WO2006060839A2

WO2006060839A2 - Method for identifying ppt inhibitors

Info

Publication number: WO2006060839A2
Application number: PCT/AT2005/000500
Authority: WO
Inventors: Gerhard Adam; Michaela Peruci; Rudolf Mitterbauer; Franz Berthiller; Marc Lemmens
Original assignee: Universität Für Bodenkultur Wien
Priority date: 2004-12-10
Filing date: 2005-12-12
Publication date: 2006-06-15
Also published as: WO2006060839A3

Abstract

The present invention relates to a method for the identification of inhibitors of a phosphopantetheinyl transferase comprising the steps: providing a cell producing at least one polyketide synthase (PKS) or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and producing a phosphopantetheinyl transferase (PPT), wherein said phosphopantetheinyl transferase activates said polyketide synthase (PKS) or said nonribosomal peptide synthase (NRPS), contacting said cell with a potential inhibitor, and determining the inhibitory effect of said potential inhibitor by comparing the concentration of said secondary metabolite prior and after contacting said enzymes with the potential inhibitor.

Description

Method for identifying PPT inhibitors

The present invention relates to a method and means for the identification of inhibitors of phosphopantetheinyl transferases of the primary and secondary metabolisms.

Microbial pathogens of plants and animals frequently produce secondary metabolites which are relevant as virulence factors. Two major groups of biosynthetic genes are very important for production of the enormous diversity of microbial secondary metabolites (Cane D.E. et al. , Science (1998), 282:63-68): a) genes encoding polyketide synthases (PKSs) , b) genes encoding nonribosomal peptide synthases (NRPS) . In addition also mixed type NRP/PKSs genes exist (Du L. et al., Metab. Eng. (2001), 3:78-95).

The enzymes encoded are in essence multimodular assembly lines (Schwarzer D. and Marahiel M.A., Naturwissenschaften (2001) 88:93-101) having acyl-carrier protein domains (ACP) in case of PKSs (Fig. 1) and peptidyl carrier protein (PCP) domains (Fig. 2) in case of NRPSs interspersed among the catalytic domains. The PCP and ACP domains are post-translationally activated by dedicated phosphopantetheinyl transferases (PPT) that attach the essential 4'-phosphopantetheine prosthetic group providing the terminal free thiol (Mootz H.D. et al., J. Biol. Chem. (2001) ,276:37289-37298) . The reaction is depicted in more detail in Fig. 3.

Phosphopantetheinyl transferases are not only involved in the secondary metabolism of organisms producing secondary metabolites but also in the primary metabolism e.g. in the fatty acid biosynthesis. For instance, in bakers yeast which is devoid of PKS or NRPS genes, PPT activity is needed for fatty acid biosynthesis, activation of mitochondrial ACP and for lysine biosynthesis. The fatty acid synthase {FAS2 gene: NCBI Ace. No. Z73587) contains a PPT domain for autoactivation. The mitochondrial ACP is activated by the PPT2 gene product which is required for respiration only (NCBI Ace. No. Y16253) . A dedicated PPT (LYS5 gene product) is required for lysine biosynthesis, which converts the inactive apo-form of Lys2p (alpha-aminoadip- ate reductase) into the active enzyme.

Mammalian or plant PPTases exist, but highly diverge from fungal proteins and have different roles. Plants use type III poly- ketide synthases without acyl-carrier protein for production of polyketides. Therefore, for instance, a fungal PPTase inhibitor should not affect the ability of plants to produce secondary metabolites.

Humans are lysine auxotrophs, but use a phosphopantetheinyl- transferase activated α-aminoadipic semialdehyde dehydrogenase in lysine catabolism (Mootz H.D. et al. , J. Biol. Chem.

(2001) ,276:37289-37298) . This broad specificity enzyme is supposedly also necessary for activation of the ACP for cytosolic fatty acid biosynthesis and for activation of mitochondrial ACP

(Joshi A.K., J Biol Chem. 2003, 278:33142-9)

The filamentous fungus Fusarium graminearum {Gibberella zeae) , is an agriculturally important plant pathogen - and as many other Fusarium species - a notorious producer of toxins. Yet, currently only a limited number of metabolites causing problems in humans and animals (mycotoxins) are investigated, very little is known about other substances which most likely have a role in disease development on the host plant. Since secondary metabolites, such as toxins, are produced in most of the cases by poly- ketide synthases (PKSs) and nonribosomal peptide synthases (NRPS) , which are activated by phosphopantetheinyl transferases (PPT) , these enzymes may represent suitable targets for inhibitors. However, also the inhibition of phosphopantetheinyl transferases of other organisms affecting their primary metabolisms may be of practical value, because the primary metabolism is required for the survival of the organism, whereas the secondary metabolism is not as much essential for the organism. Therefore, the inhibition of phosphopantetheinyl transferases of the primary metabolism will lead to the killing of the affected organism.

In the WO 03/080828 the synthesis of melithiazols (polyketides) with improved pharmacological properties by polyketide and non ribosomal peptide synthases, which are activated by phospho- pantetheinyl transferase, is described.

The WO 1997/013845 relates to methods for determining the activity of phosphopantetheinyl transferases by monitoring the transfer of a phosphopantetheinyl group to a radioactively labelled substrate. In addition also methods for the identification of phosphopantetheinyl transferase inhibitors by contacting said transferase with potential inhibitors and monitoring the transfer of a phosphopantetheinyl group are disclosed.

In the WO 2002/077179 the synthesis of leinamycin is disclosed.

The WO 2000/042214 relates to methods for determining the inhibition of an enzyme by contacting said enzyme to a potential inhibitor, whereby the enzyme produces phosphate or pyrophosphate.

The WO 2000/017387 relates to method for the identification of phosphopantetheinyl transferase inhibitors, wherein said inhibition is determined by measuring the activity of said transferase catalysing the pyrophosphate dependent cleavage of dephos- phocoenzyme A producing ATP and phosphopantetheinyl.

In the US 2003/0138879 Al a method for the determination of the activity of PPTs activating PKS and/or NRPS as well as methods for the identification of potential PPT inhibitors are disclosed. In this document the phosphopantetheinylation (catalyzed by a PPT) of protein substrates (PKS and/or NRPS) is determined in vitro and in vivo by using radioactively labelled CoA.

It is an object of the present invention to provide means and methods for the identification of inhibitors of phosphopantetheinyl transferases, which are responsible for the activation of enzymes of the primary (e.g. fatty acid biosynthesis) and the secondary (e.g. secondary metabolite biosynthesis) metabolism of an organism, whereas the use of radioactively labelled substances should be avoided. Another object of the present invention is to provide a method for the determination of the specificity of phosphopantetheinyl transferases towards polyketide synthases and nonribosomal peptide synthases. Therefore, the present invention provides a method for the identification of inhibitors of phosphopantetheinyl transferases comprising the steps:

- providing a cell producing at least one polyketide synthase (PKS) or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and producing a phosphopantetheinyl transferase (PPT) of a secondary metabolism, wherein said phosphopantetheinyl transferase activates said polyketide synthase (PKS) or said nonribosomal peptide synthase

(NRPS) ,

- contacting said cell with a potential inhibitor, and

- determining the inhibitory effect of said potential inhibitor by comparing the concentration of said secondary metabolite prior and after contacting said enzymes with the potential inhibitor.

According to the present invention a PPT of a secondary or primary metabolism, which is able to activate a PKS or a NRPS producing a detectable amount of secondary metabolites when activated, is contacted with a potentially inhibiting substance or substance composition. The quantification of secondary metabolites occurs in different ways/methods depending on the physico- chemical properties of said metabolites. For instance, the presence of a toxin (e.g. zearalenone, aflatoxin) may be tested by the inhibition of organisms or the presence of colouring metabolites (e.g. rubrofusarin/aurofusarin) with a photometer. Of course also other analytical methods known to the person skilled in the art may be employed to identify the secondary metabolite produced.

The PPT used in a method according to the present invention has to be able to activate PKS or NRPS. To determine such an enzymatic acticity several methods are known to the person skilled in the art. For instance, Mootz H.D. et al. (J. Biol. Chem. (2001), 276:37289-37298) describe a method were radioactively labelled CoA is employed to follow the activation of PKS or NRPS by a PPT. Also the method according to the present invention may be used to determine the activation of PKS or NRPS, which produce a secondary metabolite when activated. Of course in such a case the method step contacting said cells with potential inhib- itors has to be left away.

