WO2006064136A1 - Production de formats d'anticorps et applications immunologiques de ces formats - Google Patents

Production de formats d'anticorps et applications immunologiques de ces formats Download PDF

Info

Publication number
WO2006064136A1
WO2006064136A1 PCT/FR2005/003151 FR2005003151W WO2006064136A1 WO 2006064136 A1 WO2006064136 A1 WO 2006064136A1 FR 2005003151 W FR2005003151 W FR 2005003151W WO 2006064136 A1 WO2006064136 A1 WO 2006064136A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
vhh
human
antibody
antibodies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FR2005/003151
Other languages
English (en)
Inventor
Daniel Baty
Ghislaine Behar
Martine Chartier
André Pelegrin
Jean-Luc Teillaud
Isabelle Teulon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=34954794&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2006064136(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Centre National de la Recherche Scientifique CNRS, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Centre National de la Recherche Scientifique CNRS
Priority to CA 2590615 priority Critical patent/CA2590615C/fr
Priority to ES05826565.3T priority patent/ES2544237T3/es
Priority to EP05826565.3A priority patent/EP1824884B1/fr
Priority to JP2007546119A priority patent/JP5026279B2/ja
Priority to EP17153644.4A priority patent/EP3187505B1/fr
Publication of WO2006064136A1 publication Critical patent/WO2006064136A1/fr
Priority to US11/818,218 priority patent/US9169316B2/en
Anticipated expiration legal-status Critical
Priority to US14/856,016 priority patent/US10385137B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3007Carcino-embryonic Antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/522CH1 domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/53Hinge
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/54F(ab')2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'

