WO2006065230A1 - Procédé de détection de signal d'acide nucléique - Google Patents

Procédé de détection de signal d'acide nucléique Download PDF

Info

Publication number
WO2006065230A1
WO2006065230A1 PCT/SG2005/000422 SG2005000422W WO2006065230A1 WO 2006065230 A1 WO2006065230 A1 WO 2006065230A1 SG 2005000422 W SG2005000422 W SG 2005000422W WO 2006065230 A1 WO2006065230 A1 WO 2006065230A1
Authority
WO
WIPO (PCT)
Prior art keywords
signal
molecule
probe
nucleic acid
tdt
Prior art date
Application number
PCT/SG2005/000422
Other languages
English (en)
Inventor
Jing Guang Li
Chew Kiat Heng
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2006065230A1 publication Critical patent/WO2006065230A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means

Definitions

  • the present invention relates to a method of nucleic acid signal detection.
  • SNPs single nucleotide polymorphisms
  • DNA microarray Gut, 2001
  • minisequencing technique is widely used to discriminate alternative alleles of genes, by which a single fluorophore-labeled dideoxynucleotide (ddNTP) molecule is incorporated into the probe in the presence of DNA polymerase once the probe-target hybrid is successfully formed (Pastinen et al, 1997; Hirschhorn et al, 2000; Lovmar et al, 2003).
  • ddNTP dideoxynucleotide
  • Minisequencing has been demonstrated to be a very specific strategy for genotyping because it is mediated by the high-fidelity DNA polymerase, and many commercially available genotyping platforms are based on this approach.
  • ddNTPs dideoxynucleotides
  • a large proportion of the probes is not accessible by the targets due to, but not limited to, the following two reasons.
  • One is the high density of the probes spotted on the solid support (chip) and the other is the variable sizes of the targets (so called steric hindrance) (Southern et al, 1999).
  • steric hindrance the variable sizes of the targets
  • DNA polymerase the DNA polymerase
  • Another major application of the DNA microarray format or platform is in the analysis of gene expression profiles. It provides a powerful means to measure quantitatively the expression levels of a large number of genes simultaneously.
  • a second commonly criticized feature of DNA chip formats such as GeneChip® is its requirement of multiple probes (11 pairs) for each individual gene, which probably contributed partially to the cost of production of such chips. Last but not least, it has been demonstrated that a large proportion of genes expressed at moderate or low levels cannot be detected by DNA chips.
  • the present invention addresses the problem mentioned above and generally provides a method of detecting at least one signal in a nucleic acid.
  • the invention provides a method of detecting at least one signal in a nucleic acid, the method comprising:
  • the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby detecting the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele-specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the cleavage means may be
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the first chemical may be hydroxylamine and the first type of nucleotide cytosine.
  • the second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine.
  • the third chemical may be piperidine.
  • the method can further comprise separating the at least one discriminated molecule.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by allele-specific minisequencing.
  • the method in general may further comprise removal of unhybridized molecules.
  • the template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected.
  • the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected.
  • the invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele.
  • a method of detecting Single Nucleotide Polymorphisms comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay, chemical cleavage by mismatch reaction and/or allele-specific minisequencing.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
  • the method of analysing gene expression is a quantitative method, and the at least two target sequences are complementary RNA (cRNA) and/or complementary DNA (cDNA) converted from messenger RNA (mRNA).
  • cRNA complementary RNA
  • cDNA complementary DNA
  • the adding the at least one signal molecule may be repeated to amplify the signal detected.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA.
  • the nucleic acid(s) may be either DNA or RNA or both.
  • the method can be conducted in a microarray format.
  • nucleic acid strand with at least one signal molecule at the 3' end.
  • kits for detecting at least one signal in a nucleic acid comprising at least one template-independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise at least a signal molecule.
  • the kit may further comprise at least one probe.
  • the kit may further comprise information pertaining to its use.
  • the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction.
  • Fig. 1a shows how isothermal invader cleavage reaction (ICR) works.
  • ICR isothermal invader cleavage reaction
  • one invader probe and two allele-specific signal probes are included.
  • two signal probes also differ in their flaps (universal tags), which will later bind to its corresponding anti-tags immobilized on the slide.
  • Another feature of the signal probe is that its 3' end has to be blocked with a phosphate group to ensure that it cannot be elongated without ICR cleavage.
  • the invader probe it is complementary to the upstream sequence of the genomic DNA except the last base, which can be any one of the four dNTPs. The last base of invader probe is also where the SNP is located.
  • Fig. 1 b shows how TAPE introduces dye-labeled dNTPs onto the cleaved flap in liquid phase. Because ICR only happens on the signal probe with C allele, thus its flap has a free 3'-OH group. Subsequently, TdT can act on it and incorporate multiple dye-labeled dNTPs. The other signal probe with the T is not cleaved and remains blocked by phosphate group. As such, no dNTPs can be extended by TAPE.
  • Fig. 1c shows hybridization between the universal tags (flap) of the signal probes and their corresponding anti-tags spotted on the slide.
  • the artificial anti- tags are modified at their 3' ends with amino group (-NH2) so that they can be stably immobilized through the aldehyde group coated on the slide.
  • SNP genotype of a particular gene can be called by reading its corresponding two sites. If only one site is lighted up, it can be homozygote of either allele. Otherwise, it must be heterozygote.
