CN114369601A - Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease - Google Patents

Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease Download PDF

Info

Publication number
CN114369601A
CN114369601A CN202210143597.XA CN202210143597A CN114369601A CN 114369601 A CN114369601 A CN 114369601A CN 202210143597 A CN202210143597 A CN 202210143597A CN 114369601 A CN114369601 A CN 114369601A
Authority
CN
China
Prior art keywords
protein
ppt1
gene
preventing
pptase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210143597.XA
Other languages
Chinese (zh)
Inventor
柳志强
岑宇科
王�琦
李明涵
李江涛
章旭刚
郑裕国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN202210143597.XA priority Critical patent/CN114369601A/en
Publication of CN114369601A publication Critical patent/CN114369601A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07003—Pantetheine-phosphate adenylyltransferase (2.7.7.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a potential drug target protein PPTase and application of a coding gene thereof in preparation of a drug for preventing and treating plant scab. Experiments show that the gene is knocked out in the gibberella sakeippt1Post-genic, GA in gibberellins3、GA4、GA7The yield of the product is greatly reduced; meanwhile, the growth capacity of the knockout strain on PDA, MM, SM and other culture media is greatly reduced. Therefore, protein targeting inhibition designed for this siteThe preparation medicine can prevent and treat diseases caused by gibberellin production bacteria in plant fungi, and provides a new way for screening fungi medicines for preventing and treating plant gibberellic disease.