All methods known in the state of the art, which were employed to determine such activity in an in vitro phosphopantetheinyla- tion assay, use radioactively labelled CoA, which is transferred to PKS or NRPS by a PPT (comparable to Mootz H.D. et al. and US 2003/0138879 Al) . However, radioactively labelled CoA is not required when using the method according to the present invention, because the activation of PKS and NRPS is indirectly measured by the production of secondary metabolites, which can be easily detected by standard laboratory methods. Furthermore the proteins (enzymes) used in some of these methods have to be expressed separately, whereas in the assay according to the present invention the corresponding enzymes may be expressed simultaneously in one single cell. Therefore, the method according to the present invention may also be used to determine the activity and/or the specificity of PPT in activating distinct PKS and NRPS.

The inhibitory effect of a substance being a potential inhibitor can easily be determined by comparing the PPT activity prior to the addition of said substance with the PPT activity after the addition of said substance. The PPT activity is determined by measuring the production of a secondary metabolite produced by PKS or NRPS, which are activated by said PPT.

Several plant or microbe derived compounds are described in the literature which downregulate PKS genes for aflatoxin biosynthesis at the transcription level in an unknown way (e.g. aflastatin, uncharacterised substances in black pepper) . Since it is conceivable that the accumulating apo-protein leads to a feedback inhibition of PKS gene transcription and consequently to a reduced secondary metabolite production, plant extracts may be prime candidates for PPT inhibitors. Of course not only plant extracts may be potential inhibitors but also other substances of natural or artificial origin may be used in a method according to the present invention in order to identify inhibitors for phosphopantetheinyl transferases.

Secondary metabolites of e.g. microorganisms like fungi or bac- teria are often toxic to higher organisms such as animals, humans or plants. As already outlined above the production of these secondary metabolites involves synthases (polyketide or nonribosomal peptide synthases) which are activated by phospho- pantetheinyl transferases. Therefore phosphopantetheinyl transferase responsible for the activation of the corresponding synthases may be a preferred target of inhibitors. Nevertheless also phosphopantetheinyl transferases involved in the primary metabolism and therefore essential for the survival of organisms may be used in the method according to the present invention. Such inhibitors would show an even more enhanced effectivity, because organisms contacted with an inhibitor affecting phosphopantetheinyl transferases of primary metabolims would not survive such a treatment. However, substances affecting the primary metabolism may be evaluated carefully, in order to prove their specificity so that they are not affecting other organisms (e.g. plants, animals) .

The method according to the present invention may involve the synthases and transferase mentioned above in a cell free system, where all reactants are added to said enzymes. Such a method for screening for inhibitors may be used comparable to a system for in vitro translation of proteins (e.g. US 5,478,730). Such a method requires that the corresponding enzymes are expressed (homologously or heterologously) in a suitable host and optionally purified. However, the use of a microbial cell harbouring all the enzymes and substances required to perform the method according to the present invention is preferred, because the handling of cells is in practice easier since the single proteins have not to be purified in a further isolation step.

According to another preferred embodiment said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) are of microbial, preferably of fungal, of yeast or of bacterial origin.

According to the present invention "origin" refers to the original source of the DNA/cDNA sequence encoding for said enzymes. For instance, a synthase of fungal origin is originally taken from a fungus, potentially amplified by a nucleic acid amplific- ation step, cloned into a vector and finally transferred to a host carrying said vector. However, since the DNA (i.e. nucleic acid sequence) encoding the respective enzyme in the vector is the same as in the original fungal source, the DNA and the enzyme encoded by said DNA, will be considered to be of fungal "origin".

Since mainly microorganisms produce secondary metabolites also the enzymes to be used in a method according to the present invention are originating from said microorganisms. Furthermore many of the secondary metabolites produced by these microorganisms are easily detectable by standard chemical or biochemical methods.

Filamentous fungi are well known as producers of secondary meta- bolits, for example the Aspergillus parasiticus PKSLl (Ac. Number L42765) geneproduct involved in aflatoxin biosynthesis, (Feng et. al., J. Bacteriol. 177 (1995) 6246-6254), the Penicil- lium patulum MSA synthase (Beck et. al., Eur J Biochem. 1990 Sep 11;192 (2) :487-98) is responsible for the production of patulin. HPLC and TLC methods are standard methods for the detection and determination of fungal compounds in agricultural and food commodities (Roach et. al., Adv Exp Med Biol. 2002/504:135-40; HoI- comb et al., J. Chromatogr., A 1992, 624, 341-352; Garcia-Villan- ova et al. J. Agric. Food Chem. 2004, 52, 7235-7239). Aspergillus niger and Aspergillus nidulans produces yellow and green pigments by means of a polyketide synthase (wA gene, Mayorga et. al., Genetics 126 (1990) 73-79 (Ac. Number X65866) ) whose disruption easily can be detected by visible selection of green/white spore pigmentation.

According to the present invention phosphopantetheinyl transferases of all known organism, preferably of microbial origin, may be employed in a method as outlined in this specification, provided that such a phosphopantetheinyl transferase is able to activate a polyketide synthase (PKS) or a nonribosomal peptide synthase (NRPS) synthesising the respective secondary metabolite (i.e. phosphopantetheinyl transferases of the primary metabolism of an organism may also be used in a method according to the present invention with synthases of the secondary metabolism of another organism) . To test if a phosphopantetheinyl transferase is able to activate a polyketide synthase (PKS) or a nonri- bosomal peptide synthase (NRPS) the method according to the present invention may be used (alternatively see also e.g. Mootz H.D. et al., J. Biol. Cheiri. (2001) ,276:37289-37298) . If a secondary metabolite is produced by its respective synthases, which were activated by a phosphopantetheinyl transferase, this enzyme system may be suited to be used to test potential inhibitors for said phosphopantetheinyl transferase.

Preferably said polyketide synthase (PKS) and/or said nonri- bosomal peptide synthase (NRPS) are originating from a microorganism selected from the group consisting of Aspergillus fumig- atus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudo- graminearum, Fusarium cerealis, Botrytis cinerea and Alternaria alternate.

Especially Fusarium graminearum and Aspergillus fumigatus are well known pathogens which produce a wide range of toxins (e.g. zearalenone, biosynthesis Fig. 4) affecting the health of animals, humans and plants, and other secondary metabolites (e.g. pigment formation, rubrofusarin) . Most of these secondary metabolites are produced by polyketide synthases (PKS) or nonri- bosomal peptide synthases (NRPS) , which are activated by a phosphopantetheinyl transferase (PPT) . These secondary metabolites are generally easily detectable by simple analytical (e.g. HPLC, photometry, NMR) or biochemical/microbiological methods (e.g. Mitterbauer R. et al. , Appl. Environ. Microbiol., 2003, 69:805- 11) .

According to a preferred embodiment said polyketide synthases (PKS) are PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2, SEQ ID No. 5), synthesising the secondary metabolite zearalenone.

The PKS genes of Fusarium graminearum mentioned herein have been identified by annotation of the Fusarium graminearum genome performed by MIPS http: //mips.σsf.de/qenre/proj/fusarium/Search/in- dex.html. The corresponding entries for the predicted genes are listed below in table 1. Tablel: PKS genes referring to the MIPS entry

Both of these synthases are found in Fusarium graminearum and are responsible for the biosynthesis of zearalenone. If only one of these synthases is not activated by a phosphopantetheinyl transferase (PPT) zearalenone will not be produced. The inhibition of the zearalenone biosynthesis can be monitored by biochemical methods (e.g. Mitterbauer R. et al., Appl. Environ. Microbiol., 2003, 69:805-11) or an analytical method (e.g. HPLC) . Therefore not only the transferase activating the respective synthases may be a suitable inhibitor target, but also the synthases themselves.

Preferably said polyketide synthase (PKS) is PKS116 (SEQ ID No. 3) , which is responsible for the biosynthesis of the secondary metabolite aurofusarin/rubrofusarin.

These secondary metabolites are responsible for the colouring of Fusarium graminearum. Therefore the synthesis of this metabolite can easily be monitored by photometrical/optical methods. Since high through put screening methods are often used in combination with a photometer, the monitoring of aurofusarin/rubrofusarin production can be ideally employed in the course of such screenings.