Definitions

  • the invention relates to the production of antibody formats and their immunological applications, more particularly in immunotherapy and immunodiagnostics.
  • the antibody molecules are immunoglobulins (Ig) belonging to 5 classes: IgM, IgG, IgD, IgE and IgA.
  • these molecules comprise a heavy chain (H) and a light chain (L) which is either the kappa chain (K) or the lambda chain ( ⁇ ).
  • H heavy chain
  • L light chain
  • K kappa chain
  • lambda chain
  • Each class of immunoglobulins has a specific type of chain H: ⁇ chain for IgM, ⁇ for IgG, ⁇ for IgD, ⁇ for I 3 IgE and ⁇ for I 5 IgA.
  • Each chain is formed of domains, each having an internal disulfide bond.
  • a L chain has two domains and one H chain, 4 domains.
  • the sequence of the domain comprising the amine end of each chain is variable (regions VH and VL), that of the other domains is constant (CH1, CH2 and CH3 of the chain H, and CL of the chain L).
  • variable regions V comprise regions of hypervariable sequences called CDRs whose set determines the complementarity.
  • the first two domains are followed by a hinge region.
  • the L chain is linked to the H chain by a disulfide bond to form a heterodimer.
  • This heterodimer is connected to the same heterodimer by several disulfide bonds at the hinge region to form the immunoglobulin.
  • cleavage using a protease at the hinge two fragments are obtained: the Fab fragment (antigen-binding domain composed of the VL-CL and VH-CH1 domains) and the Fc fragment (effector domain, composed of domains (CH2-
  • the invention relates to antibody fragments and different antibody formats made from these fragments, particularly chimeric or humanized, multispecific and / or multivalent antibody formats.
  • Antibody formats as encompassed by the invention correspond to different combinations of domains and regions of the types mentioned above.
  • chimericized antibody is meant a VH domain of animal origin fused to the constant regions of a human immunoglobulin.
  • humanized antibody is meant a human VH domain to which the hypervariable regions (CDRs) of a VH of animal origin, fused to the constant regions of a human Ig, have been grafted.
  • bispecific antibody refers to a format having two different VH binding two different targets
  • Biepitopic antibody is a format with two different VH binding two different epitopes on the same target.
  • Value is the number of times that the same VH is on the considered fragment.
  • the specificity of recognition of antibodies to reach a specific target has been exploited for the diagnosis and therapy of various pathologies, and particularly in the case of oncology, where the target may be a tumor-associated antigen, a factor receptor growth, a mutant tumor suppressor or "tumor suppressor” product, or a molecule related to angiogenesis or a molecule also expressed on non-tumor cells, but absent from progenitor cells (as in the case of CD20) .
  • tumor immunization with monoclonal antibodies is currently undergoing significant development.
  • humanized antibodies such as Herceptin, an anti-HER2 / Neu antibody used in combination with chemotherapy in certain breast carcinomas,
  • chimeric antibodies such as Rituximab, an anti-CD20 antibody used in the treatment of follicular B-lymphomas.
  • this antibody must be able to fix a molecule produced on the surface of tumor cells (such as CEA, HER2 / Neu, GD 2 ...) and a molecule expressed on the surface of effector cells of immunity, NK cells, killer T cells or CTL, neutrophils, monocytes and macrophages (such as Fc receptors ).
  • An alternative to this strategy is to construct an antibody binding a molecule produced on the surface of the tumor cell and a molecule having direct or indirect cytotoxicity properties (radio-element, toxin, pro-drug).
  • VHH variable domains Camelid heavy chain single antibody (VHH) variable domains, specifically recognizing one type of antigen, were selected from immunized animals and allowed for the design of a variety of chimeric or humanized antibody formats that can be produced from of plasmid constructs. It turned out that the different formats were compatible to allow the production of any other humanized VHH or VHH, or human VH.
  • the object of the invention is to provide antibody formats comprising some or all of the humanized VHH or VHH domains, or human VH, having the desired target recognition and epitope properties.
  • the invention is directed to the immunotherapeutic and immunodiagnostic applications of the various formats made accessible.
  • the invention thus relates to antibody formats comprising some or all of the VHH domains of camelids, in particular lamas and / or human VH, fused to constant regions of human antibodies.
  • the antibody formats are of the Fab type and are characterized by the combination of two VHH domains or two identical or different human VH domains, or two human VH domains on which are transplanted VHH CDRs, one of the domains being fused to the constant region CK OR C ⁇ of a human immunoglobulin, the other to the constant region CH1 of a human immunoglobulin.
  • the antibody formats are of the Fab 'type and are characterized by the combination of two VHH domains or of two identical or different human VH domains, or two human VH domains on which the CDRs of the VHH are grafted, one of the domains being fused to the constant CK OR C ⁇ region of a human immunoglobulin, the other to the constant region CH1 followed by a hinge region H of a human immunoglobulin.
  • chimerized or humanized antibody formats are monospecific / bivalent, bispecific / monovalent and biepitopic / monovalent.
  • the antibody formats are of F (ab ') 2 type and are characterized by the association of two Fab' type formats as defined above.
  • the antibody formats have a hinge region H, "Hinge" of a human immunoglobulin and allow monospecific / tetravalent, bispecific / bivalent and biepitopic / bivalent combinations.
  • the antibody formats are of F (ab ') 2 type and are characterized by the association of two Fab' obtained by reduction of the F (ab ') 2 type formats ci -above.
  • chimerized or humanized antibody formats have a hinge hinge region of a human immunoglobulin and allow combinations of monospecific / tetravalent to tetrasececific / monovalent or tetraepitopic / monovalent, including all intermediate possibilities.
  • the antibody formats are of the type (HCH2CH3) 2 (H, representing the hinge region "Hinge” of a human immunoglobulin, CH2 and CH3, representing the second and third constant domain of a heavy chain of a human Ig, and are characterized by the combination of two or two identical human VHH or VH, on which are grafted the hypervariable regions of the VHH, each being fused to the H region -CH2-CH3 of human Ig.
  • H representing the hinge region "Hinge” of a human immunoglobulin
  • CH2 and CH3 representing the second and third constant domain of a heavy chain of a human Ig
  • the antibody formats are of the mAb * type (this type designates the original variable domains replaced by all or part of the humanized VHH or VHH or human VH domains, fused together. to constant regions of human antibodies) and are characterized by the combination of two or the same or different human VHH or VH, or two human VH on which the hypervariable regions of VHH are grafted, one being fused to the human CK OR C ⁇ region, the other to the CH1-H-CH2-CH3 region of a human Ig.
  • the immunoglobulin is an IgG, corresponding to a human IgG1, IgG2, IgG3 or IgG4 isoform, or a human IgA corresponding to an IgAl isoform, Ig A2, or any other human Ig.
  • VHH can be replaced by human VHH or humanized VHH by grafting VHH CDRs onto human VH.
  • the VHHs correspond to or include VHH antibody fragments of camelids, including llamas. It is in particular fragments characterized in that it is a part or of all fragments anti-carcinoembryonic antigen (anti-CEA abbreviated) or anti-Fc ⁇ RIII receptor (anti-CD16 abbreviated).
  • the anti-CEA antibody fragments more particularly correspond to an amino acid sequence chosen from the group comprising the sequences SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80 and SEQ ID. No. 105.
  • the anti-CD16 antibody fragments preferably correspond to an amino acid sequence selected from the group consisting of SEQ ID NO : 73, SEQ ID NO: 74, SEQ ID NO : 75, SEQ ID NO: 76, SEQ ID NO. ID NO: 103 and SEQ ID NO: 104.
  • the invention also relates to the CDRs of these VHH fragments.
  • the invention also relates to a method for producing chimeric or humanized, multispecific and / or multivalent antibodies for immunotherapy or immunodiagnostics, characterized in that it comprises the use of the antibody formats defined above.
  • the invention aims in particular a method said formats include VHH camelids, including lamas, anti-CEA and anti-CD16.
  • variable domains of VHH anti-CEA and anti-CD16 advantageously produced according to a protocol comprising - the immunization of camelids, in particular of llamas with, as immunogen, a
  • VHH DNA amplified with a phagemid. VHH are isolated from libraries by the phage display technique and purified.
  • VHH anti-CEA and anti-CD16 variable domains are advantageously produced according to a protocol comprising: immunization of camelids, in particular of llamas with, as immunogen, a CEA or a CD16,
  • the construction of the bank comprises
  • VHH DNA fragments obtained by cleavage by enzymes of the amplified DNAs, with a phagemid.
  • VHH are isolated from libraries by the phage display technique and purified.
  • VHHs have been validated in terms of specificity and affinity as illustrated by the examples.
  • the selected VHH genes were then introduced into expression vectors, including plasmids, to produce different multispecific and / or multivalent (anti-CEA / anti-CD16) chimeric antibody formats capable of to bind to tumor cells expressing CEA on their surface and to recruit the effector cells of the immune system (monocytes, macrophages, NK, neutrophils ...) which express CD 16.
  • expression vectors including plasmids, to produce different multispecific and / or multivalent (anti-CEA / anti-CD16) chimeric antibody formats capable of to bind to tumor cells expressing CEA on their surface and to recruit the effector cells of the immune system (monocytes, macrophages, NK, neutrophils ...) which express CD 16.
  • the invention also relates to the expression vectors of the antibody formats defined above.
  • plasmids containing, between two unique sites of restriction enzymes, the promoters, the signal sequences, the nucleotide sequences capable of coding for the VHH domains defined above, the constant regions of human Ig, or for human VH domains, CDRs regions of a VHH, constant regions of human Ig.
  • the plasmids according to the invention are capable of expressing in high amounts the antibody formats defined above, in soluble forms in bacteria and the regions coding for the antibody domains can easily be transferred to other systems. prokaryotic or eukaryotic expression.
  • the invention thus relates to the plasmids pC ⁇ CH1 ⁇ 1-TAG (SEQ ID No. 98 and SEQ ID NO.
  • plasmids are more specifically characterized by inserting nucleotide sequences encoding the light CK region, and the heavy constant region of an Ig CHl in plasmid p55Flag / RBS / 35cmyc6HisGS (SEQ ID NO: 94 and SEQ ID NO 0110 ).
  • the invention also relates to the plasmids pC ⁇ CH1H ⁇ 1-TAG (SEQ ID No. 99 and
  • plasmids are more specifically characterized by inserting nucleotide sequences coding for the heavy chain CHl and the hinge region (H) of an Ig in p55C ⁇ ⁇ FIAG / RBS / 35cmyc6HisGS (SEQ ID NO: 97 and SEQ ID N 0 There 1).
  • the invention also relates to the plasmids pHCH2CH3 ⁇ 1-TAG (SEQ ID No. 95) and pHCH2CH3 ⁇ 1 (SEQ ID No. 96) allowing the production of antibodies of the type (HCH2CH3) 2 according to the fifth embodiment of antibody formats defined herein. - above.
  • plasmids are more specifically characterized by the insertion of the nucleotide sequences coding for the Hinge region (H) and the constant CH2 and CH3 regions of an Ig in p55FIag / RBS / 35cirayc6HisGS.
  • the invention also relates to the plasmid pMab ⁇ l * (SEQ ID No. 102 and SEQ ID No. 116) for the production of mAb * type antibodies according to the sixth embodiment of the invention.
  • This plasmid is more specifically characterized by the insertion of the nucleotide sequences coding for the heavy constant region CH1, the Hinge region and the constant CH2 and CH3 regions of an Ig in pC ⁇ CH1 ⁇ 1-TAG.
  • the patterns of these plasmids are illustrated in Figure 1B and their nucleotide sequences in Figure 11.
  • the intermediate plasmids used for the construction of the above plasmids are also within the scope of the invention. It is more particularly plasmids p55PhoA6HisGS / N- (SEQ ID NO: 89), p55PhoA6HisGS / NA ⁇ -
  • the CH1, CH2, CH3, H domains of an Ig in these plasmids belong to IgG1, IgG2, IgG3 or IgG4, or to IgA, or any other Ig.
  • Genes encoding human VHH or VH are introduced between single sites in different plasmids. These genes can be replaced by genes encoding humanized VHH by grafting VHH CDRs onto human VH.
  • the plasmids used according to the invention can be designed to contain nucleotide sequences coding for other VHHs than anti-CEA or anti-CD16 VHHs, or for other human VH, or for other VHH humanized, able to bind to any molecule.
  • the invention also relates to the plasmid p55 / PIioA6HisGS7NAB ' (SEQ ID No. 91), characterized in that it comprises the nucleotide sequences for producing human VH domains fused to alkaline phosphatase according to the scheme of FIGS. 10A and 11.
  • VH immunoglobulin heavy chains
  • these human VH serve as a template for grafting the previously selected VHH CDRs in order to humanize the variable regions.
  • the antibody formats defined above are of great interest in immunotherapy and for immunodiagnosis. They are indeed able to recognize different molecules or to bind two different epitopes on the same molecule, and also allow access to new epitopes not recognized by conventional antibodies. They can be easily humanized, which opens advantageous perspectives, to have low immunogenecity antibodies after injection in humans. Their obtaining in a soluble form constitutes an additional characteristic of interest for these antibodies. Their applications in immunodiagnosis and immunotherapy are therefore also part of the invention.
  • FIGS. 1 to 13 represent, respectively, FIGS. 1 and 2, the amino acid sequences (SEQ ID No. 73 to 76, 103 and 104) and nucleotides (SEQ ID NOS: 81 to 84, 106 and 107) of 4 anti-CD16 VHH clones and the amino acid sequences (SEQ ID NOS: 77 to 80 and 105) and in nucleotides (SEQ ID Nos. 85 to 88 and 108) of 4 isolated anti-CEA clones according to the invention,
  • FIGS. 3 and 4 the FACS results showing the specificity of 8 VHH analyzed, and the corresponding bispecific antibodies
  • FIG. 5 the results by FACS showing the accessibility on cells of bispecific antibodies
  • FIG. 6 the results of competition tests by ELISA between 2 anti-CD16 VHH and anti-CD16 monoclonal antibodies
  • FIG. 7 FACS cell competition profiles of 2 anti-CD16 VHH and antibodies. monoclonal anti-CD16,
  • FIG. 8 the activation results of CD16A by 2 anti-CD16 VHH, and the bispecific anti-CEA 17 / anti-CD16 c21 antibody of F (ab ') 2 type ,
  • FIG. 9 the results of cell lysis by NK cells activated by bi-specific antibodies
  • FIGS. 10A and 10B plasmid constructs according to the invention
  • FIG. 11 the plasmid sequences of the invention
  • FIGS. 12A and 12B antibody formats of the Fab, Fab ', F (ab') 2 , (HCH2CH3) 2 and mAb * type, FIG. 13, electrophoresis gels of antibody fragments of Fab, Fab 'type and
  • CEA human carcinoembryonic antigen
  • the animals were immunized every month with 500 ⁇ g of each of the immunogens.
  • One hundred ml of blood was taken 15 days after each immunization.
  • a titration of sera and purified antibodies (IgG1, 2 and 3) was performed to detect the presence of antibodies against the different immunogens.
  • the B lymphocytes were then purified on a Ficoll gradient (histopaque-1077, Sigma-Aldrich) and then washed twice with PBS.
  • VHH libraries purification of total RNAs, reverse transcription, PCRl, PCR2 and cloning in pHenl phagemid.
  • RNAs of B lymphocytes are extracted according to the method using
  • RNAs Guanidium isothiocyanate (Chomczynski and Sacchi, 1987) REF. After phenol / chloroform extractions in acidic medium, the total RNAs are precipitated with ethanol. The quality of the RNAs and their quantification are evaluated on 1% agarose gel. They are then converted to cDNA by reverse transcription. Reverse transcription and PCR:
  • SEQ ID No. 1 CGCC ATC AAGGTACCAGTTGA 3'CH2-2
  • SEQ ID NO: 2 GGTACGTGCTGTTGAACTGTTCC 3 'RC-IgG2
  • SEQ ID NO: 3 GGAGCTGGGGTCTTCGCTGTGGTGCG 3 'RC-IgG3
  • SEQ ID NO 4 TGGTTGTGGTTTTGGTGTCTTGGGTT
  • SEQ ID NO: 9 CACGATTCTGCGGCCGCTGAGGAGAC (AG) GTGACCTGGGTCC Five ⁇ g total RNA are hybridized with 1 pmole of 3 'oligonucleotide
  • CH2FORTA4 (Arbabi Ghahroudi et al., 1997) REF or CH2-2 specific for the CH2 domain of IgG single chain heavy chain of retrotranscribed llamas with 150 U of superscript II (BRL) for 30 min at 50 ° C.
  • the specific oligonucleotides of the hinge regions of the IgG 2 and 3, 3 'RC-IgG2 and 3' RC-IgG3, can also be used.
  • the single strand cDNAs are purified on beads (BioMag R Carboxyl Terminator, Polyscience Inc.) and eluted with 17 ⁇ l of
  • cDNA Four ⁇ l of cDNA are amplified by PCR with 0.5 U of Dynazyme Extend DNA polymerase (Finnzymes), 10 pmoles of the same 3 'CH2FORTA4 or CH2-2 primer and 10 pmoles of the 4 specific 5' VH 1-4 Sfi primers. of the VH domain of human IgG, in a volume of 50 ⁇ l. (94 ° C., 3 min, 94 ° C., 1 min, 60 ° C., 1 min, 72 ° C., 1 min, 37 cycles, then
  • PCR2 Three DNA fragments are amplified: a fragment of about 900 bp coding for the VH-CH1-CH2 domains of IgG1; and 2 fragments of approximately 600 bp coding for the VHH-CH2 domains of IgG2 and 3.
  • PCR2 conditions The 600 bp fragments are purified on a 1% agarose gel ("Qiaquick gel extraction" kit, Qiagen) and then amplified. by PCR with 1 U of Deep Vent (Biolabs) and 10 pmol of the 4 VHI-4 SfI primers specific for the VH domain of human IgGs and 10 pmoles of the 3 'VHH-NotI primer.
  • the approximately 400 bp fragments encoding the VHH are purified on 1% agarose gel ("Qiaquick gel extraction" kit, Qiagen) pooled and precipitated with ethanol. They are then cut with restriction enzymes Ncol and NotI, or BglII and NotI (Biolabs) to be cloned into the pHenl phagemid (Hoogenboom et al., 1991) REF at the NcoI and NotI or SfII and NotI sites.
  • Vector preparation :
  • phagemid pHen1 Twenty ⁇ g of phagemid pHen1 are digested in a volume of 300 ⁇ l with 50 U of SfiI in the presence of BSA at 50 ° C. for 16 h; or with 50 U Ncol in the presence of BSA, at 37 ° C, 16 h.
  • the linearized phagemid is purified on 0.7% agarose gel ("Qiaquick gel extraction" kit, Qiagen).
  • the eluted DNA is then cut with 50 U of NotI at 37 ° C. in a volume of 200 ⁇ l, 16 h.
  • the enzyme is destroyed by heat for 15 min at 65 ° C and the DNA is phenol / chloroform extracted and ethanol precipitated.
  • VHH DNA fragments Five ⁇ g of VHH fragments are cut in a volume of 300 ⁇ l with 50 U of
  • the enzymes are denatured at 65 ° C, 15 min; then the DNAs are extracted with phenol / chloroform and precipitated with ethanol in the presence of 10 ⁇ g of glycogen (Roche).
  • the VHH fragments cut with Ncol and NotI are purified on 1% agarose gel and then checked on 2% agarose gel, quantified and adjusted to 100 ng / ⁇ l.
  • the ligase is inactivated at 65 ° C, 15 min, and the ligation product is cleaved with 20 U Xho I (Biolabs) to remove the remaining unligated vector, 37 ° C, 4 h. Six ligatures are thus realized.
  • the ligation products are then combined into 2 tubes and extracted with phenol / chloroform, precipitated in the presence of 10 ⁇ g of glycogen and taken up in 2 ⁇ 18 ⁇ l H 2 O ultrapure. Two ⁇ l are used by electroporation.
  • the male llama VHH library (ref .: 080101) represents 5.4 10 6 clones and the VHH library of the female llama (ref .: 010301) 10 6 clones.
  • VHHs have been isolated by the phage-display technique.
  • Production of Deposited Banks Ten ⁇ l of the stock of a 080101 or 010301 library (TG1 cells transformed with phagemids) are inoculated into 50 ml of (2TY, 100 ⁇ g / ml of ampicillin, 2% glucose) and incubated at 37 ° C. C to an OD 600 equal to 0.5. Five ml of the culture are then infected with 5 ml of M13KO7 at 13 pfu / ml, 30 min, 37 ° C, without shaking.
  • the phage pellet is taken up in 25 ml of (2TY, 100 ⁇ g / ml of ampicillin, 25 ⁇ g / ml kanamycin). The culture is incubated for 16 h at 30 ° C. with stirring. The phages are then precipitated with 1/5 vol of 2.5 M NaCl / 20% PEG 6000 and concentrated 25 times in PBS. Selection of VHH:
  • the beads are compacted with a magnet, resuspended with 250 ⁇ l of 2% milk / PBS and incubated with 200 ⁇ l of biotinylated antigen for 30 min at room temperature on a wheel. 150, 75 and 25 nM of biotinylated antigen final are used at 1 st, 2 nd and 3 rd round, respectively.
  • TG1 made competent for the attachment of pili phages (competent cells: from a culture of TG1 at 2YT overnight, a 1/100 dilution and inoculate 50 ml of 2YT at 37 ° C with stirring to an OD 600 close to 0.5).
  • phages are counted and amplified for a new round of selection.
  • Dilutions of 1 ⁇ l of phage-transfected TG1 cells (see above) from 10 "2 to 10 " with 2YT are carried out, one, 10 and 100 ⁇ l of each dilution are plated on a Petri dish (2YT / ampicillin 100 ⁇ g / ml / glucose 2%) The dishes are incubated for 16 h at 30 ° C.
  • transfected TG1 The 5 ml of transfected TG1 are centrifuged for 10 min at 3000 g to concentrate the cells and the pellet is taken up with 1 ml of 2YT. Two hundred and fifty ⁇ l are spread per Petri dish (12 cm ⁇ 12 cm) (2TY / ampicillin 100 ⁇ g / ml / 2% glucose and incubated for 16 h at 30 ° C.
  • VHH VHH isolated by this method: four anti-CEA VHH (clones: 3, 17, 25, 43) and four anti-CD16 VHH (clones: cl3, c21, c28, c72) were obtained, the sequences of which were amino acids and nucleotides are shown in Figures 1 and 2.
  • VHHs were cloned into the plasmid p55PhoA6HisGS / NAB ' (construction described in section 1.3.6, see Figure 10A and 11) between the SfiI and HindIII restriction sites.
  • PCR conditions Fifty ng of VHH were amplified by PCR with 1 U of Deep Vent (Biolabs), 10 pmol of the 5 'pJF-VH3-Sfi primers and 3' cmyc-6His / HindIII in a final volume of 50 ⁇ l.
  • sequences SEQ ID No. 10 and SEQ ID No. 11 of the oligonucleotides used are the following: 5 'pJF-VH3-Sfi
  • the PCR products are purified on 1% agarose gel (Qiaquick gel extraction kit, Qiagen) and cut with 20 U BgII and 20 U HindIII (Biolabs) 16 h at 37 ° C. Ten ⁇ g of p55PhoA / NAB ' are cut first with 50 U of Sfil 16 h at 50 ° C., then with 20 U of HindIII for 12 h at 37 ° C. Digestion products (vector and PCR fragments) are precipitated with ethanol. The DNAs are resuspended in 20 ⁇ l of H 2 O and quantified on a 0.7% agarose gel.
  • Ligation is carried out with 200 U T4 DNA ligase (50 ng p55PhoA / NAB "cut with SfiI and HindIII and 10 ng of PCR fragment cut by BglI and Hind III in a volume of 20 .mu.l, 16h at 16 ° C. After inactivation of the T4 DNA ligase for 15 min at 65 ° C, the non-recombinant vector is removed by enzymatic digestion with 10 U Xhol, 2 h to
  • VHHs of interest are produced in E. coli.
  • An isolated colony is inoculated into 3 ml of 2YT / ampicillin 100 ⁇ g / ml / 2% glucose and incubated at 37 ° C with shaking. Fifty ml of 2YT / ampicillin 100 ⁇ g / ml / 2% glucose are then inoculated with a dilution of the preceding culture and incubated for 16 h at 30 ° C. with stirring. Four hundred ml of 2YT / ampicillin 100 ⁇ g / ml are inoculated with the equivalent of 0.1 unit OD 6O0 , and incubated at 30 ° C. with shaking, to an OD 600 of 0.5 to 0.7. The culture is then induced with 400 ⁇ l of IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) 0.1 mM final and cultured at 30 ° C. for 16 h. Production of bispecific antibodies:
  • the culture is incubated at 20 ° C. with shaking, until at an OD 60O of 0.5 to 0.7.
  • the culture is then induced with 400 ⁇ l of IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) 0.1 mM final cultured at 20 ° C for 72 h.
  • the column (BD TALON TM Metal Affinity, BD Biosciences Clontech) is equilibrated with the equilibrium buffer (50mM sodium acetate, 0.1M NaCl, pH 7.0). The periplasmic fraction is deposited on the column. After washing the column with 5 volumes of equilibration buffer, the VHH is eluted by pH or imidazole gradient (gradient between equilibration buffer pH 7.0 and 50mM sodium acetate pH 5.0 or the imidazole solution 200 mM). Each fraction is controlled on an SDS / PAGE gel (acrylamide
  • VHH is membrane-bound (Amicon Ultra
  • bispecific antibodies are purified from the soluble fraction of the periplasm (Cf extraction of the soluble fraction of the periplasm) in two steps; first on a BD TALON column (see purification of VHH) then on a protein G (HiTrap protein G 5 ml, Amersham biosciences).
  • the "Hi Trap Protein G” column is equilibrated with PBS (137 mM NaCl, 2.47 mM KCl, 1.2 mM Na 2 HPO 4 , 1.76 mM KH 2 PO 4 pH 7.4).
  • PBS 137 mM NaCl, 2.47 mM KCl, 1.2 mM Na 2 HPO 4 , 1.76 mM KH 2 PO 4 pH 7.4
  • the bispecific antibody After washing the column with 5 volumes of PBS, the bispecific antibody is eluted with 0.1 M glycine pH 2.7 and then buffered. with 1 M pH 8 hepes. After control on SDS / PAGE gel (10% acrylamide), the bispecific antibody is dialyzed in PBS O 3 Ix, frozen at -80 ° C. and lyophilized to be concentrated ten times. Finally, F (ab ') 2 is separated from Fab' on a Tricorn Superdex 200 10/300 GL column (Amersham Biosciences) equilibrated with PBS.
  • biotinylated antigen (CEA or CD 16) are fixed on a streptavidin plate (BioBind Assembly Streptavidin Coated, ThermoLabsystems) previously saturated with 2% -PBS milk. Five October 10 phage-antibodies are contacted with the antigen.
  • the antigen / antibody binding is detected by means of an ELISA composed of a monoclonal antibody directed against the P8 protein of the phage (HRP / anti-M13 monoclonal conjugate,
  • biotinylated antigen Five ⁇ g / ml of biotinylated antigen are fixed on a streptavidin plate (BioBind Assembly Streptavidin Coated, ThermoLabsystems) previously saturated with 2% -PBS milk.
  • Each VHH (range of 0.001 ⁇ g / ml to 1 ⁇ g / ml) is linked to the antigen adsorbed in the microwells.
  • the binding is revealed with a monoclonal antibody against the c-myc label (Santa Cruz Biotechnology, Inc.) diluted 1/1000 and polyclonal goat antibody directed against mouse IgG coupled to peroxidase diluted 1/5000 (ref 55556, ICN) in the presence of ABTS (2 3 2'-Azino-di- (3-ethylbenzthiazoline sulfonate) diammonium knows, Roche).
  • ELISA of bispecific antibodies Ten ⁇ g / ml of antigen (rhCDl ⁇ or rhCEA) are passively coated on a plate
  • VHH CEA 17 Demonstration of the accessibility of VHH CEA 17 when VHH CD16 c21 is bound to rhCD16 adsorbed in microwells with biotinylated rhCEA and streptavidin coupled to alkaline phosphatase diluted 1/500 (DAKO, cat DO396).
  • BIACORE uses the principle of the surface plasmon resonance (SPR) to follow in real time the interactions between molecules without marking of these.
  • SPR surface plasmon resonance
  • One of the interaction partners is immobilized covalently on one biosensor while the other is injected into a continuous flow.
  • the principle of detection by SPR makes it possible to follow the changes of mass on the surface of the biosensor due to the formation then the dissociation of the molecular complexes.
  • the response, quantified in resonance unit (RU) is a direct indication of the rate of fixation of the analyte by measuring the variation of the refractive index.
  • the detection of the antigen-antibody binding is carried out on the untransfected line MC38 (mouse colon cancer cell line), the lines transfected with CEA (MC38 / CEA + ) or the NCA (MC38 / NCA + ), the human tumor line 2i PCT / FR2005 / 003151
  • LS174T human colonic adenocarcinoma cell line expressing CEA on its surface
  • granulocytes which express on their surface the NCA.
  • the granulocytes are extracted from fresh blood in the presence of heparin, on a ficoll gradient at two densities (histopaque 1119 and 1077). The granulocytes are at the interface of the 2 histopaques.
  • Antibodies used for binding to cells are:
  • Anti-CD16 VHH (cl3, c21, c28, c72).
  • Anti-CEA / anti-CD16 bispecific antibodies constructed from the 8 isolated VHHs. Antibodies used for the revelation:
  • 0.5 x 10 6 cells are used per test.
  • the VHH and monoclonal antibodies are diluted in 100 ⁇ l of PBS-1% BSA.
  • 0.5 x 10 6 cells (measure autofluorescence of cells)
  • the samples are incubated for 45 min, 40 ° C., in the dark.
  • MAb 192 also binds MC38 NCA + cells and granulocytes that express NCA on their surface.
  • CEA 17 VHH only binds cells that express CEA on their surface.
  • Equivalent results are obtained with the other anti-CEA VHH antibodies (clones 3, 25 and 43).
  • the bispecific VHH CEA 17 / VHH CD16 c21 antibody is specific for tumor cells both in the form of Fab 'and F (ab') 2 .
  • Equivalent results are obtained with the other bispecific anti-CEA / anti-CD16 antibodies in the form of Fab, Fab 'and F (ab') 2 (derived from the 8 VHH anti-CEA and anti-CD16).
  • Specificity for CD 16 is described in the form of Fab, Fab 'and F (ab') 2 (derived from the 8 VHH anti-CEA and anti-CD16).
  • anti-CD16 antibodies selected from CD16B should also recognize CD16A. In addition, they must not be cross-reactive with CD32 (RFc ⁇ lIA and RFc ⁇ lIB).
  • the experiments are carried out with Jurkat cells (cells of a human T-lymphocyte TIB-152 line) transfected or not with the gene which encodes CD16A (stable line expressing CD16A on their surface, Vivier et al. , 1992), granulocytes that express CD16B, K562 cells that express only CD32A, and HA 6huIIB1 cells that express only CD32B.
  • Antibodies used for binding to cells are carried out with Jurkat cells (cells of a human T-lymphocyte TIB-152 line) transfected or not with the gene which encodes CD16A (stable line expressing CD16A on their surface, Vivier et al. , 1992), granulocytes that express CD16B, K562 cells that express only CD32A, and HA
  • anti-CD16 monoclonal antibody Rc ⁇ lIIA / human
  • anti-site antibody recognizing a conformational epitope and blocking the binding of IgG to CD16A and CD16B.
  • anti-CD16 monoclonal antibody human RFc ⁇ lIIA / IIIB
  • an antibody recognizing a linear epitope located off-site of CD16 IgG binding and only weakly affecting this binding at high concentrations in competitive assays
  • Anti-CEA / anti-CD16 bispecific antibodies constructed from the 8 isolated VHHs. Antibodies used for the revelation:
  • 0.5 x 10 6 cells are used per test.
  • the VHH and monoclonal antibodies are diluted in 100 ⁇ l of PBS-1% BSA.
  • 0.5 x 10 6 cells (measurement of autofluorescence of cells)
  • the FACS results demonstrate the specificity of the 4 anti-CD16 VHHs analyzed and bispecific anti-CEA / anti-CD16 antibodies in the form of Fab, Fab 'and F (ab') 2 . They are specific to CD 16 and do not cross with the CD32.
  • An example is shown in Figure 4.
  • mAb 3G8 monoclonal mAb binds to Jurkat, K562 CD32A + and IIA.1.6huIIB1 CD32B + cells that do not express CD16 but on cells.
  • Jurkat CD 16A + and the granulocytes that express CD 16 on their surface.
  • VHH CD 16 c21 only binds cells that express CD 16 on their surface.
  • Anti-CD16 VHH of the different anticotp fragments is then detected, in two stages, by incubating monoclonal antibody 7.5.4 or 3G8 (3 ⁇ g / ml) with the cells for 30 min, in the ice and then incubating the cells. with FITC-labeled goat anti-mouse IgG (H + L) F (ab ') 2 (Jackson Immunoresearch Laboratory, cat: 115-096-003), during
  • VHH anti-CEA domain Five 10 5 Jurkat CD16A + cells are incubated for 30 min in PBS-BSA
  • rhCEA (10 ⁇ g / ml) to the VHH anti-CEA domain of Fab, Fab 'or F (ab') 2 is then detected, in two steps, by incubating the monoclonal antibody 192 (3 ⁇ g / ml ) with the cells for 30 min, in ice and then incubating the cells with FITC-labeled goat anti-mouse IgG (H + L) F (ab ') 2 (cat: 115-096). 003), for 30 minutes in the ice. After several washings, the immunofluorescence is analyzed by flow cytometry with a FACScalibur 4C4 (Becton dickinson) using the CeIl Quest Pro program.
  • FACScalibur 4C4 Becton dickinson
  • FIG. 5 An example is shown in Figure 5.
  • the bispecific VHH CEA 17 / VHH CD16 c21 antibody binds to both LS174T and Jurkat CD 16A + cells. Equivalent results are obtained with the other bispecific anti-CEA / anti-CD16 antibodies in the form of Fab, Fab 'and F (ab') 2 (derived from the 8 VHH anti-CEA and anti-CD16).
  • CD1b-monoclonal antibody binding is revealed with a goat anti-mouse IgG F (ab ') 2 coupled to alkaline phosphatase (Southern Biotechnology, 1030-04) in the presence of p-nitrophenylphosphatase (Sigma, N9389).
  • VHH CD 16 c21 is displaced by the monoclonal antibody 7.5.4.
  • VHH CD16 c28 is displaced by the monoclonal antibody 3G8.
  • VHH CD 16 c21 or c28 from 1 to 100 ⁇ g / ml.
  • the cells are then incubated with 0.1 ⁇ g / ml of 3G8 or 1 ⁇ g / ml of 7.5.4 for 30 min under the same conditions, and then washed with 5% PBS-BSA.
  • the binding of 3G8 or 7.5.4 is then detected by incubating cells with F (ab ') 2 of a FITC-labeled goat anti-mouse IgG (H + L) antibody (Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA, Cat #: 115-096-003) for 30 minutes in the ice.
  • FACScalibur 4CA Becton Dickinson, Mountain View, California, USA
  • CD16 c21 is displaced by monoclonal antibody 7.5.4.
  • VHH CD16 c28 is displaced by the monoclonal antibody 3G8. At high dose the VHH CD16 c28 is also displaced by mAb 7.5.4.
  • the experiments are carried out with Jurkat cells (ATCC TIB-152) transfected with the gene which encodes CD 16 A.
  • the cells are cultured in RPMI 1640 supplemented with 10% FCS, 100 U / ml penicillin, 100 ⁇ g / ml streptomycin , 2 mM L-glutamine, 0.5 mg / ml G418.
  • Five x 10 5 cells are then incubated for 18 h in wells of microplates (250 .mu.l of RPMI containing 10% FCS, 1% PS 5 0.5 mg / ml G418).
  • PMA phorbol myristate acetate
  • Human IL2 produced in the cell supernatants is measured by ELISA using the antibodies of the R & D kit (Duoset Human IL2; reference: DY202) and alkaline phosphatase-coupled streptavidin (DAKO, DO396) in the presence of p-nitrophenylphosphate ( Sigma cat 104-405).
  • the activation results of CD16A production and secretion of interleukin 2 are shown in FIG. 8.
  • the two anti-CD16 c21 and c28 VHHs activate IL2 production of Jurkat CD 16A + cells. Higher amounts of c28 are required to achieve an IL2 production and secretion induction comparable to that induced by c21.
  • the anti-CEA 17 / anti-CD16 c21 bispecific antibody in F (ab ') 2 form also activates IL2 production if Jurkat cells express CD16A on their surface and this in the absence of bypass via streptavidin . Equivalent results are obtained from other anti-CD16 VHHs and bispecific anti-CEA / anti-CD16 antibodies
  • the lines used are NKL cells (Robertson et al., 1996 (12)) from leukemia with large granular lymphocytes, having functional properties similar to that of NK, and of which expression of CD 16 was previously verified by flow cytometry.
  • the target cells used are HeLa cells from human leukemia, highly sensitive to NK, NK-sensitive C 15.4.3 AP (MC38) murine colon cells and MC38 cells transfected with human CEA and naturally resistant to NK.
  • Target cells in culture are resuspended (by tryptic reaction for HeLa cells, mechanically for MC38 and NKL cells) and counted with Trypan blue in a Malassay cell.
  • FIGS. 10A, 10B, 11, 12A and 12B Construction of the different plasmids (see FIGS. 10A, 10B, 11, 12A and 12B).
  • the genes coding for the CK, CH1, H, CH2 and CH3 regions respectively correspond to: the domains of genes coding for the constant region of a human immunoglobulin kappa light chain, for the first region constant, for the hinge region, for the second constant region and for the third constant region of a human IgG1 immunoglobulin heavy chain.
  • These genes were obtained by RT-PCR from a pocket of the LFB (French Laboratory of Fractionation and Biotechnology). This material subscribes to the legal authorizations to be used for the described experiments.
  • each plasmid is carried out on ABI sequencer 310 using the oligonucleotides:
  • All vectors are designed to allow introduction between 2 unique restriction enzyme sites of: different promoters, different PeIB (or other) signal sequences, different RBS sequences, any humanized VHH or VHH domain, any C ⁇ domain or CH1, H, CH2 and CH3 domains of any type of immunoglobulin.
  • pMCSPhoA '
  • This plasmid encodes the mature form of Alkaline Phosphatase (PhoA) starting at the sixth residue (Proline).
  • Overlapping PCR is performed from pMCSPhoA 'with the oligonucleotides: upstream-RsrII, NcoI-sup, NcoI-inf and downstream-EcoNI. Sequences SEQ ID No. 14 to 17 of the oligonucleotides used: upstream-RsrlI
  • SEQ ID NO: 14 GGCACATGTGACCTCGCGC
  • SEQ ID NO: 15 GCAACGTACCACGGCAATATCG Ncol-inf
  • SEQ ID NO: 16 CGATATTGCCGTGGTACGTTGC downstream-EcoNI
  • SEQ ID NO: 17 GCCATCTTTGGTATTTAGCGCC
  • PCR 1 and PCR 2 Conditions: One ⁇ l of plasmid (5 ng), 10 pmoles of each oligonucleotide (upstream-RsrII and
  • PCR products are purified from a 2% agarose gel
  • the sequence of the PCR fragment is carried out on an ABI 310 sequencer using Poligo
  • Each DNA is then precipitated and resuspended with 20 .mu.l of E.
  • the ligation is carried out for 16 h at 16 ° C. with 5 ⁇ l of PCR fragment, 0.5 ⁇ l of vector and 3 U Weiss of T4 DNA ligase Biolabs in a final volume of 10 ⁇ l. Competent TG1 bacteria (CaCl 2 technique) are transformed with 5 .mu.l of ligation. p55PhoA6HisGS / N "
  • PCR is carried out from p35PhoA '/ N " using XhoI-SacI oligonucleotides and
  • SEQ ID NO: 18 CCATGGCGGCCGATCCTCGAGAG 6HisGS / HindIII
  • PCR was performed with 5 ng of p35PhoA '/ N " vector, 10 pmol of each oligonucleotide and 0.5 U Dynazyme (94 ° C, 3 min, 94 ° C, 1 min, 70 ° C, 1 min. 72 ° C., 1 min, 35 cycles then 72 ° C., 10 min) in a final volume of 50 ⁇ l
  • the PCR product is purified from a 1% agarose gel (Quiagen Kit Extraction Gel, final volume 50 ⁇ l).
  • SEQ ID NO: 20 CATAGAGCTGTCTTCGGTATC Apal-BstEII-sup
  • SEQ ID NO: 21 TAATGGTCCCGCTAACAGCGCGATTTGCTGATGACCCA BstEII-Apal-inf
  • SEQ ID No. 22 TGGGTC ATCAGC AAATCGCGCTGTTAGCGGGACC ATTA down-MluI
  • SEQ ID No. 23 GAACGAAGCGGCGTCGAAG
  • MIuI for PCR 2 MIuI for PCR 2
  • 0.5 U Dynazyme 94 ° C., 3 minutes, 94 ° C., 45 seconds, 60 ° C., 45 seconds, 72 ° C., 45 seconds;
  • PCR products are purified from an agarose gel
  • the ligation is carried out for 16 h at 16 ° C. with 5 ⁇ l of PCR fragment, 0.5 ⁇ l of vector and 3 U Weiss of T4 DNA ligase Biolabs in a final volume of 10 ⁇ l. Competent TG1 bacteria (CaCl 2 technique) are transformed with 5 .mu.l of ligation.
  • p55PhoA6HisGS7NAB "
  • Phase shift of the PhoA gene at the Eagl site creates a unique Fsel site.
  • Five ⁇ l (2.5 ⁇ g) of ⁇ 55PhoA6HisGS / NAB " are digested with 10 U of Eagl.
  • This plasmid allows the cloning and selection of the best secreted human VH antibody fragments. p55 / MCSL
  • Cloning takes place exactly according to the conditions described previously for the insertion of the MCSI.
  • the ligation mixture is digested with 10 U of XbaI enzyme.
  • p55C ⁇ Flag / RBS / 35cmyc6HisGS (FIGS. 1OB and 11)
  • Human B cells are purified by Ficoll gradient from the pocket provided by LFB.
  • L 1 total RNA is then prepared according to the protocol described in paragraph
  • RNA is preincubated with 1 pmole of 3 'CK oligonucleotide for 10 min at 70 ° C in a final volume of 8 ⁇ l. The temperature is lowered slowly (45 min) to 37 ° C.
  • RNAsine 20 U
  • 3 .mu.l of 5X buffer SuperScriptII, Invitrogen
  • 1 .mu.l of DTT 100 mM
  • 2 .mu.l of 10 mM dNTP are added and the mixture is incubated for 10 min at 50.degree. 0.75 ⁇ l of SuperScript (150 U) are then added and the incubation is continued for 30 minutes at 50 ° C. and 15 minutes at 70 ° C.
  • L 1 obtained cDNA is purified on beads (BioMag Carboxyl Terminated, Polysciences) according to the supplier's recommendations. The final elution is carried out with 15 ⁇ l of Tris-acetate 10 mM pH 7.8.
  • PCRl is carried out with 1 ⁇ l of cDNA, 10 pmol of each oligonucleotide 5 'CK and 3' CK, 0.5 U Dynazyme (94 ° C, 3 min, 94 ° C, 1 min, 60 ° C, 1 min. 72 ° C., 1.5 min, 30 cycles then 72 ° C., 10 min) in a final volume of 50 ⁇ l.
  • PCR 2 is made from 1 ⁇ l of PCRl using 0.5 U of Deep-Vent, (94 ° C., 3 min, 94 ° C., 45 sec, 60 ° C., 45 sec, 72 ° C., 45 sec. 25 cycles then 72 ° C., 5 min) in a final volume of 50 ⁇ l.
  • the PCR product is purified from a 2% agarose gel (Quiagen Kit extraction gel, final volume 50 ⁇ l).
  • the PCR fragment is sequenced before cloning on ABI310 with the 5 'CK and 3' CK oligonucleotides.
  • Cloning of the CK domain is carried out between the BstEII and SacII sites of p55Flag / RBS / 35cmyc6HisGS: 20 ⁇ l of the PCR fragment 2 and 5 ⁇ l (2.5 ⁇ g) of p55Flag / RBS / 35cmyc6HisGS are digested with 10 U of BstEII and SacII. After 16 hours of incubation the enzymes are destroyed for 10 min at 65 ° C. Each DNA is then precipitated and resuspended with 20 ⁇ l of H 2 O.
  • the ligation is carried out for 16 h at 16 ° C. with 5 ⁇ l of PCR fragment 2, 0.5 ⁇ l of vector and 3 U Weiss of T4 DNA ligase Biolabs in a final volume of 10 ⁇ l. Competent TG1 bacteria (CaCl 2 technique) are transformed with 5 .mu.l of ligation.
  • p55C ⁇ FIag / RBS / 35CHljlcmyc6HisGS pC ⁇ CH1 yl-T ⁇ G
  • SEQ ID NO: 35 GGAGGGCACGGTCACTACGCTGCTGAGGG
  • Amplification of the CH1 domain is carried out by overlap PCR to destroy the BstEII site.
  • PCR 1 after RT is carried out with 1 ⁇ l of cDNA, 10 pmoles of each 5 'CHl ⁇ 1 and 3' CHl ⁇ 1 oligonucleotides, 0.5 U of Dynazyme (94 ° C, 3 min, 94 ° C, 1 min;
  • PCR 2a is made of 1 .mu.l PCR 1, with the oligonucleotides 5 'CHl L hSi and BstEII-inf using 0.5 U of Dynazyme (94 0 C, 3 min; 94 ° C, 45 s; 60 0 C., 45 s, 72 ° C., 45 sec, 25 cycles and then 72 ° C., 5 min) in a final volume of 50 ⁇ l.
  • PCR 2b is made of 1 .mu.l PCR 1, with the oligonucleotides BstEII and sup 3 'CHl L hSi using 0.5 U of Dynazyme (94 ° C, 3 min; 94 ° C, 45 s; 60 0 C, 45 s;
  • PCR 3 is carried out from one ⁇ l of each PCR 2a and PCR 2b, with the oligonucleotides 5 'CHl ⁇ l and 3' CHl ⁇ l, using 0.5 U of Deep-Vent (94 ° C, 3 min;
  • the PCR product 3 is purified from a 2% agarose gel (Quiagen Kit extraction gel, final volume 50 ⁇ l).
  • the sequence of the PCR fragment 3 is carried out on an ABI 310 sequencer using the oligonucleotides: 5 'CHl ⁇ 1 and 3' CHl ⁇ l.
  • Cloning is carried out as described for the CK domain but between the SfiI and NotI sites of p55C ⁇ Flag / RBS / 35cmyc6HisGS.
  • pC ⁇ CHly1-TAG The resulting plasmid is more commonly called: pC ⁇ CHly1-TAG, it allows the production of Fab-type antibody fragments each chain has a label ( Figure 12A).
  • pSSCicFIag / RBS / SSCHlHylcmyc ⁇ HisGS (FIGS. 1B and 11)
  • PCR1, 2a, 2b and 3 are carried out exactly as for the amplification of the CH1 domain described above by replacing the oligonucleotide 3 'CyI by the oligonucleotide 3' CHlHyI whose sequence SEQ ID No. 36 is indicated below. below: 3 'CHIHyI SEQ ID NO: 36
  • the resulting plasmid is more commonly called: pC ⁇ CH1Hyl-TAG, it allows the production of F (ab ') 2 type antibody fragments of which each chain has a label ( Figure 12A).
  • p55C ⁇ / RBS / 35CHlyl pC ⁇ GH1 ⁇ 1 (FIGS. 10B and 11)
  • SEQ ID NO: 37 GGAGAGTGTTAATAAACAGGAAACAGAAGTCCATATGAAATACCTATTGCCTA CGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGC SEQ ID NO: 120:
  • Cloning takes place exactly according to the conditions described for the insertion of the MCSI.
  • the resulting intermediate plasmid is named: p55Ci ⁇ yRBS / 35CHl ⁇ lcmyc6HisGS.
  • the c-myc-6HisGS motif is removed by recloning the CHlIl domain in p55C ⁇ / RBS / 35CH1lcmyc6HisGS.
  • PCR is used by amplifying from 5 ng of plasmid p55CicFlag / RBS / 35CHlylcmyc6HisGS the CHlyl domain with the oligonucleotides 5 'CHlyl and 3' CHlyl-STOP. Sequence SEQ ID No. 39 of the oligonucleotide used:
  • Cloning of the PCR fragment is carried out as described for the CK domain but between the SfiI and HindIII sites of plasmid pSSCic / RBS / SSCHlylcmycHisGS.
  • the resulting plasmid is more commonly called: pC ⁇ CHlyl, it allows the production of Fab antibody fragments ( Figure 12A).
  • the c-myc-6HisGS motif is removed by recloning the CHlH ⁇ 1 domain in pSSCK / RBS / SSCHIHylcmyc ⁇ HisGS.
  • PCR is used by amplifying from 5 ⁇ g of plasmid p55C ⁇ Flag / RBS / 35CHlHylcmyc6HisGS the CHlHyI domain with the oligonucleotides 5 'CHlyl and 3' CHlHyI-STOP.
  • the resulting plasmid is more commonly called: pC ⁇ CH1Hyl, it allows the production of F (ab ') 2 type antibody fragments ( Figure 12A).
  • PCR1, 2a, 2b and 3 are carried out exactly as for the amplification of the CH1 domain described above by replacing the 3 'oligonucleotide CHlyl with the 3' HindIII / H-CH2-CH3 oligonucleotide whose sequence SEQ ID NO. 41 is shown below:
  • FIGS. 10B and 11 Insertion of the Hinge region (H) and constant CH2 and CH3 regions of an IgG1 immunoglobulin between the BstEII and NotI sites of p55Flag / RBS / 35cmyc6HisGS.
  • AAGCTTAATCTAGAGCGGCCGCTTTACCCGGAGACAGAGGAG The PCR after RT is carried out with 1 ⁇ l of cDNA, 10 pmoles of each 5 'BstE2 / H-CH2-CH3 oligonucleotides and 3' NotI / H-CH2-CH3, 0.5 U of Dynazyme (94 ° C, 3 min, 94 ° C, 1 min, 60 ° C, 1 min, 72 ° C, 1.5 min, 30 cycles then 72 ° C, 10 min) in a final volume of 50 ⁇ l.
  • the resulting plasmid is more commonly called: pHCH2CH3yl-TAG, it allows the production of (HCH2CH3) 2 type antibody fragments with a label at the CH3 end ( Figure 12B).
  • p55HCH2CH3yl pHCH2CH3 ⁇ 1 (FIGS. 10B and 11)
  • Hinge region (H) Insertion of the Hinge region (H) and the constant CH2 and CH3 regions of an IgG1 immunoglobulin between the BstEII and HindIII sites of p55Flag / RBS / 35cmyc6HisGS.
  • Reverse transcription is performed exactly as described for CK, but using the 3 'HindIII / H-CH2-CH3 oligonucleotide.
  • SEQ ID NO: 45 CCGCCAAAACAGCCAAGCTTATTTACCCGGAGACAGGGAG
  • the PCR after RT is carried out with 1 ⁇ l of cDNA, 10 pmoles of each 5 'BstE2 / H-CH2-CH3 oligonucleotides and 3' HindIII / H-CH2-CH3, 0.5 U of Dynazyme
  • the resulting plasmid is more commonly called: pHCH2CH3 ⁇ 1, it allows the production of antibody fragments of type (HCH2CH3) 2 ( Figure 12B).
  • VHH can be introduced between single sites.
  • VHHs Upstream of H: EcoRI and BstEII
  • the different VHHs are amplified by PCR with the pairs of 5 'and 3' oligonucleotides described below:
  • SEQ ID NO: 46 CGACACCGGAATTCCATATGAAATACCTATTACCAACAGCAGCAGCTGGGTTA
  • SEQ ID NO: 49 CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGT
  • Electrophoresis gels are shown in FIG. 13.
  • the Fab 'and F (ab') 2 are purified on cobalt collon then on protein G.
  • the various antibody fragments are then separated on supedex 200 (or possibly superdex 75 ).
  • the principle of the method consists in cloning human VH domains (isolated by RT-PCR from the LFB pocket) in the plasmid p55PhoA6HisGS7NAB " (FIGS. 1OA and 11), which plasmid possesses the gene coding for alkaline phosphatase in a plasmid. Reading phase does not allow its expression Cloning of VH restores the reading phase of alkaline phosphatase and allows the production of VH fused upstream of alkaline phosphatase (VH-PhoA library cloned in TG1 bacteria).
  • clones microplates are replicated and stored at -8O 0 C. After 2 hours of induction at 37 ° C, or 16 hours of induction at 30 ° C, 24 0 C or 18 0 C 5 growth judgment is and the phosphatase activity is directly measured from the supernatants of the culture media. The phosphatase activity is then directly correlated to the number of bacteria present in each well of microplates.
  • Alkaline phosphatase is active only if it is secreted into the bacterial periplasm as a dimer with its properly formed disulfide bridges. This approach therefore makes it possible to select the clones producing the largest amount of secreted VH-PhoA fusion protein in the bacterial culture medium. It is thus possible to select the VH which are correctly folded and whose disulphide bridge is correctly formed, therefore soluble.
  • the selected VHs will serve as a template for exchanging human VH CDRs by the previously described lamas VHH CDRs.
  • the choice of the VH will be realized by choosing the VH whose amino acids of the junctions of the
  • CDRs are equivalent to those of VHH.
  • RNA purification described in section 1.3.2
  • 1 pmole of oligonucleotides mixture of: 3 'JH1 -4-5; 3'JH2; 3 'JH3 and 3 1 JH6
  • the temperature is lowered slowly (45 min) to 37 ° C.
  • RNAsine 20 U
  • 3 .mu.l of 5X buffer SuperScriptII, Invitrogen
  • 1 .mu.l of DTT 100 mM
  • 2 .mu.l of 10 mM dNTP are added and the mixture is incubated for 10 min at 50.degree. 0.75 ⁇ l of SuperScript (150 U) are then added and the incubation is continued for 30 minutes at 50 ° C. and 15 minutes at 70 ° C.
  • L 1 obtained cDNA is purified on beads (BioMag Carboxyl Terminated, Polysciences) according to the supplier's recommendations. The final elution is carried out with 15 ⁇ l of Tris-acetate 10 mM pH 7.8.
  • PCRl is carried out with 1 ⁇ l of cDNA (obtained by RT-PCR), 10 pmol of 5 'oligonucleotides (0.625 pmol of each 5' oligonucleotides whose sequences are indicated below) and 3 '(2.5 pmoles). of each oligonucleotide 3 'whose sequences are shown below), 0.5 U of Dynazyme (95 ° C, 3 min, then 95 ° C, 1 min, 58 ° C, 1 min, 72 ° C, 1 min. for 35 cycles then 72 ° C., 10 min). The PCR products are deposited on a 2% agarose gel and the bands corresponding to the VH are purified (Qiagen Kit extraction gel). PCR2 is made from 1 .mu.l of PCRl diluted 1/1000, the same amount of oligonucleotides described above, 0.5 U Deep-Vent for a final volume of 50 .mu.l.
  • the fragments are purified from 2% agarose gel as previously described.
  • SEQ ID NO: 55 CG GCC AGC CCG GCC ATG GCC (CG) AG GTC AGC CTG GTA AGC TCT GG
  • SEQ ID NO: 60 CGGCCCAGCCGGCCATGGCCGAAGTGCAGCTGGTGGAGTCTGG
  • SEQ ID NO: 64 CG GCC AGC CCG GCC ATG GCC AGC CTG AGC CTG AGC GAG TC (GC) GG
  • SEQ ID NO: 72 GTCTAGACGTCCCCCCGGGGAGGAGACGGTGACCGTGG
  • the different PCR fragments purified were digested with 10 U NcoI and XmaI and inserted into the cloning vector p55 / PhoA6HisGS7NAB "by ligation.
  • the ligation mix is digested with FseI before transformation of the bacteria.
  • the transformation is carried out by electroporation with electrocompetent TG1 bacteria clones with an inserted VH domain restores phosphatase activity (blue colonies) Production in 96 or 384 well microplates:
  • Control negative control medium (2YT / ampicillin 100 ⁇ g / ml), negative control of the vector p55 / PhoA6HisGS7NAB ' , positive control of the vector p55PhoA6HisGS / NAB " Distribution of 150 or 40 ⁇ l of culture medium (2YT / ampicillin 100 ⁇ g / ml) per well (Nunclon Surface, Nunc) Each well is inoculated with a blue insulated colony with a toothpick or cell piercer (Qpix) and then sealed with a sterile adhesive sheet. at 37 ° C. or 30 ° C.
  • the alkaline phosphatase activity measured at 405 nm is reduced to the number of cells (measurement OD 620 nm) contained in each well at the end of induction.
  • Soluble CD16 binds peripheral blood mononuclear cells and inhibits pokeweed-mitogen-induced responses. Blood, 1993, 82: 3081-3090).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention vise des formats d'anticorps, caractérisés en ce qu'ils comprennent tout ou partie des domaines de VHH ou de VHH humanisés ou de VH humains fusionnés à des régions constantes d'anticorps humains. Application de ces formats d'anticorps en immunodiagnostic et en immunothérapie.