  • Fig. 2 shows the microarray image of using the ICR-TAPE strategy on two candidate genes, CETP and ACE.
  • CETP is a A/C point mutation
  • ACE is a 288-bp insertion/deletion mutation.
  • only synthetic oligonucleotides are included to find out how effective ICR-TAPE is.
  • three different genotypes of both CETP and ACE are correctly genotyped.
  • Fig. 3a shows the difference in terms of synthesis of cRNA between current approach and TAPE-mediated one.
  • biotin is introduced into the cRNA during in vitro transcription (IVT).
  • IVT in vitro transcription
  • the amount of biotin in one particular cRNA fragment depends largely on its sequence, size and poly-U tail +/-.
  • TAPE normal NTP mixture is used during IVT.
  • the product of IVT is normal RNA sequence without any biotin.
  • Fig. 3b shows the introduction of biotin onto the cRNA fragment by TAPE on the chip. After fragmentation and binding to its corresponding probe which is synthesized on the chip, the cRNA fragment with 3' protruding end will be effectively elongated by TdT with multiple biotin-labeled deoxynucleotides (dNTPs).
  • dNTPs biotin-labeled deoxynucleotides
  • Fig. 4 shows the sensitivity of TAPE with Cy5-ddCTP.
  • Fig. 5A and 5B show incorporation of multiple labelled-nucleotides by TAPE.
  • Fig. 6 shows the attachment efficiency of elongated oligonucleotides.
  • Fig. 7 shows the time-based elongation by TAPE with Cy5-ddC. Elongation was shown to saturated by the first minute and no subsequent increase in signal was observed with longer incubation time.
  • Fig. 8 demonstrates SNP genotyping by ASMS-TAPE strategy.
  • the common homozygotes, heterozygotes and rare homozygotes were represented by subarray AA, AB and BB, respectively. It could be clearly observed in Figure 8A that only one allele-specific site of each SNP was fluorescently-labelled in subarray AA, and the other five sites were fluorescently-labelled in subarray BB, and no fluorescence were observed when two alleles were present (subarray AB).
  • the pattern of the genotyping result by ASMS-TAPE is exactly opposite to that by ASMS with TAMRA-ddNTPs (Fig. 8B).
  • Fig 9 is an electrophoresis gel showing RNA fragments elongated with dNTPs by TdT. Without TdT, the majority of the cRNA fragments were 100-200 nucleotides in length (Lane 2). In the presence of TdT, however, some of these fragments were clearly polymerized, as shown by their relatively slower migration (Lanes 3). This implies that RNA can also serve as substrate for elongation by TdT.
  • Fig. 10 shows elongation of synthetic oligonucleotides with/without 3'-modifiers by TdT.
  • the 3 1 unmodified oligonucleotide (-OH) serves as control in this study.
  • TdT- Cy5-ddCTP was not incorporated into the control (-OH(TdT-)).
  • -OH(TdT+) extremely intense fluorescent signal was obtained when TdT was present (-OH(TdT+)), confirming that TdT is essential for the process of elongation.
  • Fig. 11 is an electrophoresis gel showing TdT-assisted polymerization of 5 1 or S'-biotinylated oligonucleotide.
  • the labels are: 100bp DNA ladder (1); 5'- biotinylated oligonucleotide without TdT (2) or with TdT (3); and 3'-biotinylated oligonucleotide without TdT (4) or with TdT (5).
  • Polymerization of the 58-mer S'- biotinylated oligonucleotide and 40-mer 5'-biotinylated oligonucleotide by TdT was also observed by gel shift assay.
  • Fig 12 is a graph showing that the signal is indeed generated by elongation of a nucleotide carrying the signal. After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced by about 80%. This indicates that the majority of Cy5-ddCTP incorporated into oligonucleotide was digested by Exo I 1 which breaks phosphodiester bonds between nucleotides.
  • Fig. 13 shows structures of 3' modified oligonucleotides.
  • Allele - One of the variant forms of a gene at a particular locus, or location, on a chromosome. Different alleles produce variation in inherited characteristics such as hair color or blood type. In an individual, one form of the allele (the dominant one) may be expressed more than another form (the recessive one). Allele amplification - to increase the number of copies of an allele.
  • Biomolecules - biological molecules; for example, proteins (including polypeptides and amino acids) and nucleic acids (eg deoxyribonucleic acid, DNA and ribonucleic acid, RNA) and their derivatives such as peptide nucleic acids (PNA).
  • Complementary - two biomolecules are said to be complementary when they fit with or bind to each other due to their characteristics and under certain conditions.
  • Hybridization occurs when two complementary molecules bind to each other, for example, the binding of two complementary strands of nucleic acids such a probe with a target or an antibody to a protein.
  • Hybridization can also be referred to as annealing.
  • nucleic acid consists of nitrogenous bases that are either pyrimidines (Cytosine (C), uracil (U) 1 and thymine (T) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds consisting of a pyrimidine bonded to a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing.” More specifically, A will bond to T or U, and G will bond to C.
  • nucleic acid refers to more than one contiguous nucleic acid molecules.
  • nucleic acids refers to a strand of more than one contiguous nucleic acid molecules and are used interchangeably as guided by the context in which they are used.
  • complementary refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
  • oligonucleotide or its analog
  • DNA or RNA target DNA or RNA target.
  • the oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable.
  • An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions in which specific binding is desired, for example, under physiological conditions in the case of in vivo assays. Such binding is referred to as "specific hybridization.” Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences.
  • the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization.
  • Corresponding base - the base on one strand of nucleic acid that is aligned with another base of another strand of nucleic acid when the two strands share significant homology and are base paired for most of their length.
  • a base on one strand need not hybridize to its corresponding base on another strand in the case of single nucleotide polymorphism and this lack of hydridization can be used as a basis for detecting the SNP.