According to a preferred embodiment of the present invention the phosphopantetheinyl transferase is originating from a microorganism selected from the group consisting of Aspergillus fumig- atus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudo- graminearum, Fusarium cerealis, Botrytis cinerea and Alternaria alternata.

Since many toxins are produced by fungi, phosphopantetheinyl transferases of such organisms may be used in a method according to the present invention, because especially these transferases are suitable targets for inhibitors repressing the synthesis of secondary metabolites.

Preferably said phosphopantetheinyl transferase (PPT) is PPTl (SEQ ID No. 4) of Fusarium graminearum or PPT of Aspergillus fu- migatus.

The PPT of A. fumigatus was first described by Keszenman-Pereyra et al., (Curr Genet. 2003 Jun;43 (3) :186-90) , by a BLAST search with the sfp protein from Bacillus subtilis against the A. fumigatus genome database (http: //www.tigr♦orq/tdb/e2kl/aful/) . The surfactin synthetase enzyme (sfp) is the prototyp of the PPT superfamily (Reuter et. al., EMBO J. 1999 Dec 1;18 (23) : 6823-31. )

The PPTl transferase of Fusarium graminearum activates the synthases for the production of aurofusarin/rubrofusarin and zear- alenone and the PPT transferase of Aspergillus fumigatus activates the enzymes for the synthesis of siderophore and gliotoxin (Schrettl M. et al., J. Exp. Med. 2004, 200:1213-1219). Therefore the method according to the present invention may especially be useful for the identification of inhibitors for phosphopantetheinyl transferases in Fusarium graminearum and Aspergillus fumigatus, which are able to activate the synthases responsible for the biosynthesis of secondary metabolites, preferably zearalenone, aurofusarin/rubrofusarin, siderophore and gliotoxin, respectively. Other PPT suited to be used in a method accord to the present invention may be obtained or identified by alignments (e.g. Fig. 12) or by publicly accessible data bases (e.g. NCBI, EMBL)

According to a preferred embodiment of the present invention said cell is a microorganism, preferably a yeast, a fungus or a bacterium.

Especially microorganisms may be suitably used in a method according to the present invention.

According to another preferred embodiment of the present invention said cell is selected from the group consisting of Fusarium graminearum, Aspergillus fumigatus and Saccharomyces cerevisiae. Preferably a DNA/cDNA sequence encoding said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) is recombinantely introduced into said cell.

Using genetic engineering a DNA/cDNA sequence (cDNA is obtained by reverse transcription of mRNA) encoding a polyketide synthase, a nonribosomal peptide synthase and a phosphopantetheinyl transferase cloned into a vector, preferably a bacterial, a fungal, a yeast or hybrid vector (e.g. fungal-bacterial or yeast-fungal vector), may be introduced into said cell. Furthermore said vectors are preferably expression vectors. Said DNA/cDNA sequences may be present in one single or in different vectors. The methods and the plasmids required for the cloning of said DNA/cDNA sequences are disclosed in the prior art or available from commercial suppliers of vectors.

According to another preferred embodiment a DNA/cDNA sequence encoding said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) is recombinantely introduced into the chromosomal and/or episomal DNA of said cell.

The introduction of said DNA/cDNA into the chromosomal and/or episomal DNA of a host (e.g. by recombination events) results in an even better expression system because DNA integrated into the genomic DNA of an organism is generally much more stable compared to plasmids. Therefore said DNA/cDNA sequences are preferably integrated in the genomic DNA.

Another aspect pf the present invention relates to a pesticide composition, preferably a fungicide or a bactericide, comprising an inhibitor obtainable by a method according to the present invention.

A phosphopantetheinyl transferase (PPT) inhibitor identified by the method disclosed herein may be used in a pesticide composition. In addition other substances which are regularly used in pesticides may be mixed to the identified inhibitor. Without the production of secondary metabolites, pathogens, e.g zearalenone producing Fusarium graminearum and siderophore producing Aspergillus fumigatus, are less virulent. Therefore, the identification of inhibitors reducing the activity of phosphopantetheinyl transferase, which activates polyketide synthases or nonri- bosomal peptide synthases responsible for the production of secondary metabolites, may be useful as active compound in a pesticide. The inhibitor identified by a method according to the present invention should not affect plants, animals, humans or other organisms when used as pesticide against toxin producing organisms. Therefore the method of the present invention may also be used to screen PPT of these organisms in order to determine if the inhibitor is also capable to inhibit said PPTs. The PPT of plants, animals, humans or other organisms (e.g. microorganisms) may only be screened with the method according to the present invention if the PKS or NRPS producing secondary metabolites is also activated by a PPT of said organisms.

Another aspect of the present invention relates to a vector comprising DNA/cDNA sequence encoding at least one polyketide synthase (PKS) and/or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and DNA/cDNA sequence encoding at least one phosphopantetheinyl transferase (PPT) .

"Vector" according to the present invention refers to known vectors, which may be used for expressing proteins encoded on these vectors in a host. Optionally these vectors may be suited to be integrated in the genomic DNA of said host. "Vector" includes bacterial, eukaryotic, yeast, fungal and hybrid vectors. The DNA/cDNA may be cloned into these vectors by regular laboratory methods. Such a vector may be introduced (i.e. by transformation, conjugation or transfection) into a host used in a method according to the present invention. A single vector transformed into a cell/host may harbour all enzymes required for the biosynthesis of the secondary metabolites or, alternatively, said enzymes are distributed on more than one vector.

Preferably said DNAs/cDNAs are of microbial origin, preferably of fungal, of yeast or of bacterial origin. According to another preferred embodiment said DNAs/cDNAs are originating from a microorganism selected from the group consisting of Aspergillus fumigatus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudograminearum, Fusarium cerealis, Botryt- is cinerea and Alternaria alternata.

According to a preferred embodiment said polyketide synthase (PKS) is PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2, SEQ ID No. 5) or PKS116 (SEQ ID No. 3) and combinations thereof.

Preferably said vector is an expression vector or integration or episomal vector.

Another aspect of the present invention relates to a vector system comprising:

- a vector comprising a DNA/cDNA sequence encoding at least one polyketide synthase (PKS) and/or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and

- a vector comprising a DNA/cDNA sequence encoding at least one phosphopantetheinyl transferase (PPT) .

The vector system of the present invention may be introduced in a host in order to allow expressing of the corresponding enzymes encoded on these vectors. The main advantage of this vector system is the flexible handling of the vectors when using them in a method according to the present invention. For instance, it is possible to introduce in a first step the vector comprising a DNA/cDNA sequence encoding the polyketide synthase or the nonribosomal peptide synthase and consequently isolating single clones which may be transformed with various vectors comprising DNA/cDNA sequences encoding phosphopantetheinyl transferases of several organisms.

Preferably said DNAs/cDNAs are of microbial origin, preferably of fungal, of yeast or of bacterial origin.

According to a preferred embodiment said DNAs/cDNAs are originating from a microorganism selected from the group consisting of Aspergillus fumigatus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudograminearum, Fusarium cerealis, Botrytis cinerea and Alternaria alternate.

According to another preferred embodiment said polyketide synthase (PKS) is PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2, SEQ ID No. 5) or PKS116 (SEQ ID No. 3) .

Preferably said vectors are expression vectors or integration or episomal vectors.

Another aspect of the present invention relates to a cell comprising a vector or a vector system according to the present invention.

Preferably the cell is a microorganism, preferably a yeast, a fungus or a bacterium.

According to a preferred embodiment said cell is selected from the group consisting of Fusarium graminearum, Aspergillus fumig- atus and Saccharomyces cerevisiae.

Preferably said vector or said vectors are integrated into the chromosomal and/or episomal DNA of said cell.

Another aspect of the present invention relates to a kit for the identification of inhibitors of phosphopantetheinyl transferases of secondary metabolisms comprising

- a cell, preferably a yeast, a fungus or a bacterium cell, and

- a vector or vector system according to the present invention.

A kit according to the present invention may be used to establish a test system for screening for substances inhibiting phosphopantetheinyl transferases. The phosphopantetheinyl transferases, which are provided already cloned into a vector (of the vector system) or have to be cloned in a vector by the user, are co-expressed in a cell with the polyketide synthase (s) or the nonribosomal peptide synthase (s) producing a secondary metabolite, when activated by said phosphopantetheinyl transferase (s) . Another aspect of the present invention relates to the use of PKS118 (Seq ID No. 1) and PKS119 (Seq ID No. 2, SEQ ID No. 5) of Fusarium graminearum as zearalenone biosynthetic polyketide synthases.

Both PKS118 and PKS119 are responsible for the biosynthesis of zearalenone in Fusarium graminearum. Therefore one or both of these PKS may be used as targets for inhibiting the production of zearalenone or to be knocked out to create zearalenone deficient Fusarium mutants. The sequences may be further used for the identification of PKS or NRPS responsible for the biosynthesis of other toxins in other organisms (via sequence alignments followed by deletion studies) .

The present invention is further illustrated by the following figures and examples without being restricted thereto.

Fig. 1 shows the functionality of acyl carrier domain (ACP) in polyketide synthases (PKSs) . The flexible phosphopantetheinyl arm of the acyl-carrier protein (ACP) is loaded with the chain extender (either malonyl-CoA (R=H) or methylmalonyl-CoA (R=CH3) derived) . The acyl residue of a starter unit or the previous chain elongation product is transferred to the active site cysteine of a β-keto-synthase domain (KS) . This enzyme catalyses the decarboxylation of the extender on the ACP and the transfer of the (growing) acyl chain to the next ACP and is also responsible for the substrate specifity.

Fig. 2 shows the functionality of the peptidyl carrier domain (PCP) in non-ribosomal peptide synthases (NRPSs) . The first step in peptide-bond formation by NRPSs is the activation of an amino-acid by the adenylation domain (AD) , which also catalyses the transfer to the flexible phosphopantetheinyl arm of the peptidyl carrier protein (PCP) . The condensation domain (CON) catalyses the nucleophilic attack of the amino-nitrogen of the acceptor aminoacyl-S-PCP on the electrohilic carbonyl carbon of the donor peptidyl-PCP residue.

Fig. 3 shows the reaction catalysed by 4 ^λ-phosphopantetheinyl- transferase [PPTl) : CoA + apo ACP/PCP = holo ACP/PCP + 3 \ 5 ^Λ-ADP

Fig. 4 shows the biosynthetic pathway of zearaleonone.

Fig. 5 shows the disease symptoms on wheat. A single spikelet was inoculated with either wild-type strain PH-I (3 wheat heads left ) , or a pptl gene disruption mutant (right) . While the wild-type spreads through the ear and produces the typical symptoms, these are confinded to the initially inoculated spikelet in case of the mutant.

Fig. 6 shows wild type PHl (expressing rubrofusarin/aurofusarin) and knock out strain 116-4 (showing no expression, white mycelium) on PDA plates.

Fig. 7 shows a HPL.MS/MS profile (A) indicating that both mutants did not produce aurofusarin (B, structural formula) .

Fig. 8 shows the plasmid map of pPPT KO-5 (A) , the disruption by crossover with a hygromysin marker on a KO plasmid (B) and the disruption with two overlapping PCR products (C) .

Fig. 9 shows the cultivation of the PPT inactivation mutant PPPT KO2.1.A (white mycelium, no expression of aurofusarin/rubro- fusarin) in comparison with wildtype PHl (red mycelium, expression of aurofusarin/rubrofusarin) .

Fig. 10 shows the screening for zearalenone production. Extracts of transformants from a fully covered petri dish were tested with the zearalenone sensitive yeast strain YZRM7. Therefore the extracts were added to SC -His - Ura medium and the indicator strain YZRM7, as well as the positive control strain YZGA 376 and the negative control YZGA310 were spottet on the surface. A zearalenone standard dilution series is shown (A) . In (B) trans- formant PPPTKO2 is shown to be zearalenone negative.

Fig. 11 shows an agarose gel of a PCR amplification of genomic DNA of the PPTase knock out strains to ensure the insertion of hygromycin cassette at the desired loci. Lane 1, 7, 13: wildtyp PHl; Lane 2, 8, 14: PPT K02; Lane 3, 9, 15: PPT KO2.2.A; Lane 4, 10, 16: PPT KO 2.1.B; Lane 5, 11, 17: PPT KO 2.1.A; Lane 6, 12, 18: PPT KO 2.2.B.

Fig. 12 shows an alignment of putative fungal PPT (deduced amino acid sequences) : Fusarium graminearum (fgO8779) , Magnaporthe grisae (mg03046.4), Neurospora crassa (ncPPTl, manually annotated), Aspergillus nidulans (an6140.2), Aspergillus fumigatus (atPPTl, manually annotated) . Identical amino acids are shaded grey (100% and 80% idendity) .

Fig. 13 shows the cloning strategy for pksll8.

Fig. 14 shows the cloning strategy for pksll9.

Fig. 15 shows the repair strategy of pksll9 (pks4) fragment 3 in the course of the cloning of pksll9.

Examples:

Example 1: Identification of the polyketide synthase responsible for the pigment formation of Fusarium graminearum

F. graminearum produces pigments on appropriate media (e.g. PDA, potato dextrose agar) . Aurofusarin and rubrofusarin, which cause the orange/red phenotype, were first described in 1937 (Ashley, J.N. et al., Biochemical Journal 31: 385-97 (1937)).The polyketide synthase necessary for production of the polyketides rubrofusarin and aurofusarin was identified by disruption the F. graminearum gene FG02395.1 (PKS116) , resulting in knock out strain PKS116-4.

Disruption of Fusarium graminearum genes has been succesfully shown by Proctor et. al. (MoI Plant Microbe Interact. 1995 JuI- Aug; 8 (4) :593-601) where the trichodien synthase (Tri5) was deleted with a plasmid carrying a doubly truncated copy of the Tri5 coding region interrupted by a hygromycin B resistance gene.

HPL-MS/MS analysis (Fig. 7A) confirmed that the strain with a disrupted FG02395.1 gene does not form aurofusarin (which is the dimerisation product of rubrofusarin, Fig. 7B) . Furthermore, the knock out strain PKS116-4 showed no red color when cultivated on PDA medium in contrast to the wildtype Fusarium gramineaurm strain PHl (Fig. 6) .

Example 2: Identification of phosphopantetheinyl transferase in F. graminearum

By analysing the publicly available genome sequence a F. graminearum gene encoding a phosphopantetheinyl transferase was identified (fgO8779 called PPTl) . The predicted open reading frame is comprised of 2 exons of 99 and 780 nucleotides, which are interrupted by a 51 nt intron. The amino acid sequence of PPTl is disclosed in the enclosed sequence listing (Seq ID No. 4), its corresponding nucleic acid sequence in publicly available data bases.

Example 3: Gene disruption of PPTl in F. graminearum:

Genomic DNA of Fusarium graminearum strain PHl was amplified using primers dPPT fwd (5^-AGTCGAAGTCGAAGAATAATTGAAGTAA-3\ SEQ ID No. 6) and dPPT rev (5^Λ-CATTTAAACACCAGACAATGATGATAAGAAGAAGC-3^Λ, SEQ ID No. 7) , which gave a product of 2054 bp. This fragment was subcloned into a TOPO-4 PCR vector - gPPT3. This plasmid was digested with Hindlll+Xhol and a 2,7 kb Hindlll+Xhol hygromycin kassette of pRLMex30 was inserted. In the resulting plasmid pPPTKO-5 (Fig. 8A) the hygromycin cassette of pRLMex30 is flanked by a DNA region from contig 355 (541 left, 808 right of PPTl) . This plasmid was used for transformations in a linearised (Notl digested) form, or in a cotransformation of two overlapping PCR fragments (see below) .

Fragments used for deletion of PPTase:

(1) dPPT fwd 54,8⁰C 2274 bp hyg Rev 55,9 ⁰C

(2) dPPT rev 54,7 ⁰C 2768 bp hyg fwd 56,2 ⁰C Transformation was done using a protoplasting transformation method. Twelve transformants containing the linear plasmid and six transformants containing the PCR products were screened for white mycelium, lysine auxotrophy and alteration in the zear- alenone synthesis. PCR test was done to ensure the insertion in the PPTase loci.

Screening for white mycelium;

Wildtyp PHl and knock out strain PPTKO2.1.A were plated on PDA and incubated at 24°C (Fig. 9) . Three transformants showed a clear "white" phenotyp in comparision to wild-type PHl: PPPTKO2, PPPTKO5, PPPTKO6.

Lysine auxothrophy:

Radial growth was measured on different media at two time points

(two and five days) . K...Addition of Lysin

Radial growth of PPTase transformants [cm]

nt = not tested fc = fully covered

PHl grew on all tested media except PDA, HyglOO • All transformants did not grow on SNA without added lysine (2 mg/ml) but showed a strong hygromycin resistance on PDA_HyglOo plates.

Screening for zearalenone production

Extracts of transformants from a fully covered petri dish were tested with the zearalenone sensitive yeast strain YZRM7. Therefore the extracts were added to SC -His - Ura medium and the indicator strain YZRM7, as well as the positive control strain YZGA 376 and the negative control YZGA310 were spotted on the surface. A ZON standard dilution was also used. These results indicate that transformant PPPTKO2 is zearalenone negative (Fig. 10) . This result was also confirmed by LC-MS/MS.

PCR amplification of the disrupted PPTase loci

Genomic DNA of the purified PPTase knock out strains were tested with PCR methods to ensure the insertion of hygromycin cassette at the desired loci (Figure 11; PPT-Flank2 rev: 5'-AGTATAACCAG- GCTGACACCAACAAC-3' (SEQ ID No. 8), Tm= 56,6 ⁰C; PPT-Flank2 fwd: 5'-AGAACAAAGAAGATTGAGTAAAGTCGAAGT-S' (SEQ ID No. 9), Tm = 56,4 ⁰C) . Wildtyp PHl showed the original band of 2135 bp. The trans- formants did not yield the wildtype band. Crossing over at both overlapping regions could be shown by amplification of the 2319 bp fragment (left) and the 2804 bp fragment (right) .

A stable hygromycin resistant transformant PPT K02.1.A is disrupted in the 4 '-phosphopantetheinyltransferase locus of the wildtyp PHl. Its mycelium has white colour, the growth of the mutant is lysine dependent. Production of the polyketide zearalenone could also not been detected. This may suggest, that PPTase of contig 355 is a important cofactor in the pigmentation pathway, as well as in the aminoadiapate pathway of lysine synthesis and it is also necessary for the production of secondary PKS metabolites in the fungus Fusarium graminearυm.

Example 4: Heterologous expression of PPTl in yeast

PPTase from contig 355 was cloned from cDNA (3) with specific primer pair (Pl PhosphoT + EcoRI (5'-AGCAAGGAATTCAACAATGAGT- CAGACCCAGTCTTCA-3' , SEQ ID No. 10) and P2 PhosphoT + Kpnl (5'-ACGTTGAGGTACC TCATGAACTGGGCAACCTTTC-3', SEQ ID NO. H)) . The amplified PCR product was subcloned into a PCR 4 - Topo vector and sequenced. Because no clone was without mutation, a repair strategy was chosen to get a functional gene. Since plasmid pho- top33 showed one mutation, the 423 bp Sall/Kpnl fragment containing the alteration was exchanged against the corresponding DNA fragment with the wildtype sequence. The resulting plasmid CPPT12 was cloned EcoRI / Kpnl into pPGE5. This plasmid is named pMPl.

Complementation tests

First, a Iys5 host strain for complementation tests was constructed from the yeast strain #235, which has the genotype FY1679-28C: MATa ura3-52 leu2Δl his3Δ-200 trplΔ63.

The strain BY4741: MATa lys5::KAN^R Ieu2 ura3 his3 metl5, which has the Iys5 locus replaced with a kanamycin resistance, was used for the amplification of this cassette by flanking primers (Lys5 KO fwd: 5'-TGGCAAGAATCTCAGACGCAGA-S' (SEQ ID No. 12), Lys5 KO rev: 5'- AAAACAGTGCTGGATGATACAGAAAATAC -3' (SEQ ID No. 13)) . The resulting PCR product was directly transformed into the parent yeast strain #235. The transformants were selected on YPD+G418 plates. Two transformants Lys5KOl and Lys5 K02 were tested on SC-lys plates for lysine auxotrophy. Strain Lys5KOl was used for further studies.

Plasmid pMPl as well as the empty vector pPGE5 were transformed into the yeast strain Lys5K01 resulting in YZMPl (+ pMPl) and YZMP5 (+pPGE5) . These strains were tested on their ability to complement the loss of the Lys5 function. It could be shown that the fungal PPTase gene is functional in yeast and able to complement the LYS5 gene of Sacceromyces cerevisiae.

Example 5: Assays based on Fusarium graminearum pigment formation

The screening method provided herein is based on the observation of the phenotype of the following engineered Fusarium strains which are growing on a plate containing a candidate PPT inhibitor or the respective solvent control. Of interest are compounds that inhibit the PPT of the fungus but not the human or plant counterpart.

As a source of the human PPT cDNA for instance the clone HU3_p983A04354D of the German resource center (RZPD) can be used (see: http://www.rzpd.de/cgi-bin/asearch/searchOGMC.pl.cgi?op- tion=geneInfo&header=no&searchStr=HU3_p983A04354D&geneId=Hs.6459 5) . Attractive candidate PPT inhibitors should have minimal inhibitory effects on the human PPT, and therefore mammalian toxicity.

Also PPTs of plants (dedicated to fatty acid biosynthesis (e.g. At3gll470_l) ) in a method according to the present invention may be used to identify respective inhibitors.

The Fusarium PPTl gene may be replaced by homologs of other species in order to test for species specific inhibition. One attractive candidate would be the Aspergillus fumigatus PPT (which is expected to be essential for siderophore and gliotoxin production via NRPSs. These genes can be identified in genomic sequences . Example 6: Assay based on Fusarium graminearum zearalenone production

In order to independently verify the effect of PPT inhibitors the production of the estrogenic polyketide metabolite zearalenone can be used. Many very sensitive and simple bioassays based on expression of the human estrogen receptor are available, that lead to phenotypically easily detectable phenotypes in yeast (Mitterbauer et. al. Appl Environ Microbiol. 2003 Feb; 69 (2) :805- 11., 2002; Bovee et al., J Steroid Biochem MoI Biol. 2004 JuI; 91 (3) : 99-109) .

Basically an agar block from the PDA plate containing a candidate PPT inhibitor is removed and the ZON extracted with hot 70% ethanol. The extract is used for testing of reporter gene induction of phenotypic changes cased by the estrogenic ZON.

Example 7: Assay based on heterologogous co-expression of PPT and a suitable PKS or NRPS expression in yeast

If both the PKS (or NRPs) and the corresponding PPT are expressed in yeast the biosynthetic pathway can be reconstructed.

Again two assays are provided. The first is based on production of a pigment in yeast by expression PKSllβ (SEQ ID No. 3) .

The second is based on ZON formation. For ZON biosynthesis 2 separate PKSs genes are necessary - called PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2 and SEQ ID No. 5) .

Example 8: Cloning of a full length Fusarium graminearum PKSl18

The pksll8 gene (SEQ ID No. 1) was cloned using the genomic DNA of the F. graminearum wildtyp strain PHl as template. The gene was seperated into 8 fragments to facilitate cloning of only the exons.

To this end, restriction sites (Dral, MIuI) have been introduced next to the introns, which alter the nucleotide sequence but not the amino acid sequence. The restriction sites Kpnl and BstXI - 2A - are present in the native gene. By means of homologous recombination in yeast YPH499 fragment 8, the last missing part of pksllδ, was introduced without the necessity for appropriate restriction sites. At its ends fragment 8 contained regions homologous to the 5' region immediately flanking intron 2 and to a 40 nucleotide stretch within exon 3. In contrast to the other fragments, fragments 3 and 4 were generated in only one PCR reaction from appropriate cDNA.

Additional sites were introduced at both ends of the pks 118 gene to allow retrieval of the whole gene from the vector.

Amplifications of τ>ks!3 fragments 1 to 8

Fragments 1, 2 and 5 to 8 were amplified from genomic DNA of strain PHl. The PCR conditions were as follows: 200 pmol primer each, 200 nm dNTPs, 1.25 U Triple Master polymerase in the supplied high fidelity buffer and a total volume of 20 μl. The only exception was fragment 8, for whose amplification 4mM MgSO₄ and 2.5 U Pfu polymerase were used.

Fragments 3 and 4 were amplified in only one step from cDNA generated from F. graminearum strain 116-4. Synthesis of cDNA was performed in a reaction containing both primers 118_4 and 118__10. Subsequent PCR reaction was then performed in a total volume of 20 μl containing 200 pmol primer each, 200 nm dNTPs, 1.25 U Triple Master polymerase in the supplied high fidelity buffer.

PCR fragments 1-7 were cloned into pCR4-TOPO and sequenced. Plasmids, which contained the correct sequence, were:

pFl-6 for fragment 1 pF2-l for fragment 2 pF3+4-5 for fragments 3 and 4 pF5-l for fragment 5 pFβ-1 for fragment 6 pF7-5 for fragment 7.

Fragment 8 was desalted and then used directly in the transform- ation of yeast.

Table 2: Overview about PCR conditions for amplification of fragments 1-8

FragPrimers PCR programm Αmpl±con ment length

1 118_1 + 118_2 [Ix] 94°C/5' 314 bp

[25x] 94°C/1', 55°C/30", 72°C/30" [Ix] 72°C/2'

2 118_3 + 118_4 [Ix] 94°C/5' 350 bp

[30x] 94°C/1', 50°C/30", 72°C/40" [Ix] 72°C/2' 3 + 4 118_5 + 118_8 [Ix] 94°C/5' 781 bp

[25x] 94°C/1', 55°C/30", 72°C/30" [Ix] 72°C/2'

5 118_9 + 118_10 [Ix] 94°C/5' 1228 bp

[22x] 94°C/1', 49°C/40", 72°C/1'3O" [Ix] 72°C/5'

6 118_11 + 118_12 [Ix] 94°C/5' 944 bp

[23x] 94°C/1', 55°C/45", 72°C/2' [Ix] 72°C/7'

7 118_13 + 118_14 [Ix] 94°C/5' 1671 bp

[23x] 94°C/1', 55°C/45", 72°C/2' [Ix] 72°C/7'

8 118_15a + 118_16 [Ix] 94°C/5' 1119 bp

[25x] 94°C/1', 60°C/l', 74°C/3' [Ix] 74°C/10'

Table 3: Sequences of primers involved in cloning of pksllβ

Primer name Primer sequence SEQ ID No, [5'-3']

118 1 ATCTGCAGTACAATGGCGC- 14 CAAACAAGAAAACAATC

118 2 ACATTCTTTAAAAGTATCCCT 15 GCCCTGAC

118 3 GACACACATGTCTTAA- 16 CATTTAAAATGGGCAA Primer name Primer sequence SEQ ID No. [5'-3^{^}]

118_4 TAGAGACTATTCCCGG- 17

GTTTCAATCAC 118_4a AGATGGTGGTGCGACCCGG- 18

GTATTCC 118_5 ACTCACTCGACCCGGGTTGT- 19

GGTTCTACAG 118_8 TTACCGATCCAAGACGCGT- 20

TGCCACCTGCTGC 118_9 AATAGGGTGGTAACGCGT- 21

GTATCTT 118_10 GTTCAGCACGCATTG- 22

GTACCTTTGTC 118_11 ACCCTCGACAAAGGTAC- 23

CAATGCGT 118_12 ACACCGAATCCAGCAAGATG- 24

GACAAGACT 118_13 GTAAGTGTTGTCCATCT- 25

TGCTGGATTCGT 118_14 GCACTAGTATTAC- 26

CCCGCCTCGTTAAAGAACTC 118_15a TGAGCTTCGTAATGCCCTAG- 27

ATCAGTATCAGCAG

AGTATGGGAATTCCACCGAT-

CAAGAGAGCACAGG 118_16 TTGGCGAGAAGGCTGGTA- 28

CATGCGAGATG

Table 4: Sequences of primers used to sequence pksllβ

Primer name Primer sequence SEQ ID No. [5--3-]

M13fw GTAAAACGACGGCCAGT 29

M13rv AGCGGATAACAATTTCACAC 30

TCGATGAGCATAAGGCT-

118_seql 31 GTCCAC

TCTCGAGGTCGCCG-

118_seq2 32 GTTTACTTG Primer name Primer sequence SEQ ID No . [5 ' -3 ' ]

AGCCTTGTCTCGACCCTTG-

118_seq3 33

GAC

TCGAAATGGCTGGGTACT- 118_seq4 34

CAGACGGC

AAACCACTCTG- 118_seq5 35

GCAACTCTTCTTCC

CAAGAAGAGCGATCCAC-

118_seq6 36 GAGTGC

TGCCCTCTGGAG-

118_seq7 37 GTCTATCGG

TGCCCTCTGGAG-

118_seq8 38

GTCTATCGG

AGGTTACCTTCCGAGCAT- 118_seq9 39

CACTTTC

TTGCCAACACAGTTAAATA-

118_seqlO 40

TGATGCC 118_seqll TTCTGGGAGGCACCAACACC 41

TGTCCCGTCACTGCCACCT- 118_seql2 42

GT

GCCATATTTGCTGCCGT-

118_seql3 43

TGCTAC

CTTGATGACT- 118_seql4 44

TGACGCACACCTTC

CAAGCTGCCACCATACAAT- 118_seql5 45

CACC

CCTTTGTACTTGGTGG- 118 seqlβ 46

GTTCTCTG

Assembly of the pksll8 fragments to yield the full length yksllβ cDNA

After confirmation of their correct sequence, fragments were assembled step by step to yield the complete pksllδ gene. As a guide see Fig. 13.

For joining fragments 6 and I₁ the BstXI restriction site was used to fuse these two fragments. However, because a restriction site for BstXl was present in fragment 7 not only on its 5'end but also in the 3'part, the 0.4 kb EcoRI-Spel fragment of pF7-5 was first cloned into pBSIISK- to yield pF7b-3. Then, fragment 6 from pF6-l digested with Kpnl and BstXI and fragment 7 (only the 5'part) from pF7-5 digested with EcoRV and BstXI were cloned into pBF7b-3 previously digested with Kpnl and EcoRV. The resulting plasmid, containing both fragments 6 and 7 was named pSF3.

In the same manner fragments 3 and 4 from pF3+4-5 digested with Xmal and MIuI and fragment 5 from pF5-l digested with MIuI and Kpnl were cloned into pBSIISK- digested with Xmal and Kpnl. The resulting plasmid contained fragments 3 to 5 and was named pSF2.

Fragments 6 and 7 from pSF3 digested with Kpnl and Spel and fragments 3 to 5 from pSF2 digested with Xmal and Kpnl were then cloned into pBSIISK- previously digested with Xmal and Spel. The resulting plasmid contained fragments 3 to 7 and was named pSF4.

Fragments 1 and 2 were joined by digesting pFl-6 with Pstl and Dral and pF2-l with Dral and Xmal and cloning the released fragments in one step into pUCl9 digested with Pstl and Xmal. The resulting plasmid contained fragments 1 and 2 and was named pSFl.

Fragments 1 to 7 were united by cloning fragments 1 and 2 from pSFl digested with Pstl and Xmal and fragments 3 to 7 from pSF4 digested with Xmal and Spel into pRS304 digested with Pstl and Spel. The resulting plasmid was named pSF5.

As pRS304 was not a suitable vector for homologous integration of fragment 8 into pSF5 in yeast, fragments 1 to 7 from pSF5 digested with Pstl and Spel were cloned in both pRS314, which contains a trp marker and pRS315 containing a leu marker. The resulting plasmids were pSF5a (pRS314 backbone) and pSF5b (pRS315 backbone) . Homologous integration of fragment 8 into pSF5a/b in yeast

The following transformation was done with both plasmids, pSF5a and pSF5b, however, only pSF5b gave a positive result, therefore only pSF5b will be mentioned below.

Desalted PCR fragment 8 and linearised pSF5b (with Smal, which cuts at the same site as Xmal) were transformed into yeast YPH499 in one step. Transformed cells were plated on SC-leu. Single colonies were picked and cultivated in 5 ml SC-leu for two days. Thereafter, DNA was isolated and checked via PCR for integration of fragment 8 into pSF5b. To this end, PCR was performed with either primers 118_seq2 and 118_4a (Pl) or primers 118_seq3 and 118__16 (P2) .