Description

« Production de formats d'anticorps et applications immunologiques de ces formats »
L'invention se rapporte à la production de formats d'anticorps et à leurs applications immunologiques, plus particulièrement en immunothérapie et en immunodiagnostic.
On rappelle que les molécules d'anticorps sont des immunoglobulines (Ig) appartenant à 5 classes : IgM, IgG, IgD, IgE et IgA. De manière générale, ces molécules comprennent une chaîne lourde (H) et une chaîne légère (L) qui est soit la chaîne kappa (K), soit la chaîne lambda (λ). Chaque classe d' immunoglobulines comporte un type propre de chaîne H : chaîne μ pour l'IgM, γ pour l'IgG, δ pour l'IgD, ε pour I3IgE et α pour I5IgA.
Chaque chaîne est formée de domaines, chacun possédant une liaison disulfure interne. Une chaîne L possède deux domaines et une chaîne H, 4 domaines. La séquence du domaine comprenant l'extrémité aminée de chaque chaîne est variable (régions VH et VL), celle des autres domaines est constante (CHl, CH2 et CH3 de la chaîne H, et CL de la chaîne L).
Les régions variables V comportent des régions de séquences hypervariables appelées CDR dont l'ensemble détermine la complémentarité.
Dans les chaînes H, les deux premiers domaines (VH-CHl) sont suivis d'une région charnière. Dans une immunoglobuline, la chaîne L est reliée à la chaîne H par une liaison disulfure pour former un hétérodimère. Cet hétérodimère est relié au même hétérodimère par plusieurs liaisons disulfures au niveau de la région charnière pour former l'immunoglobuline. Par clivage à l'aide d'une protéase au niveau de la charnière, on obtient deux fragments : le fragment Fab (domaine fixant l'antigène, composé des domaines VL- CL et VH-CHl) et le fragment Fc (domaine effecteur, composé des domaines (CH2-
CHB)2).
L'invention concerne plus spécialement des fragments d'anticorps et différents formats d'anticorps élaborés à partir de ces fragments, en particulier des formats d'anticorps chimérisés ou humanisés, multispécifiques et/ou multivalents. Les « formats d'anticorps » tels que visés par l'invention correspondent à différentes combinaisons des domaines et régions des types mentionnés ci-dessus. Par « anticorps chimérisé », on entend un domaine VH d'origine animale fusionné aux régions constantes d'une immunoglobuline humaine.
Par « anticorps humanisé », on entend un domaine VH humain sur lequel on a greffé les régions hypervariables (CDRs) d'un VH d'origine animale, fusionné aux régions constantes d'une Ig humaine.
Ces anticorps reconnaissent les épitopes de cibles correspondant à une molécule donnée. Ces épitopes peuvent être différents, et appartenir à des cibles différentes ou à la même cible. Ainsi, « anticorps bispécifique » désigne un format possédant deux VH différents liant deux cibles différentes ; « anticorps biépitopique » correspond à un format possédant deux VH différents liant deux épitopes différents sur la même cible.
La « valence » correspond au nombre de fois où le même VH se trouve sur le fragment considéré.
La spécificité de reconnaissance des anticorps pour atteindre une cible déterminée a été exploitée pour le diagnostic et la thérapie de différentes pathologies, et tout particulièrement dans le cas de l'oncologie, où la cible peut être un antigène associé aux tumeurs, un récepteur de facteur de croissance, un produit d'oncogène ou de gène "suppresseur de tumeur" muté, voire une molécule liée à l'angiogenèse ou une molécule exprimée également sur les cellules non tumorales, mais absente des cellules progénitrices (comme dans le cas du CD20). Après plus de 20 années de travaux expérimentaux, Pimmunociblage des tumeurs par des anticorps monoclonaux connaît actuellement un développement important.
Ainsi, les résultats de différentes études cliniques ont démontré, récemment, les possibilités thérapeutiques de certains anticorps et ont conduit à leur approbation par la FDA et à l'obtention d'AMM européenne. Cette progression est due pour beaucoup à l'utilisation d'anticorps recombinants dits de «seconde génération» :
- anticorps humanisés, comme l'Herceptine, un anticorps anti-HER2/Neu utilisé en association avec la chimiothérapie dans certains carcinomes du sein,
- anticorps chimériques comme le Rituximab, un anticorps anti-CD20 utilisé dans le traitement de lymphomes B folliculaires.
Grâce à l'ingénierie génétique, il est en effet possible de «greffer» les régions variables ou hypervariables d'anticorps de souris sur des molécules d'Ig humaines. De nouvelles techniques permettent désormais d'obtenir des anticorps entièrement humains soit par sélection de domaines variables humains exprimés sur des phages (technique dite du «Pliage display»), soit en utilisant des souris transgéniques produisant des anticorps humains. Par ailleurs, pour stimuler le système immunitaire et favoriser ainsi le contact entre la cellule cible tumorale et une cellule effectrice, on a utilisé le concept d'anticorps bispécifiques. Il s'agit donc de construire un anticorps doté d'une double spécificité : cet anticorps doit être capable de fixer une molécule produite à la surface des cellules tumorales (telles que le CEA, HER2/Neu, le GD2 ...) et une molécule exprimée à la surface de cellules effectrices de l'immunité, cellules NK, lymphocytes T tueurs ou CTL, polynucléaires neutrophiles, monocytes et macrophages (telles que les récepteurs Fc...). Une variante à cette stratégie consiste à construire un anticorps liant une molécule produite à la surface de la cellule tumorale et une molécule présentant des propriétés directes ou indirectes de cytotoxicité (radio-élément, toxine, pro-drogue). Jusqu'à présent la plupart des anticorps bispécifiques étaient développés en couplant 2 fragments d'anticorps par voie biochimique. Cette technique est cependant rarement développée à l'échelle industrielle. Quelques anticorps bispécifiques ont été développés par voie génétique, tels que les anticorps bispécifiques de type scFv (« diabodies »). Mais ils restent difficiles à produire dans E. coli sous forme soluble et ils sont de plus très peu efficaces en termes d'ADCC.
Dans le cadre de la recherche d'anticorps candidats pour générer des formats d'anticorps pour l'immunothérapie et disposer notamment d'anticorps multi-spécifiques, les inventeurs ont orienté leurs travaux vers des anticorps particuliers, dépourvus de chaîne légère, identifiés chez les camélidés (chameau, dromadaire, lama) (Hamers-Casterman et al, 1993).
Des domaines variables d'anticorps simple chaîne lourde de camélidés (VHH), reconnaissant spécifiquement un type d'antigènes, ont été sélectionnés à partir d'animaux immunisés et ont permis de concevoir divers formats d'anticorps chimérisés ou humanisés pouvant être produits à partir de constructions plasmidiques. Il s'est avéré que les différents formats étaient compatibles pour permettre la production de n'importe quel autre VHH ou VHH humanisé, ou VH humain. L'invention a pour but de fournir des formats d'anticorps comportant une partie ou la totalité des domaines de VHH ou de VHH humanisés, ou de VH humains, ayant les propriétés de reconnaissance de cibles et d'épitopes recherchés.
Elle a également pour but de fournir un procédé de production de ces différentes constructions.
Selon encore un autre aspect, l'invention vise les applications immunothérapeutiques et immunodiagnostiques des différents formats rendus accessibles.
L'invention a ainsi pour objet les formats d'anticorps comprenant une partie ou la totalité des domaines de VHH de camélidés, notamment de lamas et/ou de VH humains, fusionnés à des régions constantes d'anticorps humains.
Selon un premier mode de réalisation de l'invention, les formats d'anticorps sont de type Fab et sont caractérisés par l'association de deux domaines VHH ou de deux domaines VH humains, identiques ou différents, ou deux domaines VH humains sur lesquels sont greffés les CDRs des VHH, l'un des domaines étant fusionné à la région constante CK OU Cλ d'une immunoglobuline humaine, l'autre à la région constante CHl d'une immunoglobuline humaine.
Selon un deuxième mode de réalisation de l'invention, les formats d'anticorps sont de type Fab' et sont caractérisés par l'association de deux domaines VHH ou de deux domaines VH humains, identiques ou différents, ou deux domaines VH humains sur lesquels sont greffés les CDRs des VHH, l'un des domaines étant fusionné à la région constante CK OU Cλ d'une immunoglobuline humaine, l'autre à la région constante CHl suivie d'une région charnière H d'une immunoglobuline humaine.
Ces formats d'anticorps chimérisés ou humanisés sont de type monospécifique/bivalent, bispécifique/monovalent et biépitopique/monovalent. Selon un troisième mode de réalisation de l'invention, les formats d'anticorps sont de type F(ab')2 et sont caractérisés par l'association de deux formats de type Fab' tels que définis ci-dessus.
Ces formats d'anticorps chimérisés ou humanisés possèdent une région charnière H, "Hinge" d'une immunoglubuline humaine et permettent les combinaisons monospécifique/tétravalent, bispécifique/bivalent et biépitopique/bivalent. Selon un quatrième mode de réalisation de l'invention, les formats d'anticorps sont de type F(ab')2 et sont caractérisés par l'association de deux Fab' obtenus par réduction des formats de type F(ab')2 ci-dessus.
Ces formats d'anticorps chimérisés ou humanisés possèdent une région charnière H "Hinge" d'une immunoglobuline humaine et permettent les combinaisons de monospécifique/tétravalent à tétraspécifïque/monovalent ou tétraépitopique/monovalent, incluant toutes les possibilités intermédiaires.
Selon un cinquième mode de réalisation de l'invention, les formats d'anticorps sont de type (HCH2CH3)2 (H, représentant la région charnière "Hinge" d'une immunoglobuline humaine, CH2 et CH3, représentant le second et troisième domaine constant d'une chaîne lourde d'une Ig humaine, et sont caractérisés par l'association de deux VHH ou de deux VH humains, identiques ou de deux VH humains sur lesquels sont greffés les régions hypervariables des VHH, chacun étant fusionné à la région H-CH2-CH3 d'une Ig humaine. Ces formats d'anticorps chimérisés ou humanisés permettent les combinaisons monospécifique/bivalent.
Selon un sixième mode de réalisation de l'invention, les formats d'anticorps sont de type mAb* (ce type désigne les domaines variables d'origine remplacés par tout ou partie des domaines de VHH ou de VHH humanisés ou de VH humains, fusionnés à des régions constantes d'anticorps humains) et sont caractérisés par l'association de deux VHH ou de deux VH humains, identiques ou différents, ou de deux VH humains sur lesquels sont greffées les régions hypervariables des VHH, l'un étant fusionné à la région CK OU Cλ humaine, l'autre à la région CH1-H-CH2-CH3 d'une Ig humaine.
Ces formats d'anticorps chimérisés ou humanisés permettent les combinaisons de type monospécifique/tétravalent et bispécifique/bivalent et biépitopique/bivalent. Dans ces différents formats, l'immunoglobuline est une IgG, correspondant à une isoforme IgGl, IgG2, IgG3 ou IgG4 humaine, ou une IgA humaine correspondant à une isoforme IgAl, Ig A2, ou toute autre Ig humaine.
Les VHH peuvent être remplacés par des VH humains ou des VHH humanisés par greffage des CDRs des VHH sur des VH humains. Dans des exemples des modes de réalisation de l'invention ci-dessus, les VHH correspondent ou comprennent des fragments d'anticorps VHH de camélidés, notamment de lamas. Il s'agit en particulier de fragments caractérisés en ce qu'il s'agit d'une partie ou de la totalité de fragments anti-antigène carcinoembryonnaire (anti-CEA en abrégé) ou anti-récepteur FcγRIII (anti-CD16 en abrégé).
Les fragments d'anticorps anti-CEA répondent plus particulièrement à une séquence en acides aminés choisie dans le groupe comprenant les séquences SEQ ID N° 77, SEQ ID N° 78, SEQ ID N° 79, SEQ ID N° 80 et SEQ ID N° 105.
Les fragments d'anticorps anti-CD16 répondent de manière préférée à une séquence en acides aminés choisie dans le groupe comprenant les séquences SEQ ID N0 73, SEQ ID N° 74, SEQ ID N0 75, SEQ ID N° 76, SEQ ID N° 103 et SEQ ID N° 104.
Ces fragments constituent des produits nouveaux et à ce titre entrent également dans le champ de l'invention.
L'invention vise aussi les CDRs de ces fragments VHH.
L'invention vise également un procédé de production d'anticorps chimérisés ou humanisés, multispécifiques et/ou multivalents pour l'immunothérapie ou l'immunodiagnostic, caractérisé en ce qu'il comprend l'utilisation de formats d'anticorps définis ci-dessus.
L'invention vise notamment un procédé lesdits formats comprennent des VHH de camélidés, notamment de lamas, anti-CEA et anti-CD16.
Il s'agit plus spécialement des domaines variables de VHH anti-CEA et anti-CD16 avantageusement produits selon un protocole comprenant - l'immunisation de camélidés, notamment de lamas avec, comme immunogène, un
CEA ou un CD 16,
- la purification des lymphocytes B récupérés à partir du sang,
- la construction de banque de VHH, et
- l'isolement des VHH à partir de la banque. La construction de la banque comprend
- l'extraction des ARN totaux des lymphocytes B,
- la transcription inverse des ARN pour obtenir les ADNc correspondants,
- l'amplification par PCR des gènes codant pour les régions variables des anticorps simple chaîne lourde anti-CD16 et anti-CEA, - la ligation de fragments d'ADN VHH obtenus par coupure, par des enzymes, des
ADN amplifiés avec un phagemide. Les VHH sont isolés à partir des banques par la technique de phage display et purifiés.
Lesdits domaines variables de VHH anti-CEA et anti- CD 16 sont avantageusement produits selon un protocole comprenant - l'immunisation de camélidés, notamment de lamas avec, comme irnmunogène, un CEA ou un CD 16,
- la purification des lymphocytes B récupérés à partir du sang,
- la construction de banque de VHH, et
- l'isolement des VHH à partir de la banque. De manière avantageuse, la construction de la banque comprend
- l'extraction des ARN totaux des lymphocytes B,
- la transcription inverse des ARN pour obtenir les ADNc correspondants,
- l'amplification par PCR des gènes codant pour les régions variables des anticorps simple chaîne lourde anti-CD16 et anti-CEA, - la ligation de fragments d'ADN VHH, obtenus par coupure par des enzymes des ADN amplifiés, avec un phagemide.
Les VHH sont isolés à partir des banques par la technique de phage display et purifiés.
Les différents VHH ont été validés en termes de spécificité et d'affinité comme illustré par les exemples.
Conformément à l'invention, les gènes des VHH sélectionnés ont ensuite été introduits dans des vecteurs d'expression, notamment des plasmides, pour produire différents formats d'anticorps chiméiïsés multispécifîques et/ou multivalents (anti- CEA/anti-CD16), capables de se lier aux cellules tumorales exprimant le CEA à leur surface et de recruter les cellules effectrices du système immunitaire (monocytes, macrophages, NK, polynucléaires neutrophiles...) qui expriment le CD 16.
L'invention vise également les vecteurs d'expression des formats d'anticorps définis ci-dessus.
Elle vise plus spécialement des vecteurs d'expression, notamment des plasmides renfermant entre deux sites uniques d'enzymes de restriction les promoteurs, les séquences signal, les séquences nucléotidiques capables de coder pour les domaines VHH définis ci- dessus, les régions constantes d'une Ig humaine, ou pour des domaines VH humains, les régions CDRs d'un VHH, les régions constantes d'une Ig humaine. Les plasmides selon l'invention sont capables d'exprimer en quantités élevées les formats d'anticorps définis ci-dessus, sous des formes solubles dans des bactéries et les régions codant pour les domaines d'anticorps peuvent être facilement transférées dans d'autres systèmes d'expression procaryotes ou encore eucaryotes.
L'invention vise ainsi les plasmides pCκCHlγl-TAG (SEQ ID N°98 et SEQ ID
N°112) et pCKCHlγl (SEQ ID N0IOO et SEQ ID N0114) permettant la production des anticorps de type Fab selon le premier mode de réalisation de formats d'anticorps défini ci- dessus. Ces plasmides sont plus spécialement caractérisés par l'insertion des séquences nucléotidiques codant pour la région légère CK, et la région constante lourde CHl d'une Ig dans le plasmide p55Flag/RBS/35cmyc6HisGS (SEQ ID N°94 et SEQ ID N0110).
L'invention vise également les plasmides pCκCHlHγl-TAG (SEQ ID N°99 et
SEQ ID N0113) et pCKCHlHγl (SEQ ID N0IOl et SEQ ID N0I l 5) permettant la production des anticorps de type Fab' et F(ab')2 selon les deuxième, troisième et quatrième mode de réalisation de formats d'anticorps définis ci-dessus.
Ces plasmides sont plus spécialement caractérisés par l'insertion des séquences nucléotidiques codant pour la chaîne lourde CHl et la région Hinge (H) d'une Ig dans p55Cι<FIag/RBS/35cmyc6HisGS (SEQ ID N°97 et SEQ ID N0Il 1). L'invention vise encore les plasmides pHCH2CH3γl-TAG (SEQ ID N°95) et pHCH2CH3γl (SEQ ID N°96) permettant la production des anticorps de type (HCH2CH3)2 selon le cinquième mode de réalisation de formats d'anticorps défini ci- dessus.
Ces plasmides sont plus spécialement caractérisés par l'insertion des séquences nucléotidiques codant pour la région Hinge (H) et les régions constantes CH2 et CH3 d'une Ig dans p55FIag/RBS/35cirayc6HisGS.
L'invention vise aussi le plasmide pMabγl* (SEQ ID N°102 et SEQ ID N°116) permettant la production des anticorps de type mAb* selon le sixième mode de réalisation de l'invention. Ce plasmide est plus spécialement caractérisé par l'insertion des séquences nucléotidiques codant pour la région constante lourde CHl, la région Hinge et les régions constantes CH2 et CH3 d'une Ig dans pCκCHlγl-TAG.
Les schémas de ces plasmides sont illustrés sur la figure 1OB et leurs séquences nucléotidiques dans la figure 11. Les plasmides intermédiaires utilisés pour la construction des plasmides ci-dessus entrent également dans le champ de l'invention. Il s'agit plus spécialement des plasmides p55PhoA6HisGS/N- (SEQ ID N°89), p55PhoA6HisGS/NAβ-
(SEQ ID N°90), p55/MCSl (SEQ ID N°92), p55Flag/RBS/35 (SEQ ID N°93 et SEQ ID
N°109), p55FIag/RBS/35cmyc6HisGS (SEQ ID N°94 et SEQ ID N0I lO) et p55CκFIag/RBS/35cmyc6HisGS (SEQ ID N°97 et SEQ ID N0I I l) construits pour développer les plasmides définis plus haut.
Les domaines CHl, CH2, CH3, H d'une Ig dans ces plasmides appartiennent à IgGl, IgG2, IgG3 ou IgG4, ou encore à IgA, ou toute autre Ig.
Les gènes codant pour les VHH ou les VH humains sont introduits entre les sites uniques dans les différents plasmides. Ces gènes peuvent être remplacés par des gènes codant pour des VHH humanisés par greffage des CDRs des VHH sur des VH humains.
De façon plus générale, les plasmides utilisés selon l'invention peuvent être conçus pour renfermer des séquences nucléotidiques codant pour d'autres VHH que les VHH anti- CEA ou anti-CD16, ou pour d'autres VH humains, ou pour d'autres VHH humanisés, capables de se fixer à n'importe quelle molécule.
L'invention vise encore le plasmide p55/PIioA6HisGS7NAB' (SEQ ID N°91) caractérisé en ce qu'il comprend les séquences nucléotidiques pour produire des domaines VH humains fusionnés à la phosphatase alcaline selon le schéma des figures 1OA et 11.
Une méthode pour sélectionner les fragments variables humains des chaînes lourdes d'immunoglobulines (VH) et isoler les clones les mieux produits et les mieux sécrétés a été développée.
De manière avantageuse, ces VH humains servent de matrice pour y greffer les CDR des VHH précédemment sélectionnés afin d'humaniser les régions variables.
Les formats d'anticorps définis ci-dessus présentent un grand intérêt en immunothérapie et pour l'immunodiagnostic. Ils sont en effet capables de reconnaître des molécules différentes ou de lier deux épitopes différents sur une même molécule, et permettent en outre d'avoir accès à de nouveaux épitopes non reconnus par les anticorps conventionnels. Ils peuvent être aisément humanisés, ce qui ouvre des perspectives avantageuses, pour disposer d'anticorps de faible immunogénécité après injection chez l'homme. Leur obtention sous une forme soluble constitue une caractéristique additionnelle d'intérêt pour ces anticorps. Leurs applications en immunodiagnostic et en immunothérapie font donc également partie de l'invention.
D'autres caractéristiques et avantages de l'invention seront donnés dans les exemples qui suivent dans lesquels il est fait référence aux figures 1 à 13, qui représentent, respectivement, - Les figures 1 et 2, les séquences en acides aminés (SEQ ID N°73 à 76, 103 et 104) et en nucléotides (SEQ ID N°81 à 84, 106 et 107) de 4 clones de VHH anti-CD16 et les séquences en acides aminés (SEQ ID N°77 à 80 et 105) et en nucléotides (SEQ ID N°85 à 88 et 108) de 4 clones anti-CEA isolés selon l'invention,
- les figures 3 et 4, les résultats par FACS montrant la spécificité de 8 VHH analysés, et des anticorps bispécifiques correspondant,
- la figure 5, les résultats par FACS montrant l'accessibilité sur cellules des anticorps bispécifiques,
- la figure 6, les résultats d'essais de compétition par ELISA entre 2 VHH anti-CD16 et des anticorps monoclonaux anti-CD16, - la figure 7, les profils de compétitions sur cellules par FACS de 2 VHH anti-CD16 et des anticorps monoclonaux anti-CD16,
- la figure 8, les résultats d'activation du CD16A par 2 VHH anti-CD16, et par l'anticorps bispécifique anti-CEA 17/anti-CD16 c21 de type F(ab')2,
- la figure 9, les résultats de lyse cellulaire par les cellules NK activées par les anticorps bi-spécifiques,
- les figures 10A et 10B, des constructions de plasmides selon l'invention, la figure 11, les séquences de plasmides de l'invention,
- les figures 12A et 12B, des formats d'anticorps de type Fab, Fab', F(ab')2, (HCH2CH3)2 et mAb*, - la figure 13, des gels d'électrophorèse de fragments d'anticorps de type Fab, Fab' et
F(ab')2 au cours des différentes étapes de leur purification. Exemple 1 : Immunisation des lamas, titration des sérums et purification des lymphocytes B.
Un lama femelle a été immunisé avec la région extracellulaire du récepteur FcγRIIIB humain recombinant (CD 16B) (décrit dans la publication : Teillaud C et ah, 1993).REF
Un lama mâle a été immunisé avec la région extracellulaire de l'antigène carcino- embryonnaire humain recombinant (CEA) (décrit dans la publication : Terskikh et al, 1993, et dans le brevet : Terskikh A étal, 1993).REF