  • Discrimination The detection and identification of a biomolecule from another biomolecule based on some selection criteria. For example in the case of alleles, allele discrimination is a procedure by which the allele of a given sample is identified, thus discriminating it from another allele. Detection technologies used in discrimination include, but are not limited to, direct detection, electrochemical, fluorescence, fluorescence polarization, colorimetry, mass spectrometry, luminescence, optical, primer extension and minisequencing.
  • Invader cleavage reaction The invader cleavage reaction (ICR) is a means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences.
  • a nucleic acid cleavage structure is formed on a target sequence depending on whether the probe matches or does not match the target sequence.
  • the unique cleavage structures are then cleaved in a site-specific manner by the 5' nuclease activity of a variety of enzymes, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
  • ICR is taught in the following US patents: 5,846,717; 6,348,314; 6,001 ,657; 6,090, 543; 6,090,606; and 5,888,780, all of which are hereby incorporated in full by reference.
  • OLA oligation ligation assay
  • the oligation ligation assay is a technique for detecting single nucleotide polymorphisms.
  • OLA uses a pair of oligonucleotide probes (oligomers) that hybridize to adjacent or contiguous segments of DNA including the variable single base.
  • the oligomer on the 5' end of the pair is an allele-specific oligonucleotide (ASO) to one allele of the target.
  • ASO allele-specific oligonucleotide
  • the last base at the 3 1 end of this ASO is positioned at the site of the target DNA's polymorphism.
  • the ASO also has a biotin molecule at its 5' end that functions as a chemical hook.
  • the oligomer on the 3' end of the pair is the common oligomer (that is, the sequence is the same for the two different alleles.)
  • the common oligomer is positioned at an invariable site next to the target DNA's polymorphism and is labeled at its 3' end. If the ASO is perfectly complementary to the target sequence: the ASO hybridizes completely when annealed and will lie flat against that target, DNA ligase can then be used to covalently ligate the ASO to the common oligomer and this successful ligation can be detected.
  • One way to detect the successful ligation is to use the biotin hook to remove the ASO and the labeled common oligomer will also be removed, producing a detectable signal. However, the chemical hook need not be used if the ligated molecule can be detected by other means.
  • the OLA is taught in US Patent Numbers 4,988,617 and 5,830,711 , which are hereby incorporated in full by reference.
  • Chemical cleavage of mismatch detection is a DNA mutation detection system which involves the addition of the chemicals hydroxylamine and osmium tetroxide which react with free cytosine and thymine nucleotides respectively (Cotton & Campbell, 1999). By denaturing the double stranded DNA being screened and allowing it to hybridize with a single stranded labelled DNA probe, any mismatched cytosine or thymine nucleotides will be exposed and therefore be susceptible to reaction with the hydroxylamine and osmium tetroxide.
  • Genotyping The process of assessing genetic variation present in an individual.
  • Homology biomolecules like proteins and nucleic acids possess a sequence of amino acids and nucleotides respectively.
  • Homology refers to the degree of similarity between sequences.
  • homology refers to the degree of similarity between sequences of amino acids.
  • nucleic acids it refers to the sequential correspondence of nucleotide triplets in a nucleic acid molecule that permits nucleic acid hybridization.
  • Microarray - a microarray is a two-dimensional array, typically on a glass, filter, or silicon wafer, upon which genes or gene fragments are deposited or synthesized in a predetermined spatial order allowing them to be made available as probes in a high-throughput, parallel manner.
  • Microarray formats include, but are not limited to, bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, encoded bead arrays, gel pad arrays, gene arrays, gene expression arrays, genome arrays, genomic arrays, high density oligonucleotide arrays, high density protein arrays, hybridization arrays, in situ arrays, low density arrays, microelectronic arrays, multiplex DNA hybridization arrays, nanoarrays, nylon macroarrays, oligo arrays, oligonucleotide arrays, oligosaccharide arrays, peptide arrays, planar arrays, protein arrays, solution arrays, spotted arrays, tissue arrays, exon arrays, filter arrays, macroarrays, small molecule microarrays, suspension arrays, theme arrays, tiling arrays, transcript arrays; and gene expression arrays.
  • Minisequencing - A solid-phase method for the detection of any known point mutation or allelic variation of DNA.
  • Moiety - A moiety is a functional group attached to a larger molecule.
  • Moieties can be used as modifiers to alter the characteristic of larger molecules.
  • a moiety may be added to the 3' end of a strand of nucleic acid to modify the characteristic of the nucleic acid strand such as changing its susceptibility to certain enzymes.
  • Nucleotide or nucleic acid - One of the structural components, or building blocks, of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
  • a nucleotide consists of a base (one of four chemicals: adenine, thymine, guanine, and cytosine) plus a molecule of sugar and one of phosphoric acid.
  • a polynucleotide is a nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes.
  • An "oligonucleotide” is a plurality of joined nucleotides joined by native phosphodiester bonds.
  • An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length.
  • An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions.
  • oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
  • Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
  • PNA peptide nucleic acid
  • PCR Polymerase chain reaction
  • Single nucleotide polymorphism (SNP) - SNPs are polymorphisms due to single nucleotide substitutions (transitions > transversions) or single nucleotide insertions/deletions in genomic DNA at a frequency of 1 % or higher.
  • Probes and primers - Probes and primers as used herein may, for example, include at least 10 nucleotides of the nucleic acid sequences that are shown to encode specific proteins. In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise 15,20, 30,40, 50,60, 70,80, 90 or 100 consecutive nucleotides of the disclosed nucleic acid sequences.
  • the term specific for (a target sequence) indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence.
  • the present invention relates to a universal signal detection and/or amplification method and may be applied to various molecular biology reactions, such as complementary nucleic acid hybridizations and/or antibody-protein hybridizations, through the use of suitable enzymes. Accordingly, while the method according to the present invention is described with particular reference to its application for the detection of at lesat one signal in at least one nucleic acid, the method may also encompass the application to other biomolecules as mentioned above. As possible applications, SNP genotyping and gene expression studies through DNA microarray platforms are exemplified here to illustrate how the limitations associated with existing technologies can be circumvented by the present invention. However, the present invention is not limited to the use to the use of microarray format.
  • the invention provides generally a method of detecting at least one signal in a nucleic acid, the method comprising:
  • the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
  • a method of detecting at least one signal in at least one nucleic acid hybridization reaction comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT).
  • TdT catalyzes the addition of normal, fluorescent or biotin-labeled deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs) or ribonucleotides (NTPs) to the free 3'-OH termini of DNA in a unique template-independent manner.
  • dNTPs deoxynucleotides
  • ddNTPs dideoxynucleotides
  • NTPs ribonucleotides
  • the substrates for TdT are deoxynucleotides (dNTPs) and these could be labeled for use as signal molecules. Subsequently, multiple dNTPs can be incorporated onto each probe to amplify the signal as opposed to a single ddNTP by minisequencing. This feature of TAPE alone can remarkably improve the sensitivity to a great extent. Moreover, the signal introduction by TAPE is no longer dependent on formation of probe-target hybrid since it occurs on the 3 1 terminal of the probes.
  • dNTPs deoxynucleotides
  • minisequencing the main steric hindrance effects of minisequencing are circumvented.
  • four labeled dideoxynucleotides are needed in the course of minisequencing.
  • TAPE may be carried out under room temperature, thus requiring no special equipments or incubators.
  • TAPE is compatible with most current allele-discrimination chemistries other than minisequencing, such as invader cleavage reaction (ICR) (de Arruda et al, 2002; Lyamichev and Neri, 2003) catalyzed by specific flap endonuclease 1 (FEN1), oligonucleotide ligation assay (OLA) (Barany, 1991 ; Consolandi et al, 2003) catalyzed by DNA ligase, and even chemical cleavage of mismatch (CCM) (Cotton and Campbell, 1989; Ellis et al, 1998) which is a very specific SNP screening approach.
  • ICR invader cleavage reaction
  • FEN1 flap endonuclease 1
  • OLA oligonucleotide ligation assay
  • CCM chemical cleavage of mismatch
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction.
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele- specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the cleavage means may
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay.
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the first chemical may be hydroxylamine and the first type of nucleotide cytosine.
  • the second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine.
  • the third chemical may be piperidine.
  • the method can further comprise separating the at least one discriminated molecule.
  • the invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele.
  • the invention provides a method of detecting Single Nucleotide Polymorphisms (SNP), the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
  • SNP Single Nucleotide Polymorphisms
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay and/or chemical cleavage by mismatch reaction.
  • the template- independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • various genotyping and/or gene expression platforms may be developed by coupling TAPE with different allele- discrimination chemistries and/or technique(s).
  • various SNP genotyping and/or screening platforms may be developed by coupling TAPE with different allele-discrimination chemistries and/or technique(s).
  • the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA.
  • the nucleic acid(s) may be either DNA or RNA or both.
  • the method can be conducted in a microarray format.
  • TAPE can be easily integrated into the existing "DNA chips” such as the GeneChip® platform from Affymetrix®, with only two modifications to its current protocol.
  • the first modification is during the synthesis of cRNA, in which only normal NTPs are introduced instead of NTPs with biotin-C/UTP under the present strategy.
  • the original target is the amount of messenger RNA (mRNA) that are transcribed for each gene.
  • mRNA messenger RNA
  • these mRNA are converted to complementary RNA or cRNA (if using Affymetrix®) or cDNA if using other methods, to form converted targets.
  • the converted targets are hybridized to complementary probes.
  • the second difference is an additional step after fragmentation and hybridization, in which fragments that successfully form hybrid with probes on chip will be equally elongated with biotin-labeled dNTPs by TAPE. After removal of un hybridized targets, signal molecules are added by TdT.
  • TdT signal molecules
  • RT-PCR Reverse Transcription-PCR
  • Cy3 and Cy5 typically Cy3 and Cy5.
  • cRNA targets are also pre-labelled before hybridization to the probes on the chips.
  • the different signal intensities between genes on one chip can now be attributed to different expression levels of different genes by the method of the present invention. As such, it is now possible to compare the signal intensities among the multiple fragments of one particular gene. It is also noteworthy that the price of biotin-dNTPs is lower than that of biotin-NTP. Therefore, the cost of using a gene chip platform can be remarkably reduced and the data analysis greatly simplified. Further, TAPE is able to improve the sensitivity of the current approach. By optimizing the reaction conditions of TAPE, more biotin-labeled dNTPs can be incorporated into the ends of cRNA fragments because TdT has been proven to be very effective in extending oligonucleotides carrying free 3'-OH group.