The following clones gave positive signals in either one control PCR:

Pl: YZAC2-5, YZAC2-6, YZAC2-7

P2: YZAC2-12

DNA of these clones was retransformed into E. coli DHlOB, plas- mid DNA was isolated and the now complete pksllβ gene was se- quenced. The sequences of plasmid pPKS118-l and pPKS118-2 was confirmed using two additional primer (Seq PKS118_17, Seq PKS 118_18) .

The coding sequence of PKS118 can be released from plasmid pPKS118-l {Pstl, Spel) for heterologous expression.

It was cloned into the pPGE5 (Smal, Pstl) cut yeast expression vector (the Spel site of the cDNA was filled in by Klenow polymerase) .

The yeast expression vector pPGE5 is a 2μ plasmid with TRPl as selectable marker allowing expression of cDNA inserts under control of the strong PGKl promoter.

Example 9: Cloning of the full length PKS119 gene of Fusarium graminearum The cloning of PKS119 was based on amplification of PCR fragments from cDNA (fragments 1-5) . These PCR fragments were assembled in pBSIISK- using restriction sites that are present in pksll9 only once or - in one case - three times (see Fig. 14) .

Synthesis of the yksllθ cDNA

F. graminearum was cultivated in starch glutamat media, which is known to induce ZON production. To this end, strain 116-4, which has been shown to exhibit an increased ZON production in comparison with the wildtype PHl, was first cultivated in 50 ml malt- extract media (30 g/1) , which had been inoculated from a PDA plate. After 3 days shaking at 150 rpm at room temperature the culture was homogenised and 5 ml thereof were added to 20 ml of starch glutamate media. These cultures were then incubated in the dark at 11°C in cell culture dishes. After 11 and 16 days the mycelia was harvested, frozen in liquid nitrogen and stored at -80⁰C. RNA was isolated from both samples employing the peqGold Trifast system according to the manufacturers' instructions. After digestion of the RNA with DNase, cDNA was synthes- ised using the RevertAid™ H Minus First Strand cDNA Synthesis Kit from Fermentas. For this amplification pksll9 specific primers were employed.

Amplification of yksllθ fragments 1 to 5

The PCR conditions were the following: 200 pmol primer each, 200 nmol dNTPs, 1.25 U Triple Master polymerase in the supplied high fidelity buffer and a total volume of 20 μl.

Table 5:

FragPrimers cDNA from PCR program Length ment RT-PCR with of primer: amplicon

1 119_ 1 + 119_2 [Ix] 94°C/5' 1102 bp

119_ 2 [28x] 94°C/1^', 60°C/45' '

72°C/2'45' '

[Ix] 72°C/7' Frag- Primers cDNA from PCR program Length ment RT-PCR with of primer : amplicon

119_3 + Fl_119rv [Ix] 94°C/5' 1518 bp 119 4 [3Ox] 94°C/1', 58°C/45",

72°C/2'45"

[Ix] 72°C/7'

119_5 + 119_6 [Ix] 94°C/5' 2081 bp 119 6 [28x] 94°C/1', 60°C/45",

72°C/2'45' '

[Ix] 72°C/7'

119_7 + 119_8 [Ix] 94°C/5' 1314 bp 119 8 [28x] 94°C/1', 60°C/45",

72°C/2'45"

[Ix] 12⁰Q./!'

119_9 + Fl_119rv [Ix] 94°C/5' 1246 bp 119 10 [3Ox] 94°C/1', 48°C/45",

72°C/2'

[Ix] 72°C/7'

The PCR products of the correct size were excised from a 0.8% agarose gel and eluted by means of the QIAEXII Kit from QIAGEN. The fragments were then cloned into the pGEM-T easy plasmid from Promega, whereafter the correct sequence of the fragments was confirmed. Plasmids containing the confirmed correct DNA sequence were named pll9_Fl to pll9_F5.

Table 6: Sequences of primers involved in cloning of pksllθ

Primer Primer sequence [5'-3'] SEQ ID No name

119_1 AATCCCGGGATACAATGTCT- 47

GTCGATAACAAACAAGTG 119_2 ACCAACTAGTTAACGCTAGC- 48

CACACCTGC 119_3 TGACCCGGGAGTGGCTAGCGT- 49

TATCAAGG 119_4 TCCAAACTAGTCTCGACTGC- 50

ATTCTGACC 119 5 ATGCTCACACGAGGTCAGAATGC 51 Primer Primer sequence [5'-3'] SEQ ID No, name

119_ 6 AGGGCCAGCGACGGACTCTC 52

119_ _7 AGTCGTTTTGACTAGTCAGCGC- 53

ATTCTATG

119_ _8 TGAGCGTCATCTGGGAAGGAGAG 54

119__ _9 TCCGTATCATGCGACGAG- 55

GAAAACACC

119 _ 10 AGAGCTCCTCAAGATAC- 56

CGTAACCAACTTGCTA

Fl 119rv actqgqqcacαatatccαcaataq 57

Table 7: Sequences of primers used to sequence pksll9

Primer name Primer sequence SEQ ID No.

[5'-3']

M13fw GTAAAACGACGGCCAGT 29

M13rv AGCG- 30

GATAACAATTTCACAC

119 seql AGTAGCACTTGGAC- 58

CATGTATGTCG

119_seq2 GAGGCCTTC- 59

GAAAATGCTGGTAA

119_seq3 GGCGTGGTGAAG- 60

GATGTGGTA

119_seq4 TAGTGGCTTTGG- 61

CATGGGAGGTA

119_seq5 GAGATGCTTCACCGTC- 62

CAGTCTTC

119_seqβ CATTTTTGCCCGAC- 63

GACTGAGA

119_seq7 ACTTACAAACCTTCCC- 64

CCATACCC

119 seq8 TTACGAGGGCAATA- 65

CAΆGTCAGCAG

119_seq9 GAΆCCTCGGAGCTT- 66

GAAATGG

119_seqlO CCCACAAGGATTC- 67

CAGTTTCAGG 119_seqll CGTGT- 68

CGTTGTTGGAAGTT-

GAGC

119_seql2 ATGGCATCAATGG- 69

CACTGGTTC

119_seql3 TCTGGTGAGCTGTTG- 70

CGTGTA

119_seql4 GTGGCCTCGGTCG- 71

CAGTCT

119_seql5 ACAAGGCACCAGCG- 72

GAAACATC

Due to the length of fragment 3 sequencing of several clones revealed that they all contained mutations within the DNA sequence. Therefore, a repair strategy was chosen to eliminate these mutations.

Repair strategy of yksll9 fragment 3

All clones (fragment 3 in pGEM-T easy) sequenced had the same mutation at the same position and various other mutations at different positions in the sequence. Two clones (pF3-14 and pF3- 16) had their mutations positioned in way that by cutting a 1382 bp Xhol - Nael fragment from pF3-14 and introducing it into pF3- 16 all variable mutations were removed. Plasmid pF3-16 was previously cut with the same enzymes thereby removing the same 1382 bp Xhol - Nael fragment from pF3-16 (see Fig. 15) . However, since Nael was present twice in pF3-16, it was first completely digested with Xhol and then, in a second step, only partially digested with Nael. The resulting plasmid, pF3k, still had the mutation at position 654 that was present in all clones.

To remove this last mutation, a PCR reaction with primers 119_5 and 119_6 was performed using genomic DNA from PHl as a template (PCR conditions were as described above) . The mutation that was thereby eliminated was lying between two Ncol sites on a 442 bp fragment. After the PCR the amplicon was therefore digested with Ncol (and BamRI to further digest the rest of the amplicon) and the 442 bp band was eluted from the gel. In plasmid pF3k 4 Ncol restriction sites were present, however by partial digestion it was achieved that only the two required sites were cut. After dephosphorylation with SAP the vector was ligated with the 442 bp genomic DNA fragment and transformed into E. coli DHlOB. The sequence of the resulting plasmids was confirmed and the plasmid named pll9_F3.

Assembly of the PKS4 fragments to yield the complete, intronless vksll9

Fragment 2 was excised from pll9_F2 using the Xmaϊ and Spel restriction sites and was cloned into pBSIISK- previously digested with the same enzymes to yield pll9_2.