Les animaux ont été immunisés tous les mois avec 500 μg de chacun des immunogènes. Cent ml de sang ont été prélevés 15 jours après chaque immunisation. Pour chacun des échantillons prélevés, une titration des sérums et des anticorps purifiés (IgGl, 2 et 3) a été réalisée pour détecter la présence d'anticorps contre les différents immunogènes. Les lymphocytes B ont ensuite été purifiés sur gradient de Ficoll (histopaque-1077, Sigma- Aldrich), puis lavés 2 fois avec du PBS.
Construction des banques de VHH : purification des ARN totaux, transcription inverse, PCRl, PCR2 et clonage dans Ie phagemide pHenl.
Construction des banques de VHH :
Purification des ARN totaux : Les ARN totaux des lymphocytes B sont extraits selon la méthode utilisant
Pisothiocyanate de guanidium (Chomczynski et Sacchi, 1987) REF. Après des extractions phénol/chloroforme en milieu acide, les ARN totaux sont précipités à Péthanol. La qualité des ARN et leur quantification sont évaluées sur gel d'agarose 1%. Ils sont ensuite convertis en ADNc par transcription inverse. Transcription inverse et PCR :
Séquences SEQ ID N° 1 à 9 des oligonucléotides utilisés : 3' CH2FORTA4
SEQ ID N°l : CGCC ATC AAGGTACCAGTTGA 3'CH2-2 SEQ ID N°2 : GGTACGTGCTGTTGAACTGTTCC 3' RC-IgG2
SEQ ID N°3 : GGAGCTGGGGTCTTCGCTGTGGTGCG 3' RC-IgG3 SEQIDN°4:TGGTTGTGGTTTTGGTGTCTTGGGTT
5'VHl-Sfi
SEQIDN°5 :
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGT CTGG
SEQ ID N°6:
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTCACCTTGAAGGAGT
CTGG 5'VH3-Sfi
SEQIDN°7 :
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGT
CTGG
SEQIDN°8:
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGCAGGAGT
CGGG
3'VHH-Not
SEQ ID N°9 : CACGATTCTGCGGCCGCTGAGGAGAC(AG)GTGACCTGGGTCC Cinq μg d'ARN total sont hybrides avec 1 pmole d'oligonucléotide 3'
CH2FORTA4 (Arbabi Ghahroudi et al, 1997)REF ou CH2-2 spécifique du domaine CH2 des IgG simple chaîne lourde de lama rétrotranscrits avec 150 U de superscript II (BRL) pendant 30 min à 5O0C. Les oligonucléotides spécifiques des régions charnières des IgG 2 et 3, 3' RC-IgG2 et 3' RC-IgG3, peuvent aussi être utilisées. Les ADNc simples brins sont purifiés sur billes (BioMagR Carboxyl Terminator, Polyscience Inc) et élues avec 17 μl de
10 mM Tris-acétate pH 7,8.
Conditions de PCRl :
Quatre μl d'ADNc sont amplifiés par PCR avec 0,5 U de Dynazyme Extend DNA polymerase (Finnzymes), 10 pmoles de la même amorce 3' CH2FORTA4 ou CH2-2 et 10 pmoles des 4 amorces 5 'VH 1-4 Sfi spécifiques du domaine VH des IgG humaines, dans un volume de 50 μl. (94°C, 3 min; 940C, 1 min; 600C, 1 min; 72°C, 1min ; 37 cycles puis
720C, 10 min). Trois fragments d'ADN sont amplifiés : un fragment d'environ 900 pb codant pour les domaines VH-CHl -CH2 des IgGl ; et 2 fragments d'environ 600 bp codant pour les domaines VHH-CH2 des IgG2 et 3. Conditions de PCR2 : Les fragments de 600 pb sont purifiés sur gel d'agarose 1% ( kit « Qiaquick gel extraction », Qiagen) puis amplifiés par PCR avec 1 U de Deep Vent (Biolabs) et 10 pmoles des 4 amorces 5 'VHl -4 Sfî spécifiques du domaine VH des IgG humaines et 10 pmoles de l'amorce 3' VHH-Notl. (94°C, 3 min; 94°C, 45 sec; 65°C, 45 sec; 72°C, 45 sec ; 15 cycles, puis, 94°C, 45 sec; 60°C, 45 sec; 72°C, 45 sec ; 15 autres cycles, puis 72°C, 10 min).
Les fragments d'environ 400 pb codant pour les VHH sont purifiés sur gel d'agarose 1% ( kit « Qiaquick gel extraction », Qiagen) rassemblés et précipités par l'éthanol. Ils sont ensuite coupés par les enzymes de restriction Ncol et Notl, ou BgII et Notl (Biolabs) pour être clones dans le phagemide pHenl (Hoogenboom et al., 1991) REF aux sites Ncol et Notl ou SfII et Notl. Préparation du vecteur :
Vingt μg de phagemide pHenl sont digérés dans un volume de 300 μl avec 50 U de Sfil en présence de BSA, à 50°C, 16 h ; ou avec 50 U de Ncol en présence de BSA, à 37°C, 16 h. Le phagemide linéarisé est purifié sur gel d'agarose 0,7% (kit « Qiaquick gel extraction », Qiagen). L'ADN élue est ensuite coupé par 50 U de Notl à 370C dans un volume de 200 μl, 16 h . L'enzyme est détruite par la chaleur 15 min à 65°C et l'ADN est extrait au phénol/chloroforme et précipité à l'éthanol. Le pHenl coupé est contrôlé sur gel d'agarose 0,7%, quantifié et ajusté à 200 ng/μl. Préparation des fragments d'ADN VHH : Cinq μg de fragments VHH sont coupés dans un volume de 300 μl avec 50 U de
BgII et Notl en présence de BSA, à 370C, 16 h ; ou avec 50 U de Ncol et Notl en présence de BSA, à 37°C, 16 h. Les enzymes sont dénaturées à 65°C, 15 min ; puis les ADN sont extraits au phénol/chloroforme et précipités à l'éthanol en présence de 10 μg de glycogène (Roche). Les fragments VHH coupés par Ncol et Notl sont purifiés sur gel d'agarose 1% puis contrôlés sur gel d'agarose 2%, quantifiés et ajustés à 100 ng/μl.
Ligature : Cent cinquante ng de pHenl digérés par Sfil et Notl sont ligaturés avec 60 ng de fragment VHH digéré par BgII et Notl dans un volume de 20 μl avec 2000 U de T4 DNA ligase (Biolabs) à 16°C, 17 h.
La ligase est inactivée à 65 °C, 15 min, et le produit de ligature est coupé par 20 U de Xhol (Biolabs) pour éliminer le vecteur résiduel non ligaturé, 37°C, 4 h. Six ligatures sont ainsi réalisées. Les produits de ligature sont ensuite rassemblés en 2 tubes et extraits au phénol/chloroforme, précipités en présence de 10 μg de glycogène et repris dans 2 x 18 μl H2O ultrapure. Deux μl sont utilisés par électroporation.
La banque de VHH du lama mâle (réf. : 080101) représente 5,4 106 clones et la banque de VHH du lama femelle (réf. : 010301) 106 clones.
Isolement des VHH à partir des banques par la technique de phage-display. Sélection des VHH anti-CEA et anti-CD16 :
Les différents VHH ont été isolés par la technique du phage-display. Production des banques dephages : Dix μl du stock d'une banque 080101 ou 010301 (cellules TGl transformées avec les phagemides) sont inoculés dans 50 ml de (2TY, 100 μg/ml d'ampicilline, 2% glucose) et incubés à 37°C jusqu'à une DO600 égale à 0,5. Cinq ml de la culture sont alors infectés avec 5 ml de M13KO7 à 1013pfu/ml, 30 min, 37°C, sans agitation. Après centrifugation, le culot de phages est repris dans 25 ml de (2TY, 100 μg/ml d'ampicilline, 25 μg/ml kanamycine). La culture est incubée 16 h à 30°C avec agitation. Les phages sont ensuite précipités avec 1/5 vol de 2,5 M NaCl / 20% PEG 6000 et concentrés 25 fois dans du PBS. Sélection des VHH :
Deux cents μl de billes recouvertes de streptavidine (Dynabeads M-280, Dynal) sont équilibrés avec 1 ml de lait 2%/PBS pendant 45 min à température ambiante avec agitation sur une roue. 1012 phages de la production précédemment décrite sont aussi équilibrés avec du lait 2%-PBS dans un volume final de 500 μl pendant 60 min à température ambiante avec agitation sur une roue.
Les billes sont compactées avec un aimant, re-suspendues avec 250 μl de lait 2%/PBS et incubées avec 200 μl d'antigène biotinylé pendant 30 min à température ambiante sur une roue. 150, 75 et 25 nM final d'antigène biotinylé sont utilisés au 1er, 2ème et 3ème tour, respectivement.
Aux 450 μl de billes/antigène-biotine on rajoute les 500 μl de phages pendant 3 h à température ambiante avec agitation sur une roue. Le mélange billes / antigène-biotine / phages est lavé 5 fois avec 800 μl de lait 4%-PBS puis transféré dans un nouveau tube eppendorf. Cinq autres lavages sont réalisés avec 800 μl de PBS-Tween 0,1% puis le mélange est transféré dans un nouveau tube eppendorf. Enfin, 5 lavages sont réalisés avec 800 μl de PBS. Les phages anticorps fixés sur les billes/antigène-biotine sont re-suspendus avec
200 μl de PBS et incubés 30 min à 37°C, sans agitation, avec 1 ml de TGl rendues compétentes pour la fixation des phages au pili (cellules compétentes : à partir d'une culture de TGl en 2YT sur la nuit, on réalise une dilution au 1/100 et on inocule 50 ml de 2YT à 37°C sous agitation jusqu'à une DO600 proche de 0,5). A chaque sélection, les phages sont comptés et amplifiés pour un nouveau tour de sélection.
Comptage des sélections :
On réalise des dilutions de 1 μl de cellules TGl transfectées avec les phages (voir ci-dessus) de 10"2 à 10'5 avec du 2YT. Un, 10 et 100 μl de chaque dilution sont étalés sur boîte de Pétri (2YT / ampiciline 100 μg/ml / glucose 2%). Les boîtes sont incubées 16 h à 3O0C.
Etalement de la sélection pour l'isolement des colonies :
On centrifuge les 5 ml de TGl transfectées pendant 10 min à 3000 g pour concentrer les cellules et on reprend le culot avec 1 ml de 2YT. Deux cent cinquante μl sont étalés par boîte de Pétri (12 cm x 12 cm) (2TY / ampicilline 100 μg/ml / glucose 2% et incubées 16 h à 30°C.
Les VHH suivants ont été isolés par cette méthode : quatre VHH anti-CEA (clones : 3, 17, 25, 43) et quatre VHH anti-CD16 (clones : cl3, c21, c28, c72) ont été obtenus dont les séquences en acides aminés et en nucléotides sont indiquées dans les Figures 1 et 2.
Reclonage, production et purification des VHH et des anticorps bispécifiques.
Clonage des VHH :
Les VHH ont été clones dans le plasmide ρ55PhoA6HisGS/NAB' (construction décrite dans le paragraphe 1.3.6, voir Figure 10A et 11) entre les sites de restriction Sfil et HindIII.
Conditions de PCR : Cinquante ng de VHH ont été amplifiés par PCR avec 1 U de Deep Vent (Biolabs), 10 pmoles des amorces 5' pJF-VH3-Sfi et 3' cmyc-6His/HindIII dans un volume final de 50 μl.
(94°C, 3min ; 940C, 45 sec; 520C, 45 sec; 720C5 45 sec ; 30 cycles puis, 72°C, 5 min). Les séquences SEQ ID N° 10 et SEQ ID N°l 1 des oligonucléotides utilisés sont les suivantes : 5' pJF-VH3-Sfi
SEQ ID N0IO: CTTTACTATTCTCACGGCCATGGCGGCCGAGGTGCAGCTGGTGG 3'cmyc-6His/HindIII SEQ ID N0I l:
CCGCGCGCGCCAAGACCCAAGCTTGGGCTA(GA)TG(GA)TG(GA)TG(GA)TG(GA) TG (GA)TGTGCGGCCCCATTCAGATC
Les produits de PCR sont purifiés sur gel d'agarose 1% ( kit « Qiaquick gel extraction », Qiagen) et coupés avec 20 U de BgII et 20 U de HindIII (Biolabs) 16 h à 37°C. Dix μg de p55PhoA/NAB' sont coupés d'abord avec 50 U de Sfil 16 h à 500C, puis avec 20 U de HindIII 12 h à 37°C. Les produits de digestion (vecteur et fragments de PCR) sont précipités à Péthanol. Les ADN sont re-suspendus dans 20 μl d'H2O et quantifiés sur un gel d'agarose 0,7%.
La ligature est effectuée avec 200 U de T4 DNA ligase (50 ng de p55PhoA/NAB" coupés par Sfil et HindIII et 10 ng de fragment PCR coupés par BgII et HindIII dans un volume de 20 μl, 16h à 16°C. Après inactivation de la T4 DNA ligase 15 min à 65°C, le vecteur non recombinant est éliminé par digestion enzymatique avec 10 U de Xhol, 2 h à
370C.
Après transformation de la ligature et analyse de quelques colonies recombinantes, les VHH d'intérêt sont produits chez E. coll.
Production des VHH :
Une colonie isolée est inoculée dans 3 ml de 2YT / ampicilline 100 μg/ml / 2% glucose et incubée à 37°C avec agitation. Cinquante ml de 2YT / ampicilline 100 μg/ml / 2% glucose sont ensuite ensemencés avec une dilution de la culture précédente et incubés 16 h à 300C avec agitation. Quatre cents ml de 2YT/ ampicilline 100 μg/ml sont inoculés avec l'équivalent de 0,1 unité DO6O0, et incubés à 300C avec agitation, jusqu'à une DO600 de 0,5 à 0,7. La culture est ensuite induite avec 400 μl d'IPTG (isopropyl-β-D- thiogalactopyranoside) 0,1 mM final et cultivée à 3O0C pendant 16 h. Production des anticorps bispécifiques :
Une colonie isolée, issue d'une transformation des plasmides réalisée dans la souche d'E. coli DH5α, est inoculée dans 3 ml de 2YT / ampicilline 100 μg/ml / 2% glucose et incubée à 30°C avec agitation. Cinquante ml de LB / ampicilline 100 μg/ml / 2% glucose sont ensuite ensemencés avec une dilution de la culture précédente et incubés 16 h à 30°C avec agitation. Quatre cents ml de LB / ampicilline 100 μg/ml sont inoculés avec l'équivalent de 0,1 unité DO600, et incubés à 30°C avec agitation pendant 2h30, puis la culture est incubée à 20°C avec agitation, jusqu'à une DO60O de 0,5 à 0,7. La culture est ensuite induite avec 400 μl d'IPTG (isopropyl-β-D-thiogalactopyranoside) 0,1 mM final cultivée à 20°C pendant 72 h.
Extraction de la fraction soluble du périplasme :
Les cultures à partir desquelles sont produits les VHH ou les anticorps bispécifiques sont centrifugées à 4200 g, 4°C, 40 min. Le culot est repris dans 4 ml de TES glacé (0,2 M Tris-HCl pH 8,0; 0,5 mM EDTA; 0,5 M sucrose). On ajoute ensuite 160 μl de lysozyme (10 mg/ml dans du TES, fraîchement préparé) puis 24 ml de TES froid dilué au
1/2 dans H2O. Le mélange est incubé 30 min dans la glace.
1 Après centrifugation à 4200 g, 4°C, 40 min, on récupère le surnageant (correspondant à la fraction périplasmique) et on ajoute 150 μl de DNAse (10 mg/ml) et 5 mM final de MgC12, 30 min à température ambiante. La solution est dialysée 16 h contre le tampon d'équilibre (acétate de sodium 50 mM, NaCl 0, IM pH 7,0).Purification des VHH :
La colonne (BD TALON™ Métal affinity, BD Biosciences Clontech) est équilibrée avec le tampon d'équilibre (acétate de sodium 5OmM, NaCl 0,1M, pH 7,0). La fraction périplasmique est déposée sur la colonne. Après lavage de la colonne avec 5 volumes de tampon d'équilibre, le VHH est élue par gradient de pH ou d'imidazole (gradient entre le tampon d'équilibre pH 7,0 et la solution acétate de sodium 5OmM pH 5,0 ou la solution d'imidazole 200 mM). Chaque fraction est contrôlée sur un gel SDS/PAGE (acrylamide
15%) après coloration au bleu de coomassie. Les fractions d'intérêt sont rassemblées et dialysées contre du PBS. Le VHH est concentré sur membrane (Amicon Ultra
5000MWCO, Millipore) et dosé par la méthode colorimétrique de Lowry à l'aide du kit Biorad Protein Assay.
Purification des anticorps bispécifiques : Les anticorps bispécifiques sont purifiés à partir de la fraction soluble du périplasme (Cf extraction de la fraction soluble du périplasme) en deux temps ; d'abord sur une colonne BD TALON (Cf purification des VHH) puis sur une protéine G (HiTrap protein G 5 ml, Amersham biosciences). La colonne « Hi Trap protein G » est équilibrée en PBS (NaCl 137 mM, KCl 2,67 mM, Na2HPO4 1,2 mM, KH2PO4 1,76 mM pH 7,4). Les protéines éluées sur la colonne BD TALON et dialysées en PBS sont déposées sur la protéine G. Après lavage de la colonne avec 5 volumes de PBS, l'anticorps bispécifique est élue avec de la glycine 0,1 M pH 2,7 puis tamponné avec de l'hépès 1 M pH 8. Après contrôle sur gel SDS / PAGE (acrylamide 10%), l'anticorps bispécifique est dialyse en PBS O3Ix, congelé à -800C et lyophilysé pour être concentré dix fois. Enfin le F(ab')2 est séparé du Fab' sur une colonne Tricorn Superdex 200 10/300 GL (Amersham Biosciences) équilibrée en PBS.
Caractérisatiom fonctionnelle des VHH et des anticorps bispécifiques par ELISA, Biacore, immunofluorescence (cytométrie de flux, FACS) et par tests d'activation du CD16.
Caractérisation des anticorps anti-CEA et anti-CD16 par ELISA :
ELISA des phages-VHH :
Cinq μg/ml d'antigène biotinylé (CEA ou CD 16) sont fixés sur une plaque streptavidine (BioBind Assembly Streptavidin Coated, ThermoLabsystems) préalablement saturée en lait 2%-PBS. Cinq 1010 phages-anticorps sont mis en contact avec l'antigène. La liaison antigène/anticorps est détectée grâce à un ELISA composé d'un anticorps monoclonal dirigé contre la protéine P8 du phage (HRP/anti-M13 monoclonal conjugate,
Pharmacia). L'ajout du substrat, 10 mg ABTS (2,2'-azino bis (3-ethylbenzo-thiazoline-6- sulphonic acid, diammonium sait) à 20 ml tampon de révélation ( 18 ml PBS, ImI acide citrique 1 M, 1 ml citrate de sodium 1 M, 10 ml H2O2 30%), permet de lire la réaction à
405 nm (Tecan).
ELISA des VHH:
Cinq μg/ml d'antigène biotinylé sont fixés sur une plaque streptavidine (BioBind Assembly Streptavidin Coated, ThermoLabsystems) préalablement saturée en lait 2%-PBS.
Chaque VHH (gamme de 0,001 μg/ml à 1 μg/ml) est lié à l'antigène adsorbé dans les micropuits. La liaison est révélée avec un anticorps monoclonal dirigé contre l'étiquette c- myc (Santa Cruz Biotechnology, Inc) dilué au 1/1000 et un anticorps polyclonal de chèvre dirigé contre les IgG de souris couplé à la peroxidase dilué au 1/5000 (ref 55556, ICN) en présence d'ABTS.(232'-Azino-di-(3-ethylbenzthiazoline sulfonate)diammonium sait, Roche).
ELISA des anticorps bispécifiques : Dix μg /ml d'antigène (rhCDlό ou rhCEA) sont coatés passivement sur une plaque
MaxiSorp ( Nunc). Après saturation de la plaque en PBS / lait 4%, l'anticorps bispécifique (F(ab')2, Fab', Fab) (gamme de 800 à 0,4 nM) est lié à l'antigène adsorbé dans les micropuits. La liaison est révélée soit :
- avec un anticorps monoclonal dirigé contre l'étiquette Flag (anti-Flag M2 mAB, Sigma) dilué au 1/5000 et un anticorps polyclonal de chèvre dirigé contre les IgG de souris couplé à la phosphatase alcaline dilué au 1/5000 (ref 115-055-003, Jackson
Imrnunoresearch) en présence de DNPP (disodium 4-nitrophenyl phosphate hexahydrate). avec un anticorps monoclonal dirigé contre l'étiquette c-myc (Santa Cruz Biotechnology) dilué au 1/500 et un anticorps polyclonal de chèvre dirigé contre les
IgG de souris couplé à la phosphatase alcaline dilué au 1/5000 (ref 115-055-003, Jackson Immunoresearch) en présence de DNPP avec un anticorps polyclonal de chèvre dirigé contre la chaîne légère kappa humaine couplé à la phosphatase alcaline dilué au 1/500 (ref 2060-04, SouthernBiotech) en présence de DNPP.
Mise en évidence de l'accessibilité du VHH CEA 17 quand le VHH CD16 c21 est lié au rhCD16 adsorbé dans les micropuits avec du rhCEA biotinylé et de la streptavidine couplée à la phosphatase alcaline diluée au 1/500 (DAKO, cat DO396).
Constantes d'affinité des anticorps anti-CEA et anti-CD16 par Biacore : Le BIACORE utilise le principe de la résonance plasmonique de surface (SPR) pour suivre en temps réel les interactions entre molécules sans marquage de celles-ci. L'un des partenaires de l'interaction est immobilisé de façon covalente sur un biocapteur alors que l 'autre est injecté dans un flux continu. Le principe de détection par SPR permet de suivre les changements de masse à la surface du biocapteur dus à la formation puis à la dissociation des complexes moléculaires. La réponse, quantifiée en unité de résonance (RU) est une indication directe du taux de fixation de l'analyte par la mesure de la variation de l 'indice de réfraction. L'enregistrement du signal (un sensorgramme) est traité de façon mathématique pour obtenir les constantes de vitesse d'association, ka, de dissociation kd et les constantes d'association KA (KA = ka/kd) et de dissociation à l'équilibre KD (KD = kd/ka).
Les interactions entre le CEA ou le CD 16 et les VHH (qui possèdent une étiquette c-myc reconnue par l'anticorps monoclonal 9ElO5 Santa Cruz Biotechnology, Inc) ont été étudiées sur un BIACORE 3000 muni d 'un biocapteur de type CM5 sur lequel l'anticorps monoclonal 9E10 a été immobilisé de façon covalente suivant la procédure standard de couplage par les aminés proposée par BIACORE (activation par NHS/EDC). Le VHH (en tampon : 10 mM HEPES; 150 mM NaCl; 3 mM EDTA; 0,005% surfactant P20) est alors injecté puis une gamme de CEA ou de CD 16 est injectée sur le VHH immobilisé sur le 9E10. En parallèle, les injections sont réalisées sur un canal contrôle qui a subi la même chimie de couplage mais sans injection de protéine. Les affinités des VHH sont indiquées dans le Tableau 1 ci-dessous. Des affinités équivalentes sont obtenues à partir des différents formats d'anticorps bispécifiques.
Tableau 1
Figure imgf000021_0001
Analyse par FACS de la spécificité des VHH anti-CEA et anti-CD16 et des anticorps bispécifiques correspondant :
Spécificité pour le CEA :
(Pour que l 'immunociblage soit efficace, il est primordial que les anticorps anti- CEA ne reconnaissent pas le NCA, molécule très homologue au CEA qui est exprimée à la surface des granulocytes.)
La mise en évidence de la liaison antigène-anticorps est effectuée sur la lignée non transfectée MC38 (lignée cellulaire d'un cancer du colon murin), les lignées transfectées avec le CEA (MC38/CEA+) ou le NCA (MC38/NCA+), la lignée tumorale humaine 2i PCT/FR2005/003151
LS174T (lignée cellulaire d'adénocarcinome colique humain exprimant le CEA à sa surface) et les granulocytes qui expriment à leur surface le NCA.
Les granulocytes sont extraits à partir de sang frais en présence d'héparine, sur gradient de ficoll à deux densités (histopaque 1119 et 1077). Les granulocytes se trouvent à l'interface des 2 histopaques.
Anticorps utilisés pour la fixation aux cellules :
- 35A7, anticorps monoclonal anti-CEA(spécifique du CEA).
- 192, anticorps monoclonal anti-CEA (qui croise avec le NCA).
- 7.5.4 et 3G8 anticorps monoclonal anti-CD16. - VHH anti-CD16 (cl3, c21, c28, c72).
- VHH anti-CEA (3, 17, 25, 43).
- Anticorps bispécifiques anti-CEA/anti-CD16 construits à partir des 8 VHH isolés. Anticorps utilisés pour la révélation :
- 9E10, anticorps monoclonal de souris anti-cmyc (200 μg/ml, utilisé au l/10eme) se fixant à l'étiquette c-myc des VHH purifiés.
- AP326F, anticorps polyclonal de mouton anti-IgG de souris couplé au FITC (Silenus, utilisé au l/100ème).
0,5 x 106 cellules sont utilisées par essai. Les VHH et anticorps monoclonaux sont dilués dans 100 μl de PBS- 1% BSA. 0,5 x 106 cellules (mesure autofluorescence des cellules)
0,5 x 106 cellules + anti IgG de souris-FITC 20 μg/ml
0,5 x 106 cellules + anti-9E10 20 μg/ml, puis anti IgG de souris-FITC 20 μg/ml
0,5 x 106 cellules + VHH anti-CEA ou anti-CD16 1 à 5 μg/ml, puis 9E10 20 μg/ml, puis anti IgG de souris-FITC 20 μg/ml 0,5 x 106 cellules + anticorps monoclonaux (35A7, 192, 7.5.4) 20 μg/ml, puis anti
IgG de souris-FITC 20 μg/ml
A chaque étape les échantillons sont incubés 45 min, 40C, dans l'obscurité.
Entre chaque réaction, on effectue un lavage avec 2 ml de PBS / 1% BSA. A la dernière étape les cellules sont reprises avec 0,5 ml de PBS. Les résultats par FACS démontrent la spécificité des 4 VHH anti-CEA analysés et des anticorps bispécifiques anti-CEA / anti-CD16 sous forme de Fab, Fab' et F(ab')2. Ils sont spécifiques du CEA et ne croisent pas avec le NCA. Un exemple est illustré dans la figure 3. Dans cet exemple, les anticorps monoclonaux de référence mAb 35A7 et 192 ne se lient pas sur les cellules MC38 qui n'expriment pas le CEA mais sur les cellules MC38 CEA+, et LS174T CEA+ qui expriment le CEA sur leur surface. Le mAb 192 lie aussi les cellules MC38 NCA+ et granulocytes qui expriment le NCA sur leur surface. Le VHH CEA 17 ne lient que les cellules qui expriment le CEA sur leur surface. Des résultats équivalents sont obtenus avec les autres anticorps VHH anti-CEA (clones 3, 25 et 43). L'anticorps bispécifique VHH CEA 17 / VHH CD 16 c21 est spécifique des cellules tumorales à la fois sous forme de Fab' et de F(ab')2. Des résultats équivalents sont obtenus avec les autres anticorps bispécifiques anti-CEA/anti-CD16 sous forme de Fab, Fab' et F(ab')2 (dérivant des 8 VHH anti-CEA et anti-CD16). Spécificité pour le CD 16 :