  • the potential applications of the present invention include, but not limited to, SNP genotyping and gene expression studies. Besides microarray-based platforms, many non-microarray platforms can also be developed with this invention.
  • the present invention relates to a universal signal detection and/or amplification approach as opposed to target amplification methods such as PCR.
  • the specificity of any platforms based on this invention is dependent on their molecular recognition chemistries.
  • the allele-discrimination chemistry employed is crucial to the specificity of the method.
  • the hybridization between probes and cRNA fragments determines how specific the assay is. By repeating several runs of TAPE as desired, the sensitivity of the method of the present invention may be increased.
  • the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
  • the adding the at least one signal molecule may be repeated to amplify the signal detected.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • a method of detecting a strand of nucleic acids comprising: providing a strand of nucleic acids, wherein the nucleotide at the 3' end of the strand does not comprise a free hydroxyl group, and at least one modifier molecule; adding a tag to the strand by the modifier molecule; introducing at least one signal molecule; and catalyzing the adding of the at least one signal molecule to the 3' end of the strand of nucleic acids with template-independent enzyme.
  • the template- independent enzyme may terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the tag may be any known tag suitable for the purpose of the invention.
  • the at least one tag may comprise at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group.
  • the method of the present invention can be incorporate various analytical chemistries to highlight various genetic events (in SNP, gene expression, and the like).
  • nucleic acid strand obtained by the method of detecting a strand of nucleic acids wherein the 3' end of the strand does not comprise a free hydroxyl group.
  • kits for detecting at least one signal in a nucleic acid comprising at least one template- independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise a at least a signal molecule.
  • the kit may further comprise at least , one probe.
  • the kit may further comprise information pertaining to its use.
  • the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction.
  • kits for detecting a strand of nucleic acids where the 3' end of the strand was terminated by a base not possessing a free hydroxyl group comprising at least one template-independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise at least one modifier molecule and at least one tag.
  • the tag may comprises at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group.
  • the kit may further comprise information pertaining to its use.
  • the variations under the present invention comprises, but are not limited to: 1) introduction of modified nucleotides into regular probes for immobilization on solid substrate or support such as aldehyde-coated slides, magnetic beads, microtitre plates or other microarray formats; 2) incorporation of fluorescent nucleotides onto oligonucleotides of DNA or RNA fragments, thus serving as a signal generating and amplification tool; and 3) leveraging on the ability of TdT to extend multiple fluorescently labelled dNTPs contiguously for nucleic acids that do not possess a free hydroxyl moiety, the method of the present invention can be used as a signal amplification tool for detecting targets of low abundance.
  • the person skilled in the art will also appreciate that other signal molecules for signal detection means by photometry, radioactivity or enzymatic action can be used under the present invention.
  • the power of TAPE for genotyping studies is demonstrated by the ICR-TAPE strategy of the present invention, i.e., the different alleles of genes is molecularly recognized by invader cleavage reaction and the signal is introduced and amplified by TAPE.
  • the invader assay depends on the unique ability of cleavase enzymes to discriminate a special overlap structure between the probes (including signal and invader probes) and the targets (Fig. 1a).
  • the DNA targets there are one invader probe and two allele-specific signal probes in each assay.
  • the 3' ends of signal probes are blocked with phosphate group to ensure that no TAPE can happen without cleavage of the signal probes to expose their 3'-OH group.
  • the signal probes also differ from each other in being tagged with different universal sequences at their 5' ends so that the two alleles of genes can be addressed by their corresponding anti-tags immobilized on chip by hybridization.
  • the invader probes are sequence completely complementary to the upstream sequence of the SNP site with the last base where SNP is located to be any dNTP of the four. If perfect match happens between the signal probes and the targets at SNP site (C/G in Fig.
  • cleavage will occur to release the universal tags with free 3'-OH groups, which will be elongated with fluorescently labeled dNTPs (Fig. 1b). Otherwise, the signal probes (T/G in Fig. 1a) will remain intact so that signal cannot be introduced by TAPE (Fig. 1b).
  • CETP cholesterol ester transfer protein
  • ACE angiotensin l-converting enzyme
  • the invader probes are: ipCETP: GCAGCCAATGATCTCAGAGGCTGTATACCCT (SEQ ID NO: 5)
  • ipACE TCTAGACCTGCTGCCTATACAGTCACTTTTC (SEQ ID NO: 6)
  • the 3' blocked allele-specific signal probes (universal tags are underlined, SNP is bold letter) are: bpCETPa: CCGTCATAATCTCTAGACCGACCCAGAGTTATTTTATGCATATCp
  • antitagOI CGGTCTAGAGATTATGACGGttttttttttttttttttttt-NH2 (SEQ ID NO: 11)
  • antitagO2 GCTTTAATGTCGGACGACTTtttttttttttttttttttt-NH2 (SEQ ID NO: 12)
  • antitagO3 TGCGACCTCAGCATCGACCTCAGCttttttttttttttttttttttttttt-NH2 (SEQ ID NO:
  • antitagO4 CAGCACCTGACCATCGATCGCAGCttttttttttttttttttttttttttttt-NH2 (SEQ ID NO:
  • Each 10 ⁇ l invader reaction mixture contains the following components: 200ng of Cleavase® VIII enzyme purchased from Third Wave Technologies (Madison, Wl), 1.85 ⁇ l of invader buffer (5.5X), 50fmols of each invader probe, 200fmols of each signal probe and 50fmols of each synthetic target.
  • Three synthetic target pools which contain either CETPCoC and ACECoT, or CETPCoA and ACECoA, or all four, simulate three different genotypes of two genes, C and T homozygotes, A and A homozygotes, or CA and TA heterozygotes, respectively.
  • the reaction is performed isothermally at 63 0 C for about 2 hours.
  • TAPE reaction typically contains 2 units of TdT, 2 ⁇ l of TdT buffer (5X), and 10 ⁇ M Cy3-dCTP.
  • This reaction is carried out at room temperature or in 37 0 C incubator for 20-30 minutes, followed by 75 0 C for 15 minutes to inactivate the TdT enzyme.
  • about 5 ⁇ l of the TAPE products are directly placed on chip to allow for hybridization between tags of the signal probes and anti-tags on chip (55 0 C, 1-2 hours). After washing by 0.2%SDS once for 5 minutes and water twice for 3 minutes, the chip is scanned to acquire the fluorescence signal by ScanArray® 5000 (Packard BioScience Ltd, UK).
  • oligonucleotides with NH2-modifier from 1st BASE were re-suspended to 20 ⁇ M with ArrayltTM micro-spotting solution (TeleChem) prior to spotting on aldehyde-coated slides (CEL) using a PixSys 7500 arrayer (Cartesian).
  • the quadruplicate spots were arranged in a 2 x 2 format. After incubation (37 0 C, overnight), the slides were washed sequentially with 2 x SSC (3 min), 0.2% SDS (3 min), boiling water (3 min) and water (3 min). The materials thus prepared were then used in the examples below.
  • oligonucleotide probe with a 3'-NH2 group with a 15 dT spacer or (TCGATCCAGTCACGTCGCTAtttttttttttttttttttttttttttt; SEQ ID NO: 15) was immobilized as described above.
  • the 15-dT spacer was introduced to facilitate hybridization through the capitalized sequence.
  • a 38-mer oligonucleotide tagged with a complementary sequence (TAGCGACGTGACTGGATCGAgggaacacctccgacacc; SEQ ID NO: 16) to the probe was serially (1/2) diluted from 40fmols/ ⁇ l to 2.5fmols/ ⁇ l.
  • Another oligonucleotide with 5'-NH2 (tttttttttttttttttttttttttttCCTATACAGTCACTTTT; SEQ ID NO: 17) was also immobilized on the slides as described above. Due to the availability of 3'-OH group of this oligonucleotide, elongation by TdT can be carried out on the slide. The objective of this experiment was to find out whether multiple labelled-nucleotides could be incorporated by TdT.
  • TAPE has a good sensitivity of 10fmols.
  • the signal intensity increased correspondingly but plateaued out beyond 20fmols when the saturation point of the scanner was reached.
  • TAPE with Cy5-dU or Cy5-dU/dNTPs generated much stronger fluorescence (2-3 times higher) than that with Cy5-ddU, indicating the occurrence of multiple-incorporation of Cy5-dU ( Figure 5A).
  • Example 5 The time-based TAPE
  • the oligonucleotide immobilized through 5'-NH2 as taught in Example 2 was also used to investigate time-based TAPE because such reaction could be terminated at various time intervals by washing away active TdT and redundant Cy5-ddC from the slide as described earlier.
  • the 5 ⁇ l reaction cocktail contained 1 U of TdT 1 1 pmol of Cy5-ddC, 1 ⁇ l of TdT buffer and 2 ⁇ l of diH2O. These were loaded onto the slides and incubated at time intervals of 1 , 2, 3, 4, 5, 10, 15 and 20 min. At each time point, the corresponding slide was stringently washed to remove TdT and Cy5-ddC before scanning.
  • FIG. 6 shows that intense fluorescence could be obtained within one minute of elongation by TAPE with Cy5-ddC. By incubation of up to 20 minutes, however, the fluorescence intensity did not increase correspondingly. This suggests that elongation by TdT is extremely rapid.
  • TAPE SNP genotyping. This was demonstrated by integrating TAPE with allele-specific minisequencing (ASMS). A pair of allele-specific primers has their 3' ends bearing the complementary base of the SNP.
  • ASMS-TAPE The principle behind ASMS-TAPE is that, when the SNP of interest is a homozygote, one of the two allele-specific primers will be extended by minisequencing with regular ddNTPs, while the other is still available for elongation by TAPE with a fluorescent ddNTP. In the case of heterozygote, both primers will be blocked so that no fluorescence can be introduced by the subsequent TAPE reaction.
  • the two allele-specific oligonucleotides of each SNP are complementary to each other. These oligonucleotides served as both probes to be immobilized on the slides and synthetic targets for allele-specific minisequencing reaction.
  • Allele-specific minisequencing was performed typically in an 8 ⁇ l cocktail containing 1 U of ThermoSequenase DNA polymerase, IOOfmols of allele- specific primers which were complementary to the capitalized sequences of the synthetic oligonucleotides listed in Table 1 , 20fmols of synthetic targets from one of the three pools and 20pmols of ddNTPs.
  • the initial temperature was 95 0 C (5 min), followed by 30 cycles of 95 0 C (30 sec), 5O 0 C (20 sec) and 54 0 C (30 sec). The final extension was 6O 0 C (5 min).
  • SNPs were also genotyped by ASMS with four TAMRA-labelled ddNTPs to serve as control. Following ASMS, hybridization was directly carried out for genotype calling.
  • RNA fragments from frozen liver tissue of mouse were prepared according to the standard protocol of Affymetrix®. Following the protocol, total RNA was isolated using Trizol reagent (Life Technologies) and then purified with RNeasy® Mini Kit (Qiagen). Following this, 10 ⁇ g of purified RNA was reverse transcribed to cDNA with Superscript Il (Invitrogen). Subsequently, cDNA was in vitro transcribed to biotinylated cRNA using the RNA transcript Labeling Kit (Affymetrix®).
  • reaction mixtures Two reaction mixtures were prepared and both contained 2 ⁇ l of cRNA fragments and 1 ⁇ l of dNTPs (10OnM). 100 U of TdT were introduced into only one mixture. After topping up to 20 ⁇ l with diH2O, the mixtures were incubated in a thermal cycler (37°C, 2.5 hours), followed by separation on a 2% agarose gel for visualization of the elongation products.
  • RNA can also serve as substrate for elongation by TdT.
  • Example 8 Elongation of 3' chemically modified oligonucleotides.
  • oligonucleotides with and without 3'-modifiers that were used in this example are summarized in Table 2. Their structures are illustrated in Figure 13. With the exception of 3C3Oligo (Operon, USA) and 3BioOligo (Alpha DNA 1 Canada), all other oligonucleotides were synthesized by 1st BASE (Singapore).
  • the 3NH2Oligo serves as probes for other 3 1 modified oligonucleotides. They have a 15-dT spacer added to make them more accessible for hybridization.
  • Each reaction cocktail contained 11 ) of TdT (Fermentas), 0.5 ⁇ l of TdT buffer (10 X) and 1 pmol of Cy5-ddC (Amersham) and topped up to 5 ⁇ l with deionized H 2 O. This mixture was loaded on the slide for elongation at room temperature for 20 minutes. The slide was then washed once with 2% SSC (4 min) and twice with distilled H 2 O (3 min) before being scanned to obtain the signal of Cy5 (633 nm) by ScanArray® 5000. Both laser power and photo-multiplier tube (PMT) were set to 100%. Finally, the fluorescence intensities were measured by QuantArray® 3.0.