As a second step, fragment 1 from pll9_Fl digested with XmaT and Nhel was cloned into pll9_2, previously digested with Xmal and Nhel. The resulting plasmid was named pll9_12.

Fragments 4 and 5 were added to pll9_12 via a triple ligation. Prior to this ligation plasmid pll9_F4 was digested with Spel and SacII, pll9_F5 with SacII and Sad and pll9_12 with Spel and Sacl. The resulting plasmid was named pll9_1245.

Fragment 3 of pll9_F3 was introduced into pll9_1245 via the restriction sites BstEII and Spel. The correct sequence of the pksll9 cDNA insert of the resulting plasmid, pPKS119, was confirmed.

The PKS119 insert can be retreived from pPKS119 by Smal and Sacl digestion.

Blunt ends were generated by digesting away the 3' overhang. The

7059 bp fragment was ligated into yeast expression vector pADH- fwd {EcoRI blunt) resulting in plasmid pLN38.

This 2 μ plasmid has LEU2 as selectable marker for yeast transformation, and allows expression of the PKS119 cDNA under control of the constitutive ADHl promoter.

Example 10: Construction of a yeast strain with and integrated PPTl from Fusarium graminearum To generate a yeast strain with chromosomal integration of PPTl from Fusarium graminearum, the parent strain YZCP908 was used.

A PCR product (1535 bp) was amplified from plasmid pMPl including the PGK promoter und CYCl Terminator from yPGE5 and additional PvuII restriction sites with primer cPPT fwd and cPPT rev. The PCR product was separated on an agarose gel and sub- cloned into a pGEM-T vector for sequencing (pM567) . The fragment was PvuII released and cloned into the vector pDP6 (Smal) resulting in plasmid pMP576. This is an integrative plasmid with a LYS2 marker for integration into the yeast genome.

Plasmid pMP576 was linearized with Cfr42I (=SacII) , and transformed into the yeast strain YZCP908.

Table 8: Used primer for the construction of a yeast strain with and integrated PPTl from Fusarium graminearum

The genotype of yeast strain YZCP908 is given below:

MATα Ieu2-M urα3-52 trpl-Δl Ms3-A200 lys2-801 P₃X_ERE-ADE2 pdr5Δ'. '. trpl : : P_3κEBE-URA3-loxP-KAlP-loxP snq2A: : hisG ( 2μ HIS3 P_PGK1- hER)

When an estrogenic compound like zearalenone is formed (due to action of PKS118+PKS119+PPT1) the human estrogen receptor (plasmid borne , 2μ HIS3 P_PGK1-hER) is activated and the URA3 and ADE2 reporter genes turned on .

Claims

Claims :

1. Method for the identification of inhibitors of a phospho- pantetheinyl transferase comprising the steps:

- providing a cell producing at least one polyketide synthase (PKS) or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and producing a phospho- pantetheinyl transferase (PPT) , wherein said phosphopantetheinyl transferase activates said polyketide synthase (PKS) or said nonribosomal peptide synthase (NRPS) ,

- contacting said cell with a potential inhibitor, and

2. Method according to claim 1, characterised in that said phosphopantetheinyl transferase is involved in the metabolism of secondary metabolites.

3. Method according to claim 1 or 2, characterised in that said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) are of microbial origin, preferably of fungal, of yeast or of bacterial origin.

4. Method according to any one of claims 1 to 3, characterised in that said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) are originating from a microorganism selected from the group consisting of Aspergillus fumigatus, Ffusarium graminearum, Fusarium culmorum, Fusarium pseudogramin- earum, Fusarium cerealis, Botrytis cinerea and Alternaria al- ternata.

5. Method according to any one of claims 1 to 4, characterised in that said polyketide synthase (PKS) is PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2) .

6. Method according to claim 5, characterised in that the syn- thesised secondary metabolite is zearalenone.

7. Method according to any one of claims 1 to 6, characterised in that said polyketide synthase (PKS) is PKS116 (SEQ ID No. 3) .

8. Method according to claim 7, characterised in that the syn- thesised secondary metabolite is aurofusarin/rubrofusarin.

9. Method according to any one of claims 1 to 8, characterised in that the phosphopantetheinyl transferase is originating from a microorganism selected from the group consisting of Aspergillus fumigatus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudograminearum, Fusarium cerealis, Botrytis cinerea and Al- ternaria alternata.

10. Method according to any one of claims 1 to 9, characterised in that said phosphopantetheinyl transferase (PPT) is PPTl (SEQ ID No. 4) of Fusarium graminearum or PPT of Aspergillus fumigatus.

11. Method according to any one of claims 2 to 10, characterised in that said cell is a microorganism, preferably a yeast, a fungus or a bacterium.

12. Method according to any one of claims 2 to 11, characterised in that said cell is selected from the group consisting of Fusarium graminearum, Aspergillus fumigatus, Saccharomyces cerevisiae.

13. Method according to any one of claims 2 to 12, characterised in that a DNA/cDNA sequence encoding said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) is recombinantely introduced into said cell.

14. Method according to any one of claims 2 to 13, characterised in that a DNA/cDNA sequence encoding said polyketide synthase (PKS) and/or said nonribosomal peptide synthase (NRPS) and/or said phosphopantetheinyl transferase (PPT) is recombinantely introduced into the chromosomal and/or episomal DNA of said cell.

15. Pesticide composition, preferably a fungicide or a bactericide, comprising an inhibitor obtainable by a method according to any one of claims 1 to 14.

16. Vector comprising DNA/cDNA sequence encoding at least one polyketide synthase (PKS) and/or at least one nonribosomal peptide synthase (NRPS) synthesising a secondary metabolite and DNA/cDNA sequence encoding at least one phosphopantetheinyl transferase (PPT) .

17. Vector according to claim 16, characterised in that said DNAs/cDNAs are of microbial origin, preferably of fungal, of yeast or of bacterial origin.

18. Vector according to claim 16 or 17, characterised in that said DNAs/cDNAs are originating from a microorganism selected from the group consisting of Aspergillus furαigatus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudograminearum, Fusarium cerealis, Botrytis cinerea and Alternaria alternata.

19. Vector according to any one of claims 16 to 18, characterised in that said polyketide synthase (PKS) is PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2) or PKS116 (SEQ ID No. 3) .

20. Vector according to any one of claims 16 to 19, characterised in that vector is an expression vector.

21. Vector according to any one of claims 16 to 19, characterised in that vector is an integration or episomal vector.

22. Vector system comprising:

23. Vector system according to claim 22, characterised in that said DNAs/cDNAs are of microbial origin, preferably of fungal, of yeast or of bacterial origin.

24. Vector system according to claim 22 or 23, characterised in that said DNAs/cDNAs are originating from a microorganism selected from the group consisting of Aspergillus fumigatus, Fusarium graminearum, Fusarium culmorum, Fusarium pseudograminearum, Fusarium cerealis, Botrytis cinerea and Alternaria alternata.

25. Vector system according to any one of claims 22 to 24, characterised in that said polyketide synthase (PKS) is PKS118 (SEQ ID No. 1) and PKS119 (SEQ ID No. 2) or PKS116 (SEQ ID No. 3) .

26. Vector system according to any one of claims 22 to 25, characterised in that said vectors are expression vectors.

27. Vector system according to any one of claims 22 to 26, characterised in that said vectors are integration or episomal vectors.

28. Cell comprising a vector or a vector system according to any one of claims 16 to 27.

29. Cell according to claim 28, characterised in that the cell is a microorganism, preferably a yeast, a fungus or a bacterium.

30. Cell according to claim 28 or 29, characterised in that said cell is selected from the group consisting of Fusarium graminearum, Aspergillus fumigatus and Saccharomyces cerevisiae.

31. Cell according to any one of claims 28 to 30, characterised in that said vector or said vectors are integrated into the chromosomal and/or episomal DNA of said cell.

32. Kit for the identification of inhibitors of phospho- pantetheinyl transferases of secondary metabolisms comprising

- a cell, preferably a yeast, a fungus or a bacterium cell, and

- a vector or vector system according to claims 16 to 27.

33. Use of PKS118 (Seq ID No. 1) and PKS119 (Seq ID No. 2) of Fusarium graminearum as zearalenone biosynthetic polyketide synthases.