Description

Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of PPTase protein and a coding gene thereof in preparation of a medicament for preventing and treating plant scab.
Background
The plants of rice, wheat, corn and the like are infected by fungus pathogenic bacteria such as fusarium graminearum, fusarium moniliforme and the like, and then the plants grow excessively, the diseased plants are usually higher than normal plants by more than 50 percent, the maturing rate is greatly reduced, and the disease is often accompanied by withering and yellowing symptoms, so the plants are called as 'bakanae disease' or 'gibberellic disease'.
The primary reason for the development of tall and overgrown plants is generally thought to be due to the secretion of a class of plant growth hormone gibberellins by this type of crop pathogen. The chemical structure of gibberellin belongs to diterpenoid acid, which is a widely existing plant hormone, and the currently discovered bioactive gibberellin is GA1、GA3、GA4、GA7The fertilizer acts on economic crops including wheat, corn, sugarcane and the like to cause a series of problems of yield reduction, death and the like, and seriously jeopardizes the development of agricultural economy in China.
Researches find that the mechanism of the channeling of crops such as rice, corn and the like is that excessive gibberellin can cause abnormal increase of auxin in plants, so that cells are accelerated to divide and excessively extend, and finally bakanae disease of the plants such as rice and the like is formed. The crop scab affects and hinders the development of agricultural economy in China to a great extent, and how to effectively prevent crops from infecting scab fungi becomes a focus of attention in the field.
Wheat scab is listed in the famous records of diseases and insect pests of crops of the same kind by the rural part of agriculture in China in 2020, and at the present stage, the control measures of the scab mainly depend on chemical bactericides for spraying in the flowering phase, however, no matter a single bactericide is used or a plurality of bactericides are used in combination, after a long use time, pathogenic bacteria easily generate certain drug resistance, and the control effect of the chemical bactericides is greatly reduced. In addition, in order to avoid adverse effects of plant diseases and insect pests on crop harvest, scientists often select and breed biologically-controlled plant varieties. However, due to the long development cycle of antibacterial varieties and the safety of transgenic crops, the pesticide market needs to develop a targeted drug with strong specificity and difficult generation of resistance by pathogenic bacteria.
However, the quantity of the bactericide molecular targets which can be used as drug target proteins in the germ eukaryotic cells is very small, and the bactericide molecular targets with high drug sensitivity and strong selectivity are more digressive, so that a plurality of major crops lack effective drug control, and therefore, the pesticide market needs to explore a new target with control effect urgently.
Disclosure of Invention
The invention aims to provide application of PPTase protein and a coding gene thereof in preparation of a medicament for preventing and treating plant scab.
The technical scheme adopted by the invention is as follows:
the application of PPTase (4' -phosphopantetheinyl transferase) protein as a target protein of a fungal drug in preparing a drug for preventing and treating plant gibberellic disease.
Specifically, the application is as follows: and designing an inhibitor drug taking the protein as a target aiming at the target protein of the fungal drug. E.g. designed for the target protein siteppt1Gene variant Crispr/ZNF system, expression inhibitionppt1siRNA of gene, etc., to reduce or delete PPTase expression; or obtaining PPTase protein activity inhibitor by drug screening to reduce GA in gibberellin3、GA4And GA7The yield of the method can be further reduced, and gibberellin can further act on economic crops including wheat, corn, sugarcane and the like to cause a series of problems of yield reduction, death and the like.
Preferably, the amino acid sequence of the fungal drug target protein is shown as SEQ ID No. 1.
Phosphopantetheinyl transferase (PPTase) catalyzes post-translational modification reactions of proteins such as acyl carrier proteins and peptidyl carrier proteins of fatty acid synthases, polyketide synthases and non-ribosomal peptide synthetases, and transfers the phosphopantetheinyl group on coenzyme a to a conserved serine residue of the above proteins, thereby synthesizing fatty acids, polyketides and non-ribosomal peptides.
The invention also relates toppt1The application of the gene in preparing the medicine for preventing and treating plant scab.
Specifically, the application is as follows: to the saidppt1Gene design ofppt1An inhibitor drug of a deletion or reduction in gene expression.
Preferably, the nucleotide sequence of the coding gene of the fungal drug target protein is shown in SEQ ID No. 2.
The plant comprises: rice, wheat, corn, cucumber, etc.
The invention is based on influencing the flux of the gibberellin's entire metabolic pathwayppt1(encoding PPTase) gene, which is associated with lysine metabolic pathway, polyketide and non-ribosomal peptide species of fungi, etc. Experiments show that the gene is knocked out in the gibberella sakeippt1Post-genic, GA in gibberellins3The yield is reduced by 70 to 95 percent, and GA4The yield is reduced by 50 to 80 percent, and GA7The yield of the method is also reduced by 80 to 95 percent; meanwhile, the growth capacity of the knockout strain on PDA, MM, SM and other culture media is greatly reduced.