  • the reaction mixture was prepared as described for elongation on slide, with the addition of 50fmols of oligonucleotides which have complementary sequences of the probes. Elongation was similarly carried out at room temperature for 20 minutes. Prior to being loaded on the slide, the reaction mixture with TdT was inactivated by both the addition of 1 ⁇ l EDTA (0.5M, pH 8.0), and incubation at 95 0 C for 15min. Hybridization was carried out in a sealed humidified cassette immersed in a water bath (50 0 C, 1 hour). The slide was subsequently washed and scanned to obtain fluorescence signal as described earlier.
  • Elongation was also carried out on: one 5'-biotinylated oligonucleotide (ttttttttttagtgag-atggtcatgtgtggcggctcacta, 40- mer; SEQ ID NO: 24) and
  • each reaction mixture was given 50pmols of each oligonucleotide and 2OU of TdT. Incubation was also carried out at room temperature for one hour before gel shift assay.
  • TdT-assisted elongation of oligonucleotides with and without 3'-modifiers are shown in Figure 10. Except for 3NH2Oligo and 5N3POIigo which were immobilized on the slides, all other oligonucleotides were elongated in liquid phase before hybridization was carried out. The 3' unmodified oligonucleotide (3OHOIigo) serves as control in this study. In the absence of TdT, Cy5-ddCTP was not incorporated into the control (-OH(TdT-)).
  • the modified oligonucleotide 3NH2Oligo was used for the Exo I experiment as it could be immobilized on the slide and be elongated by TdT. This ensured that any signal reduction was not due to washing away of some elongated products from the hybrid.
  • TdT After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced to about 20% (Fig. 12). This implied that the majority of Cy5-ddCTP incorporated into 3NH2Oligo was digested by Exo I.
  • TdT can polymerize DNA by adding nucleotides repetitively to its 3' terminus (Ramadan et al., 2004).
  • TdT is evidently unique because it can catalyze such process entirely in the absence of DNA template.
  • Another common belief is that, an oligonucleotide that is modified at its 3' end cannot be polymerized. This is because DNA synthesis proceeds in 5' ⁇ 3' direction, and the free 3'-OH group of oligonucleotide is required .for forming a phosphodiester bond with the subsequent nucleotide during chain elongation.
  • in vitro synthesis of oligonucleotide advances in an opposite direction (3' ⁇ 5'). If a 3' modifier is introduced, however, the terminal 3'-OH will be replaced when synthesis is complete.
  • the 3'-NH2 modifier molecule also carries a -OH group which might be recognized by TdT as a substitute for the 3'-OH group on the deoxyribose sugar.
  • TdT a substitute for the 3'-OH group on the deoxyribose sugar.
  • another -OH (circled) on the carbon chain is present along with the 3'-NH2 modifier.
  • This moiety was initially engaged by succinyl-long chain alkylamino (lcaa) group so that the modifier can be attached to controlled pore glass (CPG) support.
  • CPG controlled pore glass
  • oligonucleotides with different 3'-modifiers or tags such as biotin, C3 linker and phosphoryl group.
  • these oligonucleotides could not be immobilized on the slide, hybridization was carried out following TdT-assisted elongation in solution. Subsequently, they were hybridized to complementary oligonucleotides immobilized on the slide so that fluorescence signal could be detected if elongation did occur.
  • the reaction cocktail was treated with EDTA and heated at 95 0 C for 15 minutes to inactivate TdT before it was loaded onto the slide.
  • Oligonucleotides modified with either 3'-biotin or 3'-C3 linker tags could be efficiently elongated by TdT.
  • These two modified oligonucleotides and 3'-NH2 oligonucleotides have an extra -OH group introduced by their respective modifier molecule, despite differences in the linkers. Elongation did not occur without such a -OH group, as was the case for 3'-phosphorylated oligonucleotide and oligonucleotides with dual modifications at their 5' and 3 1 ends (5'-NH2, 3'-PO4).
  • the main difference between 3'-NH2 and 5'-NH2 modifiers is that an extra -OH group is introduced by the former via its linker. Therefore, we conclude that TdT can elongate 3' modified oligonucleotides if recognizable extrinsic -OH group is introduced as a tag.
  • Exo I can catalyze the removal of nucleotides (3' ⁇ 5') from single- stranded DNA (ssDNA) strand by breaking the phosphodiester bond within DNA.
  • ssDNA single- stranded DNA
  • TdT could catalyze the elongation of oligonucleotides with certain 3' chemical modifiers or tags such as amino, biotin or C3 linker.
  • this finding implies that TdT could potentially catalyze DNA synthesis in the absence of primers if an appropriate modifier molecule with a tag such as an OH group is provided.
  • This discovery may be industrially applied in the addition of nucleotides to a strand of nucleic acids that do not possess a free OH group at its 3' end by first adding a modifier molecule possessing a tag such as a free OH group to the terminal 3' base and then using TdT to add other nucleic acids or derivatives to the strand.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé de détection d'au moins un signal dans un acide nucléique, le procédé consistant: (a) à utiliser au moins un acide nucléique; et (b) à ajouter au moins une molécule signal dans l'acide nucléique, au moyen d'au moins une enzyme indépendante du modèle. L'invention concerne également un procédé de détection d'au moins un signal dans un acide nucléique comprenant les étapes consistant: (a) à utiliser au moins une séquence cible d'acide nucléique et au moins une sonde; (b) à permettre à celle-ci de s'hybrider à la séquence cible, de manière à former une molécule hybridée; (c) à distinguer les molécules hybridées de manière à former au moins une molécule distincte; et (d) à ajouter au moins une molécule signal, au moyen d'au moins une enzyme indépendante du modèle dans la molécule distincte, de manière à détecter ainsi le signal. Le procédé selon l'invention peut être utilisé pour le génotypage et/ou l'analyse d'expression génique.
PCT/SG2005/000422 2004-12-15 2005-12-15 Procédé de détection de signal d'acide nucléique WO2006065230A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63638404P 2004-12-15 2004-12-15
US60/636,384 2004-12-15

Publications (1)

Publication Number Publication Date
WO2006065230A1 true WO2006065230A1 (fr) 2006-06-22

Family

ID=36588175

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2005/000422 WO2006065230A1 (fr) 2004-12-15 2005-12-15 Procédé de détection de signal d'acide nucléique

Country Status (1)

Country Link
WO (1) WO2006065230A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468181A (zh) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 一种双重扩增法检测dna或蛋白质的方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BERTAZZONI B ET AL: "Radioactive Labeling and Analysis of 3'-Terminal Nucleotides of DNA Fragments.", BIOCHIMICA AT BIOPHYSICA ACTA., vol. 312, 1973, pages 192 - 201 *
KWON K Y ET AL: "Expression of apoptotic nuclei by ultrastructural terminal deoxyribonucleotidyl transferase mediated dUTP nick end labeling and detection of FasL, caspases and PARP protein molecules in cadmium induced acute alveolar cell injury.", TOXICOLOGY., vol. 218, 2006, pages 197 - 204 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468181A (zh) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 一种双重扩增法检测dna或蛋白质的方法

Similar Documents

Publication Publication Date Title
US11821030B2 (en) Multiplex targeted amplification using flap nuclease
CA2810931C (fr) Capture directe, amplification et sequencage d'adn cible a l'aide d'amorces immobilisees
US7459273B2 (en) Methods for genotyping selected polymorphism
US20110003301A1 (en) Methods for detecting genetic variations in dna samples
US10155976B2 (en) Methods for genotyping selected polymorphism
US20070178519A1 (en) Length determination of nucleic acid repeat sequences by discontinuous primer extension
US20100112556A1 (en) Method for sample analysis using q probes
WO2006065230A1 (fr) Procédé de détection de signal d'acide nucléique
JINGGUANG Multiplexed genotyping of single nucleotide polymorphisms using microarray technology

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05815251

Country of ref document: EP

Kind code of ref document: A1