Pour une reconnaissance efficace des cellules effectrices du système immunitaire, les anticorps anti-CD16 sélectionnés à partir du CD16B doivent aussi reconnaître le CDl 6A. De plus ils ne doivent pas présenter de réaction croisée avec le CD32 (RFcγlIA et RFcγlIB). Les expériences sont réalisées avec des cellules Jurkat (cellules d'une lignée de lymphome T humain; ATCC TIB- 152) transfectées ou non avec le gène qui code le CD16A (lignée stable exprimant le CDl 6 A à leur surface ; Vivier et al., 1992), des granulocytes qui expriment le CD16B, des cellules K562 qui n'expriment que le CD32A et des cellules HA 6huIIBl qui n'expriment que le CD32B. Anticorps utilisés pour la fixation aux cellules :
- 3G8, anticorps monoclonal anti-CD16 (RFcγlIIA/IÏÏB humain), anticorps anti-site reconnaissant un épitope conformationnel et bloquant la liaison des IgG aux CDl 6 A et CDl 6B.
- 7.5.4, anticorps monoclonal anti-CD16 (RFcγlIIA/IIIB humain), anticorps reconnaissant un épitope linéaire, localisé hors site de liaison des IgG du CD 16 et n'affectant que faiblement cette liaison à fortes concentrations dans des tests de compétition (Vély et al.,
1997).
-ATlO anticorps monoclonal anti-CD32 (RFcγlIA/IIB) humain.
- IV.3, anticorps monoclonal anti-CD32 (RFcγlIA) humain. - VHH anti-CD16 (cl3, c215 c28, c72).
- VHH anti-CEA (3, 17, 25, 43).
- 35A7, anticorps monoclonal anti-CEA
- 192, anticorps monoclonal anti-NCA (qui croise avec le CEA) - Anticorps bispécifiques anti-CEA/anti-CD16 construits à partir des 8 VHH isolés. Anticorps utilisés pour la révélation :
- 9E10, anticorps monoclonal de souris anti-cmyc (200 μg/ml, utilisé au l/10ème) se fixant à l'étiquette c-myc des VHH purifiés. - Fab'2 d'un anticorps de chèvre anti-IgG de souris couplé au FITC (F(ab')2/FITC) utilisé à 20 μg/ml (Jackson Immunoresearch Lab. Inc., 115-096-003).
0,5 x 106 cellules sont utilisées par essai. Les VHH et anticorps monoclonaux sont dilués dans 100 μl de PBS- 1% BSA. 0,5 x 106 cellules (mesure autofluorescence des cellules) 0,5 x 106 cellules + (F(ab')2/FITC) 20 μg/ml
0,5 x 106 cellules + anti-9E1020 μg/ml, puis (F(ab')2/FITC) 20 μg/ml
0,5 x 106 cellules + VHH 1 à 5 μg/ml, puis 9E10 20 μg/ml, puis (F(ab')2/FITC) 20 μg/ml
0,5 x 106 cellules + anticorps monoclonaux ( 35A7, 192, 3G8,7.5.4, ATlO, IV.3) 20 μg/ml, puis (F(ab')2/FITC) 20 μg/ml. A chaque étape les échantillons sont incubés 45 min, 4°C, dans l'obscurité.
Entre chaque réaction, on fait un lavage avec 2 ml de PBS / 1% BSA. A la dernière étape les cellules sont reprises avec 0,5 ml de PBS
Les résultats par FACS démontrent la spécificité des 4 VHH anti-CD16 analysés et des anticorps bispécifiques anti-CEA / anti-CD16 sous forme de Fab, Fab' et F(ab')2. Ils sont spécifiques du CD 16 et ne croisent pas avec le CD32. Un exemple est illustré dans la figure 4. Dans cet exemple, l'anticorps monoclonal de référence mAb 3G8 se lient pas sur les cellules Jurkat, K562 CD32A+ et IIA.1.6huIIBl CD32B+ qui n'expriment pas le CD16 mais sur les cellules Jurkat CD 16A+, et les granulocytes qui expriment le CD 16 sur leur surface. Le VHH CD 16 c21 ne lient que les cellules qui expriment le CD 16 sur leur surface. Des résultats équivalents sont obtenus avec les autres anticorps VHH anti-CD16 (clones : cl3, c28 et c72). L'anticorps bispécifique VHH CEA 17 / VHH CD16 c21 est spécifique des cellules Jurkat CD 16A+ et NKL à la fois sous forme de Fab' et de F(ab')2. Des résultats équivalents sont obtenus avec les autres anticorps bispécifiques anti- CEA/anti-CD16 sous forme de Fab, Fab' et F(ab')2 (dérivant des 8 VHH anti-CEA et anti- CD16). Analyse par FACS de l'accessibilité des anticorps bispécifiques sur cellules : L'accessibilité du domaine VHH anti-CD16 :
Cinq 105 cellules LS174T sont incubées pendant 30 min, dans du PBS-BSA 1 % dans la glace, en présence de Fab, Fab' ou F(ab')2, (gamme de 10 μg/ml à 0,1 μg/ml). Les cellules sont lavées en PBS-BSA 1 %. La fixation du rhCDlβ (lOμg/ml) sur le domaine
VHH anti-CD16 des différents fragments d'anticotps est ensuite détectée, en deux temps, en incubant l'anticorps monoclonal 7.5.4 ou 3G8 (3 μg/ml) avec les cellules pendant 30 min, dans la glace puis en incubant les cellules avec du F(ab')2 de chèvre anti-IgG de souris (H+L) marqué au FITC (Jackson Immunoresearch Laboratory, cat : 115-096-003), pendant
30 min dans la glace. Après plusieurs lavages, l'immunofmorescence est analysée par cytométrie de flux avec un FACScalibur 4C4 (Becton dickinson) en utilisant le programme
CeIl Quest Pro.
L 'accessibilité du domaine VHH anti-CEA : Cinq 105 cellules Jurkat CD16A+ sont incubées pendant 30 min, dans du PBS-BSA
1 % dans la glace, en présence de Fab, Fab' ou F(ab')2, (gamme de 10 μg/ml à 0,1 μg/ml). Les cellules sont lavées en PBS-BSA 1 %. La fixation du rhCEA( 10 μg/ml) sur le domaine VHH anti-CEA des Fab, Fab' ou F(ab')2, est ensuite détectée, en deux temps, en incubant l'anticorps monoclonal 192 (3 μg/ml) avec les cellules pendant 30 min, dans la glace puis en incubant les cellules avec du F(ab')2 de chèvre anti-IgG de souris (H+L) marqué au FITC (Jackson Immunoresearch Laboratory, cat : 115-096-003), pendant 30 min dans la glace. Après plusieurs lavages, rimmunofluorescence est analysée par cytométrie de flux avec un FACScalibur 4C4 (Becton dickinson) en utilisant le programme CeIl Quest Pro.
Un exemple est illustré dans la figure 5. L'anticorps bispécifique VHH CEA 17 / VHH CD 16 c21 se lie à la fois aux cellules LS174T et Jurkat CD 16A+. Des résultats équivalents sont obtenus avec les autres anticorps bispécifiques anti-CEA/anti-CD16 sous forme de Fab, Fab' et F(ab')2 (dérivant des 8 VHH anti-CEA et anti-CD16).
Essai de compétition entre les VHH anti-CD16 et les anticorps monoclonaux 3G8 et 7.5.4 : ELISA :
Cinq μg/ml de VHH biotinylé (c21, c28) sont fixés par puits d'une plaque adsorbée avec de la streptavidine (BioBind Assembly Streptavidin Coated, ThermoLabsystems) préalablement saturée en lait 2%-PBS. Le CD16B à une gamme de concentration de 0,07 à 20 μg/ml est ensuite ajouté. Dans un deuxième temps, l'anticorps monoclonal (3G8 ou 7.5.4) à la concentration constante de 5 μg/ml est ajouté. La liaison CDlόB-anticorps monoclonal est révélée avec un F(ab')2 de chèvre anti-IgG de souris couplé à la phosphatase alcaline (Southern Biotechnology, 1030-04) en présence de p- nitrophenylphosphatase (Sigma, N9389).
Les courbes de compétitions en ELISA sont montrées dans la Figure 6. Le VHH CD 16 c21 est déplacé par l'anticorps monoclonal 7.5.4. Le VHH CD16 c28 est déplacé par l'anticorps monoclonal 3G8.
Immunofluorescence indirecte (FACS) : Cinq 105 cellules Jurkat-CD16A sont incubées pendant 30 min, dans du PBS-BSA
5% dans la glace, en présence des VHH CD 16 c21 ou c28 (de 1 à 100 μg/ml). Les cellules sont ensuite incubées avec 0,1 μg/ml de 3G8 ou 1 μg/ml de 7.5.4 pendant 30 min dans les mêmes conditions, puis lavées en PBS-BSA 5%. La fixation de 3G8 ou 7.5.4 est alors détectée en incubant les cellules avec du F(ab')2 d'un anticorps de chèvre anti-IgG de souris (H+L) marqué au FITC (Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA, cat n°: 115-096-003) pendant 30 min dans la glace. Après plusieurs lavages, l' immunofluorescence est analysée par cytométrie de flux avec un FACScalibur 4CA (Becton Dickinson, Mountain View, California, USA) en utilisant le programme CeIl Quest Pro. Les profils de compétitions sur cellules sont montrés dans la Figure 7. Le VHH
CD16 c21 est déplacé par l'anticorps monoclonal 7.5.4. Le VHH CD16 c28 est déplacé par l'anticorps monoclonal 3G8. A forte dose le VHH CD16 c28 est aussi déplacé par le mAb 7.5.4.
Activation par les VHH anti-CD16 et par les anticorps bispécifiques des cellules Jurkat CD16+:
Les expériences sont réalisées avec des cellules Jurkat (ATCC TIB- 152) transfectées avec le gène qui code le CD 16 A. Les cellules sont cultivées en RPMI 1640 complémenté avec 10% de FCS, 100 U/ml pénicilline, 100 μg/ml streptomycine, 2 mM L- glutamine, 0,5 mg/ml G418. Cinq x 105 cellules sont ensuite incubées 18 h dans des puits de microplaques (250 μl de RPMI contenant 10% FCS, 1% PS5 0,5 mg/ml G418).
Dix ng/ml de phorbol myristate acétate (PMA) (concentration n'induisant pas per se la production et la sécrétion d'IL2, mais nécessaire comme " second signal " à cette production) sont ensuite ajoutés, suivis par l'addition de 0,01 à 0,1 μg/ml de VHH biotinylé et de 10 μg/ml de streptavidine (permettant le pontage des VHH) ou d'anticorps bispécifiques non biotinylés.
L'IL2 humaine produite dans les surnageants cellulaires est mesurée par ELISA en utilisant les anticorps du kit R&D (Duoset Human IL2 ; référence : DY202) et de la streptavidine couplée à la phosphatase alcaline (DAKO, DO396) en présence de p- nitrophenylphosphate (Sigma, cat 104-405).
Les résultats d'activation du CD16A (production et sécrétion d'interleukine 2) sont montrés dans la Figure 8. Les deux VHH anti-CD16 c21 et c28 activent la production d'IL2 de cellules Jurkat CD 16A+. Des quantités supérieures de c28 sont nécessaires pour obtenir une induction de la production et de la sécrétion d'IL2 comparable à celle induite par le c21. L'anticorps bispécifique anti-CEA 17 / anti-CD16 c21 sous forme de F(ab')2 active aussi la production d'IL2 si les cellules Jurkat expriment le CDl 6 A à leur surface et ceci en absence de pontage via la streptavidine. Des résultats équivalents sont obtenus à partir des autres VHH anti-CD16 et des anticorps bispécifiques anti-CEA/anti-CD16
Lyse des cellules tumorales par les cellules NKL en présence d'anticorps bispécifique :
Pour le test de cytotoxicité des cellules NK, les lignées utilisées sont des cellules NKL (Robertson et al., 1996(12)) provenant d'une leucémie à large lymphocytes granuleux, possédant des propriétés fonctionnelles semblables à celle des NK et dont l'expression du CD 16 a été vérifiée préalablement par cytométrie de flux. Les cellules cibles utilisées sont des cellules HeLa provenant d'une leucémie humaine, très sensibles aux NK, des cellules de colon murin C 15.4.3 AP (MC38), sensibles au NK et des cellules MC38 transfectées avec du CEA humain et naturellement résistantes aux NK. Les cellules cibles en culture sont remises en suspension (par réaction trypsique pour les cellules HeLa, mécaniquement pour les cellules MC38 et NKL) et comptées à l'aide de bleu de Trypan dans une cellule de Malassay. Deux mille cellules par puit sont incubées dans lOOμL avec 3.7.106 Bq de 51Cr et les différents formats de l'anticorps (à 200, 100 ou 50 μg/mL) Ih à 37°C. Les cellules sont ensuite lavées plusieurs fois pour éliminer le 51Cr restant dans le milieu ainsi que les anticorps non fixés. Les cellules NKL en suspension sont comptées et ajoutées aux cellules cibles avec des rapports effecteur/cible de 60:1 à 0,2:1. Après une incubation de 4h à 37°C, la radioactivité du Cr libéré dans le milieu est comptée à l'aide d'un compteur γ. Des exemples montrant la lyse cellulaire obtenue avec les anticorps bispécifiques anti-CEA 17 / anti-CD16 c21 et anti-CEA 17 / anti-CD16 c28 sous forme de Fab' et F(ab')2 sont représentés en figure 9.
Construction des différents plasmides (voir Figures 1OA, 1OB, 11, 12A et 12B).
- Tous les protocoles non détaillés sont décrits dans Sambrook, Fritsch et Maniatis, Molecular cloning a laboratory manual, 2nd ed, CoId Spring Harbor Laboratory Press,
1989.
- Les digestions avec les enzymes de restriction sont réalisées selon les recommandations des fournisseurs.
- Gènes d'origine humaine insérés : Les gènes codant pour les régions CK, CHl , H, CH2 et CH3 correspondent respectivement : aux domaines de gènes codant pour la région constante d'une chaîne légère kappa d'immunoglobuline humaine, pour la première région constante, pour la région charnière, pour la deuxième région constante et pour la troisième région constante d'une chaîne lourde d'immunoglobuline IgGl humaine. Ces gènes ont été obtenus par RT-PCR à partir d'une poche du LFB (Laboratoire français du Fractionnement et des Biotechnologies). Ce matériel souscrit aux autorisations légales pour être utilisé pour les expériences décrites.
- La séquence de chaque plasmide est réalisée sur séquenceur ABI 310 en utilisant les oligonucléotides :
EcoRI-90 de séquence SEQ ID N° 12 : GCGCCGACATCATAACGGTTCTGGC HindIII+88 de séquence SEQ ID N° 13 :CGCTACTGCCGCCAGGC
- Tous les vecteurs sont conçus pour permettre l'introduction entre 2 sites uniques d'enzymes de restriction de : différents promoteurs, différentes séquences signal de type PeIB (ou autres), différentes séquences RBS, n'importe quel domaine VHH ou VHH humanisé, n'importe quel domaine Cλ ou domaines CHl, H, CH2 et CH3 de n'importe quel type d'immunoglobulines. pMCSPhoA'
(Figure 10A)
La construction de ce plasmide est décrite dans Le Calvez et al. (1995).REF
Ce plasmide code pour la forme mature de la Phosphatase Alcaline (PhoA) démarrant au sixième résidu (Proline). p35PhoA'
(Figure 10A)
La construction de ce plasmide est décrite dans Le Calvez (1996). Un fragment de gène (formé par des oligonucléotides dégénérés sur la troisième base des codons 2 à 14 codant pour la séquence signal de PeIB) est inséré entre les sites Ndel et
EagI du plasmide pMCSPhoA'. Les clones (1 à 60) présentant la meilleure activité phosphatase alcaline ont ensuite été ensuite sélectionnés. p35PhoA'/N'
(Figures 1OA et 11)
Suppression du site Ncol dans le gène phoA.
Une PCR de chevauchement est réalisée à partir de pMCSPhoA' avec les oligonucléotides : amont-Rsrïï, Ncol-sup, Ncol-inf et aval-EcoNI. Séquences SEQ ID N° 14 à 17 des oligonucléotides utilisés : amont-RsrlI
SEQ ID N° 14 : GGCACATGTGACCTCGCGC
Ncol-sup
SEQ ID N° 15 : GCAACGTACCACGGCAATATCG Ncol-inf
SEQ ID N° 16: CGATATTGCCGTGGTACGTTGC aval-EcoNI
SEQ ID N° 17 : GCCATCTTTGGTATTTAGCGCC
Conditions des PCR 1 et PCR 2 : Un μl de plasmide (5 ng), 10 pmoles de chaque oligonucléotides (amont-Rsrïï et
Ncol-inf pour la PCR 1 et Ncol-sup et aval-EcoNI pour la PCR 2), 0,5 U Dynazyme (94°C,
3 min; 94°C, 45 s; 60°C, 45 s; 72°C, 45 s; pendant 25 cycles puis 72°C, 10 min) dans un volume final de 50 μl. Les produits de PCR sont purifiés à partir d'un gel d'agarose 2%
(gel extraction Kit Quiagen, volume final 50 μl). Conditions de la PCR 3 de chevauchement :
Un μl de chacune des PCR 1 et 2 et 0,5 U Deep Vent, dans un volume final de 50 μl. Après 5cycles (94°C, 3 min; 94°C, 1 min; 60°C, 1 min; 72°C, 1,5 min) on ajoute 10 pmoles de chaque oligonucléotides (amont-Rsrïï et aval-EcoNI) et la PCR est poursuivie pendant 35 cycles puis 72°C, 10 min. Le produit de la PCR 3 est purifié, à partir d'un gel d'agarose 2% (gel extraction Kit Quiagen, volume final 50 μl).
La séquence du fragment de PCR est réalisée sur séquenceur ABI 310 en utilisant Poligo
5' EcoRI-90.
Clonage du fragment de PCR 3 dans le plasmide p35 PhoA ': Trente cinq μl du fragment de PCR 3 et 5 μl (2,5 μg) de p35PhoA' sont digérés par 10 U de Rsrll et EcoNI. Après 16 h d'incubation les enzymes sont détruites 10 min à 65 °C.
Chaque ADN est ensuite précipité et resuspendu avec 20 μl d'E^O.
La ligation est réalisée 16 h à 16°C avec 5 μl de fragment de PCR, 0,5 μl de vecteur et 3 U Weiss de T4 DNA ligase Biolabs dans un volume final de 10 μl. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de ligation. p55PhoA6HisGS/N"
(Figures 10A et 11)
Insertion du motif 6Histidine-Gly-Ser. Une PCR est réalisée à partir de p35PhoA'/N" en utilisant les oligonucléotides Xhol-Sacl et
6HisGS/HindIII.
Séquences SEQ ID N° 18 et 19 des oligonucléotides utilisés :
Xhol-Sacl
SEQ ID N° 18 : CCATGGCGGCCGATCCTCGAGAG 6HisGS/HindIII
SEQ ID N0 19 :
CATGCAGTCCCAAGCTTATTAGCTCCCGTGATGGTGATGATGATGTTTCAGCCC
CAGAGCGGCTTTC
Conditions de PCR : Une PCR est réalisée avec 5 ng de vecteur p35PhoA'/N", 10 pmoles de chaque oligonucléotides et 0,5 U Dynazyme (94°C, 3 min ; 94°C, 1 min ; 70°C, 1 min ; 72°C, 1 min ; 35 cycles puis 72°C, 10 min) dans un volume final de 50 μl. Le produit de PCR est purifié à partir d'un gel d'agarose 1% (gel extraction Kit Quiagen, volume final 50 μl).
Clonage du fragment XhoI-HindIII : Vingt μl du fragment de PCR et 5 μl (2,5 μg) de vecteur p55PhoA' (Le Calvez et al. Gène
1996, 170, 51-55) sont digérés par 10 U de Xhol et HindIII en présence de BSA. Après 16 h d'incubation, les enzymes sont détruites 10 min à 65°C. Chaque ADN est ensuite précipité et resuspendu avec 20 μl d'H2O. La ligation est réalisée 16 h à 16°C avec 5 μl de fragment de PCR, 0,5 μl de vecteur et 3 U Weiss de T4 DNA ligase Biolabs dans un volume final de 10 μl. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de ligation. p55PhoA6HisGS/NAB"
(Figures 10A et 11) Suppression des sites Apal et BstEII de p55PhoA6HisGS/N'.
Une PCR de chevauchement est réalisée à partir de p55PhoA6HisGS/N" avec les oligonucléotides : amont-EcoRV, Apal-BstEII-sup, BstEII- Apal-inf et Aval-Mlul. Séquences SEQ ID N° 20 à 23 des oligonucléotides utilisés : amont-EcoRV
SEQ ID N° 20 : CATGAGCTGTCTTCGGTATC Apal-BstEII-sup
SEQ ID N° 21 : TAATGGTCCCGCTAACAGCGCGATTTGCTGATGACCCA BstEII-Apal-inf SEQ ID N° 22 : TGGGTC ATCAGC AAATCGCGCTGTTAGCGGGACC ATTA aval-MluI SEQ ID N° 23 : GAACGAAGCGGCGTCGAAG
Conditions des PCR 1 et PCR 2 :
Un μl (5 ng) de plasmide p55PhoA6HisGS/N', 10 pmoles de chaque oligonucléotides (amont-EcoRV et BstEII- Apal-inf pour PCR 1 et Apal-BstEII-sup et aval-
MIuI pour PCR 2), 0,5 U Dynazyme (940C, 3 min ; 94°C, 45 s ; 60°C, 45 s ; 720C, 45 s ;
25 cycles puis 720C, 10 min. Les produits de PCR sont purifiés à partir d'un gel d'agarose
2% (gel extraction Kit Quiagen, volume final 50 μl).
Conditions de la PCR 3 de chevauchement : Un μl de chacune des PCR 1 et 2 et 0,5 U Deep Vent, dans un volume final de 50 μl. Après 5cycles (94°C, 3 min; 94°C, 1 min; 600C, 1 min; 72°C, 1,5 min) on ajoute 10 pmoles de chaque oligonucléotides (amont-EcoRV et aval-MluI) et la PCR est poursuivie pendant 35 cycles puis 72°C, 10 min. Le produit de la PCR 3 est purifié à partir d'un gel d'agarose 2% (gel extraction Kit Quiagen, volume final 50 μl). La séquence du fragment de PCR est réalisée sur séquenceur ABI 310 en utilisant l'oligo 5' EcoRI-90.
Clonage du fragment de PCR 3 dans le pïasmide p55PhoA6HisGS/N':
Trente cinq μl du fragment de PCR 3 et 5 μl (2,5 μg) de p55PhoA6HisGS/N' sont digérés par 10 U de EcoRV et MIuI. Après 16 h d' incubation les enzymes sont détruites 10 min à 65°C. Chaque ADN est ensuite précipité et resuspendu avec 20 μl d'H2O.
La ligation est réalisée 16 h à 16°C avec 5 μl de fragment de PCR, 0,5 μl de vecteur et 3 U Weiss de T4 DNA ligase Biolabs dans un volume final de 10 μl. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de ligation. p55PhoA6HisGS7NAB"
(Figures 1OA et 11)
Déphasage du gène PhoA au niveau du site Eagl. Ce déphasage crée un site unique Fsel. Cinq μl (2,5 μg) de ρ55PhoA6HisGS/NAB" sont digérés par 10 U de Eagl. Après
16 h d'incubation l'enzyme est détruite 10 min à 65 °C. Le mélange réactionnel est ensuite précipité et resuspendu avec 20 μl d'H2O. On ajoute un mélange équimolaire de dGTP et dCTP (33 μM final) et 2,5 U de fragment Klenow exo- (Biolabs) dans un volume final de
50 μl, 15 min à 25°C. On arrête la réaction avec 2 μl d'EDTA à 500 mM, 20 min à 750C. Le mélange réactionnel est précipité à l'éthanol, repris avec 5 μl d'H2O et ligaturer avec 3
U Weiss de T4 DNA ligase Biolabs dans un volume final de 10 μl. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de ligation.
Ce plasmide permet le clonage et la sélection des fragments d'anticorps VH humains les mieux sécrétés. p55/MCSl
(Figures 10A et 11)
Insertion du MCSl dans p55PhoA6HisGS/NAB~ entre les sites Ncol et HindIII en utilisant les oligonucléotides appariés 5' MCSl et 3' MCSl.
Séquences SEQ ID N° 24 et 25 des oligonucléotides utilisés : 5' MCSl
SEQ ID N°24 :
CATGGCCCAGGTCACCGTCTCCTCAAACCGCGGACTCGAGGCGGCCCAGCCGG
CCATGGCCGCTAGCGCGGCCGCTCTAGATTA
3'MCSl SEQIDN025:
AGCTTAATCTAGAGCGGCCGCGCTAGCGGCCATGGCCGGCTGGGCCGCCTCGA
GTCCGCGGTTTGAGGAGACGGTGACCTGGGC
Cinq μl (2,5 μg) de vecteur p55PhoA6HisGS/NAB" sont digérés 16 h par 10 U de chaque enzyme Ncol et HindIII. Dix pmoles de chacun des oligonucléotides 5' MCSI et 3' MCSI sont incubés 5 min à 80°C, puis la solution est redescendue lentement à température ambiante.
Ligaturer 5 μl de vecteur avec 1,2 μl de la cassette hybridée (5' MCSI + 3' MCSI) en présence de 3 U Weiss deT4 DNA ligase Biolabs 1 h à température ambiante. La ligase est détruite en incubant 10 min à 65°C. On rajoute un mélange réactionnel (2 h) de 90 μl, contenant 10 U de EagI pour détruire le vecteur d'origine. Ce mélange est précipité à l'ethanol et repris avec 10 μl d'H2O. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de mélange. p55Flag/RBS/35
(Figures 10A et 11)
Insertion du motif Flag/RBS/PelB35 dans ρ55/MCSl entre les sites Sfil et Sac2 en utilisant les oligonucléotides appariés 5' Flag/RBS/35-sup et 3' Flag/RBS/35-inf.
Séquences SEQ ID N° 26 et 27 des oligonucléotides utilisés : 5' Flag/RBS/35-sup
SEQ ID N°26 :
GGAGAGTGTGCAGGTGATTACAAAGACGATGACGATAAGTAATAAACAGGAA
ACAGAAGTCCATATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTA
CTCGCGGCCCAGC SEQIDN0117:
GGAGAGTGTGCAGGTGATTACAAAGACGATGACGATAAGTAATAAACAGGAA
ACAGAAGTCCATATGAAATATCTTTTACCTACGGCAGCCGCAGGTTTGTTGTTA
CTCGCGGCCCAGC
3' Flag/RBS/35-inf SEQ ID N0 27 :
GGGCCGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAGGTATTTCATA
TGGACTTCTGTTTCCTGTTTATTACTTATCGTCATCGTCTTTGTAATCACCTGCA
CACTCTCCGC
SEQ ID N0 118 GGGCCGCGAGTAACAACAAACCTGCGGCTGCCGTAGGTAAAAGATATTTCATA
TGGACTTCTGTTTCCTGTTTATTACTTATCGTCATCGTCTTTGTAATCACCTGCA
CACTCTCCGC
Le clonage s'effectue exactement selon les conditions décrites précédemment pour l'insertion du MCSI. Après ligature le mélange réactionnel est digéré par 10 U d'enzyme Xhol. p55FIag/RBS/35cmyc6HisGS
(Figures 10B et 11) Insertion du motif c-myc-6HisGS dans p55Flag/RBS/35 entre les sites Notl et
HindIII en utilisant les oligonucléotides appariés 5' c-myc-6HisGS et 3' c-myc-6HisGS.
Séquences SEQ ID N° 28 et 29 des oligonucléotides utilisés :
5' c-myc-6HisGS SEQ ID N0 28:
GGCCGCAGAACAAAAACTCATCTCAGAAGAGGATCTGAATGGGGCCGTACATC
ACCACCATCACCATGGGAGCTA
SEQ ID N° 29:
3'c-myc-6HisGS AGCTTAGCTCCCATGGTGATGGTGGTGATGTACGGCCCCATTCAGATCCTCTTC
TGAGATGAGTTTTTGTTCTGC
Le clonage s'effectue exactement selon les conditions décrites précédemment pour l'insertion du MCSI. Le mélange de ligature est digéré par 10 U d'enzyme Xbal. p55CκFlag/RBS/35cmyc6HisGS (Figures 1OB et 11)
Insertion de la région constante légère Ckappa d'une immunoglobuline dans p55Flag/RBS/35cmyc6HisGS.
Séquences SEQ ID N° 30 ET 31 des oligonucléotides utilisés :
5' CK SEQ ID N° 30 :
GGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGGTACCGTGGCTGCACCATCT
GTCTTC
SEQ ID N0 119 :
GGGGCCAGGGGACCCAGGTCACCGTCTCCTCACGTACGGTGGCTGCACCATCT GTCTTC
3' CK
SEQ ID N°31 :
CGTCATCGTCTTTGTAATCACCTGCACACTCTCCGCGGTTGAAGCTCTTTGTCA
CCG Amplification du domaine CK :
Des lymphocytes B humains sont purifiés par gradient de Ficoll à partir de la poche fournie par le LFB. L1ARN total est ensuite préparé selon le protocole décrit au paragraphe
1.3.2. Hybridation:
Un μl d'ARN total est préincubé avec 1 pmole d'oligonucléotide 3' CK pendant 10 min à 70°C dans un volume final de 8 μl. La température est diminuée lentement (45 min) jusqu'à 37°C. Transcription inverse:
Aux 8 μl, on ajoute 0,5 μl de RNAsine (20 U), 3 μl de tampon 5X (SuperScriptlI, Invitrogen), 1 μl DTT, 100 mM, 2 μl dNTP 10 mM et on incube 10 min à 50°C. On ajoute ensuite 0,75 μl de SuperScript (150 U) et l'incubation est poursuivie 30 min à 50°C et 15 min à 70°C. L1ADNc obtenu est purifié sur billes (BioMag Carboxyl Terminated, Polysciences) selon les recommandations du fournisseur. L'élution finale est réalisée avec 15 μl de Tris- acétate 10 mM pH 7,8.
Conditions de PCR 1 et 2 :
La PCRl est réalisée avec 1 μl d'ADNc, 10 pmoles de chaque oligonucléotides 5' CK et 3' CK, 0,5 U Dynazyme (94°C, 3 min ; 94°C, 1 min ; 60°C, 1 min ; 72°C, 1,5 min ; 30 cycles puis 72°C, 10 min) dans un volume final de 50 μl.
La PCR2 est faite à partir de 1 μl de PCRl en utilisant 0,5 U de Deep- Vent, (94°C, 3 min ; 940C, 45 s ; 60°C, 45 s ; 72°C, 45 s ; 25 cycles puis 72°C, 5 min) dans un volume final de 50 μl. Le produit de PCR est purifié à partir d'un gel d'agarose 2% (gel extraction Kit Quiagen, volume final 50 μl).
Le fragment de PCR est séquence avant clonage sur ABI310 avec les oligonucléotides 5' CK et 3' CK.
Le clonage du domaine CK est effectué entre les sites BstEII et SacII de p55Flag/RBS/35cmyc6HisGS : 20 μl du fragment de PCR 2 et 5 μl (2,5 μg) de p55Flag/RBS/35cmyc6HisGS sont digérés par 10 U de BstEII et SacII. Après 16 h d'incubation les enzymes sont détruites 10 min à 65°C. Chaque ADN est ensuite précipité et resuspendu avec 20 μl d'H2O.
La ligature est réalisée 16 h à 16°C avec 5 μl de fragment de PCR 2, 0,5 μl de vecteur et 3 U Weiss de T4 DNA ligase Biolabs dans un volume final de 10 μl. Des bactéries TGl compétentes (technique CaCl2) sont transformées avec 5 μl de ligation. p55CκFIag/RBS/35CHljlcmyc6HisGS (pCκCHl yl-TΛG) (Figures 10B et 11) Insertion de la région constante lourde CHl d'une immunoglobuline de type IgGl dans p55CκFlag/RBS/35cmyc6HisGS.
Séquences SEQ ID N°32 à 35 des oligonucléotides utilisés :
5' CHlyl SEQ ID N°32:
CTCGAGGCGGCCCAGCCGGCCATGGCCGCTAGCACCAAGGGCCCATCGG
3' CHl y 1
SEQ ID N°33:
AAGCTTAATCTAGAGCGGCCGCACAAGATTTGGGCTCAACTTTC BstEII-sup
SEQ ID N°34:
CCCTCAGCAGCGTAGTGACCGTGCCCTCC
BstEII-inf
SEQ ID N°35: GGAGGGCACGGTCACTACGCTGCTGAGGG
L'amplification du domaine CHl y 1 est réalisée par PCR de chevauchement pour détruire le site BstEII.
La transcription inverse est réalisée exactement comme décrite ci-dessus pour la
CK, mais en utilisant l'oligonucléotide 3' CHlyl. La PCR 1 après RT est réalisée avec 1 μl d'ADNc, 10 pmoles de chaque oligonucléotides 5' CHl γl et 3' CHl γl, 0,5 U de Dynazyme (94°C, 3 min ; 94°C, 1 min ;
600C3 1 min ; 72°C, 1,5 min ; 30 cycles puis 72°C, 10 min) dans un volume final de 50 μl. La PCR 2a est réalisée à partir de 1 μl la PCR 1, avec les oligonucléotides 5' CHl γl et BstEII-inf en utilisant 0,5 U de Dynazyme (940C, 3 min ; 94°C, 45 s ; 600C, 45 s ; 720C, 45 s ; 25 cycles puis 72°C, 5 min) dans un volume final de 50 μl.
La PCR 2b est réalisée à partir de 1 μl la PCR 1, avec les oligonucléotides BstEII- sup et 3' CHl γl en utilisant 0,5 U de Dynazyme (94°C, 3 min ; 94°C, 45 s ; 600C, 45 s ;
720C, 45 s ; 25 cycles puis 72°C, 5 min) dans un volume final de 50 μl.
La PCR 3 est réalisée à partir d'un μl de chaque PCR 2a et PCR 2b, avec les oligonucléotides 5' CHlγl et 3' CHlγl, en utilisant 0,5 U de Deep-Vent (94°C, 3 min ;
94°C, 45 s ; 600C, 45 s ; 72°C, 45 s ; 25 cycles puis 72°C, 5 min) dans un volume final de
50 μl. Le produit de PCR 3 est purifié à partir d'un gel d'agarose 2% (gel extraction Kit Quiagen, volume final 50 μl). La séquence du fragment de PCR 3 est réalisée sur séquenceur ABI 310 en utilisant les oligonucléotides : 5' CHl γl et 3' CHlγl.
Le clonage est réalisé comme décrit pour le domaine CK mais entre les sites Sfil et NotI de p55CκFlag/RBS/35cmyc6HisGS.
Le plasmide résultant est appelé plus communément: pCκCHlyl-TAG, il permet la production de fragments d'anticorps de type Fab dont chaque chaîne possède une étiquette (Figure 12A). pSSCicFIag/RBS/SSCHlHylcmycόHisGS
Figure imgf000037_0001
(Figures 1OB et 11)
Insertion de la région constante lourde CHl et de la région Hinge (H) d'une immunoglobuline de type IgGl dans p55CκFlag/RBS/35cmyc6HisGS.
Les PCRl, 2a, 2b et 3 sont réalisées exactement comme pour l'amplification du domaine CHl décrite ci-dessus en remplaçant l'oligonucléotide 3' CyI par l'oligonucléotide 3' CHlHyI dont la séquence SEQ ID N° 36 est indiquée ci-dessous : 3' CHlHyI SEQ ID N° 36 :
AAGCTTAATCTAGAGCGGCCGCTGGGCACGGTGGGCATGTGTGAGTTTTGTCA CAAGATTTGGGCTCAACTTTC Le clonage est réalisé comme décrit pour le domaine CHlyl entre les sites Sfil et
Notl de p55CκFlag/RBS/35cmyc6HisGS.
Le plasmide résultant est appelé plus communément : pCκCHlHyl-TAG, il permet la production de fragments d'anticorps de type F(ab')2 dont chaque chaîne possède une étiquette (Figure 12A). p55Cκ/RBS/35CHlyl (pCκGHlγl) (Figures 10B et 11)
Elimination des étiquettes Flag et c-myc-6hisGS du plasmide p55CκFlag/RBS/35CHlylcmyc6HisGS par remplacement du fragment d'ADN compris entre SacII et Sfil par une nouvelle cassette en utilisant les oligonucléotides appariés 5' RBS/35-sup et 3' RBS/35-inf.
Séquences SEQ ID N°37 et 38 des oligonucléotides utilisés :
5' RBS/35-sup
SEQ ID N°37 : GGAGAGTGTTAATAAACAGGAAACAGAAGTCCATATGAAATACCTATTGCCTA CGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGC SEQ ID N°120 :
GGAGAGTGTTAATAAACAGGAAACAGAAGTCCATATGAAATATCTTTTACCTACGGCA GCCGCAGGTTTGTTGTTACTCGCGGCCCAGC y RBS/35-inf SEQ ID N°38 :
GGGCCGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAGGTATTTCATA TGGACTTCTGTTTCCTGTTTATTAACACTCTCCGC SEQ ID N°121 :
GGGCCGCGAGTAACAACAAACCTGCGGCTGCCGTAGGTAAAAGATATTTCATA TGGACTTCTGTTTCCTGTTTATTAACACTCTCCGC
Le clonage s'effectue exactement selon les conditions décrites pour l'insertion du MCSI. Le plasmide résultant intermédiaire est appelé : p55Ci<yRBS/35CHlγlcmyc6HisGS. Le motif c-myc-6HisGS est enlevé en reclonant le domaine CHlyl dans p55Cκ/RBS/35CHlylcmyc6HisGS.
Une PCR est utilisée en amplifiant à partir de 5 ng de plasmide p55CicFlag/RBS/35CHlylcmyc6HisGS le domaine CHlyl avec les oligonucléotides 5' CHlyl et 3' CHlyl-STOP. Séquence SEQ ID N°39 de l'oligonucléotide utilisé :
3' CHlyl-STOP
SEQ ID N°39 :
CATGCAGTCCCAAGCTTAACAAGATTTGGGCTCAACTTTC
Le clonage du fragment de PCR est réalisé comme décrit pour le domaine CK mais entre les sites Sfil et et HindIII du plasmide pSSCic/RBS/SSCHlylcmycόHisGS.
Le plasmide résultant est appelé plus communément : pCκCHlyl, il permet la production de fragments d'anticorps de type Fab (Figure 12A). P55Cκ/RBS/35CHlHyl (pCκCHlHγl)
(Figures 1OB et 11) Elimination des étiquettes Flag et c-myc-6hisGS du plasmide p55CκFlag/RBS/35CHlHγlcmyc6HisGS par remplacement du fragment dADN compris entre SacII et Sfil par une nouvelle cassette en utilisant les oligonucléotides appariés 5' RBS/35-sup et 3' RB S/35 -inf décrits précédemment.
Le clonage s'effectue exactement selon les conditions décrites pour l'insertion du MCSI. Le plasmide résultant intermédiaire est appelé : pSSCK/RBS/SSCHIHylcmycôHisGS.
Le motif c-myc-6HisGS est enlevé en reclonant le domaine CHlHγl dans pSSCK/RBS/SSCHIHylcmycόHisGS.
Une PCR est utilisé en amplifiant à partir à partir de 5 ng de plasmide p55CκFlag/RBS/35CHlHylcmyc6HisGS le domaine CHlHyI avec les oligonucléotides 5' CHlyl et 3' CHlHyI-STOP.
Séquence SEQ ID N°40 de l'oligonucléotide utilisé : 3' CHlHyI-STOP SEQ ID N°40 :
CATGCAGTCCCAAGCTTATGGGCACGGTGGGCATGTGTG Le clonage du fragment de PCR est réalisé entre les sites Sfil et HindlII comme décrit précédemment mais à partir du plasmide pSSCic/RBS/SSCHlHylcmycόHisGS.
Le plasmide résultant est appelé plus communément : pCκCHlHyl, il permet la production de fragments d'anticorps de type F(ab')2 (Figure 12A). p55Cκ/RBS/35CHlHCH2CH3yl (pMabγl*) (Figures 1OB et 11)
Insertion de la région constante lourde CHl, de la région Hinge (H) et des régions constantes CH2 et CH3 d'une immunoglobuline de type IgGl dans P55CκFlag/RBS/35CHlylcmyc6HisGS.
Les PCRl, 2a, 2b et 3 sont réalisées exactement comme pour l'amplification du domaine CHl décrite ci-dessus en remplaçant l'oligonucléotide 3' CHlyl par l'oligonucléotide 3' HindIII/H-CH2-CH3 dont la séquence SEQ I D N°41 est indiquée ci- dessous :
3' HindIII/H-CH2-CH3 SEQ ID N°41 : CCGCCAAAACAGCCAAGCTTATTTACCCGGAGACAGGGAG
Le clonage est réalisé comme décrit pour le domaine CHIy entre les sites Sfil et HindlII de p55CκFlag/RBS/35CHlγlcmyc6HisGS. Le plasmide résultant est appelé plus communément : pMAbyl*, il permet la production de fragments d'anticorps de type mAb* (Figure 12B). p55HCH2CH3γlcmyc6HisGS (piyCH2Œr5γ/-2MG)
(Figures 1OB et 11) Insertion de la région Hinge (H) et des régions constantes CH2 et CH3 d'une immunoglobuline de type IgGl entre les sites BstEII et Notl de p55Flag/RBS/35cmyc6HisGS.
La transcription inverse est réalisée exactement comme décrite pour la CK, mais en utilisant l'oligonucléotide 3' NotI/H-CH2-CH3. Séquences SEQ ID N°42 et 43 des oligonucléotides utilisés : 5' BstE2/H-CH2-CH3 SEQ ID N°42 :
CCGGCCATGGCCCAGGTCACCGTCTCCTCAGACAAAACTCACACATGCCC 3' NotI/H-CH2-CH3 SEQ ID N°43:
AAGCTTAATCTAGAGCGGCCGCTTTACCCGGAGACAGGGAG La PCR après RT est réalisée avec 1 μl d'ADNc, 10 pmoles de chaque oligonucléotides 5' BstE2/H-CH2-CH3 et 3' NotI/H-CH2-CH3, 0,5 U de Dynazyme (94°C, 3 min ; 94°C, 1 min ; 60°C, 1 min ; 72°C, 1,5 min ; 30 cycles puis 72°C, 10 min) dans un volume final de 50 μl.
Le plasmide résultant est appelé plus communément : pHCH2CH3yl-TAG, il permet la production de fragments d'anticorps de type (HCH2CH3)2 avec une étiquette à l'extrémité de CH3 (Figure 12B). p55HCH2CH3yl (pHCH2CH3γl) (Figures 10B et 11)
Insertion de la région Hinge (H) et des régions constantes CH2 et CH3 d'une immunoglobuline de type IgGl entre les sites BstEII et HindIII de p55Flag/RBS/35cmyc6HisGS.
La transcription inverse est réalisée exactement comme décrite pour la CK, mais en utilisant l'oligonucléotide 3 ' HindIII/H-CH2-CH3.
Séquences SEQ ID N°44 et 45 des oligonucléotides utilisés : 5' BstE2/H-CH2-CH3 SEQ ID N°44 : CCGGCCATGGCCCAGGTCACCGTCTCCTCAGACAAAACTCACACATGCCC
3' Hindiπ/H-CH2-CH3
SEQ ID N°45 : CCGCCAAAACAGCCAAGCTTATTTACCCGGAGACAGGGAG
La PCR après RT est réalisée avec 1 μl d'ADNc, 10 pmoles de chaque oligonucléotides 5' BstE2/H-CH2-CH3 et 3' HindIII/H-CH2-CH3, 0,5 U de Dynazyme
(94°C, 3 min ; 94°C, 1 min ; 600C, 1 min ; 72°C5 1,5 min ; 30 cycles puis 72°C, 10 min) dans un volume final de 50 μl.
Le plasmide résultant est appelé plus communément : pHCH2CH3γl, il permet la production de fragments d'anticorps de type (HCH2CH3)2 (Figure 12B). Clonage des VHH
Dans les différents formats n'importe quel VHH peut être introduit entre les sites uniques.
En amont de la Ck : entre EcoRI et BstEII (ou Kpnl)
En amont de CHl : entre Sfil et Nhel
En amont de H : EcoRI et BstEII A cet effet, on amplifie par PCR les différents VHH avec les couples d'oligonucléotides 5' et 3' décrits ci -dessous :
Séquences SEQ ID N°46 à 52 des oligonucléotides utilisés :
5' EcoRl-PelB55-PelBPHen
SEQ ID N°46: CGACACCGGAATTCCATATGAAATACCTATTACCAACAGCAGCAGCTGGGTTA
TTATTGCTCGCTGCGCAGCCGGCCATGGCCGAGGTGCAGCTG
5'VHl-Sfî
SEQ ID N°47:
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGT CTGG
5'VH2-Sfi
SEQ ID N°48:
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTCACCTTGAAGGAGT
CTGG 5'VH3-Sfi
SEQ ID N°49: CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGT
CTGG 005/003151
41
5'VH4-Sfi SEQ ID N°50:
CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGCAGGAGT CGGG 3' BstEII/Kpnl SEQ ID N°51:
GGTGCAGCCACGGTACCTGAGGAGACGGTGACCTG 3' BstE2/NheI SEQ ID N°52: GGGCCCTTGGTGCTAGCTGAGGAGACGGTGACCTG
Production, purification et caractérisation des anticorps bio-spécifiques La production et la purification des différents fragments d'anticorps possédant l'étiquette 6HisGS sont réalisées comme décrit en précédemment. Pour la purification des fragments d'anticorps sans étiquette, l'étape de chromatographie sur talon est remplacée par une colonne échangeuse d'ions dont les caractéristiques (anions ou cations) dépendent des caractéristiques du fragment d'anticorps.
Des gels d'électrophorèse sont montrés dans la Figure 13. Les Fab' et F(ab')2 sont purifiés sur collone de cobalt puis sur protéine G. Les différents fragments d'anticorps sont ensuite séparés sur supedex 200 (ou éventuellemnt superdex 75). Méthode pour isoler les VH humains et construction des vecteurs.
Le principe de la méthode consiste à cloner des domaines VH humains (isolés par RT-PCR à partir de la poche du LFB) dans le plasmide p55PhoA6HisGS7NAB" (Figures 1OA et 11). Ce plasmide possède le gène codant pour la phosphatase alcaline dans une phase de lecture ne permettant pas son expression. Le clonage des VH restaure la phase de lecture de la phosphatase alcaline et permet la production des VH fusionnés en amont de la phosphatase alcaline (banque VH-PhoA clonée dans des bactéries TGl). Les différents clones sont ensuite produits en microplaques 96 puits et la cinétique de croissance des différents clones est mesuré toutes les 30 min (DO 620 nm) directement à partir des microplaques. On sélectionne ainsi les clones dont la croissance n'est pas altérée par la présence des VH. Les clones des microplaques sont répliqués et conservés à -8O0C. Après 2 heures d'induction à 37°C, ou 16 heures d'induction à 30°C, 240C, voire 180C5 la croissance est arrêtée et l'activité phosphatase est directement mesurée à partir des surnageants des milieux de culture. L'activité phosphatase est ensuite directement corrélée au nombre de bactéries présentes dans chaque puits de microplaques.
La phosphatase alcaline n'est active que si elle est sécrétée dans le périplasme bactérien, sous forme de dimère avec ses ponts disulfures correctement formés. Cette approche permet donc de sélectionner les clones produisant la plus grande quantité de protéine fusion VH-PhoA sécrétée dans le milieu de culture bactérien. Il est ainsi possible de sélectionner les VH qui sont correctement repliés et dont le pont disulfure est correctement formé, donc solubles. Les VH sélectionnés serviront de matrice pour échanger les CDR des VH humains par les CDR des VHH de lamas précédemment décrits. Le choix du VH sera réalisé en choisissant le VH dont les acides aminés des jonctions des
CDR sont équivalents à ceux des VHH.
Conditions de RT-PCR et PCR :
Hybridation:
Un μl d'ARN total (purification décrite dans le paragraphe 1.3.2) est préincubé avec 1 pmole d'oligonucléotides (mélange de: 3' JHl -4-5; 3' JH2; 3' JH3 et 31 JH6) pendant 10 min à 70°C dans un volume final de 8 μl. La température est diminuée lentement (45 min) jusqu'à 37°C.
Transcription inverse :
Aux 8 μl, on ajoute 0,5 μl de RNAsine (20 U), 3 μl de tampon 5X (SuperScriptlI, Invitrogen), 1 μl DTT, 100 mM, 2 μl dNTP 10 mM et on incube 10 min à 50°C. On ajoute ensuite 0,75 μl de SuperScript (150 U) et l'incubation est poursuivie 30 min à 50°C et 15 min à 700C.
L1ADNc obtenu est purifié sur billes (BioMag Carboxyl Terminated, Polysciences) selon les recommandations du fournisseur. L'élution finale est réalisée avec 15 μl de Tris- acétate 10 mM pH 7,8.
La PCRl est réalisée avec 1 μl d'ADNc (obtenu par RT-PCR), 10 pmoles d'oligonucléotides 5' (0,625 pmole de chaque oligonucléotides 5' dont les séquences sont indiquées ci-dessous) et 3' (2,5 pmoles de chaque oligonucléotides 3' dont les séquences sont indiquées ci-dessous), 0,5 U de Dynazyme (95°C, 3 min; puis 95°C, 1 min; 58°C, 1 min; 72°C, 1 min; pendant 35 cycles puis 720C, 10 min). Les produits de PCR sont déposés sur un gel d'agarose 2% et les bandes correspondant aux VH sont purifiées (gel extraction Kit Qiagen). La PCR2 est faite à partir de 1 μl de PCRl diluée au 1/lOOOéme, la même quantité d'oligonucléotides décrits précédemment, 0,5 U Deep- Vent pour un volume final de 50 μl.
(94°C, 3 min; puis 940C, 1 min; 70°C, 1 min; 72°C, 1,5 min; pendant 40 cycles puis 720C,
10 min). Les fragments sont purifiés à partir de gel d'agarose 2% comme précédemment décrit.
Séquences SEQ ID N°53 à SEQ ID N°72des oligonucléotides utilisés :
51 VHIa
SEQ ID N°53 :
CG GCC CAG CCG GCC ATG GCC CAG GTG CAG CTG GTG CAG TCT GG 51 VHIb
SEQ ID N°54 :
CGGCCCAGCCGGCCATGGCCCAGGT(CT)CAGCT(GT)GTGCAGTCTGG
5'VHIc
SEQ ID N°55 : CG GCC CAG CCG GCC ATG GCC (CG)AG GTC CAG CTG GTA CAG TCT GG
5' VHId
SEQ ID N°56 :
CG GCC CAG CCG GCC ATG GCC CA(GA) ATG CAG CTG GTG CAG TCT GG
5' VH2a SEQ ID N°57 :
CG GCC CAG CCG GCC ATG GCC CAG GTC ACC TTG AAG GAG TCT GG
5' VH2b
SEQ ID N°58 :
CG GCC CAG CCG GCC ATG GCC CAG ATC ACC TTG AAG GAG TCT GG 5' VH3a
SEQ ID N°59 :
CGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGG
5'VH3b
SEQIDN°60 : CGGCCCAGCCGGCCATGGCCGAAGTGCAGCTGGTGGAGTCTGG
5'VH3c
SEQIDN°61 :
CGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGGAGTCTGG 03151
44
5' VH3d
SEQIDN°62:
CG GCC CAG CCG GCC ATG GCC GAG GTG CAG CTG GTG GAG (AT)C(TC)
(GC)G 5' VH4a
SEQIDN°63:
CG GCC CAG CCG GCC ATG GCC CAG GTG CAG CTG CAG GAG TCG GG
5' VH4b
SEQ ID N°64: CG GCC CAG CCG GCC ATG GCC CAG CTG CAG CTG CAG GAG TC(GC) GG
5' VH4c
SEQIDN°65:
CG GCC CAG CCG GCC ATG GCC CAG GTG CAG CTA CAG CAG TGG GG
5' VH5a SEQIDN°66:
CG GCC CAG CCG GCC ATG GCC GA(GA) GTG CAG CTG GTG CAG TCT GG
5' VH6a
SEQ ID N°67:
CG GCC CAG CCG GCC ATG GCC CAG) GTA CAG CTG CAG CAG TCA GG 5' VH7a
SEQIDN°68:
CGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAATCTGG
3'JHl-4-5
SEQIDN°69: GTC TAG ACG TCC CCC CGG GGA GGA GAC GGT GAC CAG GG
3' JH2
SEQ ID N°70:
GTCTAGACGTCCCCCCGGGGAGGAGACAGTGACCAGGG
3'JH3 SEQIDN°71:
GTC TAG ACG TCC CCC CGG GGA AGA GAC GGT GAC CAT TG
3'JH6
SEQ ID N°72: GTCTAGACGTCCCCCCGGGGAGGAGACGGTGACCGTGG
Les différents fragments de PCR purifiés sont digérés par 10 U de Ncol et Xmal et insérés dans le vecteur de clonage p55/PhoA6HisGS7NAB" par ligature. Le mélange de ligature est digéré par Fsel avant transformation des bactéries. La transformation est réalisée par électroporation avec de bactéries TGl électrocompétentes. Les clones possédant un domaine VH inséré restaure l'activité phosphatase (colonies bleues). Production en microplaque 96 ou 384 puits :
Témoins: contrôle négatif milieu (2YT/ ampicilline 100 μg/ml), contrôle négatif du vecteur p55/PhoA6HisGS7NAB', contrôle positif du vecteur p55PhoA6HisGS/NAB". Distribution de 150 ou 40 μl de milieu de culture (2YT/ ampicilline 100 μg/ml) par puits (Nunclon Surface, Nunc). On inocule chaque puits avec une colonie isolée bleue avec un cure-dent ou un piqueur de cellule (Qpix) puis on scelle la plaque avec une feuille adhésive stérile. On fait pousser 16 h soit à 370C ou 300C dans un incubateur de plaques IEMS Thermo sous agitation à 900 rpm puis faire une réplique de la microplaque "mère" avec un réplicateur 96 ou 384 puits dans une microplaque contenant 150 ou 40 μl de 2YT/ ampicilline 100 μg/ml puis sceller avec une feuille adhésive stérile (Après la réplique, on ajoute dans la microplaque mère 37,5 ou 10 μl de glycérol 80% par puits et conserver à - 800C). Après 3 h de culture (environ DO 620nm 0,5) on induit 16 h avec 100 μM d'ITPG final. La DO à 620 nm est mesurée en fin d'induction. Dosage de l'activité phosphatase alcaline :
Prendre 10 μl de la culture totale (cellules + milieu de culture) et 10 μl de surnageant de culture (pour cela centrifuger 3 min à 910 g). A chaque échantillon on ajoute 65 μl Tris-HCl 1OmM pH 8,0 et on ajoute 25 μl de PNPP (paranitrophényl phosphate) à 1 mg/ml dans (diéthanolamine pH 9,8 (HCl); MgC12 0,5 mM ). Après 30 min de réaction sous agitation, on mesure la DO à 405nm.
L'activité phosphatase alcaline mesurée à 405 nm est ramenée au nombre de cellules (mesure DO 620 nm) contenues dans chaque puits en fin d'induction. Chaque activité phosphatase, des clones exprimant un VH fusionné à la phosphatase alcaline, est comparée à celle du contrôle positif (Phosphatase alcaline non fusionnée produite par p55PhoA6HisGS/NAB"). Seuls les clones présentant une activité égale ou supérieure au contrôle sont pris en considération et séquences avec les oligonucléotides 5' EcoRI-90 et 3' inf-PstI+71 (séquence de l'oligonucléotide 3' inf-PstI+71: GTTAAACGGCGAGCACCG). REFERENCES BIBLIOGRAPHIQUES
1- Hamers-Casterman C3 Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R. Naturally occurring antibodies devoid of light chains. Nature 1993; 363 : 446-448.
2- Teillaud C, Galon J, Zilber MT, Mazieres N, Spagnoli R, Kurrle R, Fridman WH5 Sautes
C. Soluble CD 16 binds peripheral blood mononuclear cells and inhibits pokeweed- mitogen-induced responses. Blood, 1993, 82 : 3081-3090).
3- Terskikh, A, Mach, JP, and Pèlegrin A. Marked increase in the sécrétion of a fully antigenic recombinant CEA obtained by deletion of its hydrophobic tail. Mol Immunol,
1993, 30:921-927.
4- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem, 1987, 162 : 156-159.
5- Arbabi Ghahroudi M, Desmyter A, Wyns L5 Hamers R, Muyldermans S. Sélection and identification of single domain antibody fragments from camel heavy-chain antibodies.
FEBS Lett, 1997, 414 : 521-526.
6- Vivier E, Rochet N5 Ackerly M, Petrini J, Levine H, Daley J, Anderson P. Signaling fonction of reconstituted CD 16: zêta: gamma receptor complex isoforms. Int Immunol, 1992, 4 : 1313-1323. 7- Vély F, Gruel N5 Moncuit J, Cochet O, Rouard H, Daré S, Galon J, Sautés C, Fridman WH, Teillaud J-L. A new set of monoclonal antibodies against human FcgammaRII (CD32) and FcgammaRIII (CD16): characterization and use in various assays. Hybridoma, 1997, 16 : 519-528.
8- Le Calvez H, Fieschi J, Green JM, Marchesi N5 Chauveau J5 Baty D. Paratope characterisation by structural modelling of two anti-cortisol single-chain variable fragments produced in E. coli. Mol. Immunol, 1995, 32 : 185-198.
9- Le Calvez H5 Green JM, Baty D. Increased efficiency of alkaline phosphatase production levels in Escherichia coli using a degenerate PeIB signal séquence. Gène, 1996, 170 : 51-55.

Claims

REVENDICATIONS
1 - Formats d'anticorps, caractérisés en ce qu'ils comprennent tout ou partie des domaines de VHH ou de VHH humanisés ou de VH humains, fusionnés à des régions constantes d'anticorps humains.
2 - Formats d'anticorps selon la revendication 1, caractérisés en ce qu'ils sont de type Fab et comportent, en association, deux domaines VHH ou deux domaines VH humains, identiques ou différents, ou deux domaines VH humains sur lesquels sont greffés les CDRs de VHH, l'un des domaines étant fusionné à la région constante CK ou Cλ humaine, l'autre à la région CHl d'une immunoglobuline.
3 - Formats d'anticorps selon la revendication 1 , caractérisés en ce qu'ils sont de type Fab' et comportent, en association, deux domaines VHH ou deux domaines VH humains, identiques ou différents, ou deux domaines VH humains sur lesquels sont greffés les CDRs de VHH, l'un des domaines étant fusionné à la région constante CK ou Cλ humaine, l'autre à la région CHl suivie d'une région charnière H d'une immunoglobuline.
4 - Formats d'anticorps selon la revendication 1, caractérisés en ce qu'ils sont de type F(ab')2 et comportent, en association, deux formats de type Fab' tels que définis selon la revendication 3. 5 - Formats d'anticorps selon la revendication 4, caractérisés en ce qu'ils sont de type F(ab')2 et comportent, en association, deux Fab' identiques ou différents obtenus par la réduction desdits formats de type F(ab') 2.
6 - Formats d'anticorps selon la revendication 1 , caractérisés en ce qu'ils sont de type (HCH2CH3)2, où H représente la région charnière "Hinge" d'une immunoglobuline humaine, CH2 et CH3 représentant le second et troisième domaine d'une Ig humaine et comportent, en association, deux VHH ou deux VH humains, identiques ou deux VH humains sur lesquels sont greffés les régions hypervariables des VHH, chacun étant fusionné à la région H-CH2-CH3 d'une IgG ou de toute autre Ig humaine. 7 - Formats d'anticorps selon la revendication 1, caractérisés en ce qu'ils sont de type mAb* et comportent, en association, deux VHH ou deux VH humains, identiques ou différents, ou deux VH humains sur lesquels sont greffés les régions hypervariables des VHH, l'un étant fusionné à la région CK OU CΛ humaine, l'autre à la région CHl-H-
CH2-CH3 d'une Ig humaine.
8 - Formats d'anticorps selon l'une quelconque des revendications 1 à 7, caractérisés en ce que l'immunoglobuline est une IgG correspondant à une isoforme IgGl, IgG2, IgG3 ou IgG4 humaine ou une IgA humaine correspondant à une isoforme IgAl ou Ig A2.
9 - Formats d'anticorps selon l'une quelconque des revendications 1 à 8, caractérisés en ce que les VHH sont remplacés par des VH humains ou des VHH humanisés par greffage des CDRs des VHH sur des VH humains. 10 - Formats selon l'une quelconque des revendications 1 à 9, caractérisés en ce qu'ils comprennent des fragments anti-CD16 ou anti-CEA répondant à une séquence en acides aminés choisie dans le groupe comprenant, respectivement, les séquences SEQ ID N°73, SEQ ID N°74, SEQ ID N°75, SEQ ID N°76, SEQ ID N°103 et SEQ ID N°104 ou SEQ ID N°77, SEQ ID N°78, SEQ ID N°79, SEQ ID N°80 et SEQ ID N°105.
11 - Fragments d'anticorps VHH de camélidés, notamment de lamas, caractérisés en ce qu'il s'agit des fragments anti-CD16 ou anti-CEA répondant à une séquence en acides aminés choisie dans le groupe comprenant, respectivement, les séquences SEQ ID N°73, SEQ ID N°74, SEQ ID N°75, SEQ ID N°76, SEQ ID N°103 et SEQ ID N°104 ou SEQ ID N°77, SEQ ID N°78, SEQ ID N°79, SEQ ID N°80 et SEQ ID
N°105 ou à une séquence nucléotidique choisie dans le groupe comprenant, respectivement, les séquences SEQ ID N°81, SEQ ID N°82, SEQ ID N°83, SEQ ID N°84, SEQ ID N°106 et SEQ ID N°107 ou SEQ ID N°85, SEQ ID N°86, SEQ ID N°87, SEQ ID N°88 et SEQ ID N0108. 12 - Fragments d'anticorps selon la revendication 11, caractérisés en ce qu'il s'agit des CDRs des VHH.
13 - Procédé de production d'anticorps chimérisés ou humanisés, multispécifiques et/ou multivalents pour l'immunothérapie ou l'immunodiagnostic, caractérisé en ce qu'il comprend l'utilisation de formats d'anticorps selon l'une quelconque des revendications 1 à 10. R2005/003151
49
14 - Procédé selon la revendication 13, caractérisés en ce que lesdits formats comprennent des VHH de camélidés, notamment de lamas, anti-CEA et anti-CD16.
15 - Procédé selon la revendication 14, caractérisé en ce que lesdits domaines variables de VHH anti-CEA et anti- CD 16 sont avantageusement produits selon un protocole comprenant
- l'immunisation de camélidés, notamment de lamas avec, comme immunogène, un CEA ou un CD 16,
- la purification des lymphocytes B récupérés à partir du sang,
- la construction de banque de VHH, et - l'isolement des VHH à partir de la banque.
16- Procédé selon la revendication 15, caractérisé en ce que la construction de la banque comprend
- l'extraction des ARN totaux des lymphocytes B,
- la transcription inverse des ARN pour obtenir les ADNc correspondants, - l'amplification par PCR des gènes codant pour les régions variables des anticorps simple chaîne lourde anti-CD16 et anti-CEA,
- la ligation de fragments d'ADN VHH obtenus par coupure, par des enzymes, des ADN amplifiés avec un phagemide.
17- Procédé selon l'une quelconque des revendications 15 ou 16, caractérisé en ce que les VHH sont isolés à partir des banques par la technique de phage display et purifiés.
18- Procédé selon l'une quelconque des revendications 15 à 17, caractérisé en ce que les gènes des VHH sélectionnés sont introduits dans des vecteurs d'expression, notamment des plasmides, pour produire des formats selon l'une quelconque des revendications 1 à 10.
19- Vecteurs d'expression, notamment plasmides, des formats d'anticorps selon l'une quelconque des revendications 1 à 10, caractérisés en ce qu'ils renferment entre deux sites uniques d'enzymes de restriction les promoteurs, les séquences signal, les séquences nucléotidiques capables de coder pour lesdits fragments d'anticorps. 20- Plasmides pCκCHlγl-TAG de séquence SEQ ID N° 98 et SEQ ID N0 112 et pCκCHlγl de séquence SEQ ID N0IOO et SEQ ID N0114 permettant la production des anticorps de type Fab selon la revendication 2.
21- Plasmides pCκCHlHγl-TAG de séquence SEQ ID N°99 et SEQ ID N°l 13 et pCκCHlHγl de séquence SEQ ID N0IOl et SEQ ID N°115 permettant la production des anticorps de type Fab' ou F(ab')2 selon les revendications 3 et 4.
22- Plasmides pHCH2CH3γl-TAG de séquence SEQ ID N°95 et pHCH2CH3γl de séquence SEQ ID N°96 permettant la production des anticorps de type (HCH2CH3)2 selon la revendication 6. 23- Plasmide pMabγl* de séquence SEQ ID N°102 et SEQ ID N°116 permettant la production des anticorps de type m Ab* selon la revendication 7. 24- Compositions pharmaceutiques, caractérisées en ce qu'elles renferment au moins un format d'anticorps selon l'une quelconque des revendications 1 à 9. 25- Méthode d'immunodiagnostic in vitro, caractérisée en ce qu'elle comprend l'utilisation de formats d'anticorps selon l'une quelconque des revendications 1 à 9.
PCT/FR2005/003151 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats Ceased WO2006064136A1 (fr)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA 2590615 CA2590615C (fr) 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats
ES05826565.3T ES2544237T3 (es) 2004-12-16 2005-12-15 Producción de formatos de anticuerpos y aplicaciones inmunológicas de estos formatos
EP05826565.3A EP1824884B1 (fr) 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats
JP2007546119A JP5026279B2 (ja) 2004-12-16 2005-12-15 抗体フォーマット、および抗体を生産する方法
EP17153644.4A EP3187505B1 (fr) 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats
US11/818,218 US9169316B2 (en) 2004-12-16 2007-06-13 Production of antibody formats and immunological applications of said formats
US14/856,016 US10385137B2 (en) 2004-12-16 2015-09-16 Production of antibody formats and immunological applications of said formats