Saidppt1Genes and PPTase proteins widely exist in fungi such as fusarium graminearum, fusarium moniliforme, gibberella canescens and the like, and the fungi are known to cause gibberellic disease of plants. Therefore, the inhibitor drug which takes the protein designed aiming at the site as a target can prevent and treat diseases caused by gibberellin production bacteria in plant fungi.
The plant comprises: rice, wheat, corn, cucumber, etc. The plant pathogenic bacteria causing head blight include: fusarium graminearum, fusarium moniliforme, gibberella bardawil and the like.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a potential drug target protein PPTase andthe coding gene is applied to the preparation of the medicine for preventing and treating the gibberellic disease of plants. Experiments show that the gene is knocked out in the gibberella sakeippt1Post-genic, GA in gibberellins3、GA4、GA7The yield of the product is greatly reduced; meanwhile, the growth capacity of the knockout strain on PDA, MM, SM and other culture media is greatly reduced. Therefore, the inhibitor drug taking the protein designed aiming at the site as a target can prevent and treat diseases caused by gibberellin production bacteria in plant fungi, and provides a new way for screening fungal drugs for preventing and treating plant gibberellic disease.
(IV) description of the drawings
FIG. 1 is a schematic diagram of the construction of Pcas-ppt1 containing Cas9 protein in the example of the present invention;
FIG. 2 shows resistance to hygR and donor fragments of 700bp homology arms above and below;
FIG. 3 shows twoppt1Knock-out bacterial PCR pair ppt1Verifying gel pictures at upstream and downstream; in the figure, up and down respectively indicate thatppt1Knocking out original segments at the upstream and downstream positions of the gene and replacing the original segments with donor DNA segments;
FIG. 4 is a graph showing GA assay by high performance liquid chromatography3、GA4And GA7The yield of (2).
Detailed Description
The present invention will be described in further detail with reference to specific examples, but the present invention is not limited to the following examples:
example 1:
gibberella fujikuroippt1Gene knockout:
in order to verify the biological function of the PPTase protein, the CRISPR/Cas9 technology is adopted to treat the gibberella sakeippt1And (4) knocking out genes. The mutant strain is obtained by constructing a Pcas-ppt1 vector, introducing the Pcas-ppt1 vector and a donor fragment into a strain, and carrying out colony pcr verification screening. The Pcas-ppt1 vector contains DNA elements such as a targeting gRNA, a Cas9 protein expression cassette and a hygromycin resistance screening label (shown in figure 1). The donor fragment is preferably constructed by multi-fragment fusion (as shown in fig. 2).
Obtaining Gibberella fujikuroi according to GenBank sequence number HE614113.1ppt1The gene sequence ofHas high homology and similar activity in different fungi. To pairppt1After the gRNA is designed by gene site selection, a plasmid pUC-fFuCas9-HTB is subjected toNLSThe hph was digested with the restriction enzyme EcoRI, and the synthetic gRNA fragment (containing 20 bp of the PAM sequence) was ligated to the digested plasmid using a one-step cloning kit. The recombinant plasmid was transferred into DH5 alpha E.coli for storage for subsequent use.
The amino acid sequence of the PPTase protein (the source is the Gibberella fujikuroi) is shown in SEQ ID NO. 1:
MSRAQSSPTVIQWVIDTRPLWPSALKTKDLTSAASRALSLLTEEEQSSVLRYYHVRDAKLALASALLKRYAISRFCHVPWFLAKTTRDARTKPVFVLPSGDEPLIFNVSHQAGLAVLLAVHDPPKGLAVGVDVVCPSERRDRDLSSLEEDGWASFVDIHADVFGAGEVSALKSMNPVPTVQERDRALRYFYALWCLREAYVKMTGDALLASWLKDLEMHNFAPPEDMKEAQEVRLRGKKVEGVDMRLMPLLEEYMVSTAVRNGDNGESVELGEFQSLDLEEILAFGEQASKP。
the gene (the source is the Gibberella fujikuroi) of the drug target PPTase protein has a nucleotide sequence shown in SEQ ID NO. 2:
ATGAGTAGGGCCCAATCCTCACCTACGGTCATCCAATGGGTGATCGACACTCGTCCACTTTGGCCCTCCGCTCTCAAGACCAAAGACCTCACATCCGCTGTAAGTGCTCTGGTCATCCACTTTAACCTGATACTCATGTCATACCTTAGGCTTCACGTGCACTCTCACTTCTCACCGAGGAGGAACAATCTTCTGTCCTGAGATACTACCACGTCCGCGATGCCAAGCTCGCTCTCGCTTCGGCTCTTCTTAAGCGCTACGCAATCTCTCGCTTCTGTCACGTCCCCTGGTTCCTGGCCAAGACTACGCGAGATGCCCGTACTAAGCCCGTGTTTGTTTTGCCCAGCGGGGATGAGCCGCTGATCTTTAACGTCTCGCATCAGGCCGGTCTCGCGGTCCTTCTGGCCGTCCATGATCCGCCAAAGGGCCTTGCCGTGGGAGTTGATGTTGTCTGTCCGTCAGAGCGACGAGATCGAGATCTGAGTAGCTTAGAAGAAGATGGGTGGGCGAGTTTCGTCGACATTCATGCCGATGTCTTTGGAGCGGGAGAAGTCTCAGCGCTTAAGAGCATGAACCCTGTTCCTACCGTCCAAGAACGAGATCGTGCATTGCGCTACTTTTATGCGCTATGGTGTCTCCGTGAAGCCTATGTCAAGATGACAGGGGACGCTCTTCTGGCAAGCTGGTTGAAAGACCTAGAGATGCACAACTTTGCCCCGCCAGAAGACATGAAGGAAGCCCAAGAGGTTCGACTGAGAGGCAAGAAGGTTGAGGGCGTGGACATGAGACTGATGCCGCTACTTGAGGAATACATGGTCTCCACAGCTGTAAGAAACGGTGATAATGGGGAGAGTGTCGAGCTCGGAGAGTTTCAAAGTCTTGATCTGGAGGAAATATTGGCATTTGGTGAACAGGCATCCAAACCATGATCAGAGAACGTTTTAT。
construction of the donor fragment containing the hygR resistance selection tag is as follows:
three pairs of upstream and downstream primers F1, R1, F2, R2, F3 and R3 are used for amplification respectivelyppt1Upstream homologous region of gene, hygR resistance gene andppt1the region of homology arms downstream of the gene.
F1：GTTCCATCCACTCAGATCCGG（SEQ ID NO.3）
R1：CAGGCTTTTTCATTTACTGCAACTATTGCCTTGGAAT（SEQ ID NO.4）
F2：GCAGTAAATGAAAAAGCCTGAACTCACCG（SEQ ID NO.5）
R2：TTCCTATTCCTTTGCCCTCGGACG（SEQ ID NO.6）
F3：CGAGGGCAAAGGAATAGGAATAATGAGAAACGCAAGCGC（SEQ ID NO.7）
R3：AGAAGTACAAGGTCTTCATCCCTGA（SEQ ID NO.8）
The PCR reaction system is 50 uL:Fusarium fujikuroi 978#2uL of whole genome template, 2 XPhanta Mix Buffer 25uL, 2uL of each of upstream and downstream primers, dNTP Mix 1uL, Phanta Mix Super-Fidelity 1uL, ddH2O complement 50uL (reagents for PCR reaction purchased from Novowed Biotech Co., Ltd.).
