virus; tobacco vein distorting virus; tobacco yellow net virus; tobacco yellow vei^'n assistor virus; tomato ringspot virus; tomato top necrosis virus; tomato yellow virus; turnip mild yellows virus; turnip yellow virus; turnip mosaic virus; watermelon mosaic virus; wheat spindle streak mosaic virus; wheat streak mosaic virus ; wheat yellow mosaic virus._/ wild potato mosaic virus; yam mosaic virus and zucchini yellow mosaic virus.

The plant infected by the aphid-borne virus may be any plant. Preferably, the plant is a monocot. More preferably, the plant is a member of a family selected from the group consisting of Acanthaceae; Agavaceae; Alliaceae;

Alstroemeriaceae; Amaranthaceae; Amaryllidaceae; Apocynaceae; Araceae; Asclepiadaceae; Asparagaceae;

Basellaceae; Calochortaceae; Cannabidaceae; Cannaceae;

Caricaceae; Caryophyllaceae; Chenopodiaceae; Commelinaceae;

Compositae; Convolvulaceae; Crassulaceae; Cruciferae;

Cucurbitaceae 8; Dioscoreaceae; Euphorbiaceae; Gentianaceae; Gramineae; Hyacinthaceae; Hydrophyllaceae;

Iridaceae; Labiatae; Leguminosae-Caesalpinioideae;

Leguminosae-Papilionoideae; Liliaceae; Malvaceae; Melanthiaceae; Musaceae; Onagraceae; Orchidaceae; Papaveraceae; Passifloraceae; Pedaliaceae; Phytolaccaceae; Plantaginaceae; Plumbaginaceae; Polygonaceae; Portulacaceae; Primulaceae; Ranunculaceae; Rosaceae; Rutaceae; Scrophulariaceae/ Solanaceae; Tetragoniaceae; Thymelaeaceae; Tropaeolaceae/ UmbelIiferae; Valerianaceae and Zingiberaceae.

Most preferably, the plant infected by the aphid-borne virus is selected from the group consisting of Abelmoschus esculentus; Abutilon indicum; Abutilon theophrasti;

Acanthospermum hispϊdum; Adenia lobata; Ageratum conyzoides; Aglaonema; Agrostis alba; Alliaria officinalis;

Allium; Allium cepa; Allium cepa var. ascalonicum; Allium cepa var. cepa; Allium chinense; Allium fistulosum; Allium porrum; Allium sativum; Allium tuberosum; Allium vineale;

Alocasia; Alstroemeria caryophylla; Alstroemeria psittacina; Althaea officinalis; Althaea sinensis;

Amaranthus caudatus; Amaranthus deflexus; Amaranthus hybridus; Amaranthus hypochondriacus; Amaranthus retroflexus; Amara'nthus tricolor; Amorphophallus;

Amorphophallus konjac; Anethum graveolens; Anoda cristata;

Anoda dillerriana; Anoda lavateroides; Anthoxanthum odoratum; Anthriscus cerefolium; Anthriscus sylvestris; Antirrhinum majus; Apium australe; Apium graveolens; Apium graveolens var. dulce; Apium graveolens var. rapaceum;

Apium leptophyllum; Arachis hypogaea; Arachis pintoi;

Araujia angustifolia; Araujia hortorum; Araujia sericofera;

Arctotheca calendula; Arisaema; Arracacia xanthorrhiza; Arundinaria amabilis; Arundo donax; Asparagus officinalis;

Astragalus sinicus; Asystasia gangetica; Atriplex hortensis; Atropa belladonna; Avena byzantina; Avena fatua;

Avena sativa; Avena strigosa; Belamcanda chinensis; Beta macrocarpa; Beta maritime; Beta patellaris; Beta vulgaris; Beta vulgaris ssp. cicla; Bidens pilosa; Brachiaria miliiformis; Brassica campestris ssp. chinensis; Brassica campestris ssp. napus; Brassica campestris ssp. pekinensis; Brassica campestris ssp. rapa; Brassica japonica; Brassica juncea; Brassica napus var. napobrassica; Brassica nigra; Brassica oleracea var. botrytis; Brassica oleracea var. capitata; Brassica oleracea var. gemmifera; Brassica oleracea var. viridis} Brassica perviridis; Bromus inermis; Bromus macrostachys; Bromus mollis; Bromus racemosus; Bromus secalinus; Bromus sterilis; Bromus tectorum; Bupleurum rotundifolium; Cajanus cajan; Caladium hortulanum; Calandrinia caulescens; Calanthe; Calendula officinalis; Callistephus chinensis; Calochortus;

Calopogonium mucunoides; Canavalia ensiformis; Canavalia ensiformis; Canavalia gladiata; Canavalia virosa; Canna; Capsella bursa-pastoris; Capsicum annuum; Capsicum baccatum var. pendulum; Capsicum chinense; Capsicum frutescens; Carica papaya; Carthamus tinctorius; Cassia bicapsularis;

Cassia hoffmanseggi; Cassia leptocarpa; Cassia obtusifolia; Cassia occidentalis; Cassia tora; Catharanthus roseus; Celosia argentea; Celosia cristata; Cenchrus ciliaris; Centrosema; Centrosema pubescens; Cheiranthus cheiri; Cheiranthus cheiri; Chenopodium album; Chenopodium amaranticolor; Chenopodium ambrosioides; Chenopodium capitatum; Chenopodium foetidum; Chenopodium foliosum; Chenopodium hybridum; Chenopodium murale 4; Chenopodiurn quinoa 2; Chloris gayana; Cicer arietinum; Cichorium endiva; Cirsium arvense; Citrullus lanatus; Citrullus vulgaris; Citrus aurantifolia; Citrus aurantium; Citrus limon; Citrus paradisi; Citrus reticulata; Citrus sinensis; Clarkia amoena; Clarkia pulchella; Colocasia esculenta; Commelina; Commelina diffusa; Conium maculatum; Consolida ajacis; Coreopsis lanceolata; Coriandrum sativum; Coronopus didymus; Crambe abyssinica; Crinum; Crocus vernus; Crotalaria juncea; Crotalaria retusa; Crotalaria spectabilis; Cryptocoryne; Cucumis melo; Cucumis metuliferus; Cucumis sativus; Cucurbita maxima; Cucurbita moschata; Cucurbita okeechobeensis; Cucurbita pepo; Cyamopsis tetragonoloba; Cynara cardunculus; Cynara scolymus; Cynodon dactylon; Cyphomandra betacea; Cyrtosperma; Dactylis glomerata; Daphne cneorum; Daphne mezereum; Daphne odora; Daphne retusa; Datura alba} Datura bernhardii; Datura Candida; Datura ferox; Datura inermis; Datura innoxia; Datura metel; Datura meteloides; Datura sanguinea; Datura stramonium; Datura tatula; Daucus carota; Daucus carota ssp. sativus; Dendrobium; Desmodium canescens; Desmodium canum; Desmodium paniculatum; Dianthus barbatus; Dianthus caryophyllus; Dieffenbachia picta; Digitaria decumbens; Dioscorea alata; Dioscorea cayenensis; Dioscorea dumetorum; Dioscorea praehensilis; Dioscorea preussii; Dioscorea rotundata; Duchesnea indica; Ecballium elaterium; Echinochloa crus-galli; Elettaria cardamomum; Eleusine coracana; Elytrigia intermedia; Elytrigia repens; Emilia sagittata; Eragrostis cilianensis; Erigeron; Erodium botrys; Erodium cicutarium; Erodium moschatum; Eruca sativa; Eucalyptus; Eucharis grandiflora; Euphorbia lophogona; Euphorbia loricata; Euphorbia marginata; Euphorbia milii; Euphorbia peplus; Eustoma russellianum; Festuca pratensis; Ficus; Fittonia albivenis; Fragaria ananassa; Fragaria chiloensis; Fragaria ovalis; Fragaria vesca; Fragaria virginiana; Freesia; Freesia refracta; Fritillaria pudica; Gazania rigens; Gladiolus; Glycine clandestina; Glycine max; Glycine soja; Glycine tabacina; Glycine wightii; Gomphrena globosa; Gomphrena globosa var. rubra; Gossypium barbadense; Gossypium hirsutum; Gypsophila elegans; Helenium amarum; Helenium amarum hybrids; Helianthus annuus; Heracleum sphondylium; Hesperis matronalis; Hibiscus cannabinus; Hibiscus sabdariffa; Hibiscus trionum; Hippeastrum equestre; Hippeastrum hybridum; Hordeum vulgare; Hoya carnosa; Hoya coronaria; Humulus lupulus; Hyacinthus orientalis; Hyoscyamus niger; Imperata cylindrica; Ipomoea batatas; Ipomoea incarnata; Ipomoea nil; Ipomoea purpurea; Ipomoea setosa; Iris; Iris danfordiae; Iris fulva; Iris brevicaulis; Iris hollandica; Iris reticulata; Iris sibirica; Iris tingitana; Iris xiphium; Iris xiphoides; Kalanchoe blossfeldiana; Kennedya rubicunda; Kitaibelia vitifolia; Lablab purpureus; Lachenalia; Lactuca sativa; Lactuca serriola; Lagenaria siceraria; Lagurus ovatus; Lamium amplexicaule; Lathyrus odoratus; Lavatera ambigua; Lavatera arborea} Lavatera assurgentiflora; Lavatera cretica; Lavatera trimestris; Lens culinaris; Lens culinaris; Lepidium virginicum;

Lespedeza stipulacea; Lespedeza striata; Lilium; Lilium formosanum; Lilium longiflorum; Limonium sinuatum; Lolium multiflorum; Lolium perenne; Lolium perenne; Lolium temulentum; Luffa acutangula; Lupinus; Lupinus albus; Lupinus angustifolius; Lupinus cosentinii; Lupinus luteus; Lychnis chalcedonica; Lycium; Lycopersicon chilense; Lycopersicon esculentum; Lycopersicon pimpinellifolium; Macroptilium atropurpureum; Macroptilium lathyroides; Macrotyloma uniflorum; Malva alcea; Malva crispa; Malva meluca; Malva moschata; Malva neglecta; Malva nicaensis; Malva parviflora; Malva rotundifolia; Malva sylvestris; Malva verticillata; Malvastrum capense; Manihot esculenta; Matelea floridana; Matthiola incana; Medicago hispida; Medicago polymorpha; Medicago sativa} Melilotus albus; Melilotus indicus; Melilotus officinalis; Melothria pendula; Momordica charantia; Montia perfoliata; Morrenia brachyStephana; Morrenia odorata; Morus alba; Mucuna deeringianum; Musa sapientum; Napaea dioica; Narcissus; Nerine bowdenii; Nerine sarniensis; Nicandra physalodes; Nicotiana acuminata; Nicotiana benthamiana; Nicotiana bigelovii; Nicotiana clevelandii; Nicotiana debneyi; Nicotiana edwardsonii; Nicotiana glutinosa; Nicotiana megalosiphon; Nicotiana occidentalis; Nicotiana plumbaginafolia; Nicotiana rustica; Nicotiana sylvestris; Nicotiana tabacum; Ocimum basilicum; Oplismenus compositus; Ornithogalum thyrsoides; Oryza sativa; Panicum capillare; Panicum dichotomiflorum; Panicum maximum; Panicum miliaceum; Papaver nudicaule; Papaver rhoeas; Papaver somniferum; Paspalum dilatatum; Paspalum orbiculare; Passiflora aurantia; Passiflora edulis; Passiflora flavicarpa; Passiflora foetida; Passiflora quadrangularis; Passiflora suberosa; Passiflora subpeltata; Pastinaca sativa; Pennisetum americanum; Pennisetum typhoid.es; Petroselϊnum crispum; Petunia hybrida; Petunia axillaris; Petunia violacea; Phacelia campanularia; Phalaris arundinacea; Phalaris paradoxa; Phaseolus acutifolius; Phaseolus arborigenus; Phaseolus coccineus; Phaseolus lunatus; Phaseolus vulgaris; Philodendron oxycardium; Philodendron selloum; Philodendron verrucosum; Phleum pratense; Phlox drummondii; Phragmites australis; Physalis alkekengi; Physalis angulata; Physalis floridana; Physalis minima; Physalis peruviana; Phytolacca americana; Pisum arvense; Pisum sativum; Plantago lanceolata; Plantago major; Poa annua; Poa pratensis; Poa trivialis; Pogostemon patchouli; Polianthes tuberosa; Portulaca oleracea; Primula obconica; Prunus armeniaca; Prunus cerasifera; Prunus domestica; Prunus glandulosa; Prunus insititia; Prunus japonica; Prunus mahaleb; Prunus maritima; Prunus persica; Prunus salicina; Prunus sibirica; Prunus spinosa; Prunus tomentosa; Psophocarpus tetragonolobus; Ranunculus arvensis; Ranunculus asiaticus; Ranunculus sardous; Raphanus sativus; Richardia; Robinia pseudoacacia; Rosa; Rottboellia exaltata; Rubus albescens; Rubus fruticosus; Rubus henryi; Rubus idaeus; Rubus neglectus; Rubus occidentalis; Rubus phoenicolasius; Rudbeckia hirta hybridum; Rumex; Rumex obtusifolius; Saccharum officinarum; Sacciolepis indica; Samolus parviflorus; Sanguisorba minor; Saponaria vaccaria; Sarcostemma clausum; Secale cereale; Senecio; Senecio vulgaris; Sesamum indicum; Sesbania exaltata; Setaria italica; Setaria viridis; Sida micrantha; Sida napaeae; Sida rhombifolia; Sidalcea malvaefolia; Silene armeria; Silene pendula; Silene vulgaris; Sinapis alba; Sinapis arvensis; Solanum berthaultii; Solanum brachycarpum; Solanum carolinense; Solanum chacoense; Solanum chancayense; Solanum demissum; Solanum integrifolium; Solanum jasminoides; Solanum megistacrolobum; Solanum melongena; Solanum microdontum; Solanum mochiquense; Solanum muricatum; Solanum nigrum; Solanum nodiflorum; Solanum raphanifolium; Solanum tuberosum; Solanum vernei; Sonchus; Sonchus arvensis; Sonchus asper; Sonchus oleraceus; Sorbus domestica} Sorghum almum; Sorghum bicolor; Sorghum; Sorghum halepense; Sorghum laxiflorum; Sorghum macrospermum; Sorghum miliaceum; Sorghum stipoideum; Sorghum sudanense; Sorghum verticilliflorum; Sorghum vulgare; Spathiphyllum; Spinacia oleracea; Stellaria media; Stenotaphrum secundatum; Strophostyles helvula; Stylosanthes; Tagetes erecta; Telfairia occidentalis; Tephrosia vogelii; Tetragonia tetragonioides; Thaspium aureum; Tinantia erecta; Torenia fournieri; Trachymene pilosa; Tradescantia albiflora; Tradescantϊa blossfeldiana; Tradescantia flumϊnensis; Tradescantia navicularis; Tradescantia spathacea; Tradescantia zebrina; Trifolium dubium; Trifolium hybridum; Trifolium incarnatum; Trifolium pratense; Trifolium repens; Trifolium subterraneum; Trifolium vesiculosum; Trigonella foenum-graecum; Triticum aestivum; Triticum durum; Triticum westonia; Tropaeolum majus; Tropaeolum tuberosum; Tulipa; Tulipa hybrids; Ullucus tuberosus; Ulmus; Urocarpidium peruvianum; Valeriana officinalis; Vallota speciosa;

Vanilla fragrans; Vanilla pompona; Vanilla tahitensis; Verbesina encelioides; Vernonia; Viburnum; Vicia articulata; Vicia faba; Vicia faba; Vicia sativa; Vicia villosa; Vigna angularis; Vigna radiata; Vigna sesquipedalis; Vigna subterranea; Vigna unguiculata; Vigna unguiculata ssp. cylindrica; Vigna unguiculata ssp. sesquipedalis; Vigna unguiculata ssp. unguiculata; Viola cornuta; Vitis vinifera; Wisteria floribunda; Wisteria sinensis; Xanthosoma caracu; Zantedeschia; Zantedeschia elliottiana; Zea mays; Zigadenus fremontii and Zinnia elegans.

In a second aspect, the present invention provides an isolated nucleic acid molecule, which nucleic acid codes for a modified aphid transmission factor consisting essentially of the nucleotide sequence shown in Figure 1 (SEQ ID N0:l) . In a third aspect, the present invention also provides a transgenic plant, plant material, seeds or progeny thereof, comprising a nucleic acid molecule, which codes for an aphid transmission factor, wherein the expression of said nucleic acid molecule results in a transgenic plant, plant material, seeds or progeny thereof which is resistant to infection with aphid-borne virus.

Preferably, the nucleic acid molecule codes for an untranslatable aphid transmission factor.

In a fourth aspect, the present invention provides a modified aphid transmission factor gene. Preferably, the aphid transmission factor gene has either

a) a nucleotide sequence as shown in Figure 1 (SEQ ID N0:l) ; or b) a biologically active fragment of the sequence in a) ; or c) a nucleic acid molecule which has at least 75% sequence homology to the sequence in a) or b) ; or d) a nucleic acid molecule which is capable of hybridizing to the sequence in a) or b) under stringent conditions as herein defined.

In a fifth aspect, the present invention provides a nucleic acid construct comprising a promoter and a modified aphid transmission factor gene as herein defined. Preferably the construct is substantially the one shown in Figure 3.

However, it will be appreciated that modified and variant forms of the constructs may be produced in vitro, by means of chemical or enzymatic treatment, or in vivo by means of recombinant DNA technology. Such constructs may differ from those disclosed, for example, by virtue of one or more nucleotide substitutions, deletions or insertions, but substantially retain a biological activity of the construct or nucleic acid molecule of this invention.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the nucleotide sequence of the coding region of an untranslatable aphid transmission factor gene isolated from barley yellow dwarf virus (SEQ ID NO: 1) .

Figure 2 shows the nucleotide sequence of the coding region of a translatable aphid transmission factor gene isolated from barley yellow dwarf virus (SEQ ID NO: 2) .

Figure 3 shows a schematic of expression vector pCYAT carrying the nucleotide sequence of the coding region of an untranslatable aphid transmission factor gene isolated from barley yellow dwarf virus.

Figure 4 shows PCR products for AT gene generated with primers ATF and ATR (1.13kb) from T₀ generation.

Figure 5 shows an example of the segregating Tl test populations. PCR products for AT gene generated with primers ATF and ATR (1.13 kb) from Ti generation (W1660-3) .

DEFINITIONS

The description that follows makes use of a number of terms used in recombinant DNA technology. Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton, et al. , Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and

Technology (Walker ed. , 1988); The Glossary of Genetics, 5^th Ed., Rieger, R., et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991) . However, in order to provide a clear and consistent understanding of the specification and claims, including the scope given such terms, the following definitions are provided.

The term "cell" can refer to any cell from a plant, including but not limited to, somatic cells, gametes or embryos.

"Embryo" refers to a sporophytic plant before the start of germination. Embryos can be formed by fertilisation of gametes by sexual crossing or by selfing. A "sexual cross" is pollination of one plant by another. "Selfing" is the production of seed by self-pollination, ie., pollen and ovule are from the same plant. The term "backcrossing" refers to crossing a Fl hybrid plant to one of its parents. Typically, backcrossing is used to transfer genes, which confer a simply inherited, highly heritable trait into an inbred line. The inbred line is termed the recurrent parent. The source of the desired trait is the donor parent. After the donor and the recurrent parents have been sexually crossed, F, hybrid plants which possess the desired trait of the donor parent are selected and repeatedly crossed (ie., backcrossed) to the recurrent parent or inbred line.

Embryos can also be formed by "embryo somatogenesis" and "cloning." Somatic embryogenesis is the direct or indirect production of embryos from either cells, tissues or organs of plants.

Indirect somatic embryogenesis is characterised by growth of a callus and the formation of embryos on the surface of the callus.

Direct somatic embryogenesis is the formation of an asexual embryo from a single cell or group of cells on an explant tissue without an intervening callus phase. Because abnormal plants tend to be derived from a callus, direct somatic embryogenesis is preferred.

The common term, "grain" is the endosperm present in the ovules of a plant.

The phrase "introducing a nucleic acid sequence" refers to introducing nucleic acid sequences by recombinant means, including but not limited to, Agrobacterium-mediated transformation, biolistic methods, electroporation, in plants techniques, and the like. The term "nucleic acids" is synonymous with DNA, RNA, and polynucleotides. Such a plant containing the nucleic acid sequences is referred to here as an R, generation plant. Rl plants may also arise from cloning, sexual crossing or selfing of plants into which the nucleic acids have been introduced.

A "nucleic acid molecule" or "polynucleic acid molecule" refers herein to deoxyribonucleic acid and ribonucleic acid in all their forms, ie., single and double-stranded DNA, cDNA, mRNA, and the like.

A "double-stranded DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus this term includes double-stranded DNA found, inter alia, in linear DNA molecules (eg. , restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (ie., the strand having a sequence homologous to the mRNA) . A DNA sequence "corresponds" to an amino acid sequence if translation of the DNA sequence in accordance with the genetic code yields the amino acid sequence (ie., the DNA sequence "encodes" the amino acid sequence) .

One DNA sequence "corresponds" to another DNA sequence if the two sequences encode the same amino acid sequence.

Two DNA sequences are "substantially similar" when at least about 85%, preferably at least about 90%, and most preferably at least about 95%, of the nucleotides match over the defined length of the DNA sequences.

A "heterologous" region or domain of a DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a plant gene, the gene will usually be flanked by DNA that does not flank the plant genomic DNA in the genome of the source organism. Another example of a heterologous region is a construct where the coding sequence itself is not found in nature (eg., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene) . Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

A "coding sequence" is an in-frame sequence of codons that correspond to or encode a protein or peptide sequence. Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be transcribed and translated into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence. Polynucleotide "homologs" refers to DNAs or RNAs and polymers thereof in either single- or double-stranded form containing known analogues of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolised in a manner similar to naturally occurring nucleotides.

"Transgenic plants" are plants into which a nucleic acid has been introduced through recombinant techniques, eg., nucleic acid-containing vectors. A "vector" is a nucleic acid composition which can transduce, transform or infect a cell, thereby causing the cell to express vector-encoded nucleic acids and, optionally, proteins other than those native to the cell, or in a manner not native to the cell. A vector includes a nucleic acid (ordinarily RNA or DNA) to be expressed by the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a retroviral particle, liposome, protein coating or the like. Vectors contain nucleic acid sequences that allow their propagation and selection in bacteria or other non-plant organisms. For a description of vectors and molecular biology techniques, see Current Protocols in Molecular Biology, Ausubel, et al., (eds.), Current Protocols, a joint venture between Greene

Publishing Associates, Inc. and John Wiley & Sons, Inc., (through and including the 1998 Supplement) (Ausubel) .

"Plasmids" are one type of vector which comprises DNA that is capable of replicating within a plant cell, either extra-chromosomally or as part of the plant cell chromosome (s) , and are designated by a lower case "p" preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are commercially available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids by methods disclosed herein and/or in accordance with published procedures. In certain instances, as will be apparent to the ordinarily skilled worker, other plasmids known in the art may be used interchangeably with plasmids described herein.

The phrase "expression cassette" refers to a nucleic acid sequence within a vector, which is to be transcribed, and a control sequence to direct the expression. The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked nucleotide coding sequence in a particular host cell. The control sequences suitable for expression in prokaryotes, for example, include origins of replication, promoters, ribosome binding sites, and transcription termination sites. The control sequences that are suitable for expression in eukaryotes, for example, include origins of replication, promoters, ribosome-binding sites, polyadenylation signals, and enhancers. One of the most important control sequences is the promoter.

A "promoter" is an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.

A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. The promoter can either be homologous, ie., occurring naturally to direct the expression of the desired nucleic acid or heterologous, ie., occurring naturally to direct the expression of a nucleic acid derived from a gene other than the desired nucleic acid. Fusion genes with heterologous promoter sequences are desirable, eg., for regulating expression of encoded proteins. A "constitutive" promoter is a promoter that is active in a selected organism under most environmental and developmental conditions. An "inducible" promoter is a promoter that is under environmental or developmental regulation in a selected organism.

Examples include promoters from plant viruses such as the 35S promoter from cauliflower mosaic virus (CaMV) , as described in Odell et al., (1985), Nature, 313:810-812, and promoters from genes such as rice actin (McElroy et al., 1990, Plant Cell, 163-171); maize ubiquitin (Christensen et al., (1992), Plant MoI. Biol. 12:619-632; and Christensen, et al., (1992), Plant MoI. Biol. 18:675-689); pEMU (Last, et al., (1991), Theor. Appl. Genet 81:581-588); MAS (Velten et al., (1984), EMBO J. 3:2723-2730); and maize H3 histone (Lepetit et al., (1992), MoI. Gen. Genet. 231:276-285; and Atanassvoa et al., (1992), Plant Journal 2 (3) :291-300) .

Additional regulatory elements that may be connected to the aphid transmission factor polynucleotides for expression in plant cells include terminators, polyadenylation sequences, and nucleic acid sequences encoding signal peptides that permit localisation within a plant cell or secretion of the protein from the cell. Such regulatory elements and methods for adding or exchanging these elements with the regulatory elements of the replicase gene are known, and include, but are not limited to, 3' termination and/or polyadenylation regions such as those of the Agrobacterium tumefaciens nopaline synthase (nos) gene (Bevan et al., (1983), Nucl. Acids Res. 12:369-385); the potato proteinase inhibitor II (PINII) gene (Keil, et al., (1986), Nucl.

Acids Res. 14:5641-5650; and An et al., (1989), Plant Cell 1:115-122); and the CaMV 19S gene (Mogen et al. , (1990), Plant Cell 2:1261-1272) .

Plant signal sequences, including, but not limited to, signal-peptide encoding DNA/RNA sequences which target proteins to the extracellular matrix of the plant cell (Dratewka-Kos, et al., (1989), J. Biol. Chem. 264:4896- 4900), the Nicotiana plυmbaginifolia extension gene (DeLoose, et al., (1991), Gene 99:95-100), signal peptides which target proteins to the vacuole like the sweet potato sporamin gene (Matsuka, et al., (1991), PNAS 88:834) and the barley lectin gene (Wilkins, et al., (1990), Plant Cell, 2:301-313), signal peptides which cause proteins to be secreted such as that of PRIb (Lind, et al., (1992), Plant MoI. Biol. 18:47-53), or the barley alpha amylase (BAA) (Rahmatullah, et al. "Nucleotide and predicted amino acid sequences of two different genes for high-pi alpha- amylases from barley." Plant MoI. Biol. 12:119 (1989) and hereby incorporated by reference) , or from the present invention the signal peptide from the ESPl or BESTl gene, or signal peptides which target proteins to the plastids such as that of rapeseed enoyl-Acp reductase (Verwaert, et al., (1994), Plant MoI. Biol. 26:189-202) are- useful in the invention.

For the purposes of the present invention, the promoter sequence is bounded at its 3' terminus by the translation start codon of a coding sequence, and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease Sl) , as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

An "exogenous" element is one that is foreign to the host cell, or is homologous to the host cell but in a position within the host cell in which the element is ordinarily not found.

"Digestion" of DNA refers to the catalytic cleavage of DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes or restriction endonucleases, and the sites within DNA where such enzymes cleave are called restriction sites. If there are multiple restriction sites within the DNA, digestion will produce two or more linearized DNA fragments

(restriction fragments) . The various restriction enzymes used herein are commercially available, and their reaction conditions, cofactors, and other requirements as established by the enzyme manufacturers are used. Restriction enzymes are commonly designated by abbreviations composed of a capital letter followed by other letters representing the microorganism from which each restriction enzyme originally was obtained and then a number designating the particular enzyme. In general, about lμg of DNA is digested with about 1-2 units of enzyme in about 20μl of buffer solution. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer, and/or are well known in the art.

"Recovery" or "isolation" of a given fragment of DNA from a restriction digest typically is accomplished by separating the digestion products, which are referred to as "restriction fragments," on a polyacrylamide or agarose gel by electrophoresis, identifying the fragment of interest on the basis of its mobility relative to that of marker DNA fragments of known molecular weight, excising the portion of the gel that contains the desired fragment, and separating the DNA from the gel, for example by electroelution.

"Ligation" refers to the process of forming phosphodiester bonds between two double-stranded DNA fragments. Unless otherwise specified, ligation is accomplished using known buffers and conditions with 10 units of T4 DNA ligase per 0.5μg of approximately equimolar amounts of the DNA fragments to be ligated. "Oligonucleotides" are short-length, single- or double- stranded polydeoxynucleotides that are chemically synthesized by known methods (involving, for example, triester, phosphoramidite, or phosphonate chemistry) , such as described by Engels, et al., Agnew. Chem. Int. Ed. Engl. 28:716-734 (1989). They are then purified, for example, by polyacrylamide gel electrophoresis.

"Polymerase chain reaction," or "PCR," as used herein generally refers to a method for amplification of a desired nucleotide sequence in vitro, as described in U.S. Patent No. 4,683,195. In general, the PCR method involves repeated cycles of primer extension synthesis, using two oligonucleotide primers capable of hybridizing preferentially to a template nucleic acid. Typically, the primers used in the PCR method will be complementary to nucleotide sequences within the template at both ends of or flanking the nucleotide sequence to be amplified, although primers complementary to the nucleotide sequence to be amplified also may be used. Wang, et al., in PCR Protocols, pp.70-75 (Academic Press, 1990); Ochman, et al., in PCR Protocols, pp. 219-227; Triglia, et al., Nucl. Acids Res. 16:8186 (1988) .

"PCR cloning" refers to the use of the PCR method to amplify a specific desired nucleotide sequence that is present amongst the nucleic acids from a suitable cell or tissue source, including total genomic DNA and cDNA transcribed from total cellular RNA. Frohman, et al. ,

Proc. Nat. Acad. Sci. USA 85:8998-9002 (1988); Saiki, et al., Science 239:487-492 (1988); Mullis, et al., Meth. Enzymol. 155:335-350 (1987) .

For purposes of describing the present invention, the term "modified" refers to an introduced alteration to a nucleic acid molecule such that, upon transcription, a "modified RNA" molecule is produced. The term "modified RNA" is used to refer to a modified form of a naturally-occurring messenger RNA sequence which cannot be completely translated compared to the unmodified, naturally-occurring form. A modified RNA may be incapable of being translated at all or it may be capable of being partially translated into an attenuated peptide corresponding to a portion of the peptide encoded by the naturally occurring messenger RNA sequence from which the modified RNA is derived.

The coding sequence for a naturally-occurring viral RNA sequence may be modified to encode a modified RNA, for example, by removing its ATG initiation codon or by utilising a portion which does not include the initiation codon. Other means for modifying RNA molecules include introducing one or more premature stop codons and/or interrupting the reading frame.

The phrase "operably encodes" refers to the functional linkage between a promoter and a second nucleic acid sequence, wherein the promoter sequence initiates transcription of RNA corresponding to the second sequence.

The term "progeny" refers to the descendants of a particular plant (self-cross) or pair of plants (crossed or backcrossed) . The descendants can be of the Fl, the F2, or any subsequent generation.

Typically, the parents are the pollen donor and the ovule donor which are crossed to make the progeny plant of this invention.

Parents also refer to Fl parents of a hybrid plant of this invention (the F2 plants) . Finally, parents refer to a recurrent parent which is backcrossed to hybrid plants of this invention to produce another hybrid plant of this invention. The phrase "producing a transgenic plant" refers to producing a plant of this invention. The plant is generated through recombinant techniques, ie., cloning, somatic embryogenesis or any other technique used by those of skill to produce plants.

The common names of some plants used throughout this disclosure refer to varieties of plants of the following genera:

Common Name Genera

Wheat (soft, hard and durum varieties) Triticum

Sorghum Sorghum

Rice Oryza

Barley Hordeum

Maize or corn Zea

Rye Secale

Triticale Triticale

Oat Avena

"Integration" of the DNA may be effected using non¬ homologous recombination following mass transfer of DNA into the cells using microinjection, biolistics, electroporation or lipofection. Alternative methods such as homologous recombination, and or restriction enzyme mediated integration (REMI) or transposons are also encompassed, and may be considered to be improved integration methods.

A "clone" is a population of cells derived from a single cell or common ancestor by mitosis.

"Nucleic acid sequence homologs" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-or double-stranded form containing known analogues of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolised in a manner similar to naturally occurring nucleotides.

Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (eg., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer, et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka, et al., J. Biol. Chem. 260: 2605- 2608 (1985); and Rossolini, et al., MoI. Cell. Probes 8: 91-98 (1994)) . The term "nucleic acid" is used interchangeably with gene, cDNA, and mRNA encoded by a gene.

The term "amino acid sequence homolog" refers to a protein with a similar amino acid sequence. One of skill will realise that the critical amino acid sequence is within a functional domain of a protein. Thus, it may be possible for a homologous protein to have less than 40% homology over the length of the amino acid sequence, but greater than 90% homology in one functional domain. In addition to naturally occurring amino acids, homologs also encompass proteins in which one or more amino acid residue is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring proteins.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

"Conservatively modified variants" applies to both amino^' acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids that encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences.

Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein, which encodes a polypeptide, also describes every possible silent variation of the nucleic acid. One of skill will recognise that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid, which encodes a polypeptide, is implicit in each described sequence.

As to amino acid sequences, one of skill will recognise that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art.

The following six groups each contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D) , Glutamic acid (E) ;

3) Asparagine (N) , Glutamine (Q) ;

4) Arginine (R) , Lysine (K) ; 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). (See, eg., Creighton, Proteins (1984)).

As used herein, the terms "transformation" and "transfection" refer to the process of introducing a desired nucleic acid, such a plasmid or an expression vector, into a plant cells, either in culture or in the organs of a plant by a variety of techniques used by molecular biologists. Accordingly, a cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell wall. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In prokaryotes and yeast, for example, the exogenous DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the exogenous DNA is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.

Numerous methods for introducing foreign genes into plants are known and can be used to insert a modified nucleic acid into a plant host, including biological and physical plant transformation protocols. See, for example, Miki et al., (1993), "Procedure for Introducing Foreign DNA into Plants", In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds., CRC Press, Inc., Boca Raton, pages 67-88. The methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, microorganism-mediated gene transfer such as Agrobacterium (Horsch, et al., (1985), Science 227:1229-31), electroporation, micro-injection, and biolistic bombardment.

Expression cassettes and vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are known and available. See, for example, Gruber, et al., (1993), "Vectors for Plant Transformation" In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds. CRC Press, Inc., Boca Raton, pages 89-119.

The most widely utilised method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria which genetically transform plant cells. The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectfully, carry genes responsible for genetic transformation of plants. See, for example, Kado, (1991), Crit. Rev. Plant Sci. 10: 1. Descriptions of the Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided in Gruber et al., supra; Miki, et al., supra; and Moloney et al. , (1989), Plant Cell Reports 8:238.

Similarly, the gene can be inserted into the T-DNA region of a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes, respectively. Thus, expression cassettes can be constructed as above, using these plasmids. Many control sequences are known which when coupled to a heterologous coding sequence and transformed into host organisms show fidelity in gene expression with respect to tissue/organ specificity of the original coding sequence. See, eg., Benfey, P. N., and Chua, N. H. (1989) Science 244: 174-181. Particularly suitable control sequences for use in these plasmids are promoters for constitutive leaf- specific expression of the gene in the various target plants. Other useful control sequences include a promoter and terminator from the nopaline synthase gene (NOS) . The NOS promoter and terminator are present in the plasmid pARC2, available from the American Type Culture Collection and designated ATCC 67238. If such a system is used, the virulence (vir) gene from either the Ti or Ri plasmid must also be present, either along with the T-DNA portion, or via a binary system where the vir gene is present on a separate vector. Such systems, vectors for use therein, and methods of transforming plant cells are described in

U.S. Pat. No. 4,658,082; U.S. application Ser. No. 913,914, filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993 to Robeson, et al.; and Simpson, R. B., et al. (1986) Plant MoI. Biol. 6: 403-415 (also referenced in the '306 patent); all incorporated by reference in their entirety.

Once constructed, these plasmids can be placed into A. rhizogenes or A. tumefaciens and these vectors used to transform cells of plant species, which are ordinarily susceptible to BYDV infection. Several other transgenic plants are also contemplated by the present invention including but not limited to soybean, corn, sorghum, alfalfa, rice, clover, cabbage, banana, coffee, celery, tobacco, cowpea, cotton, melon and pepper. The selection of either A. tumefaciens or A. rhizogenes will depend on the plant being transformed thereby. In general A. tumefaciens is the preferred organism for transformation. Most dicotyledons, some gymnosperms, and a few monocotyledons (eg. certain members of the Liliales and Arales) are susceptible to infection with A. tumefaciens. A. rhizogenes also has a wide host range, embracing most dicots and some gymnosperms, which includes members of the Leguminosae, Compositae and Chenopodiaceae. Alternative techniques, which have proven to be effective in genetically transforming plants, include particle bombardment and electroporation. See eg. Rhodes, C. A., et al. (1988) Science 240: 204-207/ Shigekawa, K. and Dower, W. J. (1988) Bio/Techniques 6: 742-751; Sanford, J. C, et al. (1987) Particulate Science & Technology 5:27-37; and McCabe, D. E. (1988) Bio/Technology 6:923-926.

Once transformed, these cells can be used to regenerate transgenic plants, capable of withstanding aphid-borne viral infection. For example, whole plants can be infected with these vectors by wounding the plant and then introducing the vector into the wound site. Any part of the plant can be wounded, including leaves, stems and roots. Alternatively, plant tissue, in the form of an explant, such as cotyledonary tissue or leaf disks, can be inoculated with these vectors and cultured under conditions, which promote plant regeneration. Roots or shoots transformed by inoculation of plant tissue with A. rhizogenes or A. tumefaciens, containing the gene coding for the aphid transmission factor, can be used as a source of plant tissue to regenerate Aphid-borne virus-resistant transgenic plants, either via somatic embryogenesis or organogenesis. Examples of such methods for regenerating plant tissue are disclosed in Shahin, E. A. (1985) Theor. Appl. Genet. 69:235-240; U.S. Pat. No. 4,658,082; Simpson, R. B., et al. (1986) Plant MoI. Biol 6: 403-415; and U.S. patent applications Ser. Nos. 913,913 and 913,914, both filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993 to Robeson, et al.; the entire disclosures therein incorporated herein by reference.

Despite the fact that the host range for Agrobacterium- mediated transformation is broad, some major cereal crop species and gymnosperms have generally been recalcitrant to this mode of gene transfer, even though some success has recently been achieved in rice (Hiei et al., (1994), The Plant Journal 6:271-282) . Several methods of plant transformation have been developed, collectively referred to as direct gene transfer, as an alternative to Agrobacterium-mediated transformation.

A generally applicable method of plant transformation is microprojectile-mediated transformation, where DNA is carried on the surface of microprojectiles measuring about 1 to 4μm. The expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600m/s which is sufficient to penetrate the plant cell walls and membranes. (Sanford et al., (1987), Part. Sci. Technol. 5:27; Sanford, 1988, Trends Biotech 6:299; Sanford, (1990), Physiol. Plant 79:206; Klein et al., (1992), Biotechnology 10:268) .

Another method for physical delivery of DNA to plants is sonication of target cells as described in Zang et al., (1991), Bio/Technology 9:996. Alternatively, liposome or spheroplast fusions have been used to introduce expression vectors into plants. See, for example, Deshayes et al., (1985), EMBO J. 4:2731; and Christou et al., (1987), PNAS USA 84:3962. Direct uptake of DNA into protoplasts, using CaCl₂ precipitation, polyvinyl alcohol or poly-L-ornithine, have also been reported. See, for example, Hain ^'et al., (1985), MoI. Gen. Genet. 199:161; and Draper et al., (1982), Plant Cell Physiol. 23:451.

Electroporation of protoplasts and whole cells and tissues has also been described. See, for example, Donn et al.,

(1990), In: Abstracts of the VII^th Int'1. Congress on Plant Cell and Tissue Culture IAPTC, A2-38, page 53; D'Halluin et al., (1992), Plant Cell 4:1495-1505; and Spencer et al.,

(1994), Plant MoI. Biol. 24:51-61. Alternatively, the DNA constructs are combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host directs the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.

Microinjection techniques are known in the art and well described in the scientific and patent literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski, et al., EMBO J. 3: 2717 (1984) . Electroporation techniques are described in Fromm, et al., Proc. Nat'l. Acad. Sci. USA 82: 5824 (1985) . Biolistic transformation techniques are described in Klein, et al., Nature 327: 70-73 (1987) .

Agrobacterium tumefaciens-xαed±ateά transformation techniques, including disarming and use of binary vectors, are also well described in the scientific literature. See, for example Horsch, et al., Science 233: 496-498 (1984), and Fraley, et al., Proc. Nat'l. Acad. Sci. USA 80: 4803 (1983) .

One preferred method of transforming plants of the invention is microprojectile bombardment. In this method target tissues are treated with osmoticum. Then aphid transmission factor gene DNA including modified DNA is precipitated, and coated on to tungsten or gold microparticles. The microparticles are then loaded into microprojectile or biolistic device and the treated cells are bombarded (Bower et al., 1996) .

By "consisting essentially of" is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the W

- 36 -

activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but that other elements are optional and may or 5 may not be present depending upon whether or not they affect the activity or action of the listed elements.

DETAILED DESCRIPTION OF THE INVENTION

10 All publications mentioned herein are cited for the purpose of describing and disclosing the protocols and reagents which are reported in the publications and which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not

15 entitled to antedate such disclosure by virtue of prior invention.

The practice of the present invention employs, unless otherwise indicated, conventional molecular biology, plant

20 biology, and recombinant DNA techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, eg., Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual" (1982); "DNA Cloning: A Practical

25 Approach," Volumes I and II (D.N. Glover, Ed., 1985); "Oligonucleotide Synthesis" (M.J. Gait, Ed., 1984); "Nucleic Acid Hybridization" (B.D. Hames & S.J. Higgins, eds., 1985); "Transcription and Translation" (B.D. Hames & S.J. Higgins, eds., 1984); B. Perbal, "A Practical Guide to

30 Molecular Cloning" (1984), and Sambrook, et al., "Molecular Cloning: a Laboratory Manual" 12^th edition (1989) .

It is understood that the invention is not limited to the particular materials and methods described, as these may 35 vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and it is not intended to limit the scope of the present invention which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a polynucleotide" includes a plurality of such polynucleotides, and a reference to "an enhancer element" is a reference to one or more enhancer elements. Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are now described.

One of the broadest aspects of the present invention contemplates the use of a transgene engineered so as to produce a transgenic monocotyledonous plant, which expresses an' aphid transmission factor gene. As used herein, the term "transgenic plant" is intended to refer to a plant that has incorporated therein an aphid transmission factor polynucleotide sequence, including but not limited to polynucleotides which are perhaps not normally present, DNA sequences not normally transcribed into RNA or translated into a protein ("expressed") .

The term "monocotyledonous plant" as used herein, includes, for example, any plant found in the a family selected from the group consisting of Acanthaceae; Agavaceae; Alliaceae;

Alstroemeriaceae; Amaranthaceae; Amaryllidaceae;

Apocynaceae; Araceae; Asclepiadaceae; Asparagaceae; Basellaceae; Calochortaceae; Cannabidaceae; Cannaceae;

Caricaceae; Caryophyllaceae; Chenopodiaceae; Commelinaceae;

Compositae; Convolvulaceae; Crassulaceae; Cruciferae;

Cucurbitaceae; Dioscoreaceae/ Euphorbiaceae; Gentianaceae;

Gramϊneae; Hyacinthaceae; Hydrophyllaceae; Iridaceae; Labiatae; Leguminosae-Caesalpϊnioideae; Leguminosae-

Papilionoideae; Liliaceae; Malvaceae; Melanthiaceae;

Musaceae; Onagraceae; Orchidaceae; Papaveraceae; Passifloraceae; Pedaliaceae; Phytolaccaceae; Plantaginaceae; Plumbaginaceae; Polygonaceae; Portulacaceae; Primulaceae; Ranunculaceae; Rosaceae; Rutaceae; Scrophulariaceae; Solanaceae; Tetragoniaceae; Thymelaeaceae; Tropaeolaceae; Umbelliferae; Valerianaceae and Zingiberaceae.

In one embodiment, the plant is either Abelmoschus esculentus or Abutilon indicum or Abutilon theophrasti or ^'Acanthospermum hispidum or Adenia lobata or Ageratum conyzoides or Aglaonema or Agrostis alba or Alliaria officinalis or Allium or Allium cepa or Allium cepa var. ascalonicum or Allium cepa var. cepa or Allium chinense or Allium fistulosum or Allium porrum or Allium sativum or Allium tuberosum or Allium vineale or Alocasia or

Alstroemeria caryophylla or Alstroemeria psittacina or Althaea officinalis or Althaea sinensis or Amaranthus caudatus or Amaranthus deflexus ox Amaranthus hybridus or Amaranthus _rhypochondriacus or Amaranthus retroflexus or Amaranthus tricolor or Amorphophallus or Amorphophallus konjac or Anethum graveolens or Anoda cristata or Anoda dillerriana or Anoda lavateroides or Anthoxanthum odoratum or Anthriscus cerefolium or Anthriscus sylvestris or Antirrhinum majus or Apium australe or Apium graveolens or Apium graveolens var. dulce or Apium graveolens var. rapaceum or Apium leptophyllum or Araαhis hypogaea or Arachis pintoi or Araujia angustifolia or Araujia hortorum or Araujia sericofera or Arctotheca calendula or Arisaema or Arracacia xanthorrhiza or Arundi.na.ria amabilis or Aru.ndo donax or Asparagus officinalis or Astragalus sinicus or Asystasia gangetica or Atriplex hortensis or Atropa belladonna or Avena byzantina or Avena fatua or Avena sativa or Avena strigosa or Belamcanda chinensis or Beta macrocarpa or Beta maritima or Beta patellaris or Beta vulgaris or Beta vulgaris ssp. cicla or Bidens pilosa or Brachiaria miliiformis or Brassica campestris ssp. chinensis or Brassica campestris ssp. napus or Brassica campestris ssp. pekinensis or Brassica campestris ssp. rapa or Brassica japonica or Brassica juncea or Brassica napus var. napojbrassica or Brassica nigra or Brassica oleracea var. jbotrytis or Brassica oleracea var. capitata or Brassica oleracea var. gemmifera or Brassica oleracea var. viridis or Brassica perviridis or Bromus inermis or Bromus macrostachys or Bromus mollis or Bromus racemosus or Bromus secalinus or Bromus sterilis or Bromus tectorum or Bupleurum rotund!folium or Cajanus cajan or Caladium hortulanum or Cala.ndri.nia caulescens or Calanthe or Calendula officinalis or Callistephus chinensis or Calochortus or Calopogonium mucunoides or Canavalia eπsiformis or Canavalia ensiformis or Canavalia gladiata or Canavalia virosa or Carina or Capsella bursa-pastoris or Capsicum annuum or Capsicum baccatum var. pendulum or

Capsicum chinense or Capsicum frutescens or Carica papaya or Carthamus tinctorius or Cassia bicapsularis or Cassia hoffmanseggi or Cassia leptocarpa or Cassia obtusifolia or Cassia occidentalis or Cassia tora or Catharanthus roseus or Celosia argentea or Celόsia cristata or Cenchrus ciliaris or Centrosema or Centrosema pubescens or Cheiranthus cheiri or Cheiranthus cheiri or Chenopodium album or Chenopodium amaranticolor or Chenopodium ambrosioides or Chenopodium capitatum or Chenopodium foetidum or Chenopodium foliosum or Chenopodium hyjbridum or Chenopodium. murale 4 or Chenopodium guinoa 2 or Chloris gayana or Cicer arietinum or Cichorium endiva or Cirsium arvense or Citrullus lanatus or Citrullus vulgaris or Citrus aurantifolia or Citrus aurantium or Citrus limon or Citrus paradisi or Citrus reticulata or Citrus sinensis or Clarkia amoena or Clarkia pulchella or Colocasia esculenta or Commelina or Commelina diffusa or Conium maculatum or Consolida ajacis or Coreopsis lanceolata or Coriandrum sativum or Coronopus didymus or Crambe abyssinica or Crinum or Crocus vernus or Crotalaria juncea or Crotalaria retusa or Crotalaria spectabilis or Cryptocoryne or Cucumis melo or Cucumis metuliferus or Cucumis sativus or Cucurbita maxima or Cucurbita moschata or Cucurbita okeechobeensis or Cucurbita pepo or Cyamopsis tetragonoloba or Cynara cardunculus or Cynara scolymus or Cynodon dactylon or Cyphomandra betacea or Cyrtosperma or Dactylis glomerata or Daphne cneorum or Daphne mezereum or Daphne odora or Daphne retusa or Datura alba or Datura bernhardii or Datura Candida or Datura ferox or Datura inermis or Datura innoxia or Datura metel or Datura meteloides or Datura sanguinea or Datura stramonium, or Datura tatula or Daucus carota or Daucus carota ssp. sativus or Dendrobium or Desmodium canescens or Desmodium canum or Desmodium paniculatum or Dianthus barbatus or Dianthus caryophyllus or Dieffenbachia picta or Digitaria decumbens or Dioscorea alata or Dioscorea cayenensis or Dioscorea dumetorum or Dioscorea praehensilis or Dioscorea preussii or Dioscorea rotundata or Duchesnea indica or Ecballium elaterium or Echinochloa crus-galli or Elettaria cardamomum or Eleusine coracana or Elytrigia intermedia or Elytrigia repens or Emilia sagittata or Eragrostis cilianensis or Erigeron or Erodium botrys or Erodium cicutarium or Erodium moschatum or Eruca sativa or Eucalyptus or Eucharis grandiflora or Euphorbia lophogona or Euphorbia loricata or EuphorJbia marginata or Euphorbia milii or Euphorbia peplus or Eustoma russellianum or Festuca pratensis or Ficus or Fittonia albivenis or Fragaria ananassa or Fragaria chiloensis or Fragaria ovalis or Fragaria vesca or Fragaria virginiana or Freesia or Freesia refracta or Fritillaria pudica or Gazania rigens or Gladiolus or Glycine clandestina or Glycine max or Glycine soja or Glycine tabacina or Glycine wightii or Gomphrena globosa or Gomphrena globosa var. rubra or Gossypium barbadense or Gossypium hirsutum or Gypsophila elegans or Helenium amarum or Heleniura amarim hybrids or Helianthus annuus or Heracleum sphondylium or Hesperis matronalis or Hibiscus cannabinus or Hibiscus sabdariffa or Hibiscus trionum or Hippeastrum equestre or Eippeastrum hybridum or Hordeum vulgare or Eoya carnosa or #oya coronaria or Humulus lupulus or Hyacinthus orientalis or Fyoscyamus niger or Imperata cylindrica or Ipomoea batatas or Ipomoea incarnata or Ipomoea nil or Ipomoea purpurea or Ipomoea setosa or Iris or Iris danfordiae or Iris fulva or Iris brevicaulis or Iris hollandica or Iris reticulata or Iris sibirica or Iris tingitana or Iris xiphium or Iris xiphoides or Kalanαhoe blossfeldiana or .Keiznedya rubicunda or Kitaijbeϋa vitifolia or Lablab purpureus or Lachenalia or Lactuca sativa or Lactuca serriola or Lagenaria siceraria or Lagurus ovatus or Lamium amplexicaule or Latήyrus odoratus or Lavatera ambigua or Lavatera arborea or Lavatera assurgentiflora or Lavatera cretlca or Lavatera trimestris or Lens culinaris or Lens culinaris or Lepidium virginicum or Lespedeza stipulacea or Lespedeza striata or Liliυm or Lilium formosanum or Lilium longiflorum or Limonium sinuatum or Lolium multiflorum or Lolium perenne or Lolium perenne or Lolium temulentum or Luffa acutangula or Lupinus or Lupinus albus or Lupinus angustifolius or Lupinus cosentinii or Lupinus luteus or Lychnis chalcedonica or Lycium or Lycopersicon chilense or Lycopersicon esculentum or Lycopersicon pimpinellifolium or Macroptilium atropurpureum or Macroptilium lathyroides or Macrσtyloma uniflorum or Malva alcea or Malva crispa or Malva meluca or Malva moschata or Malva neglecta or Malva nicaensis or Malva parviflora or Malva rotundifolia or Malva sylvestris or Malva verticillata or Malvastrum capense or Manihot esculenta or Matelea floridana or Matthiola incana or Medicago hispida or Medicago polymorpha or Medicago sativa or Melilotus albus or Melilotus indicus or Melilotus officinalis or Melothria pendula or Momordica charantia or Montia perfoliata or Morrenia brachyStephana or Morrenia odorata or Morus aljba or Mucuna deeringianum or Musa sapientum or Napaea dioica or Narcissus or Nerine bowdenii or Nerine sarniensis or Nicandra physalodes or Nicotiana acuminata or Nicotiana benthamiana or Nicotiana bigelovii or Nicotiana clevelandii or Nicotiana debneyi or Nicotiana edwardsonii or Nicotiana glutinosa or Nicotiana megalosiphon or Nicotiana occidentalis or Nicotiana plumbaginafolia or Nicotiana rustica or Nicotiana sylvestris or Nicotiana tabacum or Ocimum basllicum or Oplismenus compositυs or Ornithogalum thyrsoides or Oryza sativa or Panicum capillare or Panicujn dichotomiflorum or Panicum maximum or Panicum miliaceum or Papaver nudicaule or Papaver rhoeas or Papaver somniferum or Paspalum dilatatum or Paspalum orbiculare or Passiflora aurantia or Passiflora edulis or Passiflora flavicarpa or Passiflora foetida or Passiflora quadrangularis or Passiflora suberosa or Passiflora subpeltata or Pastinaca sativa or Pennisetum americanum or Pennisetum typhoides or Petroselinum crispum or Petunia hybrida or Petunia axillaris or Petunia violacea or Pήacelia campanularia or Phalaris arundinacea or Phalaris paradoxa or Phaseolus acutifolius or Phaseolus arborigenus or Phaseolus coccineus or Phaseolus lunatus or Phaseolus vulgaris or Philodendron oxycardium or Philodendron selloum or Philodendron verrucosum or Phleum pratense or Phlox drummondii or Phragmites australis or Physalis alkekengi or Physalis angulata or Physalis floridana or Physalis minima or Physalis peruviana or

Phytolacca americana or Pisum arvense or Pisum sativum or Plantago lanceolata or Plantago major or Poa annua or Poa pratensis or Poa trivialis or Pogostemon patchouli or Polianthes tuberosa or Portulaca oleracea or Primula obconica or Prunus armeniaca or Prunus cerasifera or Prunus domestica or Prunus glandulosa or Prunus insititia or Prunus japonica or Prunus mahaleb or Prunus maritima or Prunus persica or Prunus salicina or Prunus sibirica or Prunus spinosa or Prunus toraentosa or Psophocarpus tetragonolcbus or Ranunculus arvensis or Ranunculus asiaticus or Ranunculus sardous or Raphanus sativus or Richardia or Robinia pseudoacacia or .Rosa or Pottjboellia exaltata or .RuJbus albescens or Rubus fruticosus or Rubus henryi or Rubus idaeus or Rubus neglectus or Rubus occidentalis or Rubus phoenicolasius or .Rudfoeαicia hirta hybridum or i?umex or i?uraex obtusifolius or Saccharum officinarum or Sacciolepis indica or Samolus parviflorus or Sanguisorba minor or Saponaria vaccaria or Sarcostemma clausum or Secale cereale or Senecio or Senecio vulgaris or SesazπuΛi indicum or Sesbania exaltata or Setaria italica or Setaria viridis or Sida micrantha or Sida .napaeae or Sida rhombifolia or Sidalcea malvaefolia or Silene armeria or Silene pendula or Silene vulgaris or Sinapis alba or Sinapis arvensis or Solanum berthaultii or Solanum brachycarpum or Solanum carolinense or Solanum chacoense or Solanum chancayense or Solanum demissum or Solanum integrifolium or Solanum jasminoides or Solanum megistacrolobum or Solanum melongena or Solanum microdontum or Solanum mochiquense or Solanum muricatum or Solanum nigrum or Solanum nodiflorum or Solanum raphanifolium or Solanum tuberosum or Solanum vernei or Sonchus or Sonchus arvensis or Sonchus asper or Sonchus oleraceus or Sorbus domestica or Sorghum almum or Sorghum bicolor or Sorghum or Sorghum halepense or Sorghum laxiflorum or Sorghum macrospermum or Sorghum miliaceum or Sorghum stipoideum or Sorghum sudanense or Sorghum verticilliflorum or Sorghum vulgare or Spathiphyllum or Spinacia oleracea or Stellaria media or Stenotaphrum secundatum or Strophostyles helvula or Stylosanthes or Tagetes erecta or Telfairia occidentalis or Tephrosia vogelii or Tetragonia tetragonioides or Thaspium aureum or Tinantia erecta or Torenia fournieri or Trachyme.ne pilosa or Tradescantia albiflora or Tradescantia blossfeldiana or rradescantia fluminensis or Tradescantia navicularis or Tradescantia spathacea or Tradescantia zebrina or Trifolium dubium or Trifolium hybridum or Trifolium incarnatum or Trifolium pratense or Trifolium repens or Trifolium subterraneum or Trifolium vesiculosum or Trigonella foenum-graecum or Triticum aestivum or Triticum durum or Triticum westonia or Tropaeolum majus or Tropaeolum tuberosum or Tulipa or Tulipa hybrids or Ullucus tuberosus or ϋlmus or Urocarpidium peruvianum or Valeriana officinalis or Vallota speciosa or Vanilla fragrans or Vanilla pompona or Vanilla tahitensis or Verbesina encelioides or Vernonia or Vijburnum or Vicia articulata or Vicia faba or Vicia faba or Vicia sativa or Vicia villosa or Vigna angularis or Vigna radiata or Vigna sesquipedalis or Vigna sujbterranea or Vigna unguiculata or Vigna unguϊculata ssp. cylindrica or Vigna unguiculata ssp. sesquipedalis or Vigna unguiculata ssp. unguiculata or

Viola cornuta or Vitis vi.ni.fera or Wisteria floribunda or itfisteria sinensis or Xanthosoma caracu or Zantedeschia or Zantedeschia elliottiana or Zea mays or Zigadenus fremontii or Zinnia elegans.

Any of these plants may be used, because aphids, which are capable of carrying one or more viruses, attack all of these plants. As discussed in the background section supra, there are about 4,000 species of aphids in the world of which about 250 are serious pests. Aphids have a world-wide distribution but there are far more species in temperate zones. Aphids are capable of carrying more than one species of virus and have more than one host plant. For example, Myzus persicae has peach as its primary host and a wide range of secondary hosts including many brassicas. M. persicae is capable of transmitting over 100 viruses including the potato leaf roll and Y viruses of potatoes, mosaic, yellow net and yellows viruses of sugar-beet, cauliflower mosaic plum pox, cucumber mosaic, lettuce mosaic, and turnip mosaic.

The pea aphid Acyrthosiphum pisum is found on many leguminous plants and transmits lucerne mosaic virus, pea leaf roll virus, pea enation mosaic virus, pea mosaic virus and pea enation mosaic virus. Cabbage aphid Brevicoryne brassicae is a serious pest of the major cabbage crops, cabbages, cauliflowers and brussel sprouts, like the pea aphid, the cabbage aphid is a one host species spending all its life on Brassicas.

Grain aphid Sitobion avenae_r carrot aphid Cavariella aegopodii, groundnut aphid Aphis craccivora a polyphagus species that prefers legumes, cotton aphid Aphis gossypii a polyphagus species found in warmer regions, black citrus aphid Toxoptera aυrantii a polyphagus in warmer regions, willow aphid Cavariella spp. on willows, holarctic willow leaf aphids Chaitophorus spp. on willows and poplars in Europe, black pine aphids Cinara spp. on a variety of conifers widespread in America, Africa, Asia and Europe, sycamore aphid Drepanosiphum platanoϊdes on sycamore only in Europe and North America, spruce aphids Elatobium spp. on Picea in North America and Europe.

Essentially, there are many species of aphid and these aphids often have multiple host plants that they can colonate. Moreover, as each aphid is capable of carrying a number of- different viruses, most, if not all of the plants disclosed supra, are capable of being infected with aphid- borne virus. This means that while the complete process of virus infection is not known there are many factors common to these species of plant and viruses. For example, while most of the constructs disclosed herein comprise an aphid transmission factor gene isolated from barley yellow dwarf virus, homologs of the aphid transmission factor gene from barley yellow dwarf virus are present in many viruses.

The aphid transmission factor genes are present in all plants that are infected with aphid-borne virus. All of the plants described supra can be infected by aphid-borne viruses. For example, aphid-borne viruses that are known to infect one or more of the plants listed supra include alpinia mosaic virus; andean potato mottle virus; apple mosaic virus; arabis mosaic virus; arracacha virus b; artichoke aegean ringspot virus; artichoke vein banding virus; asparagus virus; barley mild mosaic virus; barley yellow dwarf virus (subgroups i & ii) ; barley yellow mosaic virus; bean common mosaic virus; bean leaf roll virus; bean pod mottle virus; bean yellow mosaic virus; beet mild yellowing virus; beet western yellows virus; beet yellow net virus; blueberry shock virus; broad bean mottle virus; broad bean stain virus; broad bean true mosaic virus; broad bean wilt virus; brome streak mosaic virus; cardamom mosaic virus; carrot red lea virus; carrot thin leaf virus; cassava American latent virus; cassia yellow blotch virus/ celery yellow spot virus; cereal yellow dwarf virus; cherry leaf roll virus; cherry rasp leaf virus; chickpea stunt virus; chicory yellow mottle virus; citrus enation (woody gall) virus; citrus mosaic virus; clover yellow vein virus; cotton anthocyanosis virus; cowpea aphid-borne mosaic virus; cowpea chlorotic mottle virus; cowpea green vein banding virus; cowpea mosaic virus; cowpea stunt virus; cucumber mosaic virus; cucumber vein yellowing virus; cucurbit aphid-borne yellows virus; elm mottle virus; enamovirus; filaree red leaf virus; grapevine ajinashika virus; grapevine fanleaf virus; groundnut rosette assistor virus; hibiscus latent ringspot virus; Indonesian soybean dwarf virus; lamium mild mosaic virus; legume yellows virus; lettuce mosaic virus; maclura mosaic virus; maize dwarf mosaic virus; malva yellow virus; Michigan alfalfa virus; milk vetch dwarf virus; millet red leaf virus; narcissus latent virus; navel orange infectious mottling virus; oat mosaic virus; olive latent ringspot virus; papaya ringspot virus; patchouli mild mosaic virus; pea enation mosaic virus; pea green mottle virus; pea leaf roll virus; pea seed-borne mosaic virus; peach rosette mosaic virus; peanut mottle virus; pepper mottle virus; peru tomato mosaic virus; physalis mild chlorosis virus; physalis vein blotch virus; plum pox virus; pokeweed mosaic virus; potato black ringspot virus; potato leaf roll virus; potato virus a; potato virus u; potato virus v; potato virus y; prune dwarf virus; prunus necrotic ringspot virus; radish mosaic virus; raspberry leaf curl virus; raspberry ringspot virus; red clover mottle virus; rice necrosis mosaic virus; ryegrass mosaic virus_/ shallot yellow stripe virus; solanum yellow virus; sorghum mosaic virus; soybean dwarf virus; spinach latent virus; squash mosaic virus; strawberry latent ringspot virus/ strawberry mild yellow edge virus; subterranean clover red lea virus/ sweet potato latent virus; sweet potato mild mottle virus/ sweet potato yellow dwarf virus/ tamarillo mosaic virus/ telfairia mosaic virus/ tobacco etch virus; tobacco necrotic dwarf virus; tobacco streak virus; tobacco vein distorting virus/ tobacco yellow net virus/ tobacco yellow vein assistor virus/ tomato ringspot virus/ tomato top necrosis virus/ tomato yellow virus/ turnip mild yellows virus_/ turnip yellow virus/ turnip mosaic virus/ watermelon mosaic virus/ wheat spindle streak mosaic virus/ wheat streak mosaic virus / wheat yellow mosaic virus./ wild potato mosaic virus; yam mosaic virus and zucchini yellow mosaic virus.

In particular, viruses of the luteovirus family have aphid transmission factor genes that share high degrees of sequence homology. Table 1 shows the aphid transmission factor gene from different luteoviruses, in which it can be seen that a significant degree of homology exists.

C = coat P3 and systemic movement/aphid transmission P5 fusion protein [Bean leafroll virus]

D = 0RF5 is translated from ORF3 by read-through ~ read-through domain (RTD) read-through product [Soybean dwarf virus] E = Aphid transmission P5 [Cereal yellow dwarf virus-RPV] F = read through protein [Potato leafroll virus]

Therefore, although the present specification provides experimental evidence in respect of one species of monocotyledon plant and an aphid transmission factor gene derived from barley yellow dwarf virus, it will be clearly appreciated by a person skilled in the art that the transgenic plant of the invention may be any monocotyledonous plant and the aphid transmission factor gene may be from any aphid-borne virus.

The term "transgene" as used herein refers to any polynucleotide sequence, which codes for either an untranslatable or translatable aphid transmission factor polypeptide, which is introduced into the genome of a monocotyledonous plant cell by experimental manipulations. The transgene may be an "endogenous DNA sequence," or a "heterologous DNA sequence" (ie., "foreign DNA"). The term "endogenous DNA sequence" refers to a nucleotide sequence which is naturally found in the cell into which it is introduced so long as it does not contain some modification (eg. , a point mutation, the presence of a selectable marker gene, etc.) relative to the naturally-occurring sequence. The term "heterologous DNA sequence" refers to a nucleotide sequence which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature. Heterologous DNA is not endogenous to the cell into which it is introduced, but has been obtained from another cell. Heterologous DNA also includes an endogenous DNA sequence which contains some modification. Generally, although not necessarily, heterologous DNA encodes RNA and proteins that are not normally produced by the cell into which it is expressed. Examples of heterologous DNA include mutated wild-type genes (ie., wild-type genes that have been modified such that they are no longer wild-type genes) , reporter genes, transcriptional and translational regulatory sequences, selectable marker proteins (eg., proteins which confer drug resistance), etc.

Thus, once an appropriate monocotyledonous host plant has been identified as discussed above, a transgene is constructed which comprises one or more aphid transmission factor polynucleotides or functionally active fragemtns thereof. The term "functionally active," when used in reference to the aphid transmission factor polynucleotides of the present invention, refers to the paradigm in which an alteration to a nucleotide sequence does not necessarily affect the sequences ability to code for a polypeptide capable of performing substantially the same function as the unaltered "parent" polypeptide. For example, a nucleotide sequence may be truncated, elongated, or mutated in such a way that the polypeptide coded by the nucleotide sequence differs from the "parent" sequence, but still codes for a polypeptide that is capable of functioning in a substantially similar way to the ""parent" molecule. Consequently, a functionally active derivative, analog, homolog or variant of the aphid transmission factor polynucleotide of the present invention will have a nucleotide sequence which differs from the nucleotide sequences shown in Figure 1 or Figure 2, but the polypeptide coded for by the functionally active derivative, analog, homolog or variant is capable of displaying one or more known functional activities associated with the aphid transmission factor polypeptides. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous.

It will be appreciated by those skilled in the art that a functionally active derivative, analog, homolog or variant of the aphid transmission factor polynucleotide of the present invention can vary substantially outside regions of importance eg receptor binding sites; however, regions of high sequence conservation between aphid transmission factor polynucleotides isolated from different virus species are likely to code for important regions such as receptor binding sites and the like. Accordingly, it is likely that mutations in these highly conserved regions will not generate functionally active derivatives, analogs, homologs or variants. For example, the conserved nucleotide sequences shown in Table 1 are likely to remain unchanged unless the changes are extremely conservative.

Sequences that are substantially similar can be identified in a Southern hybridisation experiment, for example under high, medium or low stringency conditions as defined for that particular system. Defining appropriate hybridisation conditions is within the skill of the art. See eg., Sambrook et al., DNA Cloning, vols. I, II and III. Nucleic Acid Hybridization. However, ordinarily, "stringent conditions" for hybridisation or annealing of nucleic acid molecules are those that

(1) employ low ionic strength and high temperature for washing, for example, 0.015M NaCl/0.0015M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50⁰C, or

(2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/5OmM sodium phosphate buffer at pH 6.5 with 75OmM NaCl, 75mM sodium citrate at 42°C.

An example of medium stringency conditions for hybridisation is the use of 50% formamide, 5 X SSC (0.75M NaCl, 0.075M sodium citrate), 5OmM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 X Denhardt's solution, sonicated salmon sperm DNA (50μg/mL), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 X SSC and 0.1% SDS.

By way of further example, and not intended as limiting, low stringency conditions include those described by Shilo and Weinberg in 1981 (Proc. Natl. Acad. Sci. USA 78:6789- 6792) . When filters containing DNA are treated using these conditions they are usually pre-treated for 6h at 4O⁰C in a solution containing 35% formamide, 5 X SSC, 5OmM Tris-HCl (pH 7.5), 5mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500μg/ml denatured salmon sperm DNA. Hybridisations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, lOOμg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X 10⁶ cpm ³²P-labeled probe is used. Filters are incubated in hybridisation mixture for 18-2Oh at 40⁰C, and then washed for 1.5h at 55°C in a solution containing 2 X SSC, 25mM Tris-HCl (pH 7.4), 5mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5h at 60⁰C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re-exposed to film. Other conditions of low stringency, which may be used are well known in the art (eg., as employed for cross-species hybridisations) .

The aphid transmission factor polynucleotides, functionally active derivatives, analogs or variants of the invention can be produced by various methods known in the art. For example, cloned aphid transmission factor polynucleotides can be modified by any of numerous strategies known in the art (See, for example, Maniatis, T., 1990, Molecular Cloning, A Laboratory Manual, 2d ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) . The sequence can be cleaved at appropriate sites with restriction endonuclease (s) , followed by further enzymatic modification if desired, isolated, and ligated in vitro.

Additionally, the aphid transmission factor encoding polynucleotide sequences can be mutated in vitro or in vivo, to create or destroy functional regions or create variations in functional regions and/or form new restriction endonuclease sites or destroy pre-existing ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including, but not limited to, chemical mutagenesis, in vitro site-directed mutagenesis (Hutchinson et al., 1978, J. Biol. Chem 253:6551) .

Alternatively, polynucleotide variants of the aphid transmission factor polynucleotides may result from degenerate codon substitutions or complementary sequences. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer, et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka, et al., J. Biol. Chem. 260: 2605-2608 (1985) ; and Rossolini, et al. , MoI. Cell. Probes 8: 91-98 (1994)) . Alternatively, a variant may be a polynucleotide which is substantially similar to SEQ ID NO: 1 (Figure 1), or in which one or more nucleotides have been added, deleted or substituted, at the 3' and/or 5' end(s) of the polynucleotide, or within the polynucleotide.

In one embodiment, the aphid transmission factor polynucleotides are double-stranded DNA molecules having at least 85% nucleotide sequence identity with SEQ ID NO 1. Once the appropriate transgene has been identified and either isolated or constructed, it is incorporated into an expression vector by standard techniques. Accordingly, the present invention also contemplates an expression vector comprising the transgene of the present invention. Thus, in one embodiment an expression vector is constructed which comprises an isolated and purified DNA molecule comprising a promoter operably linked to the coding region for the untranslatable aphid transmission factor, which coding region is operatively linked to a transcription-terminating region, whereby the promoter drives the transcription of the coding region. The coding region may include a segment or sequence encoding the untranslatable aphid transmission factor. The DNA molecule comprising the expression vector may also contain a plant intron, and may also contain other plant elements such as sequences encoding untranslated sequences (UTL's) and sequences which act as enhancers of transcription or translation.

Preferred plant transformation vectors include, but are not limited to, those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, eg., by Herrera-Estrella (1983), Bevan (1983), Klee (1985) and Eur. Pat. Appl. No. EP 0120516 (each specifically incorporated herein by reference) .

As the expression vectors of the present invention are preferably used to transform a monocotyledonous plant, a promoter is selected that has the ability to drive expression in that particular species of plant. Promoters that function in different plant species are also well known in the art. Promoters useful in expressing the polypeptide in plants are those which are inducible, viral, synthetic, or constitutive as described (Odell et al., 1985) , and/or temporally regulated, spatially regulated, and spatio-temporally regulated. Preferred promoters include the enhanced CaMV35S promoters, and the FMV35S promoter.

The expression of a gene which exists in double-stranded DNA form localised to the plant nuclear genome involves transcription of messenger RNA (mRNA) from the coding strand of the DNA by an RNA polymerase enzyme, and the subsequent processing of the mRNA primary transcript inside the nucleus. Transcription of DNA into mRNA is regulated by a region of DNA referred to as the "promoter". The DNA comprising the promoter is represented by a sequence of bases that signals RNA polymerase to associate with the DNA and to initiate the transcription of mRNA using one of the DNA strands as a template to make a corresponding strand of RNA. The particular promoter selected should be capable of causing sufficient transciption of the aphid transmission factor coding sequence to result in the substantial protection from viral infection in the resultant plant by the aphid-borne virus associated with the particular aphid transmission factor.

Aphid transmission factor polynucleotides of the present invention can be driven by a variety of promoters in plant tissues. Promoters can be near-constitutive (ie. they drive transcription of the transgene in all tissue) , such as the CaMV35S promoter, the 1'-or 2 ' -promoter derived from T-DNA of Agrobacterium tumafaciens, or tissue-specific or developmentally specific. Enhanced or duplicate versions of the CaMV35S and FMV35S promoters are particularly useful in the practice of this invention (Kay et al., 1987; Rogers, U.S. Pat. No. 5,378,619) .

Alternatively, the plant promoter may be under environmental control. Such promoters are referred to here as ^λλinducible" promoters. Examples of environmental conditions that may effect transcription by inducible promoters include pathogen attack, anaerobic conditions, or the presence of light.

Preferably, a promoter that is capable of directing strong expression is used. Such promoters include, but are not limited to, the maize ubiquitin promoter described in Christensen and Quail (1996) , the rice actin promoter as described in McElroy D, Blowers AD Jenes B and Wu R (1991), the commelina yellow mottle promoter as described in Medberry SL, Lockhart BEL and Olszewskine (1992) . Those skilled in the art will recognise that there are a number of promoters, which are active in plant cells, and have been described in the literature. Such promoters may^¬ be obtained from plants or plant viruses and include, but are not limited to, the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of A. tumefaciens) , the cauliflower mosaic virus (CaMV) 19S and 35S promoters, the light- inducible promoter from the small subunit of ribulose 1,5- bisphosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide) , the rice Actl promoter and the Figwort Mosaic Virus (FMV) 35S promoter. All of these promoters have been used to create various types of DNA constructs which have been expressed in plants (see eg._f McElroy et al., 1990, U.S. Pat. No. 5,463,175) .

In addition, it may also be preferred to bring about expression of the aphid transmission factor polynucleotide by using plant integrating vectors containing a tissue- specific promoter. Specific target tissues may include the leaf, stem, root, tuber, seed, fruit, etc., and the promoter chosen should have the desired tissue and developmental specificity. Therefore, promoter function should be optimised by selecting a promoter with the desired tissue expression capabilities and approximate promoter strength, and selecting a transformant, which produces the desired level of resistance in the target tissues. This selection approach from the pool of transformants is routinely employed in expression of heterologous- structural genes in plants since there is variation between transformants containing the same heterologous gene due to the site of gene insertion within the plant genome (commonly referred to as "position effect") . In addition to promoters which are known to cause transcription (constitutive or tissue-specific) of DNA in plant cells, other promoters may be identified for use in the current invention by screening a plant cDNA library for genes which are selectively or preferably expressed in the target tissues, then determining the promoter regions.

Other exemplary tissue-specific promoters are corn sucrose synthetase 1 (Yang et al., 1990), corn alcohol dehydrogenase 1 (Vogel et al., 1989), corn light harvesting complex (Simpson, 1986), corn heat shock protein (Odell et al., 1985), pea small subunit RuBP carboxylase (Poulsen et al., 1986; Cushmore et al. , 1983), Ti plasmid mannopine synthase (McBride and Summerfelt, 1989), Ti plasmid nopaline synthase (Langridge et al., 1989), petunia chalcone isomerase (Van Tunen et al., 1988), bean glycine rich protein 1 (Keller et al., 1989) and Potato patatin (Wenzler et al., 1989) promoters. Preferred promoters are the cauliflower mosaic virus (CaMV 35S) promoter and the S- E9 small subunit RuBP carboxylase promoter.

The promoters used in the DNA constructs of the present invention may be modified, if desired, to affect their control characteristics. For example, the CaMV35S promoter may be ligated to the portion of the ssRUBISCO gene that represses the expression of ssRUBISCO in the absence of light, to create a promoter which is active in leaves but not in roots. For purposes of this description, the phrase ^λλCaMV35S" promoter thus includes variations of CaMV35S promoter, eg. , promoters derived by means of ligation with operator regions, random or controlled mutagenesis, etc. Furthermore, the promoters may be altered to contain multiple "enhancer sequences" to assist in elevating gene expression. Examples of such enhancer sequences have been reported by Kay et al. (1987) .

A transgenic plant of the present invention produced from a plant cell transformed with a tissue specific promoter can be crossed with a second transgenic plant developed from a plant cell transformed with a different tissue specific promoter to produce a hybrid transgenic plant that shows the effects of transformation in more than one specific tissue.

The RNA produced by a DNA construct of the present invention may also contain a 5' non-translated leader sequence (5¹UTL) . This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA. The 5' non-translated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence. The present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. One plant gene leader sequence for use in the present invention is the petunia heat shock protein 70 (hsp70) leader (Winter et al., 1988) .

5^f UTL' s are capable of regulating gene expression when localised to the DNA sequence between the transcription initiation site and the start of the coding sequence.

Compilations of leader sequences have been made to predict optimum or sub-optimum sequences and generate "consensus" and preferred leader sequences (Joshi, 1987) . Preferred leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the linked structural gene, ie. to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants, and in maize in particular, will be most preferred. One particularly useful leader may be the petunia HSP70 leader.

For optimised expression an intron may also be included in the DNA expression construct. Such an intron is typically placed near the 5' end of the iriRNA in untranslated sequence. This intron could be obtained from, but not limited to, a set of introns consisting of the maize heat shock protein (HSP) 70 intron (U.S. Pat. No. 5,424,412; 1995), the rice Actl intron (McElroy et al., 1990), the Adh intron 1 (Callis et al., 1987), or the sucrose synthase intron (Vasil et al., 1989) .

The 3 ' non-translated region of the genes of the present invention which are localised to the plant nuclear genome also contain a polyadenylation signal which functions in plants to cause the addition of adenylate nucleotides to the 3' end of the mRNA. RNA polymerase transcribes a nuclear genome coding DNA sequence through a site where polyadenylation occurs. Typically, DNA sequences located a few hundred base pairs downstream of the polyadenylation site serve to terminate transcription. Those DNA sequences are referred to herein as transcription-termination regions. Those regions are required for efficient polyadenylation of transcribed messenger RNA (mRNA) . Examples of preferred 3' regions are (1) the 3' transcribed, non-translated regions containing the polyadenylation signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene and (2) the 3' ends of plant genes such as the pea ribulose-

1, 5-bisphosphate carboxylase small subunit gene, designated herein as E9 (Fischhoff efc al., 1987) . Constructs will typically include the aphid transmission factor polynucleotides along with a 3' end DNA sequence that acts as a signal to terminate transcription and, in constructs intended for nuclear genome expression, allow for the poly¬ adenylation of the resultant mRNA. The most preferred 3' elements are contemplated to be those from the nopaline synthase gene of A. tumefaciens (nos 3'end) (Bevan et al., 1983) , the terminator for the T7 transcript from the octopine synthase gene of A. tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato. Regulatory elements such as TMV ω element (Gallie, et al., 1989) , may further be included where desired.

Transcription enhancers or duplications of enhancers could be used to increase expression. These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted in the forward or reverse orientation 5' or 3' to the coding sequence. Examples of enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis et al., 1987), the rice actin gene, and promoter from non-plant eukaryotes (eg., yeast; Ma et al., 1988) .

In certain embodiments of the invention, the use of internal ribosome binding sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988) . IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991) . IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.

Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi- subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker.

The choice of which expression vector and ultimately to which promoter the aphid transmission factor polynucleotide is operatively linked depends directly on the host cell to be transformed. These are well known limitations inherent in the art of constructing recombinant DNA molecules. However, a vector useful in practicing the present invention is capable of directing the expression of the aphid transmission factor coding region to which it is operatively linked.

The vector comprising the sequences from the aphid transmission factor sequence will also typically comprise a marker gene which confers a selectable phenotype on plant cells. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanarαycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosluforon, or phosphinothricin (the active ingredient in bialaphos and Basta) .

In one embodiment, the coding sequence component comprises a modified nucleic acid sequence which, when transcribed, produces a modified RNA molecule corresponding to a target viral sequence. The target viral sequence is a mRNA molecule of the target virus, or a portion thereof. Since the target viral sequence is naturally translatable when a translation initiation codon is present, it is modified so as to render it untranslatable. For any given target viral sequence, the skilled artisan will be able to determine various modifications which could be made to render the resulting RNA molecule untranslatable.

Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of A. tumefaciens described (Rogers et al., 1987) . However, several other plant integrating vector systems are known to function in plants including pCaMVCN transfer control vector described (Fromm et al., 1985) . pCaMVCN (available from Pharmacia, Piscataway, N.J.) includes the CaMV35S promoter.

In one embodiment, the vector used to express the aphid transmission factor polynucleotide includes a selection marker that is effective in a plant cell. In another embodiment, the genes coding for the aphid transmission factor polynucleotide and/or selection marker are on two or more separate vectors. Selection markers can be drug resistance selection markers or metabolic selection markers. One preferred drug resistance marker is the gene whose expression results in kanamycin resistance; ie. the chimeric gene containing the nopaline synthase promoter, Tn5 neomycin phosphotransferase II (nptll) and nopaline synthase 3' non-translated region described (Rogers et al., 1988) .

Means for preparing expression vectors are well known in the art. Expression (transformation) vectors used to transform plants and methods of making those vectors are described in U.S. Pat. Nos. 4,971,908, 4,940,835, 4,769,061 and 4,757,011 (each of which is specifically incorporated herein by reference) . Those vectors can be modified to include a coding sequence in accordance with the present invention.

A variety of methods have been developed to operatively link DNA to vectors via complementary cohesive termini or blunt ends. For instance, complementary homopolyruer tracts can be added to the DNA segment to be inserted and to the vector DNA. The vector and DNA segment are then joined by hydrogen bonding between the complementary homopolymeric tails to form recombinant DNA molecules.

In one embodiment double-stranded DNA coding for an untranslatable aphid transmission factor as, for example, shown in Figure 1 (SEQ ID No. 1), is ligated to the CaMV35S promoter and the ADH enhancer element to form an expression vector such as "pCYAT", which is shown in Figure 3.

A monocotyledonous plant transformed with an expression vector of the present invention is also contemplated. A transgenic plant derived from such a transformed or transgenic cell is also contemplated. Those skilled in the art will recognise that a chimeric plant gene containing a structural coding sequence of the present invention can be inserted into the genome of a plant by methods well known in the art. Such methods for DNA transformation of plant cells include _4grojbacteriuin-mediated plant transformation, the use of liposomes, transformation using viruses or pollen, electroporation, protoplast transformation, gene transfer into pollen, injection into reproductive organs, injection into immature embryos and particle bombardment. Each of these methods has distinct advantages and disadvantages. Thus, one particular method of introducing genes into a particular plant strain may not necessarily be the most effective for another plant strain, but it is well known which methods are useful for a particular plant strain.

There are many methods for introducing transforming DNA segments into cells, but not all are suitable for delivering DNA to plant cells. Suitable methods are believed to include virtually any method by which DNA can be introduced into a cell, such as infection by A. tumefaciens and related Agrobacterium strains, direct delivery of DNA such as, for example, by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA uptake, by electroporation, by agitation with silicon carbide fibres, by acceleration of DNA coated particles, etc. In certain embodiments, acceleration methods are preferred and include, for example, microprojectile bombardment and the like.

Technology for introduction of DNA into cells is well-known to those of skill in the art. Four general methods for delivering a gene into cells have been described: (1) chemical methods (Graham and van der Eb, 1973); (2) physical methods such as microinjection (Capecchi, 1980) , electroporation (Wong and Neumann, 1982; Fromm et al., 1985) and the gene gun (Johnston and Tang, 1994; Fynan et al., 1993) ; (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis and Anderson, 1988a; 1988b); and (4) receptor-mediated mechanisms (Curiel et al., 1991; 1992; Wagner et al. , 1992) .

The application of brief, high-voltage electric pulses to a variety of animal and plant cells leads to the formation of nanometer-sized pores in the plasma membrane. DNA is taken directly into the cell cytoplasm either through these pores or as a consequence of the redistribution of membrane components that accompanies closure of the pores.

Electroporation can be extremely efficient and can be used both for transient expression of cloned genes and for establishment of cell lines that carry integrated copies of the gene of interest. Electroporation, in contrast to calcium phosphate-mediated transfection and protoplast fusion, frequently gives rise to cell lines that carry one, or at most a few, integrated copies of the foreign DNA.

The introduction of DNA by means of electroporation is well-known to those of skill in the art. To effect transformation by electroporation, one may employ either friable tissues such as a suspension culture of cells, or embryogenic callus, or alternatively, one may transform immature embryos or other organised tissues directly. One would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wounding in a controlled manner, rendering the cells more susceptible to transformation. Such cells would then be recipient to DNA transfer by electroporation, which may be carried out at this stage, and transformed cells then identified by a suitable selection or screening protocol dependent on the nature of the newly incorporated DNA.

A further advantageous method for delivering transforming DNA segments to plant cells is microprojectile bombardment. In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. Using these particles, DNA is carried through the cell wall and into the cytoplasm on the surface of small metal particles as described (Klein et al., 1987; Klein et al., 1988; Kawata et al., 1988) . The metal particles penetrate through several layers of cells and thus allow the transformation of cells within tissue explants.

An advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly stably transforming plant cells, is that neither the isolation of protoplasts (Cristou et al., 1988) nor the susceptibility to Agrojbacterium infection is required. An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with the plant cultured cells in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient cells by projectiles that are too large.

For the bombardment, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein one may obtain up to 1000 or more foci of cells transiently expressing a marker gene. The number of cells in a focus which express the exogenous gene product 48 hours post-bombardment often range from 1 to 10 and average 1 to 3.

In bombardment transformation, one may optimise the pre- bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearised DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature plant embryos.

Accordingly, it is contemplated that one may desire to adjust various of the bombardment parameters in small scale studies to fully optimise the conditions. One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure. One may also minimise the trauma reduction factors (TRFs) by modifying conditions which influence the physiological state of the recipient cells and which may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation. The execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.

The methods of particle-mediated transformation is well- known to those of skill in the art. U.S. Pat. No. 5,015,580 (specifically incorporated herein by reference) describes the transformation of soybeans using such a technique.

Agrobacteriurn-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacteriuzn-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described (Fraley efc al., 1985; Rogers et al._r 1987) . The genetic engineering of cotton plants using Agrobacterium- mediated transfer is described in U.S. Pat. No. 5,004,863 (specifically incorporated herein by reference) ; like transformation of lettuce plants is described in U.S. Pat. No. 5,349,124 (specifically incorporated herein by reference) ; and the Agrobacter±um-mediated transformation of soybean is described in U.S. Pat. No. 5,416,011 (specifically incorporated herein by reference) . Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome as described (Spielmann et al., 1986; Jorgensen et al., 1987) .

Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., 1985) . Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various polypeptide coding genes. The vectors described (Rogers et al., 1987), have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.

Agrobacterium-mediated transformation of leaf disks and other tissues such as cotyledons and hypocotyls appears to be limited to plants that Agrobacterium naturally infects. Agrojbacterium-mediated transformation is most efficient in dicotyledonous plants. Few monocots appear to be natural hosts for Agrobacterium, although transgenic plants have been produced in asparagus using Agrobacterium vectors as described (Bytebier et al., 1987) . Other monocots recently have also been transformed with Agrobacterium. Included in this group are corn (Ishida et al.) and rice (Cheng et al.) .

A transgenic plant formed using Agrohacterium transformation methods typically contains a single gene on one chromosome. Such transgenic plants can be referred to as being heterozygous for the added gene. However, inasmuch as use of the word "heterozygous" usually implies the presence of a complementary gene at the same locus of the second chromosome of a pair of chromosomes, and there is no such gene in a plant containing one added gene as here, it is believed that a more accurate name for such a plant is an independent segregant ("hemizygous") , because the added, exogenous gene segregates independently during mitosis and meiosis.

An independent segregant may be preferred when the plant is commercialised as a hybrid, such as corn. In this case, an independent segregant containing the gene is crossed with another plant, to form a hybrid plant that is heterozygous for the gene of interest.

An alternate preference is for a transgenic plant that is homozygous for the added aphid transmission factor polynucleotide; ie. a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants produced for gene of interest activity and mendelian inheritance indicating homozygosity relative to a control (native, non-transgenic) or an independent segregant transgenic plant.

Two different transgenic plants can be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes that encode a polypeptide of interest. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated.

Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see eg., Potrykus et al., 1985; Lorz et al._r 1985; Fromm et al., 1985; Uchimiya et al., 1986; Callis et al., 1987; Marcotte et al., 1988) .

Application of these systems to different plant germplasm depends upon the ability to regenerate that particular plant variety from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (see, eg., Fujimura et al., 1985; Toriyama et al., 1986; Yamada et al., 1986; Abdullah et al., 1986) .

To transform plant germplasm that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilised. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, 1988) .

DNA can also be introduced into plants by direct DNA transfer into pollen as described (Zhou et al., 1983; Hess, 1987) . Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described (Pena et al. , 1987) . DNA can also be injected directly into the cells of immature embryos and introduced into cells by rehydration of desiccated embryos as described (Neuhaus et al., 1987; Benbrook et al., 1986) .

After effecting delivery of exogenous aphid transmission factor polynucleotides to recipient monocot cells, the next step to obtain the transgenic plants of the present invention generally concerns identifying the transformed cells for further culturing and plant regeneration. As mentioned herein, in order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene as, or in addition to, the aphid transmission factor polynucleotide. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.

An exemplary embodiment of methods for identifying transformed cells involves exposing the transformed cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, herbicide or the like. Cells which have been transformed and have stably integrated a marker gene conferring resistance to the selective agent used, will grow and divide in culture. Sensitive cells will not be amenable to further culturing. One example of a preferred marker gene confers resistance to glyphosate. When this gene is used as a selectable marker, the putatively transformed cell culture is treated with glyphosate. Upon treatment, transgenic cells will be available for further culturing while sensitive, or non- transformed cells, will not. This method is described in detail in U.S. Pat. No. 5,569,834, which is specifically incorporated herein by reference. Another example of a preferred selectable marker system is the neomycin phosphotransferase (nptll) resistance system by which resistance to the antibiotic kanamycin is conferred, as described in U.S. Pat. No. 5,569,834 (specifically incorporated herein by reference) . Again, after transformation with this system, transformed cells will be available for further culturing upon treatment with kanamycin, while non-transformed cells will not. Yet another preferred selectable marker system involves the use of a gene construct conferring resistance to paromomycin. Use of this type of a selectable marker system is described in U.S. Pat. No. 5,424,412 (specifically incorporated herein by reference) .

Another preferred selectable marker system involves the use of the genes contemplated by this invention. In particular, cells transformed with the aphid transmission factor polynucleotide or functional equivalents will develop viral resistance. Plant cells which have had a recombinant DNA molecule introduced into their genome can thus be selected from a population of cells which failed to incorporate a recombinant molecule by growing the cells and isolating cells which are resistant to viral attack.

It is further contemplated that combinations of screenable and selectable markers will be useful for identification of transformed cells. In some cell or tissue types a selection agent, such as glyphosate or kanamycin, may either not provide enough killing activity to clearly recognise transformed cells or may cause substantial non-selective inhibition of transformants and non-transformants alike, thus causing the selection technique to not be effective. It is proposed that selection with a growth inhibiting compound, such as glyphosate at concentrations below those that cause 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as a gene that codes for kanamycin resistance would allow one to recover transformants from cell or tissue types that are not amenable to selection alone. It is proposed that combinations of selection and screening may enable one to identify transformants in a wider variety of cell and tissue types.

The development or regeneration of plants from either single plant protoplasts or various explants is well known in the art (Weissbach and Weissbach, 1988) . This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualised cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.

The development or regeneration of plants containing the foreign, exogenous gene that encodes a polypeptide of interest introduced by Agrobacterium from leaf explants can be achieved by methods well known in the art such as described (Horsch et al., 1985) . In this procedure, transformants are cultured in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant strain being transformed as described (Fraley et al., 1983) . In particular, U.S. Pat. No. 5,349,124 (specification incorporated herein by reference) details the creation of genetically transformed lettuce cells and plants resulting therefrom which express hybrid crystal proteins conferring insecticidal activity against Lepidopteran larvae to such plants.

This procedure typically produces shoots within two to four months and those shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Shoots that rooted in the presence of the selective agent to form plantlets are then transplanted to soil or other media to allow the production of roots. These procedures vary depending upon the particular plant strain employed, such variations being well known in the art.

Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants, or pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. These lines can be either inbred or out bred lines. Conversely, pollen from plants of those important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

In one embodiment, a transgenic plant of this invention thus has an increased amount of genes for aphid transmission factor mRNA. A preferred transgenic plant is an independent segregant and can transmit these genes and their activities to its progeny. A more preferred transgenic plant is homozygous for the aphid transmission factor polynucleotide, and transmits these to its entire offspring on sexual mating. Seed from a transgenic plant may be grown in the field or greenhouse, and resulting sexually mature transgenic plants are self-pollinated to generate true breeding plants. The progeny from these plants become true breeding lines that are evaluated for expression of the aphid transmission factor transgene.

It is contemplated that in some instances the genome of a transgenic plant will have been augmented through the stable introduction of one or more aphid transmission factor transgenes, either native, synthetically modified, or mutated. In some instances, more than one transgene will be incorporated into the genome of the transformed host plant cell. Such is the case when more than one aphid transmission factor-encoding DNA segments are incorporated into the genome of such a plant. In certain situations, it may be desirable to have one, two, three, four, or even more aphid transmission factor genes (either native or recombinantly-engineered) incorporated and stably expressed in the transformed transgenic plant.

Throughout the specification, the word "comprise" and variations of the word, such as "comprising" and "comprises", means "including but not limited to" and is not intended to exclude other additives, components, integers or steps.

The invention will now be further described by way of reference only to the following non-limiting examples. It should be understood, however, that the examples following are illustrative only, and should not be taken in any way as a restriction on the generality of the invention described above. In particular, while the invention is described in detail in relation to the use of aphid transmission factor genes isolated from barley yellow dwarf virus, it will be clearly understood that the findings herein are not limited to these sources of aphid transmission factor genes.

EXAMPLE 1 BARLEY YELLOW DWARF VIRUS (BYDV) -PAV ISOLATE

The BYDV-PAV Western Australia (PAV-WAl) isolate, which was identified with anti-serum reaction and ELISA assay, was originally isolated from wheat plants from Western

Australia by the Plant Pathology group of Agriculture Western Australia. The inventors sequenced the complete nucleotide sequence of this isolate. Based on sequence information, the homology at nucleotide level and identity at amino acid level of the aphid transmission factor (ATF) protein, the PAV-WAl and CSRIO isolates (Miller et al., 1988, Accession Number: X07653) are identical (100%).

EXAMPLE 2 PRIMER DESIGN

Primers for amplification of an untranslatable AT gene from BYDV PAV-WAl were designed based on the complete nucleotide sequence information. Forward primer (AT For) was:

5' GGATCCATGAGAAATGTGAAACGAAAGTCATCG (SEQ ID NO: 3)

Reverse primer (AT Rev) was: 5'GGTACCTCACTGGAATTGCGCCTTGTACGACTTTGC (SEQ ID NO: 4) .

The length of the predicted AT gene PCR product was 1133 bp.

EXAMPLE 3 RT-PCR AND PCR CONDITIONS

Total-RNA was extracted from about lOOmg of leaf material from BYDV infected leaves using an Ambion RNAqueous kit in accordance with the manufacturer's instructions. Extracted RNA for use as a template in cDNA synthesis was stored at -80⁰C in 50μl aliquots.

cDNA was synthesised by reverse transcriptase reaction.

Reagents were supplied by Applied Biosystems (MuLV reverse transcriptase, RNase Inhibitor, AmpliTaq DNA polymerase, 1OX PCR buffer II and dNTPs) . A RT-PCR reaction was initiated which used 4 mM MgCl₂, 1 X PCR Buffer II, 5 U RNase Inhibitor, 12.5 U MuLV Reverse Transcriptase, 1 mM dNTPs, 10 pmol downstream primer, 0.5 μl RNA extract, and RNase-free H₂O to a final volume of 10 μl. The reaction was incubated at 42°C for 15 min and then 99°C for 5 min to denature the reverse transcriptase enzyme.

For the PCR step, the volume was increased to 50 μl maintaining conditions of 4 mM MgCl₂ and 1 X PCR Buffer II, and adding 1.25 U Taq DNA Polymerase and 10 pmol upstream primer. The PCR cycling run consisted of an initial denaturation period of 3 min at 94 C followed by 30 cycles of 94°C 1 min, 60^°C 1 min, 72^°C 2 min, followed by a final extension cycle of 72°C for 7 min. The Perkin Elmer PCR System 2400 Thermal Cycler was used for RT-PCR and PCR experiments in 0.2 ml reaction tubes.

PCR products were analysed in a 1% agrose gel, stained with ethidium bromide and compared with standard of 1 kb plus DNA molecular marker. Amplified product was purified from agrose gel using SuperClean™ DNA kit (Geneworks) in accordance with the manufacturer's instructions. The right size band of interest was excised from the gel with a clean razor blade, 3 gel volumes of Bresa-Salt was added and the mixture incubated at 56°C for 5 min to dissolve the agarose. 7 μl Bresa-Bind silica matrix was added, the solution mixed thoroughly and the tube incubated at room temperature for 5 min to bind DNA. The Bresa-Bind/DNA matrix was pelleted by centrifugation at 20,800 g for 17 sec, the supernatant discarded and the pellet washed by resuspending the matrix in an equal volume of Bresa-Wash solution. The tube was then centrifuged for 17 sec, the supernatant discarded and all traces of wash removed by evaporation in a Speedivac. The DNA was eluted from the Bresa-Bind matrix by resuspending the pellet in 20 μl distilled water and incubating the solution in a water bath for 5 min at 5β°C. The tube was centrifuged at 20,800 g for 1 min and the supernatant, containing the purified DNA, was transferred to a new tube.

A PCR-amplified band of the right size was so amplified and purified.

EXAMPLE 4 CLONING QF THE AT GENE INTO pGEMT VECTOR

The gel purified PCR product from Example 3 was ligated into pGEMT-vector according to the manufacturer's instructions, followed by transformation of the ligation product into E. coli competent cells (DHlOB strain) with white/blue screening induced by IPTG and X-gal. Four white colonies were picked from the plate and grown in the LB broth with ampicillin at lOOmg/1 overnight. The plasmids were purified from bacterium culture with QIAGEN spin columns. The plasmids were double digested by Bam HI and Kpn I to screen the positive colonies. Positive colonies with the correct digestion pattern were obtained.

EXAMPLE 5 SEQUENCING THE AT GENE

Sequencing was carried out on two positive clones identified in Example 4 using an automated sequencer ABI377 (Applied Biosystems Industries) in according with the manufacturer's instructions. The sequencing was performed with the T7 (5¹ CTATGACCATGATTACGCCAAGC) and Spβ (5'

CTATGACCATGATTACGCCAAGC) primers from both directions. The SeqEd™ version 1.0.3 software (Applied Biosystems Industries) was used to analyse raw sequence data and the GCG-programs (Wisconsin Package Version 8.1- unix Genetics Computer Group, Madison WI) were used for homology comparisons.

Figure 1 shows the nucleotide sequence obtained while Figure 2 shows the complete, translatable sequence for the aphid transmission factor from BYDV.

EXAMPLE 6 CLONING THE AT GENE INTO PCY VECTOR

After finishing sequence confirmation, the AT gene was digested out of the pGEMT vector with Bam HI and Kpn I and ligated into the multiple cloning site (MCS) of a pCY vector, which contains a CoYMV promoter and Nos terminator, to generate pCYAT vector for wheat transformation (see Figure 3) . The pCYAT vector was produced using checked AT gene sequence.

EXAMPLE 7 PRODUCTION OF TRANSGENIC WHEAT PLANTS WITH

CYAT CONSTRUCT

A population of transgenic wheat plants, containing pCYAT construct as described in Example 6, was generated using the following procedures. Target tissues

Wheat plants (cultivar: Westonia) were grown at 22-24⁰C in a glasshouse. Seeds containing immature embryos were harvested at 11-15 days post-anthesis and surface sterilised. Immature embryos were excised and placed on MS (Murashige and Shoog, 1962) medium containing 2.5 mg/1 2,4 dichlorophenoxyacetic acid (2,4-D) for seven to sixteen days prior to bombardment.

Microprojectile Bombardment

Osmoticum treatment of target tissues, DNA precipitation and microprojectile bombardment were performed as described for sugarcane (Bower et al., 1996) with the exception of the use of tungsten particles. Wheat tissues were bombarded with 250 μg of gold particles per bombardment.

The plasmids used for bombardment were pCAM (Weeks et al., 2000) , which encodes cyanamide hydratase protein to degrade the cyanamide, in equal molecular concentrations with the construct pCYAT.

Selection of cyanamide resistant plants

Following bombardment the embryos were placed on MS medium containing 2.5mg/l 2,4-D for two weeks at 24⁰C in the dark and transferred to the same medium plus 40mg/l cyanamide (Sigma) for a further two weeks under the same culture conditions. They were then cultured for two weeks as previously, but with 50mg/l cyanamide in the MS medium. The tissues were then transferred to MS medium lacking 2,4-D and containing 50mg/l cyanamide, and placed in the light for regeneration. After two weeks tissues were transferred under the same culture conditions. Green transgenic (T₀) plants were transferred to H strength MS containing 65mg/l cyanamide to produce roots and then established in soil in pots in the glasshouse. From 4800 bombarded embryos 100 plants were regenerated.

EXAMPLE 8 DETECTION QF TRANSGENES IN REGENERATED LINES

A population of To lines resistant to cyanamide was generated, as described above, and plants were analysed by PCR to determine which contained the AT transgene. The method of DNA extraction from wheat leaf was adapted from that described by Dellaporta et al. (1983) . Leaves were harvested fresh from the plant to obtain 3 cm of leaf tip. The leaves were quickly frozen in liquid nitrogen and then crushed to a powder. The powder was transferred to a 1.5 ml Eppendorf tube and 500 μl of extraction buffer added (500 mM NaCl, 100 mM Tris-HCl pH 8.0, 50 mM EDTA and 0.6%

2-mercaptoethanol) . Then 10 μl of 20% SDS was added to the tube which was incubated at 65°C with occasional shaking for 10 min. After incubation, 50 μl of 5 M potassium acetate was added with shaking and the tube placed on ice for 20 min. Following centrifugation at 14,000 rpm for 20 min the supernatant was transferred to a clean 1.5 ml Eppendorf tube containing 100 μl isopropanol. The tube was then incubated at -20⁰C for 1 hr before centrifugation at 20,800 g for 20 min. The supernatant was removed and the tube drained for a few minutes before resuspending the pellet in 700 μl of TE (10 mM Tris-HCl pH 8.0, 10 mM EDTA) . This was transferred to an Eppendorf tube containing 7 μl of ribonuclease enzyme (10 mg/ml) and incubated at 37⁰C for 1 hr. 75 μl of 3 M sodium acetate (pH 5.3) was added and the sample centrifuged at 20,800 g for 15 min. The supernatant was transferred to a new Eppendorf tube and the DNA precipitated with 500 μl of isopropanol at room temperature. After 5 min, the DNA was pelleted by centrifugation at 20,800 g for 15 min and the supernatant discarded. The pellet was washed with cold 70% ethanol, then dried in a Speedivac and resuspended in 20 μl TE buffer. The PCR conditions were the same as those described in Example 3 (PCR part) , the differences were using 1 μl genomic DNA as the template, and also actin gene primers were added as an internal reaction control. Negative controls consisted of leaf tissue from a non-transgenic Westonia wheat plant and a PCR reaction using water as a sample template. Positive controls consisted of 20ng of the appropriate plasmid DNA.

From the one hundred regenerated lines, eight tested positive for the AT transgene. The results of an example PCR test for the presence of the introduced BYDV replicase gene is shown in Figure 4.

EXAMPLE 9 CHALLENGE OF TRANSGENIC WHEAT LINES WITH

BYDV

To determine whether a proportion of plants containing the AT-based constructs show resistance to BYDV infection, as predicted on the basis of the method of introduction of the constructs and on the design of the constructs, the transgenic lines were analysed using the following procedures.

From the subpopulation of eight To wheat plants (cvs Westonia) that were found to contain the introduced replicase only four produced seed. From each of these four line progenitors a Ti population was generated. Each Ti population consisted of 15 or sixteen plants and these were tested for resistance to BYDV using the challenge protocol described below.

BYDV Infection

Sixteen Ti seeds from each line were planted and grown to a three leaf stage for challenge with BYDV-PAV (WAl isolate) . In addition, ten non-transgenic lines of cultivar Westonia were grown and infected in parallel to confirm the efficiency of the BYDV infection procedure. The virus was maintained in wheat and paspalum plants grown in a growth chamber at 18°C. A colony of the oat aphid (Rhopalosiphum padi) , an efficient vector for spread of BYDV in wheat, was maintained on wheat plants grown in aphid cages.

For each wheat plant to be challenged, 10 aphids in the early non-winged stage of development were collected and stored in a Petri dish for 3-5 hrs before transfer to the maintained BYDV infected leaves for incubation. The leaves were prepared in the following manner. Young leaves from BYDV infected wheat plants grown at 18°C were sliced from the plant in the late afternoon and placed with their cut ends in MS agar medium. The aphids and leaves were co- incubated overnight at 18°C to ensure the aphids were able to act as highly effective vectors for the virus. The next day, 10 of these aphids were placed on each plant to be challenged and a plastic container placed over the plant to contain the aphids. The plants and aphids were co-incubated at 18°C for three days, then the aphids were killed with insecticide and the plants maintained in a controlled environment glasshouse to enable BYDV infection to develop in susceptible plants before the first assays were carried out to measure BYDV infection. After one month the non- transgenic control plants were sampled and RT-PCR carried out as in Example three to confirm the presence of BYDV and so successful infection and challenge. These ten control plants all tested positive for the virus.

Detection of BYDV in Plants

To determine whether the transgenic Ti lines that were inoculated with BYDV, as described, were resistant or susceptible to BYDV infection, Enzyme Linked Immuno-Sorbant Assays (ELISAs) were performed on leaf tissues from the newest fully expanded leaf of the 15 or 16 Ti progeny of each of the original transgenic To lines. Positive controls for the ELISAs consisted of leaf tissue from previously infected, BYDV tested positive wheat plants and negative controls consisted of leaf tissue from uninfected Westonia plants. Leaf tissue from 10 non-transgenic Westonia wheat plants, plus all Tx null segregants for the replicase transgene from each To plant, infected in parallel with the transgenic population were assayed to confirm the effectiveness of the BYDV challenge and detection protocol. The ELISA was performed using a PLANTEST ELISA kit (Sanofi Pasteur) that detects the presence of the BYDV coat protein. All samples were assayed in duplicate. The resistance, or susceptibility, of each of the 15 or 16 Ti plants from each original T₀ plant line was assessed by comparison with the readings from the ELISA assay of BYDV infected wheat plants and non- infected plants. ELISA was carried out six weeks, eight ^■weeks and twelve weeks following infection. All data points were calculated by subtraction of the ELISA reading, from a non-transgenic, uninfected Westonia wheat of the same age as the infected plant, and measured on the same plate. Subtraction of this value resulted in slightly negative values in some plants showing resistance to viral infection. Plants that showed ELISA values of less than l/5th the value of the positive control value were rated as ELISA negative, indicating resistance to BYDV infection.

Results

Thirteen plants exhibited strong resistance to BYDV and all these were confirmed as transformed with AT (see Figure 5 for example of screening) . The variability inherent in unsorted transformation events in combination with segregation patterns and different genetic backgrounds is consistent with the observation that not all transgenic plants are resistant. Summarised results of the ELISA data are shown in Table 2, with the actual third date ELISA results of those plants judged to be resistant listed in Table 3. These results are consistent with the earlier two sampling dates. It is evident that resistance to the luteovirus, BYDV has been conferred to certain individual transgenic lines by incorporation of the AT gene.

TABLE 2

SUMMARY OF THE T₁ TRANSGENIC WHEAT PLANTS WITH AT GENE EXHIBITING RESISTANCE TO BYDV

TABLE 3

EXTRA DETAIL ON THE T₁ TRANSGENIC WHEAT PLANTS ELISA WITH AT GENE EXHIBITING RESISTANCE TO BYDV

Values presented are triplicated ELISA plate readings on the third and final test date, with the resultant overall mean without and with the negative control reading subtracted. Transgenic status is also indicated for the AT (ATF encoding) , or Cah introduced genes

*: P or N indicates a positive or negative ELISA result for BYDV infection, hence N indicates a resistant plant.

REFERENCES

Abdullah et al. , 1986, Bio/Technology, 4: 1087-1090.

Benbrook et al. , 1986, In: Proceedings Bio Expo 1986, Butterworth, Stoneham, Mass., pp. 27-54.

Bower, R., Elliott, A.R., Potier, B.A.M. & Birch, R.G. (1996) . High-efficiency, microprojectile-mediated cotransformation of sugarcane, using visible or selectable markers. Molecular Breeding, 2, 239-249.

Bytebier et al., 1987, Proc. Natl. Acad. Sci., USA, 84:5345-5349.

Callis et al., 1987, Genes and Development, 1:1183.

Capecchi, 1980, Cell, 22(2 Pt 2) :479-88.

Cheng et al., 1998, Applied Biological Sciences, Vol. 95, Issue 6, 2767-2772.

Christensen, A. H. and Quail, P. H (1996) . Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5, 1-6.

Clapp, 1993, Clin. Perinatol. 20 (1) : 155-168.

Cristou et al., 1988, Plant Physiol, 87:671-674.

Curiel et al. , 1991, Proc. Natl. Acad. Sci. USA, 88(19) :8850-8854.

Curiel et al. , 1992, Hum. Gen. Ther. 3 (2) : 147-154.

Cushmore et al., 1983, Gen. Eng. of Plants, Plenum Press, New York, 29-38.

Eglitis & Anderson, 1988 (a) , Biotechniques, 6 (7) : 608-614.

Eglitis et al. , 1988 (b), Adv. Exp. Med. Biol. 241:19-27.

Ellis et al. 1987, EMBO J. 6:11-16.

Fischhoff et al., 1987, Bio/Technology, 5:807-813. Fraley et al. , 1983, Proc. Natl. Acad. Sci. , USA, 80:4803- 4807.

Fraley et al., 1985, Biotechnology, 3:629.

Fromm et al., 1985, Proc. Natl. Acad. Sex. USA, 82:5824.

Fujimura et al._r 1985, Plant Tissue Culture Letters, 2:74.

Fynan et al., 1993, Proc. Natl. Acad. Sci. USA, 90(24) : 11478-11482.

Gallie et al., 1989, Plant Cell, 1:301-311.

Graham & van der Eb, 1973, Virology, 54 (2) :536-539.

Herrera-Estrella et al., 1983, Nature, 303:209.

Hess, 1987, Intern Rev. Cytol. , 107:367.

Horsch et al., 1985, Science, 227:1229-1231.

Ishida et al., 1996, Nature Biotechnology, 14 (6) :745-50.

Johnston & Tang, 1994, Methods Cell. Biol. 43 (A) : 353-365.

Jorgensen et al., 1987, MoI. Gen. Genet., 201-.All-All.

Joshi, 1987, Nucl. Acids Res., 15:6643-6653.

Kay et al., 1987, Science, 236:1299-1302.

Keller et al., 1989, The EMBO Journal, 8:1309-1314.

Klee et al. , 1985, In: Plant DNA Infectious Agents, Hohn & Schell, eds., Springer-Verlag, New York pp. 179-203. Klein et al., 1987, Nature, 327:70.

Klein et al., 1988, Proc. Natl. Acad. Sci., USA, 85:8502- 8505.

Langridge et al., 1989, Proc. Natl. Acad. Sci. U.S.A., 86:3219-3223.

Lorz et al., 1985, MoI. Gen. Genet., 199:178.

Lu et al., 1993, J. Exp. Med. 178 (6) :2089~2096.

Ma et al., 1988, Nature, 334:631-633.

Macejak & Sarnow, 1991, Nature, 353:90-94.

Marcotte et al., 1988, Nature, 335:454.

McBride and Summerfelt, 1989

McElroy D, Blowers AD Jenes B and Wu R (1991) . l(actl) 5' region for use in monocot transformation. Construction of expression vectors based on the rice actin. Molecular and General Genetics. 231: 150-160.

McElroy et al., 1990, Plant Cell. 2: 163171.

Medberry SL, Lockhart BEL and Olszewskine (1992) . The Plant Cell 1992, 4: 185-192.

Miller WA and Rasochova L, 1997. Barley yellow dwarf viruses. Annu. Rev. Phytopathol. 35: 167-190.

Miller, W.A., P. M. Waterhouse and W.L. Gerlach (1988) Sequence and organisation of barley yellow dwarf virus genomic RNA. Nucleic Acid Research 16(13) : 6097-6111. Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15:473-497.

Neuhaus et al., 1987, Theor. Appl. Genet., 75:30.

Omirulleh et al. , 1993, Plant Molecular Biology, 21:415- 428.

Pelletier & Sonenberg, 1985, MoI. Cell. Biol. 5:3222-3230,

Pelletier & Sonenberg, 1988, Nature, 334: 320-325.

Potrykus et al. , 1985, Plant Molecular Biology Reporter, 3:117-128.

Poulsen et al., 1986, MoI. Gen. Genet., 205:193-200.

Rogers & Bendich, 1988, Plant MoI Biol. A6: 1-10.

Simpson et al., 1986, Science, 233:34-38.

Spielmann et al., 1988, Nucleic Acids Res., 16:1199.

Toriyama et al. , 1987, Plant Sci., 48: 123-128.

Uchimiya et al. , 1986, MoI. Gen. Genet. 204: 204-207.

Van Tunen et al., 1988, EMBO J., 7:1257.

Vasil et al., 1989, Plant Physiol 91: 15751579.

Vogel et al., 1989, J. Cell Biochem. , (supplement 13D, 312) .

Wagner et al., 1992, Proc. Natl. Acad. Sci. USA, 89(13) :6099-6103. Weeks, J. T., K. Y. Koshiyama, U. Maier-Greiner, T. Schaeffner and O. D. Anderson 2000, Wheat transformation using cyanamide as a new selective agent. Crop Science 40: 1749-1754.

Weissbach & Weissbach, 1988, In: Methods for Plant Molecular Biology, Academic Press, Inc., San Diego, Calif,

Wenzler et al., 1989, Plant MoI. Biol., 12:41-50.

Winter et al._r 1988, MoI. Gen. Genet., 221 (2) : 315-319.

Wong & Neumann, 1982, Biochim. Biophys. Res. Commun. 107(2) :584-587.

Yamada et al., 1986, Plant Cell Rep., 4:85.

Yang et al., 1990, Proc. Natl. Acad. Sci. , USA, 87:4144- 4148.

Zhou et al., 1983, Methods in Enzymology, 101:433.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A method for protecting a plant from aphid-borne viral infection, comprising the step of introducing a nucleic acid molecule into a plant, which nucleic acid molecule codes for an aphid transmission factor.

2. A method according to claim 1, wherein the nucleic acid molecule codes for an untranslatable aphid transmission factor.

3. A method according to claim 1 or claim 2, wherein the nucleic acid molecule is a cDNA molecule encoding an aphid transmission factor, which has been modified so that it is transcribed but not translated within a plant cell.

4. A method according to any one of claims 1 to 3, wherein the cDNA molecule is substantially that shown in Figure 1 (SEQ ID N0:l) or biologically active fragment thereof.

5. A method according to any one of claims 1 to 4, wherein the nucleic acid molecule is integrated into the host cell genome.

6. A method according to any one of claims 1 to 4, wherein the nucleic acid molecule is extrachromosomal.

7. A method according to any one of claims 1 to 6, wherein the aphid transmission factor nucleic acid molecule is isolated from any aphid-borne viral species.

8. A method according to claim 7, wherein the virus is selected from the viral family groups consisitng of Luteoviridae, Bromoviridae, Comoviridae, and Potyviridae.

9. A method according to claim 7, wherein the virus is a virus selected from the viral family group Luteoviridae.

10. A method according to claim 7, wherein the virus is barley-yellow dwarf virus (BYDV) .

11. A method according to any one of claims 1 to 10, wherein the plant infected by the aphid-borne virus is a monocot.

12. A method according to claim 11, wherein the plant is a member of a family selected from the group consisting of Acanthaceae; Agavaceae; Alliaceae; Alstroemeriaceae; Amaranthaceae; Amaryllidaceae; Apocynaceae; Araceae; Asclepiadaceae; Asparagaceae; Basellaceae; Calochortaceae;

Cannabidaceae; Cannaceae; Caricaceae; Caryophyllaceae;

Chenopodiaceae; Commelxnaceae; Compositae; Convolvulaceae;

Crassulaceae; Cruciferae; Cucurbitaceae 8; Dioscoreaceae;

Euphorbiaceae; Gentianaceae; Gramineae; Hyacinthaceae; Hydrophyllaceae; Iridaceae; Labiatae; Leguminosae-

Caesalpinioideae; Leguminosae-Papilionoideae; Liliaceae;

Malvaceae; Melanthiaceae; Musaceae; Onagraceae;

Orchidaceae; Papaveraceae; Passiflσraceae; Pedaliaceae;

Phytolaccaceae; Plantaginaceae; Plumbaginaceae; Polygonaceae; Portυlacaceae; Primulaceae; Ranunculaceae;

Rosaceae; Rutaceae; Scrophulariaceae; Solanaceae;

Tetragoniaceae; Thymelaeaceae; Tropaeolaceae; Umbelliferae;

Valerianaceae and Zingibezaceae.

13. An isolated nucleic acid molecule, which nucleic acid codes for an untranslatable aphid transmission factor gene consisting essentially of the nucleotide sequence shown in Figure 1 (SEQ ID N0:l), wherein said nucleic acid molecule is capable of producing plants resistant to infection with aphid-borne virus upon transformation into a susceptible plant.

14. A transgenic plant, plant material, seeds or progeny thereof, comprising an untranslatable aphid transmission factor gene, wherein the expression of said gene results in a transgenic plant, plant material, seeds or progeny thereof which is resistant to infection with aphid-borne virus.

15. An untranslatable aphid transmission factor gene.

16. An untranslatable aphid transmission factor gene according to claim 15, wherein the aphid transmission factor gene has either a) a nucleotide sequence as shown in Figure 1

(SEQ ID N0:l) ; or b) a biologically active fragment of the sequence in a) ; or c) a nucleic acid molecule which has at least 75% sequence homology to the sequence in a) or b) ; or d) a nucleic acid molecule which is capable of hybridizing to the sequence in a) or b) under stringent conditions as herein defined.

17. A nucleic acid construct comprising a promoter and an untranslatable aphid transmission factor gene according to claim 15 or claim 16.

18. A nucleic acid construct according to claim 17, wherein said construct is substantially the one shown in Figure 3.