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0413433 2004-12-16
FR0413433A FR2879605B1 (fr) 2004-12-16 2004-12-16 Production de formats d'anticorps et applications immunologiques de ces formats

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP11178479.9A Previously-Filed-Application EP2433965B1 (fr) 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats
US11/818,218 Continuation US9169316B2 (en) 2004-12-16 2007-06-13 Production of antibody formats and immunological applications of said formats

Publications (1)

Publication Number Publication Date
WO2006064136A1 true WO2006064136A1 (fr) 2006-06-22

Family

ID=34954794

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2005/003151 Ceased WO2006064136A1 (fr) 2004-12-16 2005-12-15 Production de formats d'anticorps et applications immunologiques de ces formats

Country Status (7)

Country Link
US (2) US9169316B2 (fr)
EP (3) EP2433965B1 (fr)
JP (1) JP5026279B2 (fr)
CA (1) CA2590615C (fr)
ES (3) ES2627607T3 (fr)
FR (1) FR2879605B1 (fr)
WO (1) WO2006064136A1 (fr)

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102229671A (zh) * 2011-06-07 2011-11-02 南京医科大学 抗IMMT全人源Fab抗体及其在制备抗肝癌药物中的应用
WO2012089814A1 (fr) 2010-12-30 2012-07-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Formats de liaison à l'antigène destinés à être utilisés dans des traitements thérapeutiques ou des dosages diagnostiques
WO2015124588A1 (fr) 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques pour le traitement de maladies induites par la voie de signalisation du complexe nrp-1/obr
WO2016189118A1 (fr) 2015-05-28 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Méthodes de pronostic et de traitement de patients atteints de leucémie myéloïde aiguë
WO2016189091A1 (fr) 2015-05-26 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques (inhibiteurs de ntsr1) pour le traitement de carcinomes hépatocellulaires
WO2016207278A1 (fr) 2015-06-23 2016-12-29 Innate Pharma Protéines d'engageur nk multispécifiques
WO2017081190A1 (fr) 2015-11-13 2017-05-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique anti-nkg2d et utilisations de ceux-ci
WO2018090052A1 (fr) * 2016-11-14 2018-05-17 Amgen Inc. Protéines de liaison à l'antigène bispécifiques ou biparatopiques et utilisations de celles-ci
US10519234B2 (en) 2014-06-27 2019-12-31 Innate Pharma NKp46 binding proteins
WO2020120644A1 (fr) 2018-12-13 2020-06-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Nouvel anticorps à domaine unique d'épitope dirigé contre tau svqivykpv
EP2847230B1 (fr) * 2012-05-10 2020-08-12 Zymeworks Inc. Constructions hétéromultimères de chaînes lourdes d'immunoglobulines comprenant des mutations dans le domaine fc
WO2020254619A1 (fr) 2019-06-20 2020-12-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique conformationnels anti-protéase nexine-1 et utilisations associées
WO2021116119A1 (fr) 2019-12-09 2021-06-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps présentant une spécificité pour her4 et leurs utilisations
US11208480B2 (en) 2014-06-27 2021-12-28 Innate Pharma Multispecific antigen binding proteins
WO2022002880A1 (fr) 2020-06-29 2022-01-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique anti-protéine s et polypeptides les comprenant
WO2022144836A1 (fr) 2020-12-31 2022-07-07 Sanofi Agents d'activation de cellules tueuses naturelles (nk) multifonctionnels se liant à nkp46 et cd123
WO2022180271A1 (fr) 2021-02-26 2022-09-01 LAVA Therapeutics N.V. Anticorps se liant à des récepteurs des lymphocytes t cd123 et gamma-delta
WO2022258673A1 (fr) 2021-06-09 2022-12-15 Innate Pharma Anticorps multispécifiques se liant à cd20, nkp46, cd16 et conjugués à il-2
WO2023014863A1 (fr) 2021-08-05 2023-02-09 Go Therapeutics, Inc. Anticorps anti-glyco-muc4 et leurs utilisations
WO2023034571A1 (fr) 2021-09-03 2023-03-09 Go Therapeutics, Inc. Anticorps anti-glyco-lamp1 et leurs utilisations
WO2023034569A1 (fr) 2021-09-03 2023-03-09 Go Therapeutics, Inc. Anticorps anti-glyco-cmet et leurs utilisations
WO2023037333A1 (fr) 2021-09-13 2023-03-16 Janssen Biotech, Inc Anticorps multispécifiques cd33 x vδ2 pour traiter le cancer
WO2023067138A1 (fr) 2021-10-21 2023-04-27 LAVA Therapeutics N.V. Utilisations d'anticorps d'activation de lymphocytes t gamma delta
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
EP4285926A1 (fr) 2022-05-30 2023-12-06 LAVA Therapeutics N.V. Traitement combiné de la leucémie lymphocytaire chronique
EP4130046A4 (fr) * 2020-03-31 2024-04-24 Biotheus Inc. Plateforme de construction d'un anticorps multispécifique
US12060436B2 (en) 2012-11-28 2024-08-13 Zymeworks Bc Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
EP4438624A1 (fr) 2023-03-27 2024-10-02 LAVA Therapeutics N.V. Anticorps se liant aux récepteurs des lymphocytes t nectin-4 et gamma-delta
WO2024200573A1 (fr) 2023-03-27 2024-10-03 LAVA Therapeutics N.V. Agents de liaison à la nectine-4 et méthodes d'utilisation
WO2024224313A1 (fr) 2023-04-24 2024-10-31 Sanofi Utilisation d'un recruteur de cellules nk cd123 pour traiter une lam et des troubles associés
WO2024251884A1 (fr) 2023-06-09 2024-12-12 Innate Pharma Protéines d'activation de cellules nk comprenant un anticorps anti-cd20 et ant-nkp46, liées à il-2 dans le traitement de lnh-b r/r
US12195555B2 (en) 2022-05-27 2025-01-14 Sanofi Natural killer (NK) cell engagers binding to NKp46 and BCMA variants with Fc-engineering
WO2025012118A2 (fr) 2023-07-07 2025-01-16 LAVA Therapeutics N.V. Agents de liaison à 5t4 et méthodes d'utilisation
WO2025012704A1 (fr) 2023-07-13 2025-01-16 Sanofi Thérapie combinée par cellules tueuses naturelles et engageurs de cellules nk cd123
WO2025114919A1 (fr) 2023-11-28 2025-06-05 Sanofi Polythérapie par activation de cellules tueuses naturelles multifonctionnelles (nk) pour le traitement de troubles néoplasiques hématologiques
WO2025132833A1 (fr) 2023-12-20 2025-06-26 Institut National de la Santé et de la Recherche Médicale Anticorps à domaine unique anti-trypsine-3
WO2026055280A1 (fr) 2024-09-04 2026-03-12 Sanofi Polythérapie associant des agents engageant les cellules nk anti-cd123 et l'interleukine 2 (il-2)

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2879605B1 (fr) * 2004-12-16 2008-10-17 Centre Nat Rech Scient Cnrse Production de formats d'anticorps et applications immunologiques de ces formats
UA117218C2 (uk) * 2011-05-05 2018-07-10 Мерк Патент Гмбх Поліпептид, спрямований проти il-17a, il-17f та/або il17-a/f
PT3049439T (pt) * 2013-09-26 2020-03-31 Ablynx Nv Nanocorpos biespecíficos
RU2609627C2 (ru) * 2014-09-26 2017-02-02 Закрытое Акционерное Общество "Биокад" Высокоаффинные и агрегационно стабильные антитела на основе вариабельных доменов vl и производного vhh
MX383614B (es) 2015-05-21 2025-03-14 Harpoon Therapeutics Inc Proteinas de union triespecificas y metodos de uso.
US10100106B2 (en) 2016-05-20 2018-10-16 Harpoon Therapeutics, Inc. Single domain serum albumin binding protein
AU2017267793B2 (en) 2016-05-20 2024-01-25 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
US11623958B2 (en) 2016-05-20 2023-04-11 Harpoon Therapeutics, Inc. Single chain variable fragment CD3 binding proteins
WO2018014260A1 (fr) 2016-07-20 2018-01-25 Nanjing Legend Biotech Co., Ltd. Protéines de liaison antigènes multi-spécifiques et leurs procédés d'utilisation
WO2018068201A1 (fr) 2016-10-11 2018-04-19 Nanjing Legend Biotech Co., Ltd. Anticorps à domaine unique et ses variants contre ctla-4
KR102275008B1 (ko) 2016-11-23 2021-07-13 하푼 테라퓨틱스, 인크. 전립선 특이 막 항원 결합 단백질
US10844134B2 (en) 2016-11-23 2020-11-24 Harpoon Therapeutics, Inc. PSMA targeting trispecific proteins and methods of use
WO2018160754A2 (fr) 2017-02-28 2018-09-07 Harpoon Therapeutics, Inc. Protéine monovalente inductible de fixation d' antigène
CA3063362A1 (fr) 2017-05-12 2018-11-15 Harpoon Therapeutics, Inc. Proteines trispecifiques ciblant la msln et procedes d'utilisation
AU2018265856B2 (en) 2017-05-12 2023-04-27 Harpoon Therapeutics, Inc. Mesothelin binding proteins
SI3694529T1 (sl) 2017-10-13 2024-10-30 Harpoon Therapeutics, Inc. Trispecifične beljakovine in načini uporabe
IL315737A (en) 2017-10-13 2024-11-01 Harpoon Therapeutics Inc B-cell maturation antigen-binding proteins
JP2021505637A (ja) * 2017-12-12 2021-02-18 マクロジェニクス,インコーポレーテッド 二重特異性cd16結合分子、及び疾患の治療におけるその使用
TW201930358A (zh) 2017-12-28 2019-08-01 大陸商南京傳奇生物科技有限公司 針對tigit之單域抗體及其變異體
BR112020023330A2 (pt) 2018-05-14 2021-04-20 Harpoon Therapeutics, Inc. porção de ligação para ativação condicional de moléculas de imunoglobulina
US12195544B2 (en) 2018-09-21 2025-01-14 Harpoon Therapeutics, Inc. EGFR binding proteins and methods of use
EP3856771A4 (fr) 2018-09-25 2022-06-29 Harpoon Therapeutics, Inc. Protéines de liaison à dll3 et méthodes d'utilisation
RU2754760C2 (ru) 2019-04-02 2021-09-07 Закрытое Акционерное Общество "Биокад" Водная фармацевтическая композиция анти-il17a антитела и ее применение
KR20220008866A (ko) 2019-05-14 2022-01-21 하푼 테라퓨틱스, 인크. EpCAM 결합 단백질 및 사용 방법
CA3170833A1 (fr) 2020-02-21 2021-08-26 Harpoon Therapeutics, Inc. Proteines de liaison a flt3 et methodes d'utilisation
WO2024040195A1 (fr) 2022-08-17 2024-02-22 Capstan Therapeutics, Inc. Conditionnement pour l'ingénierie de cellules immunitaires in vivo
AU2024279278A1 (en) 2023-05-31 2025-12-18 Capstan Therapeutics, Inc. Lipid nanoparticle formulations and compositions
WO2025076113A1 (fr) 2023-10-05 2025-04-10 Capstan Therapeutics, Inc. Lipides cationiques ionisables à espacement conservé et nanoparticules lipidiques
IL327045A (en) 2023-10-05 2026-05-01 Capstan Therapeutics Inc Structure-restricted ionizable cationic lipids and lipid nanoparticles
US20250302763A1 (en) 2024-02-22 2025-10-02 Capstan Therapeutics, Inc. Immune engineering amplification
WO2025217454A2 (fr) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Lipides cationiques ionisables et nanoparticules lipidiques
WO2025217452A1 (fr) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Lipides cationiques ionisables contraints et nanoparticules lipidiques

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020155604A1 (en) * 1998-02-19 2002-10-24 Jeffrey A. Ledbetter Compositions and methods for regulating lymphocyte activation

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2052027T5 (es) 1988-11-11 2005-04-16 Medical Research Council Clonacion de secuencias de dominio variable de inmunoglobulina.
CA2116640A1 (fr) 1993-03-25 1994-09-26 Alexey Terskikh Derives de l'antigene carcino-embryonnaire
US6838254B1 (en) * 1993-04-29 2005-01-04 Conopco, Inc. Production of antibodies or (functionalized) fragments thereof derived from heavy chain immunoglobulins of camelidae
EP0739981A1 (fr) 1995-04-25 1996-10-30 Vrije Universiteit Brussel Fragments variables d'immunoglobulines-utilisation thérapeutique ou vétérinaire
WO1999023221A2 (fr) 1997-10-27 1999-05-14 Unilever Plc Proteines multivalentes de fixation de l'antigene
EP1002861A1 (fr) 1998-10-26 2000-05-24 Unilever Plc Protéines se liant aux antigènes comprenant un liant conférant une flexibilité conformationnelle limitée
WO2002002781A1 (fr) * 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Proteines de fusion heterodimeres
ATE513854T1 (de) * 2000-12-13 2011-07-15 Bac Ip B V Proteinraster aus variablen domänen der schweren immunoglobulinkette von kamelen
GB0110029D0 (en) * 2001-04-24 2001-06-13 Grosveld Frank Transgenic animal
US7371849B2 (en) * 2001-09-13 2008-05-13 Institute For Antibodies Co., Ltd. Methods of constructing camel antibody libraries
JP2005289809A (ja) * 2001-10-24 2005-10-20 Vlaams Interuniversitair Inst Voor Biotechnologie Vzw (Vib Vzw) 突然変異重鎖抗体
EP1600459A3 (fr) 2002-06-28 2005-12-07 Domantis Limited Ligand
GB0230203D0 (en) * 2002-12-27 2003-02-05 Domantis Ltd Fc fusion
WO2004087757A2 (fr) * 2003-04-03 2004-10-14 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Produits therapeutiques a capacite amelioree d'immunomodulation de fonctions cellulaires
EP1544215A1 (fr) * 2003-12-17 2005-06-22 Institut National De La Sante Et De La Recherche Medicale (Inserm) Fragments d'anticorps humains anti-idiotypiques imitant l'antigène Her-2/neu
WO2005075515A2 (fr) * 2004-02-06 2005-08-18 Unilever N.V. Immunoglobulines et leur procede de modification
FR2879204B1 (fr) * 2004-12-15 2007-02-16 Lab Francais Du Fractionnement Anticorps cytotoxique dirige contre les proliferations hematopoietiques lymphoides de type b.
FR2879605B1 (fr) * 2004-12-16 2008-10-17 Centre Nat Rech Scient Cnrse Production de formats d'anticorps et applications immunologiques de ces formats
FR2894584A1 (fr) * 2005-12-09 2007-06-15 Centre Nat Rech Scient Nouveaux peptides et leurs applications biologiques

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020155604A1 (en) * 1998-02-19 2002-10-24 Jeffrey A. Ledbetter Compositions and methods for regulating lymphocyte activation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MÜLLER KM ER AL: "The first constant domain (CH1 and Cl) of an antibody used as heterodimerization domain for bispecific miniantibodies", FEBS LETTER, vol. 422, 1998, pages 259 - 264, XP002343701 *

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10167345B2 (en) * 2010-12-30 2019-01-01 Daniel Baty Antigen binding formats for use in therapeutic treatments or diagnostic assays
WO2012089814A1 (fr) 2010-12-30 2012-07-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Formats de liaison à l'antigène destinés à être utilisés dans des traitements thérapeutiques ou des dosages diagnostiques
US9598499B2 (en) 2010-12-30 2017-03-21 Institut National De La Santé Et De La Recherche Médicale (Inserm) Antigen binding formats for use in therapeutic treatments or diagnostic assays
CN102229671B (zh) * 2011-06-07 2013-04-10 南京医科大学 抗IMMT全人源Fab抗体及其在制备抗肝癌药物中的应用
CN102229671A (zh) * 2011-06-07 2011-11-02 南京医科大学 抗IMMT全人源Fab抗体及其在制备抗肝癌药物中的应用
EP2847230B1 (fr) * 2012-05-10 2020-08-12 Zymeworks Inc. Constructions hétéromultimères de chaînes lourdes d'immunoglobulines comprenant des mutations dans le domaine fc
US12060436B2 (en) 2012-11-28 2024-08-13 Zymeworks Bc Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
WO2015124588A1 (fr) 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques pour le traitement de maladies induites par la voie de signalisation du complexe nrp-1/obr
US10519234B2 (en) 2014-06-27 2019-12-31 Innate Pharma NKp46 binding proteins
US11845795B2 (en) 2014-06-27 2023-12-19 Innate Pharma NKp46 binding proteins
US11208480B2 (en) 2014-06-27 2021-12-28 Innate Pharma Multispecific antigen binding proteins
WO2016189091A1 (fr) 2015-05-26 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques (inhibiteurs de ntsr1) pour le traitement de carcinomes hépatocellulaires
WO2016189118A1 (fr) 2015-05-28 2016-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Méthodes de pronostic et de traitement de patients atteints de leucémie myéloïde aiguë
US12252543B2 (en) 2015-06-23 2025-03-18 Innate Pharma Multispecific NK engager protein
WO2016207278A1 (fr) 2015-06-23 2016-12-29 Innate Pharma Protéines d'engageur nk multispécifiques
US11267897B2 (en) 2015-06-23 2022-03-08 Innate Pharma Multispecific NK engager protein
WO2017081190A1 (fr) 2015-11-13 2017-05-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique anti-nkg2d et utilisations de ceux-ci
WO2018090052A1 (fr) * 2016-11-14 2018-05-17 Amgen Inc. Protéines de liaison à l'antigène bispécifiques ou biparatopiques et utilisations de celles-ci
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
WO2020120644A1 (fr) 2018-12-13 2020-06-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Nouvel anticorps à domaine unique d'épitope dirigé contre tau svqivykpv
WO2020254619A1 (fr) 2019-06-20 2020-12-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique conformationnels anti-protéase nexine-1 et utilisations associées
WO2021116119A1 (fr) 2019-12-09 2021-06-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps présentant une spécificité pour her4 et leurs utilisations
EP4130046A4 (fr) * 2020-03-31 2024-04-24 Biotheus Inc. Plateforme de construction d'un anticorps multispécifique
WO2022002880A1 (fr) 2020-06-29 2022-01-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Anticorps à domaine unique anti-protéine s et polypeptides les comprenant
US11692039B2 (en) 2020-12-31 2023-07-04 Innate Pharma Multifunctional natural killer (NK) cell engagers binding to NKp46 and CD123
WO2022144836A1 (fr) 2020-12-31 2022-07-07 Sanofi Agents d'activation de cellules tueuses naturelles (nk) multifonctionnels se liant à nkp46 et cd123
WO2022180271A1 (fr) 2021-02-26 2022-09-01 LAVA Therapeutics N.V. Anticorps se liant à des récepteurs des lymphocytes t cd123 et gamma-delta
WO2022258673A1 (fr) 2021-06-09 2022-12-15 Innate Pharma Anticorps multispécifiques se liant à cd20, nkp46, cd16 et conjugués à il-2
WO2023014863A1 (fr) 2021-08-05 2023-02-09 Go Therapeutics, Inc. Anticorps anti-glyco-muc4 et leurs utilisations
WO2023034569A1 (fr) 2021-09-03 2023-03-09 Go Therapeutics, Inc. Anticorps anti-glyco-cmet et leurs utilisations
WO2023034571A1 (fr) 2021-09-03 2023-03-09 Go Therapeutics, Inc. Anticorps anti-glyco-lamp1 et leurs utilisations
WO2023037333A1 (fr) 2021-09-13 2023-03-16 Janssen Biotech, Inc Anticorps multispécifiques cd33 x vδ2 pour traiter le cancer
WO2023067138A1 (fr) 2021-10-21 2023-04-27 LAVA Therapeutics N.V. Utilisations d'anticorps d'activation de lymphocytes t gamma delta
US12195555B2 (en) 2022-05-27 2025-01-14 Sanofi Natural killer (NK) cell engagers binding to NKp46 and BCMA variants with Fc-engineering
EP4285926A1 (fr) 2022-05-30 2023-12-06 LAVA Therapeutics N.V. Traitement combiné de la leucémie lymphocytaire chronique
WO2023232805A1 (fr) 2022-05-30 2023-12-07 LAVA Therapeutics N.V. Polythérapie contre la leucémie lymphoïde chronique
WO2024200573A1 (fr) 2023-03-27 2024-10-03 LAVA Therapeutics N.V. Agents de liaison à la nectine-4 et méthodes d'utilisation
EP4438624A1 (fr) 2023-03-27 2024-10-02 LAVA Therapeutics N.V. Anticorps se liant aux récepteurs des lymphocytes t nectin-4 et gamma-delta
WO2024224313A1 (fr) 2023-04-24 2024-10-31 Sanofi Utilisation d'un recruteur de cellules nk cd123 pour traiter une lam et des troubles associés
WO2024251884A1 (fr) 2023-06-09 2024-12-12 Innate Pharma Protéines d'activation de cellules nk comprenant un anticorps anti-cd20 et ant-nkp46, liées à il-2 dans le traitement de lnh-b r/r
WO2025012118A2 (fr) 2023-07-07 2025-01-16 LAVA Therapeutics N.V. Agents de liaison à 5t4 et méthodes d'utilisation
WO2025012704A1 (fr) 2023-07-13 2025-01-16 Sanofi Thérapie combinée par cellules tueuses naturelles et engageurs de cellules nk cd123
WO2025114919A1 (fr) 2023-11-28 2025-06-05 Sanofi Polythérapie par activation de cellules tueuses naturelles multifonctionnelles (nk) pour le traitement de troubles néoplasiques hématologiques
WO2025132833A1 (fr) 2023-12-20 2025-06-26 Institut National de la Santé et de la Recherche Médicale Anticorps à domaine unique anti-trypsine-3
WO2026055280A1 (fr) 2024-09-04 2026-03-12 Sanofi Polythérapie associant des agents engageant les cellules nk anti-cd123 et l'interleukine 2 (il-2)

Also Published As

Publication number Publication date
EP2433965A2 (fr) 2012-03-28
EP3187505B1 (fr) 2019-07-31
EP3187505A1 (fr) 2017-07-05
US20090202979A1 (en) 2009-08-13
JP5026279B2 (ja) 2012-09-12
CA2590615C (fr) 2015-03-31
EP1824884A1 (fr) 2007-08-29
ES2627607T3 (es) 2017-07-28
EP1824884B1 (fr) 2015-05-13
ES2544237T3 (es) 2015-08-28
FR2879605A1 (fr) 2006-06-23
US10385137B2 (en) 2019-08-20
US20160083476A1 (en) 2016-03-24
EP2433965B1 (fr) 2017-03-15
JP2008523795A (ja) 2008-07-10
FR2879605B1 (fr) 2008-10-17
US9169316B2 (en) 2015-10-27
CA2590615A1 (fr) 2006-06-22
EP2433965A3 (fr) 2013-03-20
ES2751006T3 (es) 2020-03-30

Similar Documents

Publication Publication Date Title
EP2433965B1 (fr) Production de formats d&#39;anticorps et applications immunologiques de ces formats
JP6392923B2 (ja) Muc1*抗体
Jain et al. Engineering antibodies for clinical applications
Muyldermans Nanobodies: natural single-domain antibodies
André et al. In vivo Phage Display: A promising selection strategy for the improvement of antibody targeting and drug delivery properties
Thie et al. Rise and fall of an anti-MUC1 specific antibody
US7371849B2 (en) Methods of constructing camel antibody libraries
Baral et al. Single‐domain antibodies and their utility
CN113321734B (zh) 抗cd47/抗pd-l1抗体及其应用
Aires da Silva et al. Recombinant antibodies as therapeutic agents: pathways for modeling new biodrugs
CN111492243B (zh) 用于新颖抗原结合模块的特异性测试的car-t细胞测定法
CN112118892A (zh) Cd79特异性嵌合抗原受体
CA2877446A1 (fr) Anticorps diriges contre des cibles hautement conservees
WO2015053381A1 (fr) Anticorps anti-podoplanine
TWI690539B (zh) 一個需依賴標靶細胞使T細胞接合及活化之不對稱異二聚Fc-ScFv融合抗體形式及其在癌症治療上之應用
WO2001030393A2 (fr) Procedes permettant de reduire les effets des cancers exprimant l&#39;antigene a33 a l&#39;aide d&#39;immunoglobulines specifiques de l&#39;antigene a33
Toleikis et al. Cloning single-chain antibody fragments (ScFv) from hyrbidoma cells
Loo et al. Antibody engineering principles and applications
Christensen et al. Modifying antibody specificity by chain shuffling of VH/VL between antibodies with related specificities
CA3113116C (fr) Anticorps intracellulaires permettant de reduire l&#39;activite de fut8
CN119798442A (zh) 特异性结合cd39的纳米抗体及其用途
Zamboni Design of human single chain fragments for antibody direct enzyme prodrug therapy (ADEPT)
MEDICA et al. " TOR VERGATA
HK40038628A (en) Diagnostic assays to detect tumor antigens in cancer patients
HK40035031A (en) Car-t cell assay for specificity test of novel antigen binding moieties

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2590615

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007546119

Country of ref document: JP

Ref document number: 2005826565

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWP Wipo information: published in national office

Ref document number: 2005826565

Country of ref document: EP