The PCR reaction conditions are as follows: 95 ℃ 10min, (95 ℃ 30s, 60 ℃ 30s, 72 ℃ 1min, 30 cycles) 72 ℃ extension 10 min.
The three fragments obtained were purified by agarose gel recovery kit and used as templates, and fusion PCR was performed on the three fragments using F1 and R3 primers to obtain a donor fragment. Fusion PCR reaction conditions: 95 ℃ 10min, (95 ℃ 30s, 60 ℃ 30s, 72 ℃ 2 min10 s, 30 cycles) 72 ℃ extension 10 min.
The preparation method of the protoplast comprises the following steps:
digging 1 cm from eggplant bottle slant culture medium by using sterile inoculation shovel2The size of the pellet was transferred to 25 mL of YEPD medium (YEPD medium: 30g/L yeast powder, 10g/L peptone, 20g/L glucose), and cultured at 250 rpm at 28 ℃ for 2 days. Sucking 1mL of bacterial liquid from a YEPD culture medium into an EP (Eppendorf) tube, centrifuging at 12000 rpm for 3min, and discarding a supernatant; adding 1mL of sterile water (sterilized by ultrapure water) into an EP tube, fully mixing, centrifuging at 12000 rpm for 3min, and removing supernatant; to the EP tube, 1mL of sterile 0.8M NaCl solution was addedMixing the solution, sucking out the pellet with a pipette, centrifuging at 12000 rpm for 3min, and removing the supernatant; adding 1mL of sterile cell wall enzymolysis liquid (prepared from 1% Driselase, 2% Yatalase, 1% Snailase and 0.8M NaCl solution) into an EP tube, fully mixing, putting the mixture into a constant-temperature water bath shaker at 150 rpm and 30 ℃ for water bath for 60-90 min, wherein the specific time is determined according to the current thallus concentration and the number of bacteria balls; centrifuging the bacterium solution after enzymolysis at 4500rpm for 3min, transferring the upper solution to a 2 mL sterile EP tube, adding 0.8M NaCl in equal amount, mixing well, centrifuging at 4500rpm for 3min, and discarding the supernatant; adding 1 mL0.8M NaCl into an EP tube, fully and uniformly mixing, centrifuging at 4500rpm for 3min, and removing supernatant; the solution was washed once with 0.8M NaCl, the supernatant was discarded, 20. mu.L of STC solution was added, and the mixture was stored in a refrigerator at 4 ℃ for further use.
The protoplast transformation method comprises the following steps:
by using PEG-CaCl2The Pcas-ppt1 plasmid constructed as above and a donor fragment containing hygR and 700bp each of the upper and lower homology arms were integrated by transformation using a chemical transformation method. Adding 100uL of protoplast suspension, 10ug of prepared Pcas-ppt1 plasmid and 10ug of denor fragment into a conversion tube, gently mixing, standing on ice for 20min, adding 50uL of 60% PEG6000, standing on ice for 20min, adding 500uL of 60% PEG6000 and 1mL of STC solution, mixing, adding the conversion system into 10mL of MYG semisolid culture medium (MYG culture medium: 5g/L of maltose, 5g/L of yeast powder, 10g/L of glucose, 171g/L of sucrose and 15g/L of agar powder) which is cooled to room temperature and has hygromycin resistance of 100ug/mL, shaking, pouring onto MYG plate with the same hygromycin resistance concentration, culturing at 28 deg.C for 4-5 days to obtain transformant deltappt1-14 and Δppt1-18。
Verification of Gibberella fujikuroippt1Gene-deleted strains:
first, growth defect was verified in SM medium (SM medium: glucose 20g/L, KH) without any amino acid2PO4 1g/L，MgSO4·7H2O 0.5g/L，KCl 2g/L，FeSO4·7H2O10 mg/L, agar powder 20g/L, NaNO3 3 g/L), the knockout bacterium can not grow on the culture medium, and lysine defect is shownPhenotype of type, and the wild type bacteria can grow under the medium condition.
Second, gene fragment deletion was verified by PCR. Primers F4, R4, F5 and R5 are designed as two groups of primers for upstream and downstream verification, the obtained transformants are transferred to a PDA (potato dextrose agar) plate (200 g/L, 20g/L and 15g/L agar powder) to be cultured for 4-5 days at 28 ℃, and then genomes are respectively extracted as templates for PCR verification, the result is shown in figure 3, and thus, the red blood bacteria can be seenppt1The gene has been knocked out.
F4：CTAAGCACAGTAGCAATGCCTC（SEQ ID NO.9）
R4：CCACTATCGGCGAGTACTTCTAC（SEQ ID NO.10）
F5：TCTCCGACCTGATGCAGCTC（SEQ ID NO.11）
R5：GCTGCAACATACCTCCTGTTGTC（SEQ ID NO.12）
The PCR reaction system is 25 uL: the extracted genome template of each transformed single colony was 2uL, 2 × Rapid Taq Master Mix12.5uL, and the upstream and downstream primers were 1uL and ddH2O respectively to make up 25uL (reagents for PCR reaction were purchased from Novowed Biotechnology Ltd.). The PCR reaction conditions are as follows: 95 ℃ 3min, (95 ℃ 15s, 60 ℃ 15s, 72 ℃ 40s, 30 cycles) 72 ℃ extension 10 min.
Example 2:
wild type bacterium (A), (B), (C), (B), (C), (B), (C)Fusarium fujikuroi 978#Supplied by Zhejiang Qianjiang biochemistry corporation) as a control group, two plantsppt1Gene knock-out bacterium (. DELTA.)ppt1-14 and Δppt1-18) evaluation of the growth status of the strains for the experimental group.
Evaluation of growth of the strains 3 media, including potato medium PDA, and two synthetic media MM medium (glucose 20g/L, KH)2PO4 1g/L，MgSO4·7H2O 0.5g/L，KCl 2g/L，FeSO4·7H2O10 mg/L, agar powder 20g/L, NaNO3 3 g/L) and SM medium. Wherein 10mM lysine was additionally added to the synthetic medium.
Colony diameters were measured after 7 days of growth at 28 ℃ for the control and knockout strains. The results are shown in table 1 below,PPTase gene deletion strainΔppt1The growth ability of (a) is greatly reduced.
Table 1: growth of colonies
Figure 504818DEST_PATH_IMAGE002
Example 3: metabolism of gibberellins
The invention aims to identify the effect of PPTase protein of filamentous fungi on gibberellin synthesis, thereby obtaining the feasibility of the protein serving as an agricultural antibiotic target to inhibit gibberellic disease and providing technical and theoretical support for drug development of gibberellic disease. This example evaluated the effect of PPTase proteins on gibberellin synthesis by assessing the levels of metabolic synthesis of 3 major gibberellins GA3, GA4, and GA 7.
The culture medium used in the experimental process comprises a seed expanding culture medium (corn starch 20g/L, sucrose 15g/L, peanut powder 15g/L, KH)2PO4 1g/L，MgSO41g/L of soybean meal and 3g/L of soybean meal) and a fermentation medium (corn starch 75g/L, rice flour 87.5g/L, soybean meal 5g/L, peanut powder 5g/L, KH)2PO4 0.5g/L，K2SO4 0.5g/L，MgSO4·7H2O0.11 g/L), the components of the culture medium are consistent with those of an industrial fermentation culture medium, natural conditions are simulated, and the components of carbon and nitrogen sources in the components of the culture medium are all from plants and are similar to the natural conditions.
The method for determining gibberellin metabolism level comprises extracting gibberellin with waterppt1Gene knockout strains and wild type 978#The strain will be about 2cm after culturing at 28 ℃ for 4 days on PDA plates2Inoculating the agar block of the transformant to a seed culture medium for propagation, culturing at 28 ℃ and 250 rpm for 2 days, transferring to a fermentation culture medium, wherein the inoculum size is 6.25%, culturing at 28 ℃ and 250 rpm for 7 days, collecting the supernatant of a bacterial liquid, reasonably diluting, and measuring GA by using high performance liquid chromatography3、GA4And GA7The yield of (2).
The gibberellin metabolism level of the wild-type strain was set to 100%, and the results are shown in Table 2,ppt1gibberellin production by knockout strainsThe strain is obviously reduced and has obvious difference with a control strain.
Table 2:ppt1effect of Gene-deleted Strain on gibberellin production
Figure DEST_PATH_IMAGE004
The invention proves that the deletion of PPTase can cause the capability of a strain to synthesize a secondary metabolite to be greatly reduced (as shown in figure 4), and the synthesis of the metabolite is effectively inhibited.
Sequence listing
<110> Zhejiang industrial university
Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 292
<212> PRT
<213> Gibberella fujikuroi
<400> 1
Met Ser Arg Ala Gln Ser Ser Pro Thr Val Ile Gln Trp Val Ile Asp
1 5 10 15
Thr Arg Pro Leu Trp Pro Ser Ala Leu Lys Thr Lys Asp Leu Thr Ser
20 25 30
Ala Ala Ser Arg Ala Leu Ser Leu Leu Thr Glu Glu Glu Gln Ser Ser
35 40 45
Val Leu Arg Tyr Tyr His Val Arg Asp Ala Lys Leu Ala Leu Ala Ser
50 55 60
Ala Leu Leu Lys Arg Tyr Ala Ile Ser Arg Phe Cys His Val Pro Trp
65 70 75 80
Phe Leu Ala Lys Thr Thr Arg Asp Ala Arg Thr Lys Pro Val Phe Val
85 90 95
Leu Pro Ser Gly Asp Glu Pro Leu Ile Phe Asn Val Ser His Gln Ala
100 105 110
Gly Leu Ala Val Leu Leu Ala Val His Asp Pro Pro Lys Gly Leu Ala
115 120 125
Val Gly Val Asp Val Val Cys Pro Ser Glu Arg Arg Asp Arg Asp Leu
130 135 140
Ser Ser Leu Glu Glu Asp Gly Trp Ala Ser Phe Val Asp Ile His Ala
145 150 155 160
Asp Val Phe Gly Ala Gly Glu Val Ser Ala Leu Lys Ser Met Asn Pro
165 170 175
Val Pro Thr Val Gln Glu Arg Asp Arg Ala Leu Arg Tyr Phe Tyr Ala
180 185 190
Leu Trp Cys Leu Arg Glu Ala Tyr Val Lys Met Thr Gly Asp Ala Leu
195 200 205
Leu Ala Ser Trp Leu Lys Asp Leu Glu Met His Asn Phe Ala Pro Pro
210 215 220
Glu Asp Met Lys Glu Ala Gln Glu Val Arg Leu Arg Gly Lys Lys Val
225 230 235 240
Glu Gly Val Asp Met Arg Leu Met Pro Leu Leu Glu Glu Tyr Met Val
245 250 255
Ser Thr Ala Val Arg Asn Gly Asp Asn Gly Glu Ser Val Glu Leu Gly
260 265 270
Glu Phe Gln Ser Leu Asp Leu Glu Glu Ile Leu Ala Phe Gly Glu Gln
275 280 285
Ala Ser Lys Pro
290
<210> 2
<211> 945
<212> DNA
<213> Gibberella fujikuroi
<400> 2
atgagtaggg cccaatcctc acctacggtc atccaatggg tgatcgacac tcgtccactt 60
tggccctccg ctctcaagac caaagacctc acatccgctg taagtgctct ggtcatccac 120
tttaacctga tactcatgtc ataccttagg cttcacgtgc actctcactt ctcaccgagg 180
aggaacaatc ttctgtcctg agatactacc acgtccgcga tgccaagctc gctctcgctt 240
cggctcttct taagcgctac gcaatctctc gcttctgtca cgtcccctgg ttcctggcca 300
agactacgcg agatgcccgt actaagcccg tgtttgtttt gcccagcggg gatgagccgc 360
tgatctttaa cgtctcgcat caggccggtc tcgcggtcct tctggccgtc catgatccgc 420
caaagggcct tgccgtggga gttgatgttg tctgtccgtc agagcgacga gatcgagatc 480
tgagtagctt agaagaagat gggtgggcga gtttcgtcga cattcatgcc gatgtctttg 540
gagcgggaga agtctcagcg cttaagagca tgaaccctgt tcctaccgtc caagaacgag 600
atcgtgcatt gcgctacttt tatgcgctat ggtgtctccg tgaagcctat gtcaagatga 660
caggggacgc tcttctggca agctggttga aagacctaga gatgcacaac tttgccccgc 720
cagaagacat gaaggaagcc caagaggttc gactgagagg caagaaggtt gagggcgtgg 780
acatgagact gatgccgcta cttgaggaat acatggtctc cacagctgta agaaacggtg 840
ataatgggga gagtgtcgag ctcggagagt ttcaaagtct tgatctggag gaaatattgg 900
catttggtga acaggcatcc aaaccatgat cagagaacgt tttat 945
<210> 3
<211> 21
<212> DNA
<213> Unknown (Unknown)
<400> 3
gttccatcca ctcagatccg g 21
<210> 4
<211> 37
<212> DNA
<213> Unknown (Unknown)
<400> 4
caggcttttt catttactgc aactattgcc ttggaat 37
<210> 5
<211> 29
<212> DNA
<213> Unknown (Unknown)
<400> 5
gcagtaaatg aaaaagcctg aactcaccg 29
<210> 6
<211> 24
<212> DNA
<213> Unknown (Unknown)
<400> 6
ttcctattcc tttgccctcg gacg 24
<210> 7
<211> 39
<212> DNA
<213> Unknown (Unknown)
<400> 7
cgagggcaaa ggaataggaa taatgagaaa cgcaagcgc 39
<210> 8
<211> 25
<212> DNA
<213> Unknown (Unknown)
<400> 8
agaagtacaa ggtcttcatc cctga 25
<210> 9
<211> 22
<212> DNA
<213> Unknown (Unknown)
<400> 9
ctaagcacag tagcaatgcc tc 22
<210> 10
<211> 23
<212> DNA
<213> Unknown (Unknown)
<400> 10
ccactatcgg cgagtacttc tac 23
<210> 11
<211> 20
<212> DNA
<213> Unknown (Unknown)
<400> 11
tctccgacct gatgcagctc 20
<210> 12
<211> 23
<212> DNA
<213> Unknown (Unknown)
<400> 12
gctgcaacat acctcctgtt gtc 23

Claims (8)

  1. The application of PPTase protein as a fungal drug target protein in the preparation of drugs for preventing and treating plant scab.
  2. 2. The use according to claim 1, characterized in that the use is: and designing an inhibitor drug taking the protein as a target aiming at the target protein of the fungal drug.
  3. 3. The use according to claim 1 or 2, wherein the amino acid sequence of the fungal drug target protein is as shown in SEQ ID No. 1.
  4. 4.ppt1The application of the gene in preparing the medicine for preventing and treating plant scab.
  5. 5. The use according to claim 1, characterized in that the use is: to the saidppt1Gene design ofppt1An inhibitor drug of a deletion or reduction in gene expression.
  6. 6. The use according to claim 4, wherein the nucleotide sequence of the coding gene of the fungal drug target protein is shown as SEQ ID No. 2.
  7. 7. Use according to claim 1 or 4, characterized in that said plants comprise: rice, wheat, corn, cucumber.
  8. 8. The use as claimed in claim 1 or 4 wherein the phytopathogenic fungi causing head blight include: fusarium graminearum, Fusarium moniliforme, and Gibberella fujikuroi.
CN202210143597.XA 2022-02-17 2022-02-17 Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease Pending CN114369601A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210143597.XA CN114369601A (en) 2022-02-17 2022-02-17 Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210143597.XA CN114369601A (en) 2022-02-17 2022-02-17 Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease

Publications (1)

Publication Number Publication Date
CN114369601A true CN114369601A (en) 2022-04-19

Family

ID=81145559

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210143597.XA Pending CN114369601A (en) 2022-02-17 2022-02-17 Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease

Country Status (1)

Country Link
CN (1) CN114369601A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006060839A2 (en) * 2004-12-10 2006-06-15 Universität Für Bodenkultur Wien Method for identifying ppt inhibitors
CN102776209A (en) * 2012-06-20 2012-11-14 浙江大学 Fungus pathogenic gene MoMon1 from magnaporthe grisea and usage thereof
CN111534525A (en) * 2020-05-22 2020-08-14 山东农业大学 Fusarium graminearum FgARL1 gene and application thereof
CN113563437A (en) * 2021-08-20 2021-10-29 南京农业大学 Drug target protein PMA1 and application thereof in agriculture

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006060839A2 (en) * 2004-12-10 2006-06-15 Universität Für Bodenkultur Wien Method for identifying ppt inhibitors
CN102776209A (en) * 2012-06-20 2012-11-14 浙江大学 Fungus pathogenic gene MoMon1 from magnaporthe grisea and usage thereof
CN111534525A (en) * 2020-05-22 2020-08-14 山东农业大学 Fusarium graminearum FgARL1 gene and application thereof
CN113563437A (en) * 2021-08-20 2021-10-29 南京农业大学 Drug target protein PMA1 and application thereof in agriculture

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
PHILIPP WIEMANN，等: "Deciphering the Cryptic Genome: Genome-wide Analyses of the Rice Pathogen Fusarium fujikuroi Reveal Complex Regulation of Secondary Metabolism and Novel Metabolites，Genbank 登录号 CP023094.1", GENBANK DATABASE, 30 June 2013 (2013-06-30), pages 1 - 35 *
PHILIPP WIEMANN，等: "The Sfp-Type 49-Phosphopantetheinyl Transferase Ppt1 of Fusarium fujikuroi Controls Development, Secondary Metabolism and Pathogenicity", Genbank Database, HE614113.1", GENBANK DATABASE, 31 May 2012 (2012-05-31), pages 1 - 15 *
SABINE ALBERMANN, 等: "Characterization of novel mutants with an altered gibberellin spectrum in comparison to different wild-type strains of Fusarium fujikuroi", APPL MICROBIOL BIOTECHNOL, 31 December 2013 (2013-12-31), pages 1 - 12 *
孟玲宁，等: "新靶点PPTase 抗真菌药物的研究进展", 中国药物化学杂志, vol. 29, no. 1, 28 February 2019 (2019-02-28), pages 69 - 76 *
孟玲宁，等: "磷酸泛酰巯基乙胺基转移酶在真菌和细菌的研究进展", 中国真菌学杂志, vol. 13, no. 5, 31 October 2018 (2018-10-31), pages 305 - 308 *
李超;杨佳羽;刘佳;朱廷恒;: "藤仓赤霉(Gibberella fujikuroi)分子生物学及发酵工程研究进展", 工业微生物, no. 02, 22 April 2016 (2016-04-22), pages 47 - 55 *

Similar Documents

Publication Publication Date Title
CN114107340B (en) Mevalonate kinase gene RKMK and application thereof
Liu et al. Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis
CN111690690B (en) Saccharomyces cerevisiae for producing farnesene
CN112725360B (en) Application of cotton GhHDA6 gene in regulation and control of plant flowering period
CN112280698B (en) Saccharomyces cerevisiae engineering bacteria for high-yield yacholanol type sesquiterpene and construction method and application thereof
CN112852650B (en) Saccharomyces cerevisiae engineering bacterium for high yield of santalene and santalol and construction method and application thereof
Ding et al. Differential roles of three FgPLD genes in regulating development and pathogenicity in Fusarium graminearum
CN110317250B (en) Application of MYB6 gene and encoding protein thereof in regulation and control of verticillium wilt resistance of plants
CN105132288B (en) Novel Antrodia camphorata separation strains and its cultured products
Kumari et al. Heterologous expression of a salinity and developmentally regulated rice cyclophilin gene (OsCyp2) in E. coli and S. cerevisiae confers tolerance towards multiple abiotic stresses
Hamayun et al. Gibberellin production and plant growth enhancement by newly isolated strain of Scolecobasidium tshawytschae
Zheng et al. FoMyo5 motor domain substitutions (Val151 to Ala and Ser418 to Thr) cause natural resistance to fungicide phenamacril in Fusarium oxysporum
CN103194456A (en) Lilium regale antifungal gene Lr14-3-3 and application thereof
Chen et al. Biocontrol potential of Bacillus subtilis CTXW 7-6-2 against kiwifruit soft rot pathogens revealed by whole-genome sequencing and biochemical characterisation
He et al. A novel chorismate mutase from Erysiphe quercicola performs dual functions of synthesizing amino acids and inhibiting plant salicylic acid synthesis
Chou et al. A translationally controlled tumor protein gene Rpf41 is required for the nodulation of Robinia pseudoacacia
JP2019524137A (en) Metabolite production in endophytic fungi
CN114369601A (en) Application of PPTase protein and coding gene in preparation of medicine for preventing and treating plant gibberellic disease
CN114774457B (en) Application of gene Placement 1 in regulation and control of growth, antioxidation and pathogenicity of phytophthora litchi
CN111154665A (en) Recombinant yarrowia lipolytica and construction method and application thereof
CN110117321A (en) Cotton GhDctpp1-D11 gene is promoting the application in flowering of plant
CN110305893B (en) Gossypol biosynthetic pathway gene CYP71BE79 and application thereof
CN114874919A (en) Micafungin precursor FR901379 high-yield strain and application thereof
CN113788883A (en) Magnaporthe grisea MoSpc2 gene and application thereof
CN100404550C (en) Gene MgPTH12 for controlling mature and pathogenicity of fungi appressorium derived from Magnaporthe grisea and its uses

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination