WO2006042145A2

WO2006042145A2 - THE RICE BACTERIAL BLIGHT DISEASE RESISTANCE GENE xa5

Info

Publication number: WO2006042145A2
Application number: PCT/US2005/036220
Authority: WO
Inventors: Susan R. Mccouch; Anjali S. Lyer-Pascuzzi
Original assignee: Cornell Research Foundation, Inc.
Priority date: 2004-10-07
Filing date: 2005-10-07
Publication date: 2006-04-20
Also published as: WO2006042145A3

Abstract

The present invention relates to genes, proteins and methods comprising xa5 in the TFIIAgamma family and the Xa series of plant disease resistance (R) genes. In a preferred embodiment, the present invention relates to altering bacterial blight resistance in plants and microorganisms using xa5 and TFIIAgamma.

Description

THE RICE BACTERIAL BLIGHT DISEASE RESISTANCE GENE xa5

• The present application was funded in part with government support under grant number 2003-35301-13130 from the United States Department of Agriculture. The government may have certain rights in this invention.

FIELD OF THE INVENTION The present invention relates to genes, proteins and methods comprising xa5 in the TFIIAgamma family and the Xa. series of plant disease resistance (R) genes. In a preferred embodiment, the present invention relates to altering bacterial blight resistance in plants and microorganisms using xα5 and TFIIAgαmmα.

BACKGROUND

Oiyzα sαtivα, a staple food crop for billions of people, is subject to a wide variety of diseases, including bacterial blight. Bacterial blight is caused by numerous species (races) of bacteria including but not limited to Xαnthomonαs and Pseudomonαs species. Bacterial blight is a common disease adversely affecting numerous commercial crops and garden plants. In particular, Xαnthomonαs oryzάe pv. oryzαe (Xoo) causes severe rice crop loss in South and Southeast Asia.

Xoo is a common bacterium that persists in soil and water and is spread by numerous natural means. The bacteria can persist through over-wintering (for example on crop residue, fall-sown cereals, and perennial grasses, etc.) and spreads by wind- driven rains, splashing rain-drops, plant-to-plant contact and insects.

Crop management for containing bacterial blight is time and labor consuming. These management tools include direct seeding using disease free seed (rather than transplanting seedlings that might carry pathogenic bacteria), using a 2 to 3 -year crop rotation to avoid the chance of contaminating the newly planted crop, turning under plant debris as soon as possible after harvest to allow enough time for the debris to disintegrate over the winter, and avoiding over-irrigation. Providing disease free seed can be difficult since although treating the surface (for example using hot-water seed treatment) infected seeds often harbor the bacterium. Chemicals are not routinely used because of their ineffectiveness however in a few situations copper-based fungicides can slow disease spread. Therefore, it would be of considerable advantage to provide means of preventing the infection and spreading of bacterium that cause bacterial blight. Further, a means of preventing blight bacterial infections in a cost-effective and environmentally friendly manner would enhance the economic advantages of these crops.

SUMMARY OF THE INVENTION

The present invention relates to genes, proteins and methods comprising xa5 in the TFIIAgamma family and the Xa series of plant disease resistance (R) genes. In a preferred embodiment, the present invention relates to altering bacterial blight resistance in plants and microorganisms using xa5 and TFIIAgamma. The present invention is not limited to any particular sequence encoding a protein having bacterial blight disease resistance activities. The present invention is not limited to any particular sequence encoding a protein having disease resistance activities, hi some embodiments, the invention provides a nucleic acid comprising 'a sequence encoded by a sequence selected from the group consisting of SEQ ID NO:01 and sequences at least 54% identical to SEQ ID NOrOl₃ wherein said sequence encodes a protein having bacterial blight resistance activity, hi other embodiments, the present invention provides a nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In some embodiments, the invention provides an isolated nucleic acid molecule encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein said sequence encodes a polypeptide having bacterial blight resistance activity. In other embodiments, the present invention provides a polypeptide at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein the sequence encodes a polypeptide having bacterial blight resistance activity, hi other embodiments, said polypeptide further comprises a conserved domain having at least a 38% sequence identity to SEQ ID NO:248. In other embodiments, the present invention provides a polypeptide further comprising a conserved domain having at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248. In other embodiments, said polypeptide further comprises a conserved domain having at least a 66% sequence identity to SEQ ID NO: 327. In other embodiments, the present invention provides a polypeptide further comprising a conserved domain having at least 66%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO: 327.

In some embodiments, the invention provides an isolated polypeptide comprising a polypeptide selected from the group consisting of SEQ ID NO:78 and variants thereof, that encodes a polypeptide having bacterial blight resistance activity. In other embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain having at least 95% sequence identity to one or more of SEQ ID NO: 170- 177. In some embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 170- 177.'

In some embodiments, the invention provides an isolated polypeptide having SEQ ID NO:78 and variants thereof that are at least 35% identical to SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, the present invention provides an isolated polypeptide and variants thereof, having bacterial blight resistance activity, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78 wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said polypeptide having bacterial blight resistance activity further comprises a conserved domain having at least 38% sequence identity to SEQ ID NO:248. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248. In other embodiments, said polypeptide further comprises aXoo bacterial blight resistance region having at least 66% sequence identity to SEQ ID NO:327. In other embodiments, the present invention provides a.Xoo bacterial blight resistance region at least 66%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:327-345. In other embodiments, said polypeptide further comprises a conserved domain chosen from one or more of SEQ ID NOs: 248, and 285-326, wherein said conserved domain interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95% sequence identity to one or more of SEQ ID NO : 170- 177. In some embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 170-177.

In some embodiments, the present invention provides a nucleic acid and variants thereof at least 95% identical to any of SEQ ID NOs:195-217, wherein the sequence encodes a protein having disease resistance activity. In some embodiments, the present invention provides a nucleic acid and variants thereof at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said nucleic acid interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95% sequence identity to one or more of SEQ ID NO: 170- 177. In some embodiments, said nucleic acid interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof having at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 170-177. In some embodiments, the invention provides an isolated polypeptide comprising a polypeptide selected from the group consisting of SEQ ID NOs:248 and variants thereof, that encodes a polypeptide having bacterial blight resistance activity. In other embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95% sequence identity to one or more of SEQ ID NO: 170-177. In some embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 170-177. In some embodiments, said polypeptide interacts with a pathogen polypeptide consisting of an acidic domain and variants thereof, having at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 170-177. In some embodiments, the invention provides an isolated polypeptide comprising a polypeptide selected from the group consisting of SEQ ID NOs:248, 285-326 and variants thereof, that encodes a polypeptide having bacterial blight resistance activity.

In some embodiments, the invention provides a vector construct comprising a nucleic acid at least 54% identical to SEQ ID NO:01, wherein said sequence encodes a protein having bacterial blight resistance activity. In other embodiments, the present invention provides a nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, said nucleic acid is operably linked to an endogenous promoter. In other embodiments, said nucleic acid is operably linked to an exogenous promoter. In other embodiments, said exogenous promoter is a eukaryotic promoter. In other embodiments, said eukaryotic promoter is active in a plant. In other embodiments, said vector is a eukaryotic vector. In other embodiments, said eukaryotic vector is a plant vector. In other embodiments, said plant vector is a T-DNA vector. In other embodiments, said vector is a prokaryotic vector.

In some embodiments, the invention provides an expression vector comprising a nucleic acid molecule encoding a polynucleotide at least 35% identical to SEQ ID NO:78, wherein the polypeptide has bacterial blight resistance activity. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said nucleic acid molecule is operably linked to an exogenous promoter. In other embodiments, said vector is a eukaryotic vector. In other embodiments, said eukaryotic vector is a plant vector. In other embodiments, said plant vector is a T-DNA vector. In other embodiments, said vector is a prokaryotic vector. In other embodiments, said polypeptide further comprises a conserved domain having at least a 38% sequence identity to SEQ ID NO:248, operably linked to an exogenous promoter. In other embodiments, the present invention provides a polypeptide further comprising a conserved domain having at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248. In other embodiments, said polypeptide further comprises a Xoo resistance domain having at least an 66% sequence identity to one or more of SEQ ID NOs: 327-345, operably linked to an exogenous promoter. In other embodiments, the present invention provides a Xoo bacterial blight resistance region at least 66%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:327- 345.

In some embodiments, the invention provides an expression vector, expression vector, comprising a first nucleic acid sequence encoding a nucleic acid product that interferes with the expression of a second nucleic acid sequence encoding a polypeptide at least 35% identical to SEQ ID NO:78. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said nucleic acid product that interferes is an antisense sequence. In other embodiments, said nucleic acid product that interferes is a dsRNA that mediates RNA interference.

In some embodiments, the invention provides a transgenic plant comprising a nucleic acid molecule at least 54% identical to SEQ ID NO:01, wherein the nucleic acid encodes a polypeptide having bacterial blight resistance activity. In other embodiments, the present invention provides a nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01 , wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, said plant is chosen from one or more members of a grass, a vegetable, and a fruit. In other embodiments, said plant is chosen from one or more members of a rice, a cotton, a potato, a pepper, a tomato, and a maize. In other embodiments, said plant is chosen from one or more members of a crop plant, an ornamental plant and a tree.

In some embodiments, the invention provides a method for producing a transgenic plant resistant to bacterial blight comprising; a) providing: i) a target plant; ii) gene fragments comprising one or more of SEQ ID NOs: 195-217; and b) producing a transgenic plant comprising one or more of SEQ ID NOs: 195-217, wherein the transgenic plant is resistant to bacterial blight. In other embodiments, said target plant is subject to bacterial blight infection. In other embodiments, said bacterial blight infection is caused by one or more of a Xαnthomonαs and a Pseudomonαs bacterium. In other embodiments, said target plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In some embodiments, the invention provides a transgenic plant comprising a nucleic acid molecule at least 54% identical to SEQ ID NO:01, wherein the nucleic acid is altered by homologous recombination. In other embodiments, the present invention provides a nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, said altered nucleic acid is chosen from one or more of SEQ ID NOs. : 195-217. In other embodiments, said altered nucleic acid encodes a polypeptide having bacterial blight resistance activity. In other embodiments, said plant is chosen from one or more members of a grass, a vegetable, and a fruit. In other embodiments, said plant is chosen from one or more members of a crop plant, an ornamental plant and a tree. In other embodiments, said plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In some embodiments, the invention provides a transgenic plant comprising a nucleic acid molecule encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein the polypeptide has bacterial blight resistance activity. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO: 78, wherein said polypeptide having bacterial blight resistance activity.

In some embodiments, the invention provides a transgenic plant comprising an exogenous nucleic acid molecule encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein the polypeptide has bacterial blight resistance activity. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, ^'65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said polypeptide comprises a Xoo resistance domain having at least 66% sequence identity to SEQ ID NOs:327-345, operably linked to a heterologous promoter. In other embodiments, the present invention provides aXoo bacterial blight resistance region at least 66%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:327-345. In other embodiments, said exogenous nucleic acid molecule is operably linked to a eukaryotic promoter. In other embodiments, said eukaryotic promoter is active in a plant. In other embodiments, said transgenic plant is chosen from one or more members of a grass, a vegetable, and a fruit. Li other embodiments, said transgenic plant is chosen from one or more members of a crop plant, an ornamental plant and a tree. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper.

In some embodiments, the invention provides a transgenic plant comprising an exogenous nucleic acid encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein the polypeptide has bacterial blight activity. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said plant is chosen from one or more members of a grass, a vegetable, a fruit, a crop plant, an ornamental plant and a tree. In other embodiments, said crop plant is a rice. In other embodiments, said grass comprises one or more of a cotton, a soybean, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In other embodiments, said plant comprises one or more parts for vegetative propagation. In other embodiments, said parts for vegetative propagation comprises one or more sprigs, plugs, stolons, meristem, rhizomes and sod. In other embodiments, the present invention provides a seed of the transgenic plant. In other embodiments, the present invention provides a tiller of the transgenic plant. In other embodiments, the present invention provides an expression vector, comprising a first nucleic acid sequence encoding a nucleic acid product that interferes with the expression of a second nucleic acid sequence encoding a polypeptide at least 35% identical to SEQ ID NO:78. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%Xor more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said nucleic acid product that interferes is an antisense sequence. In other embodiments, said nucleic acid product that interferes is a dsRNA that mediates RNA interference.

In some embodiments, the invention provides a method for altering the phenotype of a plant, comprising: a) providing; i) an expression vector comprising a nucleic acid sequence encoding; ii)a polypeptide at least 35% identical to SEQ ID NO:78, wherein the polypeptide has bacterial blight resistance activity; and iii) plant tissue; and b) transforming the plant tissue with the vector so that the phenotype of a plant derived from said plant tissue is altered. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said plant tissue comprises one or more of calli, primordial meristem, root cells, and endosperm. In some embodiments, the invention provides a method for altering bacterial blight resistance, comprising: a) providing a vector construct comprising a nucleic acid encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein the polypeptide alters bacterial blight infections; and b) producing a plant comprising the vector, wherein the plant exhibits altered bacterial blight resistance. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said altered bacterial blight resistance is an increase in resistance to Xanthomonas bacterial infections. In some embodiments, the invention provides an expression vector, comprising a first nucleic acid sequence encoding a nucleic acid product that interferes with the expression of a second nucleic acid sequence encoding a polypeptide at least 35% identical to SEQ ID NO:78. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein said polypeptide having bacterial blight resistance activity. In other embodiments, said nucleic acid product that interferes is an antisense sequence. In other embodiments, said nucleic acid product that interferes is a dsRNA that mediates RNA interference. In other embodiments, said transgenic plant is a crop plant.

In some embodiments, the invention provides a transgenic plant cell comprising a nucleic acid sequence encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and wherein the nucleic acid sequence is heterologous to the plant cell. In other embodiments, the present invention provides a polypeptide and variants thereof, at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a transgenic plant seed comprising a nucleic acid sequence encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and wherein the nucleic acid sequence is heterologous to the plant seed. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein the sequence encodes a protein having bacterial blight resistance activity. In some embodiments, the invention provides a transgenic plant comprising a nucleic acid encoding a polypeptide at least 38% identical to SEQ ID NO:248, operably linked to a promoter, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a method for altering the phenotype of a plant, comprising: a) providing; i) an expression vector comprising a nucleic acid sequence encoding a polypeptide at least 38% identical to SEQ ID NO:248, and ii) plant tissue; and b) transforming the plant tissue with the vector under conditions that alter the phenotype of a plant. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a method for altering bacterial resistance, comprising: a) providing a vector construct comprising a nucleic acid encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity; and b) producing a plant comprising the vector, wherein the plant exhibits altered bacterial resistance. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing; i) an expression vector comprising a nucleic acid encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and ii) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a method for producing bacterial resistance, comprising: a) providing a transgenic host cell comprising a heterologous nucleic acid sequence, wherein the heterologous nucleic acid sequence encodes a polypeptide at least 38% identical to SEQ ID NO:248, under conditions sufficient for expression of the encoded protein; and b) culturing the transgenic host cell under conditions such that bacterial resistance is produced. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%,

55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity.

In some embodiments, the invention provides a bacterial resistance expression cassette, comprising, providing, a first nucleic acid at least 54% homologous to SEQ ID NO:01, wherein said first nucleic acid encodes a polypeptide have bacterial blight resistance activity and a second nucleic acid at least 95% homologous to one or more of SEQ ID NOs:72, 73, 74, 75, 76 and 77, and fragments thereof, wherein said second nucleic acid has disease resistance activity. In other embodiments, the present invention provides a first second nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, the present invention provides a first nucleic acid and variants thereof at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 195 -217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, the present invention provides a second nucleic acid and fragments thereof, at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:72, 73, 74, 75, 76 and 77, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said bacterial resistance expression cassette further comprises, a second nucleic acid encoding a polypeptide and fragments thereof, at least 95% homologous to one or more of SEQ ID NOs: 135-163. In other embodiments, the present invention provides a second nucleic acid sequence encoding a polypeptide and fragments thereof, at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:135-163. In other embodiments, the present invention provides a first nucleic acid and variants thereof at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said bacterial resistance expression cassette further comprises, a promoter in operable combination with said nucleic acid. In other embodiments, said nucleic acid molecule is operably linked to an exogenous promoter.

In some embodiments, the invention provides a bacterial resistance expression vector construct comprising, providing, a first nucleic acid at least 54% homologous to SEQ ID NO:01, wherein said first nucleic acid encodes a polypeptide have bacterial blight resistance activity and a second nucleic acid at least 95% homologous to one or more of SEQ ID NOs: 72, 73, 74, 75, 76 and 77, and fragments thereof, wherein said second nucleic acid has disease resistance activity, and an expression vector, hi other embodiments, the present invention provides a first second nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, the present invention provides a nucleic acid and variants thereof, at least 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78 and 195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said vector is a eukaryotic vector. In other embodiments, said eukaryotic vector is a plant vector. In other embodiments, said plant vector is a T-DNA vector. In other embodiments, said vector is a prokaryotic vector.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing, i) a first nucleic acid at least 54% homologous to SEQ ID NO:01, wherein said first nucleic acid encodes a polypeptide have bacterial blight resistance activity and ii) a second nucleic acid at least 95% homologous to one or more of SEQ ID NOs:72, 73, 74, 75, 76 and 77, and fragments thereof, wherein said second nucleic acid has disease resistance activity, and iii) an expression vector; and vi) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, the present invention provides a first second nucleic acid at least 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:01, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, the present invention provides a second nucleic acid and variants thereof at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs:195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said bacterial resistance expression cassette further comprises, a nucleic acid at least 95% homologous to one or more of SEQ ID NOs: 72, 73, 74, 75, 76 and 77, and fragments thereof. In other embodiments, the present invention provides a nucleic acid and variants thereof at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said bacterial resistance expression cassette further comprises, a nucleic acid at least 95% homologous to SEQ ID NO:135-163.

In other embodiments, the present invention provides a nucleic acid and variants thereof, at least 95%, 98%, 99% (or more) identical to any of SEQ ID NOs: 195-217, wherein the sequence encodes a protein having disease resistance activity. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In some embodiments, the invention provides a method for producing bacterial resistance, comprising: a) providing a transgenic host cell comprising a bacterial resistance expression vector construct, under conditions sufficient for expression of the encoded proteins; and b) culturing the transgenic host cell under conditions such that bacterial resistance is produced. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing; i) an expression vector comprising a bacterial resistance expression vector construct, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and ii) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper.

In some embodiments, the invention provides a method for producing bacterial resistance, comprising: a) providing a transgenic host cell comprising a heterologous nucleic acid sequence, wherein the heterologous nucleic acid sequence encodes a polypeptide at least 38% identical to SEQ ID NO:248, under conditions sufficient for expression of the encoded protein; and b) culturing the transgenic host cell under conditions such that bacterial resistance is produced. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing; i) an expression vector comprising a nucleic acid encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and ii) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the sequence encodes a protein having bacterial blight resistance activity. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In some embodiments, the invention provides a method for producing bacterial resistance, comprising: a) providing a transgenic'host cell comprising a bacterial resistance expression vector construct, under conditions sufficient for expression of the encoded proteins; and b) culturing the transgenic host cell under conditions such that bacterial resistance is produced. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing; i) an expression vector comprising a bacterial resistance expression vector construct, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and ii) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, said transgenic plant is chosen from one or more of a rice, a cotton, a soybean, a potato, a sorghum, a maize, a wheat, a barley, a sugarcane, a tomato, and a pepper. In some embodiments, the invention provides an xa5 genetic test for the Xoo bacterial blight resistance mutation, comprising, providing, SEQ ID NO: 164 and SEQ ID NO: 165 for detecting a nucleic acid at position 39 of SEQ ID NO:78.

In some embodiments, the invention provides a plant gene therapy homologous recombination nucleic acid vector for replacing endogenous nucleotides comprising, a) providing, i) an xa5 gene, ii) an xa5 gene promoter, wherein said promoter is in operable combination with the xa5 gene fragment, iii) an xa5 intron sequence; and iv) a plasmid for inducing homologous recombination, and b) combining said xa5 promoter, xa5 gene, xa5 intron sequence and plasmid for constructing a plant gene therapy homologous recombination nucleic acid vector. In other embodiments, said vector is transfected into Agrobacterium tumefaciens.

In some embodiments, the invention provides a plant gene therapy homologous recombination nucleic acid vector for replacing endogenous nucleotides comprising, a) providing, i) an xa5 gene, ii) an xa5 gene promoter, wherein said promoter is in operable combination with the xa5 gene fragment, iii) a homologous recombination nucleic acid vector, wherein said vector does not contain an hpt nucleic acid and does not contain an Env nucleic acid, and iv) an xa5 intron sequence; and b) combining said xa5 promoter, xa5 gene, xa5 intron sequence and , iii) a homologous recombination nucleic acid vector for constructing a plant gene therapy homologous recombination nucleic acid vector. In other embodiments, said vector is transfected into Agrobacterium tumefaciens. In some embodiments, the invention provides a targeted plant gene therapy nucleic acid vector for replacing endogenous nucleotides comprising, a) providing: i) an xa5 gene fragment, ii) an xa5 gene promoter, wherein said promoter is in operable combination with the xa5 gene fragment, iii) a homologous recombination nucleic acid vector, and iv) an xa5 intron sequence; and b) combining said xa5 promoter, xa5 gene, xa5 intron sequence and vector for forming a plant gene therapy homologous recombination nucleic acid vector. In other embodiments, said vector is transfected into Agrohacterium tumefaciens.

In some embodiments, the invention provides a method for altering the bacterial resistance of a plant, comprising: a) providing; i) an expression vector comprising a nucleic acid encoding a polypeptide at least 38% identical to SEQ ID NO:248, wherein the nucleic acid sequence encodes a protein having bacterial resistance activity, and ii) plant tissue; and b) introducing the vector into the plant tissue under conditions such that the protein encoded by the nucleic acid sequence is expressed so that the plant tissue exhibits altered bacterial resistance. In other embodiments, the present invention provides an isolated polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:78, wherein the sequence encodes a protein having bacterial blight resistance activity, hi some embodiments, the invention provides a vector comprising a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 327-345 for replacing endogenous nucleotides.

In some embodiments, the invention provides a peptide mimic comprising a polypeptide at least 38% identical to SEQ ID NO:248, wherein said peptide mimic alters bacterial blight activity. In other embodiments, the present invention provides a polypeptide and variants thereof at least 38%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% (or more) identical to any of SEQ ID NO:248, wherein the peptide mimic alters bacterial blight activity.

DESCRIPTION OF THE FIGURES

Figure 1 shows exemplary embodiments that demonstrate relevant recombinants within the region containing xa5 that allowed narrowing of the region to approximately 8kb containing TFIIAgamma. Arrows indicate the direction of transcription. SNPs = Single Nucleotide Polymorphisms; R = resistant; S = susceptible. Base pairs refer to relative distances along the IR24 BAC.

Figure 2 shows exemplary embodiments that demonstrate RT-PCR analysis of TFIIAgamma and Q94HL4. The experiment was repeated three times; typical results are shown. Twenty, 25, 30, 35 and 40 cycles of amplification were used for PCR. 1: uninoculated plants; 2: Two hours post wounding; 3: Two hours post inoculation (PI) with X. oryzae pv. oryzae PXO 86; 4: four hours PI; 5: eight hours PI; 6: 24 hours PI; 7: 48 hours PI.

Figure 3 shows exemplary embodiments that demonstrate protein sequence, gene structure and resistant and susceptible haplotypes of TFIIAgamma. A) Resistant and susceptible TFIIAgamma sequences from isolines IRBB5 and IR24 respectively. These amino acid sequences are identical except the substitution at position 39 (italicized) in exon 2. B) Resistant and susceptible haplotypes in the four exons of rice TFIIAgamma. Dashes represent stretches of common nucleotides in the cDNA, circles represent the SNPs. Nucleotides in this region in the isolines IR24 (S) and IRBB5 (R) and in the japonica subspecies Nipponbare (S) are identical except the circles. Numbers in parentheses indicate the number of Aus-Boro rices sequenced with this genotype. R = resistant to race 2 of A' oryzae pv. oryzae,' Sl= First haplotype susceptible to race 2 of X. oryzae pv. oryzae, S2 = Second haplotype susceptible to race 2 of X. oryzae pv. oryzae. 1 = silent nucleotide substitution: CTT (leucine) CTC (leucine). 2 = Functional Nucleotide polymorphism: GTC (valine in susceptible varieties) GAG (glutamic acid in resistant varieties).

Figure 4 shows exemplary embodiments that demonstrate nucleic acid sequences for TFIIAgamma, SEQ ID NOs:01-53; Os SBP, SEQ ID NOs:54; AvrxaS, SEQ ID NO:55 AvrXa7-3M, SEQ ID NO:56; AwXaIO, SEQ ID NO:57; XAI, SEQ ID NOs:58-61; Xa4, SEQ ID NOs:62-63; Xa21, SEQ ID NOs:64-65; Pib and homologs, SEQ ID NOs:66-68; rice rust resistance YrIO, SEQ ID NO:69; rice pi-ta, SEQ ID NO:70-71; MIo, SEQ ID NOs:72-73; and Bs2, SEQ ID NOs:74-77.

Figure 5 shows exemplary embodiments that demonstrate amino acid sequences for TFIIAgamma, SEQ ID NOs:78-84; TFIIAgamma, SEQ ID NOs:85-130; Os SBP, SEQ ID NOs:131; Avrxa5, SEQ ID NO:132 AvrXa7-3M, SEQ ID NO:133; AvrXalO, SEQ ID NO: 134; XAl and XAl-like, SEQ ID NOs:135-144; Xa21, SEQ ID NOs: 145- 147; Xa26, SEQ ID NOs:148-149; Pib and homologs SEQ ID NOs:150-154; rice rust resistance YrIO SEQ ID NO:155; rice pi-ta, SEQ ID NOs:156-158; and MIo₅ SEQ ID NOs:159-160 and Bs2, SEQ ID NOs:161-163. Figure 6 shows exemplary embodiments that demonstrate PCR primers, SEQ ID NOs:164-169; acidic activation domains, SEQ ID NOs:170-177; and TFIIAgamma promoter, SEQ ID NO: 178.

Figure 7 shows exemplary embodiments that demonstrate Xa5 polypeptide variants SEQ ID NOs: 179-194.

Figure 8 shows exemplary embodiments that demonstrate a conserved domain (NA), SEQ ID NOs: 195-217, and homologous regions of TFIIAgamma, SEQ ID NOs:218-247.

Figure 9 shows exemplary embodiments that demonstrate a conserved domain (AA), SEQ ID NOs:248-284.

Figure 10 shows exemplary embodiments that demonstrate Variants of a conserved domain (AA), SEQ ID NOs: 249 and 285-326.

Figure 11 shows exemplary embodiments that demonstrate aXoo resistance domain (AA), SEQ ID NOs:327-348. Figure 12 shows exemplary embodiments that demonstrate homologous recombination sequences for gene targeting, SEQ ID NOs:349-358; Xα5 promoter region, SEQ ID NOs:259; mdXctS genomic fragment, SEQ ID NO:360.

DEFINITIONS To facilitate an understanding of the present invention, a number of terms and phrases as used herein are defined below: The use of the article "a" or "an" is intended to include one or more.

The term plant cell "compartments or organelles" is used in its broadest sense. The term includes but is not limited to, the endoplasmic reticulum, Golgi apparatus, trans Golgi network, plastids, sarcoplasmic reticulum, glyoxysomes, mitochondrial, chloroplast, thylakoid membranes and nuclear membranes, and the like.

The terms "transcription factor HA" and "TFIIA" refer to a protein comprising multiple subunits involved in transcriptional regulation.

The terms "transcription factor HA gamma," "TFIIA-gamma," "TFIIA small subunit," "TFIIAgamma," and "TFIIAγ" are used interchangeably to refer to a subunit involved with transcriptional regulation. TFIIAgamma may be referred to by multiple names in different species. For example, in Oryza sativa TFIIAgamma is also referred to as "Transcription initiation factor IIA gamma chain;" in Arabidopsis thaliana (Mouse-ear cress) "TFIIA is also referred to as "Transcription initiation factor IIA gamma chain," "TFIIAgamma" and "TFIIA-S;" in S. cerevisiae (Baker's yeast) "Transcription initiation factor IIA small chain," "TFIIA 13.5 kDa subunit," and "TOA2;" in Caenorhabditis elegans "TFIIA is also referred to as Probable transcription initiation factor IIA gamma chain," "TFIIA P12 subunit," "TFIIA-12," "TFIIAS," and "TFIIA-gamma;" in Drosophila melanogaster (Fruit fly) TFIIA is also referred to as "Transcription initiation factor ILA gamma chain," "TFIIA P14 subunit," "TFIIA-14," "dTFIIA-S," "TFIIA-gamma," and "TfIIA-S;" in (Rainbow trout) (Salmo gairdneri) TFIIA is also referred to as "Transcription initiation factor IIA gamma chain," "TFIIA P12 subunit," "TFIIA-12," "TFIIAS," "TFIIA-gamma," and "GTF2A2;" in Xenopus laevis (African clawed frog) TFIIA is also referred to as "Transcription factor IIA small subunit;" in Paralichthys olivaceus (Japanese flounder) TFIIA is also referred to as "Transcription initiation factor IIA gamma chain "TFILA P12 subunit," "TFIIA-12," "TFIIAS," "TFIIA-gamma," and "GTF2A2;" in Rattus norvegicus (Rat) TFIIA is also referred to as Transcription initiation factor IIA gamma chain "TFIIA P12 subunit," "TFIIA-12," "TFIIAS," "TFIIA small subunit" and "TFIIA¬ gamma;" in Mus musculus (Mouse) TFIIA is also referred to as Gtf2a2;" in Homo sapiens (Human) TFIIA is also referred to^: as "Transcription initiation factor IIA gamma chain "TFIIA P12 subunit," "TFIIA-12," "TFIIAS," "TFIIA-gamma," "GTF2A2," and "TF2A2." This list is not meant to be inclusive. These designations are not meant to be exclusive and for the purposes of the present invention they may be used interchangeably with TFIIA gamma. The terms "plant resistance gene" and "R gene" refer to a gene that alters plant disease resistance.

The terms "bacterial blight" and "BB" refer to a disease caused when a bacterium infects the vascular system of plants. The term "BB infection" refer to a lesion, for example a colored lesion such as a tannish-grey, yellow, whitish straw color or white lesion on leaf blades, often along the veins of leaves. Symptoms are often observed at the tillering stage, with disease incidence increasing¹ with plant growth and peaking at the flowering stage. Bacterial ooze may be observed on infected leaves. In grains such as rice, when infection occurs during panicle initiation or subsequently during stages that precede flowering, a severe impairment of grain development and a consequent increase in sterility was observed. The term "Kresek" refer to a more destructive manifestation of the disease, wherein the leaves of the entire plant turn pale yellow and wilt during the seedling to the early tillering stage, resulting in a partial or total crop failure.

The terms "bacterial blight pathogen" and "bacterial blight pathogens" refer to a bacterium that infects the vascular system of plants. Examples of a bacterial blight pathogen include but are not limited to Xanthomonas and Pseudomonas species. It is not meant to limit the species that cause bacterial blight. Examples of such species are Xanthomonas oryzae pv. oryza, Xanthomonas oryzae pv. vesicatoria, Xanthomonas oryzae pv. malvacearum and the like,

The terms "Xanthomonas oryzae pv. oryzae" and "Xoo" refer to a yellow, slime- producing, motile, gram negative rod bacterium with a polar fiagellum. A Xoo bacterium can cause infection by entering a host through wounds or natural openings.

The terms "bacterial blight activity" refers to the capability of a protein to alter the infectious capability of a bacterial blight pathogen, for example to alter the symptoms of bacterial blight infection. The term "having bacterial blight activity" refers to the ability of a protein to alter the infectious capability of a bacterial blight pathogen. For example, increasing or decreasing the size and number of lesions when exposed to a bacterial blight pathogen as compared to a control.

The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of an RNA, or a polypeptide or its precursor (e.g. , proinsulin). A functional polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence as long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the polypeptide are retained. The term "portion" when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. The term "a nucleotide comprising at least a portion of a gene" may comprise fragments of the gene or the entire gene. The term "cDNA" refers to a nucleotide copy of the "messenger RNA" or "mRNA" for a gene. In some embodiments, cDNA is derived from the mRNA. In some embodiments, cDNA is derived from genomic sequences. In some embodiments, cDNA is derived from EST sequences. In some embodiments, cDNA is derived from assembling portions of coding regions extracted from a variety of BACs, contigs, Scaffolds and the like.

The term "BAC" and "bacterial artificial chromosome" refers to a vector carrying a genomic DNA insert, typically 100-200 kb. The term " SSR" and "simple sequence repeat" refers to a unit sequence of DNA (2 to 4 bp) that is repeated multiple times in tandem wherein common examples of these in mammalian genomes include runs of dinucleotide or trinucleotide repeats (for example, CACACACACACACACACA)."

The term "EST" and "expressed sequence tag" refers to a unique stretch of DNA within a coding region of a gene; approximately 200 to 600 base pairs in length.

The term "contig" refers to an overlapping collection of sequences or clones.

The term "gene" encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA.

The sequences which are located 5' of the coding region and which are present on the mRNA are referred to as 5' non-translated sequences. The sequences which are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region termed "exon" or "expressed regions" or "expressed sequences" interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5' and 3¹ end of the sequences that are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5 ' or 3' to the non-translated sequences present on the mRNA transcript). The 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3' flanking region may contain sequences that direct the termination of transcription, posttranscriptional cleavage and polyadenylation.

The terms "allele" and "alleles" refer to each version of a gene for a same locus that has more than one sequence. For example, there are multiple alleles for eye color at the same locus. The terms "recessive," "recessive gene," and "recessive phenotype" refers to an allele that has a phenotype when two alleles for a certain locus are the same as in "homozygous" or as in "homozygote" and then partially or fully loses that phenotype when paired with a more dominant allele as when two alleles for a certain locus are different as in "heterozygous" or in "heterozygote." The terms "dominant," "dominant," and "dominant phenotype" refers to an allele that has an effect to suppress the expression of the other allele in a heterozygous (having one dominant and one recessive allele) condition.

The term "heterologous" when used in reference to a gene or nucleic acid refers to a gene that has been manipulated in some way. For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to a non-native promoter or enhancer sequence, etc.). Heterologous genes may comprise plant gene sequences that comprise cDNA forms of a plant gene; the cDNA sequences may be expressed in either a sense (to produce mRNA) or anti-sense orientation (to produce an anti-sense RNA transcript that is complementary to the mRNA transcript). Heterologous genes are distinguished from endogenous plant genes in that the heterologous gene sequences are typically joined to nucleotide sequences comprising regulatory elements such as promoters that are not found naturally associated with the gene for the protein encoded by the heterologous gene or with plant gene sequences in the chromosome, or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).

The term "nucleic acid sequence," "nucleotide sequence of interest" or " nucleic acid sequence of interest" refers to any nucleotide sequence (e.g., RNA or DNA), the manipulation of which may be deemed desirable for any reason (e.g., treat disease, confer improved qualities, etc.), by one of ordinary skill in the art. Such nucleotide sequences include, but are not limited to, coding sequences of structural genes (e.g., reporter genes, selection marker genes, oncogenes, drug resistance genes, growth factors, etc.), and non- coding regulatory sequences which do not encode an mRNA or protein product (e.g. , promoter sequence, polyadenylation sequence, termination sequence, enhancer sequence, etc.).

The term "structural" when used in reference to a gene or to a nucleotide or nucleic acid sequence refers to a gene or a nucleotide or nucleic acid sequence whose ultimate expression product is a protein (such as an enzyme or a structural protein), an rRNA, an sRNA, a tRNA, and the like.

The term "oligonucleotide" refers to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof.

The term "polynucleotide" refers to refers to a molecule comprised of several deoxyribonucleotides or ribonucleotides, and is used interchangeably with oligonucleotide. Typically, oligonucleotide refers to shorter lengths, and polynucleotide refers to longer lengths, of nucleic acid sequences.

The term "an oligonucleotide (or polypeptide) having a nucleotide sequence encoding a gene" or "a nucleic acid sequence encoding" a specified polypeptide refers to a nucleic acid sequence comprising the coding region of a gene or in other words the nucleic acid sequence which encodes a gene product. The coding region may be present in either a cDNA, genomic DNA or RNA form. When present in a DNA form, the oligonucleotide may be single-stranded (i.e., the sense strand) or double-stranded. Suitable control elements such as enhancers/promoters, splice junctions, polyadenylation signals, and the like, may be placed in close proximity to the coding region of the gene if needed to permit proper initiation of transcription and/or correct processing of the primary RNA transcript. Alternatively, the coding region utilized in the expression vectors of the present invention may contain endogenous enhancers, exogenous promoters, splice junctions, intervening sequences, polyadenylation signals, and the like, or a combination of both endogenous and exogenous control elements. The terms "complementary" and "complementarity" refer to polynucleotides {i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." Complementarity may be "partial," in which some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.

The term "SNP" and "Single Nucleotide Polymorphism" refers to a single base difference found when comparing the same DNA sequence from two different individuals. The term "partially homologous nucleic acid sequence" refers to a sequence that at least partially inhibits (or competes with) a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a sequence that is completely complementary to a target under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target which lacks even a partial degree of identity (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-identical target.

The term "substantially homologous" when used in reference to a double-stranded nucleic acid sequence such as a cDNA or genomic clone refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low to high stringency as described above.

The term "substantially homologous" when used in reference to a single-stranded nucleic acid sequence refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low to high stringency as described above.

The term "hybridization" refers to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T_m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be "self-hybridized."

The term "T_m" refers to the "melting temperature" of a nucleic acid. The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. The equation for calculating the T_m of nucleic acids is well known in the art. As indicated by standard references, a simple estimate of the T_m value may be calculated by the equation: T_n, = 81.5 + 0.41(% G + C), when a nucleic acid is in aqueous solution at 1 M NaCl (See e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985)). Other references include more sophisticated computations that take structural as well as sequence characteristics into account for the calculation of T_m.

The term "stringency" refers to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. With "high stringency" conditions, nucleic acid base pairing will occur between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of "low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.

"Low stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH₂PO₄H₂O and 1.85 g/1 EDTA₅ pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt's reagent (5OX Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V; Sigma)) and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42°C when a probe of about 500 nucleotides in length is employed. "Medium stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH₂PO₄H₂O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.

"High stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH₂PO₄H₂O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and lOOμg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0. IX SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.

It is well known that numerous equivalent conditions may be employed to comprise low stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions. In addition, the ail knows conditions that promote hybridization under conditions of high stringency (e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.). "Amplification" is a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (/. e. , replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of "target" specificity. Target sequences are "targets" in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out.

Template specificity is achieved in most amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under conditions they are used, will process specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. For example, in the case of Q βreplicase, MDV-I RNA is the specific template for the replicase (Kacian et al, Proc. Natl. Acad. Sci. USA, 69:3038-3042 (1972), herein incorporated by reference). Other nucleic acid will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al, Nature, 228(268):227-231 (1970), herein incorporated by reference). In the case of T4 DNA lϊgase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (Wu and Wallace, Genomics, 4(4):560-569 (1989), herein incorporated by reference). Finally, Taq and Pfu polymerases, by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press (1989), herein incorporated by reference).

The term "amplifiable nucleic acid" refers to nucleic acids that may be amplified by any amplification method. It is contemplated that "amplifiable nucleic acid" will usually comprise "sample template." The term "sample template" refers to nucleic acid originating from a sample that is analyzed for the presence of "target" (defined below). In contrast, "background template" is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is most often inadvertent. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.

The term "primer" refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.

The term "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, that is capable of hybridizing to another oligonucleotide of interest. A probe may be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention will be labeled with any "reporter molecule," so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.

The term "target," when used in reference to the polymerase chain reaction refers to the region of nucleic acid bounded by the primers used for polymerase chain reaction. Thus, the "target" is sought to be sorted out from other nucleic acid sequences. A "segment" is defined as a region of nucleic acid within the target sequence. The term "polymerase chain reaction" ("PCR") refers to the method of K.B. MuIUs U.S. Patent Nos. 4,683,195, 4,683,202, and 4,965,188, all of which are herein incorporated by reference, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times {i.e., denaturation, annealing and extension constitute one "cycle"; there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the "polymerase chain reaction" (hereinafter "PCR"). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified."

With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies {e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of ³²P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications. The terms "PCR product," "PCR fragment," and "amplification product" refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

The term "amplification reagents" refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.) needed for amplification except for primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, and the like).

The term "reverse-transcriptase" or "RT-PCR" refers to a type of PCR where the starting material is mRNA. The starting mRNA is enzymatically converted to complementary DNA or "cDNA" using a reverse transcriptase enzyme. The cDNA is then used as a "template" for a "PCR" reaction. The term "positional cloning" refers to an identification of a gene based on its physical location in the genome.

The term "expression" when used in reference to a nucleic acid sequence, such as a gene, refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (i.e., via the enzymatic action of an RNA polymerase), and into protein where applicable (as when a gene encodes a protein), through "translation" of mRNA. Gene expression can be regulated at many stages in the process. "Up-regulation" or "activation" refers to regulation that increases the production of gene expression products (i.e., RNA or protein), while "down-regulation" or "repression" refers to regulation that decrease production. Molecules (e.g. , transcription factors) that are involved in up-regulation or down-regulation are often called "activators" and "repressors," respectively.

The terms "in operable combination", "in operable order" and "operably linked" refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced. The term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced. The term "regulatory element" refers to a genetic element that controls some aspect of the expression of nucleic acid sequences. For example, a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, and the like.

Transcriptional control signals in eukaryotes comprise "promoter" and "enhancer" elements. Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis, et al, Science 236:1237, (1987), herein incorporated by reference). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect, mammalian and plant cells. Promoter and enhancer elements have also been isolated from viruses and analogous control elements, such as promoters, are also found in prokaryotes. The selection of a particular promoter and enhancer depends on the cell type used to express the protein of interest. Some eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review, see Maniatis, et al, supra (1987), herein incorporated by reference).

The terms "promoter element," "promoter," or "promoter sequence" refer to a DNA sequence that is located at the 5' end {i.e. precedes) of the coding region of a DNA polymer. The location of most promoters known in nature precedes the transcribed region. The promoter functions as a switch, activating the expression of a gene. If the gene is activated, it is said to be transcribed, or participating in transcription. Transcription involves the synthesis of mRNA from the gene. The promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA. The term "regulatory region" refers to a gene's 5' transcribed but untranslated regions, located immediately downstream from the promoter and ending just prior to the translational start of the gene.

The term "promoter region" refers to the region immediately upstream of the coding region of a DNA polymer, and is typically between about 500 bp and 4 kb in length, and is preferably about 1 to 1.5 kb in length. Promoters may be tissue specific or cell specific. The term "tissue specific" as it applies to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., seeds) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (e.g. , leaves). Tissue specificity of a promoter may be evaluated by, for example, operably linking a reporter gene to the promoter sequence to generate a reporter construct, introducing the reporter construct into the genome of a plant such that the reporter construct is integrated into every tissue of the resulting transgenic plant, and detecting the expression of the reporter gene (e.g., detecting mRNA, protein, or the activity of a protein encoded by the reporter gene) in different tissues of the transgenic plant. The detection of a greater level of expression of the reporter gene in one or more tissues relative to the level of expression of the reporter gene in other tissues shows that the promoter is specific for the tissues in which greater levels of expression are detected. The term "cell type specific" as applied to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term "cell type specific" when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g. , immunohistochemical staining. Briefly, tissue sections are embedded in paraffin, and paraffin sections are reacted with a primary antibody that is specific for the polypeptide product encoded by the nucleotide sequence of interest whose expression is controlled by the promoter. A labeled (e.g., peroxidase conjugated) secondary antibody that is specific for the primary antibody is allowed to bind to the sectioned tissue and specific binding detected (e.g., with avidin/biotin) by microscopy.

Promoters may be "constitutive" or "inducible." The term "constitutive" when made in reference to a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a stimulus (e.g., heat shock, chemicals, light, etc.). Typically, constitutive promoters are capable of directing expression of a transgene in substantially any cell and any tissue. In contest, an "inducible" promoter is one that is capable of directing a level of transcription of an operably linked nucleic acid sequence in the presence of a stimulus (e.g., heat shock, chemicals, light, etc.) that is different from the level of transcription of the operably linked nucleic acid sequence in the absence of the stimulus. The term "regulatory element" refers to a genetic element that controls some aspect of the expression of nucleic acid sequence(s). For example, a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, and the like. The enhancer and/or promoter may be "endogenous" or "exogenous" or

"heterologous." An "endogenous" enhancer or promoter is one that is naturally linked with a given gene in the genome. An "exogenous" or "heterologous" enhancer or promoter is one that is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of the gene is directed by the linked enhancer or promoter. For example, an endogenous promoter in operable combination with a first gene can be isolated, removed, and placed in operable combination with a second gene, thereby making it a "heterologous promoter" and a "exogenous promoter" in operable combination with the second gene. A variety of such combinations are contemplated (e.g., the first and second genes can be from the same species, or from different species).

The term "naturally linked" or "naturally located" when used in reference to the relative positions of nucleic acid sequences means that the nucleic acid sequences exist in nature in the relative positions.

The presence of "splicing signals" on an expression vector often results in higher levels of expression of the recombinant transcript in eukaryotic host cells. Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook, et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989) pp. 16.7-16.8, herein incorporated by reference). A commonly^' Used splice donor and acceptor site is the splice junction from the 16S RNA of SV4θ. Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length. The term "poly(A) site" or "poly(A) sequence" as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable, as transcripts lacking a poly(A) tail are unstable and are rapidly degraded. The poly(A) signal utilized in an expression vector may be "heterologous" or "endogenous." An endogenous poly(A) signal is one that is found naturally at the 3' end of the coding region of a given gene in the genome. A heterologous poly(A) signal is one which has been isolated from one gene and positioned 3' to another gene. A commonly used heterologous poly(A) signal is the SV40 poly(A) signal. The SV40 poly(A) signal is contained on a 237 bp BamEI/Bcll restriction fragment and directs both termination and polyadenylation (Sambrook, supra, at 16.6-16.7).

The term "vector" refers to nucleic acid molecules that transfer DNA segment(s). Transfer can be into a cell, cell to cell, anii the like. The term "vehicle" is sometimes used interchangeably with "vector."

The term "transfection" refers to the introduction of foreign DNA into cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, glass beads, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, viral infection, biolistics (i.e., particle bombardment) and the like. The term "stable transfection" or "stably transfected" refers to the introduction and integration of foreign DNA into the genome of the transfected cell. The term "stable transfectant" refers to a cell that has stably integrated foreign DNA into the genomic DNA.

The term "transient transfection" or "transiently transfected" refers to the introduction of foreign DNA into a cell where the foreign DNA fails to integrate into the genome of the transfected cell. The foreign DNA persists in the nucleus of the transfected cell for several days. During this time the foreign DNA is subject to the regulatory controls that govern the expression of endogenous genes in the chromosomes. The term "transient transfectant" refers to cells that have taken up foreign DNA but have failed to integrate this DNA. The term "calcium phosphate co-precipitation" refers to a technique for the introduction of nucleic acids into a cell. The uptake of nucleic acids by cells is enhanced when the nucleic acid is presented as a calcium phosphate-nucleic acid co-precipitate. The original technique of Graham and van der Eb (Graham and van der Eb, Virol., 52:456 (1973), herein incorporated by reference), has been modified by several groups to optimize conditions for particular types of cells. The art is well aware of these numerous modifications.

The terms "infecting" and "infection" when used with a bacterium refer to co- incubation of a target biological sample, (e.g., cell, tissue, etc.) with the bacterium under conditions such that nucleic acid sequences contained within the bacterium are introduced into one or more cells of the target biological sample.

The terms "bombarding, "bombardment," and "Holistic bombardment" refer to the process of accelerating particles towards a target biological sample (e.g., cell, tissue, etc.) to effect wounding of the cell membrane of a cell in the target biological sample and/or entry of the particles into the target biological sample. Methods for biolistic bombardment are known in the art (e.g., U.S. Patent No. 5,584,807, 6,153,813, herein incorporated by reference), and are commercially available (e.g., the helium gas-driven microprojectile accelerator (PDS- 1000/He, BioRad).

The term "microwounding" when made in reference to plant tissue refers to the introduction of microscopic wounds in that tissue. Microwounding may be achieved by, for example, particle bombardment as described herein.

The term "Agrobacterium" refers to a soil-borne, Gram-negative, rod-shaped phytopathogenic bacterium which causes crown gall. The term "Agrohacterium" includes, but is not limited to, the strains Agrobacterium tumefaciens, (which typically causes crown gall in infected plants), and Agrobacterium rhizogens (which^'causes hairy root disease in infected host plants). Infection of a plant cell with Agrobacterium generally results in the production of opines (e.g., nopaline, agropine, octopine etc.) by the infected cell. Thus, Agrobacterium strains which cause production of nopaline {e.g., strain GV3101, LBA4301, C58, A208, etc.) are referred to as "nopaline-type" Agrobacteria; Agrobacterium strains which cause production of octopine {e.g., strain LBA4404, Ach5, B6, etc.) are referred to as "octopine-type" Agrobacteria; and Agrobacterium strains which cause production of agropine {e. g., strain EHAl 05, EHAlOl, A281, etc.) are referred to as "agropine-type" Agrobaceria.

The term "transgene" refers to a foreign gene that is placed into an organism by the process of transfection. The term "foreign gene" refers to any nucleic acid {e.g., gene sequence) that is introduced into the genome of an organism by experimental manipulations and may include gene sequences found in that organism so long as the introduced gene does not reside in the same location as does the naturally-occurring gene. The terms "transformants" or "transformed cells" include the primary transformed cell and cultures derived from that cell without regard to the number of transfers. Resulting progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.

The term "selectable marker" refers to a gene which encodes an enzyme having an activity that confers resistance to an antibiotic or drug upon the cell in which the selectable marker is expressed, or which confers expression of a trait which can be detected {e.g., luminescence or fluorescence). Selectable markers may be "positive" or "negative." Examples of positive selectable markers include the neomycin phosphotrasferase (NPTII) gene that confers resistance to G418 and to kanamycin, and the bacterial hygromycin phosphotransferase gene {hyg), which confers resistance to the antibiotic hygromycin. Negative selectable markers encode an enzymatic activity whose expression is cytotoxic to the cell when grown in an appropriate selective medium. For example, the HS Y-tk gene is commonly used as a negative selectable marker. Expression of the ΗSV-tk gene in cells grown in the presence of gancyclovir or acyclovir is cytotoxic; thus, growth of cells in selective medium containing gancyclovir or acyclovir selects against cells capable of expressing a functional HSV TK enzyme. The term "reporter gene" refers to a gene encoding a protein that may be assayed.

Examples of reporter genes include, but are not limited to, luciferase {See, e.g., de Wet et al, MoI. Cell. Biol. 7(2):725-237 (1987) and U.S. PatNos., 6,074,859; 5,976,796; 5,674,713; and 5,618,682; all of which are herein incorporated by reference), green fluorescent protein (e.g. , GenBank Accession Number U43284; a number of GFP variants are commercially available from CLONTECH Laboratories, Palo Alto, CA, herein incorporated by reference), chloramphenicol acetyltransferase, beta-galactosidase, alkaline phosphatase, and horse radish peroxidase.

The term "wild-type" when made in reference to a gene refers to a functional gene common throughout an outbred population. The term "wild-type" when made in reference to a gene product refers to a functional gene product common throughout an outbred population. A functional wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the "normal" or "wild-type" form of the gene. In contrast, the term "modified" or "mutant" when made in reference to a gene or to a gene product refers, respectively, to a gene or to a gene product which displays modifications in sequence and/or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product.

The term "homology" when used in relation to nucleic acids or proteins refers to a degree of identity. There may be partial homology or complete homology. The terms "homolog," "homologue,"" "homologous," and "homology" when used in reference to amino acid sequence or nucleic acid sequence or a protein or a polypeptide refers to a degree of sequence identity to a given sequence, or to a degree of similarity between conserved regions, or to a degree of similarity between three-dimensional structures or to a degree of similarity between the active site, or to a degree of similarity between the mechanism of action, or to a degree of similarity between functions. In some embodiments, a homolog has a greater than 20% sequence identity to a given sequence. In some embodiments, a homolog has a greater than 40% sequence identity to a given sequence. In some embodiments, a homolog has a greater than 60% sequence identity to a given sequence. In some embodiments, a homolog has a greater than 70% sequence identity to a given sequence. In some embodiments, a homolog has a greater than 90% sequence identity to a given sequence. In some embodiments, a homolog has a greater than 95% sequence identity to a given sequence. In some embodiments, homology is determined by comparing internal conserved sequences to a given sequence. In some embodiments, homology is determined by comparing designated conserved functional regions. In some embodiments, means of determining homology are described in the Experimental section.

The term "homology" when used in relation to nucleic acids or proteins refers to a degree of identity. There may be partial homology or complete homology. The following terms are used to describe the sequence relationships between two or more polynucleotides and between two or more polypeptides: "identity," "percentage identity," "identical," "reference sequence", "sequence identity", "percentage of sequence identity", and "substantial identity." "Sequence identity" refers to a measure of relatedness between two or more nucleic acids or proteins, and is described as a given as a percentage "of homology" with reference to the total comparison length. A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, the sequence that forms an active site of a protein or a segment of a full-length cDNA sequence or may comprise a complete gene sequence. Since two polynucleotides or polypeptides may each (1) comprise a sequence {i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window," as used herein, refers to a conceptual segment of in internal region of a polypeptide. In one embodiment, a comparison window is at least 77 amino acids long. In another embodiment, a comparison window is at least 84 amino acids long. In another embodiment, conserved regions of proteins are comparison windows. In a further embodiment, an amino acid sequence for a conserved transmembrane domain is 24 amino acids. An example of a comparison window for a percent homology determination of the present invention is shown in Fig. 10 and described in Example 1. Calculations of identity may be performed by algorithms contained within computer programs such as the ClustalX algorithm (Thompson, et al. Nucleic Acids Res. 24, 4876-4882 (1997), herein incorporated by reference); MEGA2 (version 2.1) (Kumar, et al. Bioinformatics 17, 1244-1245 (2001);"GAP" (Genetics Computer Group, Madison, Wis.) and "ALIGN" (DNAStar, Madison, Wis., all of which are herein incorporated by reference).

For comparisons of nucleic acids, 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (Smith and Waterman, Adv. Appl. Math. 2: 482 (1981)) by the homology alignment algorithm of Needleman and Wunsch (Needleman and Wunsch, J. MoI. Biol. 48:443 (1970), herein incorporated by reference), by the search for similarity method of Pearson and Lipman (Pearson and Lipman, Proc. Natl. Acad. ScL (U.S.A.) 85:2444 (1988), herein incorporated by reference), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected. The term "sequence identity" means that two polynucleotide or two polypeptide sequences are identical (i. e. , on a nucleotide-by-nucleotide basis or amino acid basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) or amino acid, in which often conserved amino acids are taken into account, occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison. The reference sequence may be a subset of a larger sequence, for example, as a segment of the full-length sequences of the compositions claimed in the present invention.

In some embodiments, homologs may be used to generate recombinant DNA molecules that direct the expression of the encoded protein product in appropriate host cells. The term "recombinant" when made in reference to a nucleic acid molecule refers to a nucleic acid molecule that is comprised of segments of nucleic acid joined together by means of molecular biological techniques. The term "recombinant" when made in reference to a protein or a polypeptide refers to a protein molecule that is expressed using a recombinant nucleic acid molecule. The term "antisense" refers to a deoxyribonucleotide sequence whose sequence of deoxyribonucleotide residues is in reverse 5' to 3' orientation in relation to the sequence of deoxyribonucleotide residues in a sense strand of a DNA duplex. A "sense strand" of a DNA duplex refers to a strand in a DNA duplex that is transcribed by a cell in its natural state into a "sense mRNA." Thus an "antisense" sequence is a sequence having the same sequence as the non-coding strand in a DNA duplex. The term "antisense

RNA" refers to a RNA transcript that is complementary to the entire target transcript or part of a target primary transcript or mRNA and that blocks the expression of a target gene by interfering with the processing, transport and/or translation of its primary transcript or mRNA. The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence. In addition, as used herein, antisense RNA may contain regions of ribozyme sequences that increase the efficacy of antisense RNA to block gene expression. "Ribozyme" refers to a catalytic RNA and includes sequence-specific endoribonucleases. "Antisense inhibition" refers to the production of antisense RNA transcripts capable of preventing the expression of the target protein. The term "siRNAs" refers to short interfering RNAs. In some embodiments, siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to or substantially complementary to a target RNA molecule. The strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand," and is also complementary to the siRNA antisense strand. siRNAs may also contain additional sequences; non- limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.

The term "target RNA molecule" refers to an RNA molecule to which at least one strand of the short double-stranded region of an siRNA is homologous or complementary. Typically, when such homology or complementary is about 100%, the siRNA is able to silence or inhibit expression of the target RNA molecule. Although it is believed that processed mRNA is a target of siRNA, the present invention is not limited to any particular hypothesis, and such hypotheses are not necessary to practice the present invention. Thus, it is contemplated that other RNA molecules may also be targets of siRNA. Such targets include unprocessed mRNA, ribosomal RNA, and viral RNA genomes.

The term "posttranscriptional gene silencing" or "PTGS" refers to silencing of gene expression in plants after transcription, and appears to involve the specific degradation of mRNAs synthesized from gene repeats. The term "cosuppression" refers to silencing of endogenous genes by heterologous genes that share sequence identity with endogenous genes. The term "overexpression" generally refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms. The term "cosuppression" refers to the expression of a foreign gene that has substantial homology to an endogenous gene resulting in the suppression of expression of both the foreign and the endogenous gene. As used herein, the term "altered levels" refers to the production of gene product(s) in transgenic organisms in amounts or proportions that differ from that of normal or non-transformed organisms.

The terms "overexpression" and "overexpressing" and grammatical equivalents, are specifically used in reference to levels of mRNA to indicate a level of expression approximately 3 -fold higher than that typically observed in a given tissue in a control or non-transgenic animal. Levels of mRNA are measured using any of a number of techniques known to those skilled in the art including, but not limited to Northern blot analysis. Appropriate controls are included on the Northern blot to control for differences in the amount of RNA loaded from each tissue analyzed (e.g., the amount of 28S rRNA, an abundant RNA transcript present at essentially the same amount in tissues used for comparison, present in each sample can be used as a means of normalizing or standardizing the RAD50 mRNA-specific signal observed on Northern blots).

The terms "Southern blot analysis" and "Southern blot" and "Southern" refer to the analysis of DNA on agarose or acrylamide gels in which DNA is separated or fragmented according to size followed by transfer of the DNA from the gel to a solid support, such as nitrocellulose or a nylon membrane. The immobilized DNA is then exposed to a labeled probe to detect DNA species complementary to the probe used. The DNA may be cleaved with restriction enzymes prior to electrophoresis. Following electrophoresis, the DNA may be partially depurinated and denatured prior to or during transfer to the solid support. Southern blots are a standard tool of molecular biologists (J. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, pp 9.31-9.58, herein incorporated by reference).

The term "Northern blot analysis" and "Northern blot" and "Northern" refer to the analysis of RNA by electrophoresis of RNA on agarose gels to fractionate the RNA according to size followed by transfer of the RNA from the gel to a solid support, such as nitrocellulose or a nylon membrane. The immobilized RNA is then probed with a labeled probe to detect RNA species complementary to the probe used. Northern blots are a standard tool of molecular biologists (J. Sambrook, et al. supra, pp 7.39-7.52, (1989), herein incorporated by reference). The terms "Western blot analysis" and "Western blot" and "Western" refers to the analysis of protein(s) (or polypeptides) immobilized onto a support such as nitrocellulose or a membrane. A mixture comprising at least one protein is first separated on an acrylamide gel, and the separated proteins are then transferred from the gel to a solid support, such as nitrocellulose or a nylon membrane. The immobilized proteins are exposed to at least one antibody with reactivity against at least one antigen of interest. The bound antibodies may be detected by.various methods, including the use of radiolabeled antibodies.

The terms "protein," "polypeptide," "peptide," "encoded product," "amino acid sequence," are used interchangeably to refer to compounds comprising amino acids joined via peptide bonds and. A "protein" encoded by a gene is not limited to the amino acid sequence encoded by the gene, but includes post-translational modifications of the protein. Where the term "amino acid sequence" is recited herein to refer to an amino acid sequence of a protein molecule, the term "amino acid sequence" and like terms, such as "polypeptide" or "protein" are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule. Furthermore, an "amino acid sequence" can be deduced from the nucleic acid sequence encoding the protein. The deduced amino acid sequence from a coding nucleic acid sequence includes sequences which are derived from the deduced amino acid sequence and modified by post-translational processing, where modifications include but not limited to glycosylation, hydroxylations, phosphorylations, and amino acid deletions, substitutions, and additions. Thus, an amino acid sequence comprising a deduced amino acid sequence is understood to include post-translational modifications of the encoded and deduced amino acid sequence.

The term "antigenic determinant" refers to that portion of an antigen that makes contact with a particular antibody (i.e., an epitope). When a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies that bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determinants. An antigenic determinant iriay compete with the intact antigen (i.e., the "immunogen" used to elicit the immune response) for binding to an antibody. The term "isolated" when used in relation to a nucleic acid or polypeptide, as in

"an isolated oligonucleotide" refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids, such as DNA and RNA, are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid encoding a particular protein includes, by way of example, such nucleic acid in cells ordinarily expressing the protein, where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid or oligonucleotide may be present in single-stranded or double-stranded form. When an isolated nucleic acid or oligonucleotide is to be utilized to express a protein, the oligonucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide may single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide may b'e double-stranded).

The term "purified" refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated. An "isolated nucleic acid sequence" is therefore a purified nucleic acid sequence. "Substantially purified" molecules are at least 60% free, preferably at least 75% free, and more preferably at least 90% free from other components with which they are naturally associated. As used herein, the term "purified" or "to purify" also refer to the removal of contaminants from a sample. The removal of contaminating proteins results in an increase in the percent of polypeptide of interest in the sample. In another example, recombinant polypeptides are expressed iii plant, bacterial, yeast, or mammalian host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.

The term "portion" when used in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from four amino acid residues to the entire amino sequence minus one amino acid. The term "sample" is used in its broadest sense. In one sense it can refer to a plant cell or tissue. In another sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from plants or animals (including humans) and encompass fluids, solids, tissues, and gases. Environmental samples include environmental material such as surface matter, soil, water, and industrial samples. These examples are not to be construed as limiting the sample types applicable to the present invention.

The term "ortholog" refers to a gene in different species that evolved from a common ancestral gene by speciation. In some embodiments, orthologs retain the same function. The term "paralog" refers to genes related by duplication within a genome. In some embodiments, paralogs evolve new functions. In further embodiments, a new function of a paralog is related to the original function.

The terms "Xa," "Pi," "Bsp," "Xa series," "Pi series," and "Bsp series" refer to groups of plant resistance genes and proteins. The terms "Xa" and "Xa series" refers to any and all of "Xa," "XaI -26," and "xa-like" genes and proteins relating to bacterial blight resistance/susceptibility. In some embodiments, genes in the same subfamily, (e.g. TFIIAgamma), usually share at least 35% identity.

The terms "xa5 gene," "xa5," and ^uxa5 allele," refers to a recessive plant resistance gene in which a substitution mutation results in partial or complete bacterial blight resistance, or alteration of bacterial blight resistance, in a genetic background where the wild type or non-mutant phenotype "Xa5 gene" or "Xa5" or "Xa5 allele" or TFIIAgammal refers to a dominant plant resistance gene that allows susceptibility to bacterial blight infection (as demonstrated in Fig. 2).

The terms "Xa gene," "Xa," ¹Xa allele," and the like, refer to Xa R genes e.g., SEQ ID NOs:01-09 in rice. It is not meant to limit the number or type of Xa genes. In some embodiments, Xa genes are one or more of Xal-Xa26. In some embodiments a numerated Xa gene may include more than one allele. However it is not meant to limit the total number of Xa genes. The present invention identifies numerated Xa genes, for example, xa5,Xal,Xa4, Xal3, Xa21 andXa26,for example, SEQ ID NOs:58-65. The present invention identifies XA polypeptides encoded by Xa genes or related homologs; these polypeptides are referred .to by number, for example, XA5, XAl, XA4, XA21, XA26 e.g., SEQ ID NOs:135-149.

The terms "xa5" and Xa5" are used herein interchangeably to refer to TFIIAgamma alleles and proteins in plants.

The terms "TFIIAgamma5" and "TFIIAgamma5" refer to alleles and their encoded proteins encoded by nucleotides located on chromosome 5 in rice (Oryza sativa), for example, SEQ ID NO:01.

The terms "TFIIAgammal" and "TFIIAgammal" refer to alleles and their encoded proteins encoded by nucleotides located on chromosome 1 in rice (Oryza sativa), for example, SEQ ID NO:02.

The term "TFIIAgamma" refers to either and both of TFIIAgamma5 and TFIIAgammal unless specifically designated herein.

DESCRIPTION OF THE INVENTION

The present invention relates to genes, proteins and methods comprising the TFIIAgamma family and the Xa series of plant disease resistance (R) genes. In a preferred embodiment, the present invention relates to altering bacterial blight resistance in plants and microorganisms using xa5 and TFIIAgamma subunits. Thus, the present invention provides compositions comprising xa5 genes and coding sequences, xa5 polypeptides, variants of xa5 polypeptides, portions of xa5 polypeptides, mimics of xa5 polypeptides, and in particular to expression vectors encoding xa5. Examples of Xa5 compositions are provided,_,/ør example, U.S. Patent Appln. No., 20040123343A1, all of which are herein incorporated by reference, however these compositions do not provide the xa5 of the present invention. The invention further provides compositions comprising cassettes of plant disease altering genes and coding sequences, for example xa5 genes and coding sequences, XA genes and coding sequences, Pib genes and coding sequences, pi¬ ta genes and coding sequences, mlό genes and coding sequences, Bs3 genes and coding sequences, and in particular to expression vectors encoding combinations of these genes as cassettes for altering disease resistance. The present invention provides methods for identifying genes involved in bacterial blight resistance. These methods include first screening a population of specifically bred plants (for example, Oryza sativa plants) for recessive mutants that exhibit bacterial blight resistance, or in other words mutants that are more resistant to bacterial blight infections. Identification of an xa5 resistance allele was determined by positional cloning. xa5 encodes a TFIIAgamma gene and defines a new class {e.g. subfamily) of xa genes within the Xa series of disease resistant genes.

The present invention also provides methods for using xa5 genes, and xa5 polypeptides; such methods include but are not limited to use of these genes to produce transgenic plants, to produce increasing bacterial blight resistance, to increase bacterial blight resistance, to decrease bacterial blight resistance, to alter bacterial blight resistance, to alter phenotypes, and for controlled disease resistance. It may be desirable to target the nucleic acid sequence of interest to a particular locus on the plant genome. Site- directed integration of the nucleic acid sequence of interest into the plant cell genome, for example gene targeting, may be achieved by, for example, homologous recombination.

Some embodiments of the present invention contemplate compositions and methods for accomplishing homologous recombination and gene targeting; a plant gene therapy. For example, replacing endogenous nucleotides with exogenous nucleotides can be accomplished by a variety of constructs and transformation methods. It is not meant to limit the types of homologous recombination constructs and transformation methods. In one embodiment, site specific nucleotide replacement can be accomplished using a gene therapy construct comprising, providing, one or more of a vector, a promoter, an intron sequence, a selection marker, a diphtheria toxin A-fragment, a terminator, a recombinase, and replacement nucleic acids. Examples of such promoter nucleic acids are provided, but not limited to, SEQ ID NOs: 178 and 359; cauliflower mosaic virus 35S promoter, see, examples herein. Examples of such intron sequences and exon nucleic acids are provided, but not limited to, for example, SEQ ID NO: 360. Examples of such a vector are provided, but not limited to, pINA134, and the like. Examples of such a selection marker are provided, but not limited to, a positive selection marker (for example, a hygromycin resistance gene, a kanamycin resistance gene, an imidazoline resistance gene, a glyphosate resistance gene, a phosphomannose-isomerase gene, a blasticidin S resistance gene, a bar gene and a glyphosinate resistance gene, and the like), a negative selection marker (for example, a diphtheria toxin A-fragment, and the like). In some embodiments, it is contemplated that a selection marker would be eliminated following isolation of transgenic plants, for example, Hohn et al., Elimination of selection markers from transgenic plants, Current Opinion in Biotech., 12:139-143, (2001).

Examples of such a terminator are provided, but not limited to, a CaMV35S terminator, a transcription termination region of maize En/Spm transposon (Gierl et al., Molecular interactions between the components of the En-I transposable element system of Zea mays, EMBO J. 4:579-583, (1985)), and the like. Examples of such a recombinase are provided, but not limited to, a Cre recombinase, for example, in Srivastava and Ow, Biolistic mediated site-specific intergration in rice, Molecular breeding, 8:345-349 (2001), and the like.

Examples of such replacement nucleic acids are provided, but not limited to, nucleic acids encoding one or more of SEQ ID NOs:195-217, 349-359 and varients thereof. Examples of gene replacement constructs contemplated by the present invention are provided using site specific homologous recombination as demonstrated in International Patent Nos.WO03020940/EP1428885, WO9925821; Iida and Terada, A tale of two integrations, transgene and T-DNA: gene targeting by homologous recombination in rice, Curr Opin Biotechnol, 15(2): 132-138 (2004); Terada et al, Efficient gene targeting by homologous recombination in rice, Nat Biotechnol, 20(10): 1030-1034 (2002), International Patent No.WO0208409A2, and Srivastava and Ow, Biolistic mediated site-specific intergration in rice, Molecular breeding, 8:345-349 (2001), all of which are herein incorporated by reference. Examples of gene replacement methods contemplated by the present invention are provided using site specific homologous recombination as demonstrated in Terada et al. , A large-scale Agrobacterium-mediated transformation procedure with a strong positive-negative selection for gene targeting in rice (Oryza sativa L.), Plant Cell Rep, 22(9): 653-659 (2004); Echt and Schwartz, Evidence for the inclusion of controlling elements within the structural gene at the waxy locus in maize, Genetics 99:275-284 (1981); Hajdukiewicz et al, The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant MoI Biol, 25:989-994 (1994); McElroy et al, Construction of expression vectors based on the rice actin (Actl) 5' region for use in monocot transformation, MoI Gen Genet, 231: 150-160 (1991); Nelson, The Waxy locus in maize. I. Intralocus recombination frequency estimates by pollen and by conventional analyses, Genetics 47:737-742 (1962); Wessler and Varagona, Molecular basis of mutations in the Waxy locus of maize: correlation with the fine structure genetic map, Proc. Nail. Acad. Sci. USA 82:4177-4181 (1985); Srivastava et al, Single-copy transgenic wheat generated through the resolution of complex integration patterns, Proc Natl Acad Sci U S A, 96(20): 11117-11121 (1999); Srivastava and Ow, Single-copy primary transformants of maize obtained through the co- introduction of a recombinase-expressing construct, Plant MoI Biol, 46(5):561-566 (2001 }; Srivastava and Ow, Rare instances of Cre-mediated deletion product maintained in transgenic wheat, Plant MoI Biol, 52(3):661-668 (2003); U.S. Patent Nos. 5,464,764, 5,501,967, 6,187,994, 6,746,870Bl, 9,765,613, U.S. Patent Appln. Nos., 20020123145A1; 20040091885Al; International Patent Nos. WO9925821, WO98US24610; EP0628082, and WO0208409A2; all of which are herein incorporated by reference.

Examples of gene replacement constructs and methods for gene families in plants are demonstrated by U.S. Patent No. 6,524,856 and related U.S. Patent Appln., No. 20040091885 A 1 ; all of which are herein incorporated by reference. Contemplated methods specific for rice and potato plants include those described in U.S. Patents Nos. 6,329,571; 5,591,616; and 5,925,804; all of which are herein incorporated by reference.

Some embodiments of the present invention contemplate compositions and methods using a binary vector system for homologous recombination, a plasmid-based technique for introduction of specific genes into plant cells. In some embodiments, the introduction of specific genes is site-specific. Examples of such introduction in rice are demonstrated in U.S. Patents 5,501,967; £(535,381; 5,731,179; 5,925,804 (CZ290830); International Patent Nos. EP628,082 Bl (former application EP628,082 Al); EP687,73OA1; WO9114782A1; and a co-integrated plasmid, U.S. Patent 4,693,976; International Patent No., EP 120,515 Bl; all of which are herein incorporated by reference. Some embodiments of the present invention contemplate compositions and methods for increasing disease resistance using disease resistance expression cassettes. For example, increasing disease resistance with exogenous nucleotides in a disease resistance cassette can be accomplished by a variety of constructs and transformation methods. It is not meant to limit the types of disease resistance cassette constructs and transformation methods. In one embodiment, increasing disease resistance with exogenous nucleotides can be accomplished using a disease resistance cassette construct comprising, providing, one or more of a vector, a promoter, an intron sequence, a selection marker, a diphtheria toxin A-fragment, a terminator, a recombinase, and nucleic acids involved with disease resistance. Examples of such disease resistance nucleic acids are provided, but not limited to, a combination of SEQ ID NO:01 in combination with one or more of SEQ ID NOs:58-77, 195-217and/or nucleic acids encoding polypeptides, but not limited to, one or more of SEQ ID NOs:78-79, 135-163, 179-194, 248, 285-326, 327-348, and fragments thereof.

Examples of compositions and methods for increasing disease resistance in plants, including but not limited to; Xa4 - Gnanamanickam, et ah, An overview of bacterail blight disease of rice and strategies for its management, Current Sci, 77(11): 1435-1443, XaI 3 - Sanchez et ah, Genetic and Physical mapping of xa!3, a recessive bacterial blight resistance gene in rice, International Plant & Animal Genome VII Conference, P320, (1999), Xa21 - U.S. Patent Nos. 5,952,485, 5,977,434, 5977434; U.S. Patent Appln. No., 20020092041 Al, International Patent Nos., WO01/62896, WO09909151, JP10257894, NZ302843; and Wang et ah, The cloned gene, Xa21, confers resistance to multiple

Xanthomonas oryzae pv. oryzae isolates in transgenic plants, MoI Plant Microbe Interact, 9(9): 850-855 (1996); all of which are herein incorporated by reference, Xa26 - Sun et al. , Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein, Plant J, 37(4): 517-527 (2004); a combination of xa5, xal3, and xa21 using traditional breeding methods, Sanchez et al., Sequence tagged site marker-assisted selection for three bacterial blight resistance genes in rice, Crop Sci 40:792-797 (2000), combinations of xa genes including a combination of Xa4, xa5, xal3, and Xa21 using traditional breeding methods, Li et ah, Are the dominant and recessive plant disease resistance genes similar?: A case study of rice R genes and Xanthomonas oryzae pv. oryzae Races, Genetics 159:757-765 (2001) Pib - Wang et al., The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes, The Plant J, 19(l):55-64 (1999); Pi-ta - U.S. Patent No., 6479731, U.S. Patent Appln. No., 20020148004A1, International Patent No., WO00/08162, Bryan et al, A Single Amino Acid Difference Distinguishes Resistant and Susceptible Alleles of the Rice Blast Resistance Gene Pi-ta, The Plant Cell, 12:2033- 2045 (2000), all of which are herein incorporated by reference, Bs2 - Tai et al ,

Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato, Proc Natl Acad Sci U S A, 96(24): 14153-14158 (1999); U.S. Patent Nos., 6,262,343, 6,762,285, U.S. Patent Appln. No., 20020012981A1, International Patent No., WOO 107635 all of which are herein incorporated by reference, OsSBP - Sawada et al., Enhanced resistance to blast fungus and bacterial blight in transgenic rice constitutively expressing OsSBP, a rice homologue of mammalian selenium-binding proteins, Biosci Biotechnol Biochem, 68(4): 873-880 (2004), NPRland homologs - Fitzgerald et al, Overexpression of (At)NPRl in rice leads to a BTH- and environment-induced lesion- mimic/cell death phenotype, MoI Plant Microbe Interact, 17(2): 140-151 (2004); U.S. Patent Appln. No., 2003017241 IAl and Chern et al , Evidence for a disease-resistance pathway in rice similar to the NPRl -mediated signaling pathway in Arabidopsis, Plant J, 27(2): 101-113 (2001), U.S. Patent Appln. No., 20030140375A1, all of which are herein incorporated by reference.

Some embodiments of the present invention contemplate compositions and methods for increasing disease resistance using additional disease resistance genes, for example, further comprising, Xa23 isogenic lines, International Patent No., CN1241630; Gu et al, High-resolution genetic mapping of Xa27(t), a new bacterial blight resistance gene in rice, Oryza sativa L, Theor Appl Genet, 108(5): 800-807 (2004) and Bacillus thuringiensis BT crystalline protein, U.S. Patent No., 5,436,391, all of which are herein incorporated by reference.

The present invention is not limited to the use of any particular homolog, variant or mutant of xa5 protein or xa5 gene. Indeed, in some embodiments, a variety of xa5 proteins or xa5 genes, variants and mutants may be used so long as they retain at least some of the activity of altering bacterial blight resistance. In some embodiments, a variety of xa5 proteins or xa5 genes, variants and mutants may be used so long as they increase bacterial blight resistance. In particular, it is contemplated that a protein encoded by the nucleic acid of SEQ ID NOs: 01-53, 195-247, 349-358, and 360, find use in the present invention. In particular, it is contemplated that a protein exemplified by SEQ ID NOs:78-130, 179-194, 248-284, 285-326, 327-348, find use in the present invention. Further, it is contemplated that a protein encoded by the nucleic acid of SEQ ID NOs:54-77, find use in the present invention. Further, it is contemplated that proteins exemplified by SEQ ID NOs:131-163, 170-177, 179-194, 248-348, find use in the present invention. In particular, it is contemplated that nucleic acids encoding polypeptides at least 36% identical to SEQ ID NO :0 land the corresponding encoded proteins find use in the present invention. Accordingly in some embodiments, the percent identity is at least 36%, 40%, 60%, 70%, 80%, 90%, 95% (or more) to SEQ ID NO:01. Functional variants can be screened for by expressing the variant in an appropriate vector (described in more detail below) in a plant cell and analyzing the bacterial blight resistance of the plant. The present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism of action is not needed to practice the present invention. The following description describes genes and pathways involved in regulating disease resistance, with an emphasis on bacterial blight resistance or lack thereof. Also described are methods for identifying genes involved in disease resistance, and of the xa5 alleles and mutants and related TFIIAgamma genes discovered through use of these methods. These xa5 and TFIIAgamma related genes have been identified, cloned, and characterized. This description also provides methods of identifying, isolated, characterizing and using these genes and their encoded proteins. In addition, the description provides specific, but not limiting, illustrative examples of embodiments of the present invention.

I. PLANT DISEASE RESISTANCE GENES

Substantial plant research has been devoted to the study of plant disease resistance (R) genes. These genes encode products that provide resistance upon direct or indirect interaction with cognate pathogen avirulence (avr) gene products (Flor, Current status of the gene-for-gene concept, Annu. Rev. Ph'ytopathoL, 9: 275- 296 (1971)). Most of the effort in this area of research has focused on dominant R genes and their corresponding pathways. Of the more than 40 disease resistance genes cloned, two are recessive (Martin, et al, Understanding the Functions of Plant Disease Resistance Proteins, Annu. Rev. Plant Physiol. Plant. MoI. Biol, 54: 23-61 (2003)). The majority of these dominant genes fall into five classes, the most common being the nucleotide binding site leucine- rich region (NBS-LRR) (Martin, et al, Understanding the Functions of Plant Disease Resistance Proteins, Annu. Rev. Plant Physiol. Plant. MoI. Biol. 54: 23-61 (2003)), and the majority result in resistance to specific races of pathogens expressing the corresponding avr, or race specific resistance.

In contrast to resistance conferred by dominant R genes, little is known regarding recessive disease resistance. xa5 is a recessive, race-specific R gene which provides immunity to races of Xanthomonas oryzae pv. oryzae expressing avrxaδ, the cognate avirulence gene to xa5. Xanthomonas oryzae pv. oryzae causes rice bacterial blight, a severe disease in South and Southeast Asia. Avrxa5 is likely to be a member of the AvrBs3 family of proteins (Hopkins, et al., Identification of a family of avirulence genes from Xanthomonas oryzae pv. oryzae, MoI. Plant. Microbe Interact. 5: 451-9 (1992); Bai, et al., Xanthomonas oryzae pv. oryzae avirulence genes contribute differently and specifically to pathogen aggressiveness, MbI. Plant-Microbe Interact. 13: 1322-9 (2000); Gassmann et al., Molecular evolution of virulence in natural field strains of Xanthomonas campestris pv. vesicatoria, J of Bacteriology 7053-7059 (2000)), which are usually characterized by nuclear localization signals and transcriptional activation domains (Bonas and Lahaye, Plant disease resistance triggered by pathogen-derived molecules: refined models of specific recognition, Curr. Opin. Microbiol. 5: 44-50 (2002)). xa5 is a naturally occurring mutation that is most commonly found in the Aus- Boro group of rices from the Bangladeshi region of Asia (Garris et al, Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.) Genetics 165:759-69 (2003)). There are over 20 resistance genes to X. oryzae pv. oryzae, three of which have been cloned (Xa21, XaI, Xa4, Xa26 and the like, see, for example, SEQ ID NOs:64, 58, 62, respectively) and fall into one of the 5 typical R gene classes (Song, et ah, A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21, Science 270: 1804-1806 (1995); Yoshimura, et al., Expression of XaI, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation Proc. Natl. Acad. Sci. U.S.A 95: 1663-8 (1998); Sun, et al, Xa26, a gene resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein, Plant J. 37: 517-27 (2004)). Xa21 mάXa26 both encode NBS-LRR proteins containing a kinase domain, while XaI encodes a member of the NBS-LRR class. xa5 does not resemble either of the two cloned recessive resistance genes in plants, mlo or RRSl-R. In contrast to xa5, resistance governed by barley mlo is not race- specific (Buschges, et al., The barley Mo gene: A novel control element of plant pathogen resistance, Cell 88: 695-705 (1997)), see, SEQ ID NOs:72. Mutations in Mo result in immunity to nearly all isolates of the fungal pathogen Erysiphe graminis f. sp. hordei. The RRSl-R gene from Arabidopsis provides resistance to several strains of Ralstonia solanacearum and encodes an NBS-LRR protein with a WRKY motif characteristic of some plant transcription factors (Deslandes, et al., Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive RRSl-R gene, a member of a novel family of resistance genes, Proc. Natl. Acad. Sci. U. S. A. 99: 2404-9 (2002)). The RRSl-R gene product physically interacts with its cognate protein PopP2 (Deslandes, et al., Physical interaction between RRSl-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus, Proc. Natl. Acad. Sci. U. S. A. 100: 8024-9 (2003)). Unlike xa5, RRSl-R shares many characteristics with dominant R genes (Deslandes, et al., Physical interaction between RRS 1 -R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus, Proc. Natl. Acad. Sci. U. S. A. 100: 8024-9 (2003)). For example, while genetically defined as recessive, RRSl-R behaves as a dominant gene in transgenic plants and is a member of the NBS-LRR R gene class.

Recently, xa5 was mapped to 100kb on the sub-telomeric region of rice chromosome 5 (Blair and McCouch, Microsatellite and sequence-tagged site markers diagnostic for the rice bacterial leaf blight resistance gene xa5, Theor. Appl. Genet. 95:174-184 (1997)). The present invention is directed to the gene and amino acid sequence of xa5 and xa5 and methods for its use. This novel disease resistance gene provides adult plant resistance and encodes the gamma subunit of transcription factor HA (TFIIAgamma), one of several general transcription factors responsible for accurate transcription by RNA polymerase II (Orphanides, et ah, The general transcription factors of RNA polymerase II, Genes Dev. 10: 2657-83 (1996)).

π. THE xa5 GENE xa5 was shown to encode TFIIAgamma by a combination of methods. First, a collection of individuals recombinant between resistant and susceptible parents was narrowed to approximatelyan 8.1 kb interval containing the gamma subunit of TFIIA. This region was located 1.5 kb upstream of the gene encoding the hypothetical protein Q94HL4. Second, sequencing and expression analysis eliminated Q94HL4 from further consideration, but identified a single amino acid change within the coding region of TFIIAgamma that distinguished the resistant and susceptible isolines and would not affect the expression TFIIAgamma. Third, sequencing of 27 resistant and 9 susceptible cultivars in the Aus-Boro group demonstrated a perfect association between the haplotype of E39 and resistance to race 2 of X. oryzae pv. oryzae {see, Table 1). Together, these lines of evidence demonstrate that TFIIAgamma encodes the xa5 resistance gene.

TFIIA is one of a set of general transcription factors (GTFs) required for transcription by RNA polymerase II (Orphanides, et ah, The general transcription factors of RNA polymerase II, Genes Dev. 10: 2657-83 (1996)). The functional molecule is composed of two subunits in yeast and three in plants and humans, one of which is

TFIIAgamma. TFIIA is essential to cell growth and has been shown to have several roles in transcription, including stimulation and stabilization of the interaction between the TATA-box binding protein (TBP) and the general transcription factor TFIID, promoter selection, gene-specific regulation, and activator dependent transcription (Orphanides, et ah, The general transcription factors of RNA polymerase II, Genes Dev. 10: 2657-83 (1996); Hampsey et ah, Molecular genetics of the RNA polymerase II general transcriptional machinery, Microbiol. MoI. Biol. Rev. 62: 465-503.(1998)).

The Drosophila genome has two copies of TFIIAgamma, (Aoyagi and Wassarman, Genes encoding Drosophila melanogaster RNA polymerase II general transcription factors: diversity TFIIA and TFIID components contributes to gene-specific transcriptional regulation. J. Cell Biol. 150: F45-50 (2000)). In Drosophila, one copy is expressed in particular tissue types (Zeidler, et ah, Drosophila TFIIA-S is upregulated and required during Ras-mediated photoreceptor determination, Genes Dev. 10:50-9 (1996)). xa5 is 50%identical to the Drosophila and human TFIIAgammq subunits and it is 85 - 93% identical to the Ar abidopsis, maize, wheat, barley, and sugarcane genes. Most plant species appear to contain a TFIIAgamma that conforms to the susceptible allele model in rice, with a valine or leucine at position 39. Interestingly, yeast contains one copy of TFIIAgamma (Aoyagi and Wassarman, Genes encoding Drosophila melanogaster RNA polymerase II general transcription factors: diversity TFIIA and TFIID components contributes to gene-specific transcriptional regulation, J. Cell Biol. 150: F45-50 (2000)); this encodes a functional protein with a glutamic acid residue at the corresponding position to the resistant xa5 protein. While the yeast TFIIAgammq is 39% identical to xa5, this critical point of comparison suggests that this mutation does not affect the essential function of TFIIAgamma. Thus TFIIAgamma may function both as a general transcription factor in rice and also as the xa5 resistance gene. The xa5 gene product functions to confer resistance possibly in conjunction with the corresponding avirulence protein, Avrxa5. Avrxaδ has been localized to a cosmid that hybridizes to genes that encode members of the AvrBs3 family of effector proteins (Hopkins, et ah, Identification of a family of avirulence genes from Xanthomonas oryzae pv. oryzae, MoI. Plant. Microbe Interact. 5: 451-9 (1992)) and restores avirulence to a X. oryzae pv. oryzae mutant virulent on IRBB'5 (Bai, et ah, Xanthomonas oryzae pv. oryzae avirulence genes contribute differently and specifically to pathogen aggressiveness, MoI. Plant-Microbe Interact. 13: 1322-9 (2000)). The proteins of the AvrBs3 family share 90- 97% identity, have nuclear localization signals, and an acidic activation domain (AAD) (Bonas and Lahaye, Plant disease resistance triggered by pathogen-derived molecules: refined models of specific recognition, Curr. Opin. Microbiol. 5: 44-50 (2002); Szurek et al., Eukaryotic features of the Xanthomonas type III effector AvrBs3: protein domains involved in transcriptional activation and the interaction with nuclear import receptors from pepper, The Plant J, 26(5):523-534 (2001)); such as those demonstrated in Fig. 6, SEQ ID NOs: 170-177. The AAD of herpes simplex virus VP16 has been shown to interact with TFIIAgamma in a coimmunoprecipitation assay (Kobayashi, et ah, A class

Kf-. of activation domains interacts directly with TFIIA and stimulates TFIIA-TFHD- promoter complex assembly, MoI. Cell. Biol. 15: 6465-73 (1995)), though there is no reported association between this interaction and pathogenicity. AvrXa7, another Xanthomonas oryzae Avr protein in this family, has been shown to bind double stranded DNA (Yang, et al., The virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein. Proc. Natl. Acad. Sci. U.S.A. 97: 9807-12 (2000)) while Marois et al. (The Xanthomonas type III effector protein AvrBs3 modulates plant gene expression and induces cell hypertrophy in the susceptible host, MoI. Plant-Microbe Interact, 15: 637-46 (2002)) showed that the X. campestris AvrBs3 effector specifically upregulates pepper genes during infection.

Rice, like Drosophila, has two copies of TFIIAgamma in its genome. One copy corresponds to xa5 on chromosome 5 and the second to rice chromosome 1 (TFIIAgammai). The location of these two copies corresponds to a large-scale duplication of a portion of chromosome 1 and chromosome 5 (Moore, et al., Cereal genome evolution, Grasses, line up and form a circle, Curr. Biol. 5: 737-9 (1995)). TFIIAgammai, see, SEQ ID NOs:02 and 79, is 97.7% and 85.8% identical to TFIIAgamma5, nucleic acid sequence and amino acid sequence, respectively, and is longer by three amino acids. TFIIAgammai has a susceptible haplotype and is expressed at lower levels than xa5 in adult plant leaves.

III. xa5 {TFIIAgamma) Genes, Coding Sequences and Polypeptides A. Nucleic Acid Sequences

1. Oryza sativa xa5 (TFIIAgamma) genes The present invention provides plant xa5 /TFIIAgamma genes and proteins including their homologs, orthologs, paralogs, variants and mutants. The designation "xa5" refers to the phenotype exhibited by plants with a mutation in anXa5 gene, where the mutant has increased levels of bacterial blight resistance (also referred to as increased bacterial blight resistance activity). In some embodiments of the present invention, isolated nucleic acid sequences comprising xa5 /TFIIAgamma genes, and fragments thereof,in rice, see, SEQ ID NOs:01-09. Mutations mXa5 genes correlate to altered bacterial blight resistance and bacterial blight resistance phenotype (see, Table 1). The present invention also provides sequences comprising xa5, Xa5, and TFIIAgamma genomic sequences (for example, Oryza sativa genomic sequences, see, for example, SEQ ID NOs:178, 359, and 360). For example, some embodiments of the present invention provide polynucleotide sequences that produce polypeptides that are homologous to at least one of SEQ ID NOs:78, 248, and 327. In some embodiments, the polypeptides are at least 35% (or more) identical to any of SEQ ID NO:78. In some embodiments, the polypeptides are at least 38% (or more) identical to any of SEQ ID NOs:248-284. In some embodiments, the polypeptides are at least 75% (or more) identical to any of SEQ ID NOs:248, 285-326. In some embodiments, the polypeptides are at least 66% (or more) identical to any of SEQ ID NOs:327-345, 346-348.. Other embodiments of the present invention provide sequences assembled through EST sequences that produce polypeptides at least 95% or more (e.g., 95%, 98%, 99%) identical to at least one of SEQ ID NOs:78, 195-217, 218-247.

2. Additional Orvza sativa xa5, Xa5 and TFIIAsamma genes The present invention provides nucleic acid sequences comprising additional Xa5 and TFIIAgamma genes. For example, some embodiments of the present invention provide polynucleotide sequences that are homologous to at least one of Xa5 /TFIIAgamma genes in rice, see, SEQ ID NOs:02-09, identified by searching available gene databases. The present invention also provides sequences comprising Xa5 /TFIIAgamma genes, see, SEQ ID NOs: 10-53, identified by searching available gene databases. For example, some embodiments of the present invention provide polynucleotide sequences that produce polypeptides that are homologous to at least one of SEQ ID NOs:79-130. In some embodiments, the polypeptides are at least 95% (or more) identical to any of SEQ ID NOs: 79-130. Other embodiments of the present invention provide sequences assembled through EST sequences that produce polypeptides at least 95% or more (e.g., 95%, 98%, 99%) identical to at least one of SEQ ID NOs: 79-130. '^•

In other embodiments, the present invention provides nucleic acid sequences that hybridize under conditions ranging from low to high stringency to at least one of SEQ ID NOs:01-53, as long as the polynucleotide sequence capable of hybridizing to at least one of SEQ ID NOs:01-53 encodes a protein that retains a desired biological activity of a bacterial blight protein; in some preferred embodiments, the hybridization conditions are high stringency. In preferred embodiments, hybridization conditions are based on the melting temperature (T_m) of the nucleic acid binding complex and confer a defined "stringency" as explained above (See e.g., Wahl et al, Meth. EnzymoL, 152:399-407 (1987), incorporated herein by reference).

In other embodiments of the present invention, alleles of xa5 disease resistance genes, and in particular of TFIIAgamma genes, are provided. In preferred embodiments, alleles result from a mutation, {i.e., a change in the nucleic acid sequence) and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered. For example, some embodiments of the present invention provide nucleic acid sequences that produce a polypeptide sequence that are homologous to at least one of SEQ ID NOs:285-326.

In other embodiments of the present invention, alleles of xa5 disease resistance genes, and in particular of TFIIAgamma genes, are provided. In preferred embodiments, alleles result from a mutation, (/. e. , a change in the nucleic acid sequence) and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered. For example, some embodiments of the present invention provide a polynucleotide sequence that produce polypeptides that are homologous to at least one of SEQ ID NOs:285-326. Any given gene may have none, one or many allelic forms. Common mutational changes that give rise to alleles are generally ascribed to deletions, additions, or insertions, or substitutions of nucleic acids. Each of these types of changes may occur alone, or in combination with the others, and at the rate of one or more times in a given sequence. Mutational changes in alleles also include rearrangements, insertions, deletions, additions, or substitutions in upstream regulatory regions.

In other embodiments of the present invention, the polynucleotide sequence encoding an xa5 and Xa5 /TFIIAgamma gehe is extended utilizing the nucleotide sequences (e.g., SEQ ID NOs:01-53) in various methods known in the art to detect upstream sequences such as promoters and regulatory elements. For example, it is contemplated that for xa5, Xa5 or related Xa disease resistances, the sequences upstream are identified from the Oryza sativa genomic database. For other xa, XaS and TFIIAgamma genes for which a database is available, the sequences upstream of the identified xa5, TFIIAgamma, and Xa genes can also be identified. An example of an allele for an upstream region is shown is described herein as SEQ ID NO:178, 359 and 360, and fragments thereof. For other xa5, Xa5, TFIIAgamma, and Xa genes for which a public genomic database is not available, or not complete, it is contemplated that polymerase chain reaction (PCR) finds use in the present invention.

In another embodiment, inverse PCR is used to amplify or extend sequences using divergent primers based on a known region (Triglia et ah, Nucleic Acids Res., 16:8186 (1988), herein incorporated by reference). In yet another embodiment of the present invention, capture PCR (Lagerstrom et al, PCR Methods Applic, 1:111-19 (1991) , herein incorporated by reference) is used. In still other embodiments, walking PCR is utilized. Walking PCR is a method for targeted gene walking that permits retrieval of unknown sequence (Parker et al, Nucleic Acids Res., 19:3055-60 (1991), herein incorporated by reference). The PROMOTERFINDER kit (Clontech) uses PCR, nested primers and special libraries to "walk in" genomic DNA. This process avoids the need to screen libraries and is useful in finding intron/exon junctions. In yet other embodiments of the present invention, add TAIL PCR is used as a preferred method for obtaining flanking genomic regions, including regulatory regions (Liu and Whittier, Genomics, Feb 10;25(3):674-81 (1995); Liu et al, Plant J., Sep;8(3):457-63 (1995), herein incorporated by reference). Preferred libraries for screening for full-length cDNAs include libraries that have been size-selected to include larger cDNAs. Also, random primed libraries are preferred, in that they contain more sequences that contain the 5' and upstream gene regions. A randomly primed library may be particularly useful in cases where an oligo d(T) library does not yield full-length cDNA. Genomic Libraries are useful for obtaining introns and extending 5' sequence.

3. Variant xa5, TFIIAgamma and TFIIAgammal genes As will be understood by those of skill in the art, it may be advantageous to produce xa5-encoding nucleotide sequences possessing non-naturally occurring codons. Therefore, in some preferred embodiments, codons preferred by a particular prokaryotic or eukaryotic host (Murray et al, Nucl. Acids Res., 17 (1989), herein incorporated by reference) can be selected, for example, to increase the rate of xa5 expression or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, than transcripts produced from naturally occurring sequence.

In some embodiments, the present invention provides isolated variants of the disclosed nucleic acid sequences encoding xa5 and TFIIAgamma genes, and in particular of xa5, XaS, TFIIAgamma, and Xa or related disease resistances genes, and the polypeptides encoded thereby; these variants include mutants, fragments, fusion proteins or functional equivalents of genes and gene protein products. The terms "variant" and "mutant" when used in reference to a polypeptide refer to an amino acid sequence that differs by one or more amino acids from another, usually related polypeptide. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties. One type of conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine- isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine- glutamine. More rarely, a variant may have "non-conservative" changes {e.g., replacement of a glycine with a tryptophan). Similar minor variations may also include amino acid deletions or insertions {i.e., additions), or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing biological activity may be found using computer programs well known in the art, for example, DNAStar software. Variants can be tested in functional assays. Preferred variants have less than 10%, and preferably less than 5%, and still more preferably less than 2% changes (whether substitutions, deletions, and so on). Examples of xa5 polypeptide variants are provided in Fig. 7, SEQ ID NOs:179-194. Further examples of xa5 polypeptide variants comprising, providing, in Fig. 10, SEQ ID

NOs:248, and 285-326, in Fig. 11, SEQ ID NOs:327-348, and the like. Thus, nucleotide sequences of the present invention would be engineered in order to introduce or alter an xa5 coding sequence for a variety of reasons, including but not limited to initiating the production of bacterial blight resistance; alterations that modify the cloning, processing and/or expression of the gene product (such alterations include inserting new restriction sites and changing codon preference), as well as varying the protein function activity (such changes include but are not limited to differing binding kinetics to nucleic acid and/or protein or protein complexes or nucleic acid/protein complexes, differing binding inhibitor affinities or effectiveness, differing reaction kinetics, varying subcellular localization, and varying protein processing and/or stability). Examples of xa5 nucleotide variants comprising, providing; in Fig. 8, SEQ ID NOs:195-217. a. Mutants.

Some embodiments of the present invention provide nucleic acid sequences encoding mutant forms of XA5 proteins, and in particular of XA5 and TFIIAgamma proteins, (i.e., muteins), and the polypeptides encoded thereby. In preferred embodiments, muteins result from mutation of the coding sequence, (i. e. , a change in the nucleic acid sequence) and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene may have none, one, or many variant forms. Common mutational changes that give rise to variants are generally ascribed to deletions, additions or substitutions of nucleic acids. Each of these types of changes may occur alone, or in combination with the others, and at the rate of one or more times in a given sequence.

Mutants of xa5 genes can be generated by any suitable method well known in the art, including but not limited to EMS induced mutagenesis, site-directed mutagenesis, randomized "point" mutagenesis, and domain-swap mutagenesis in which portions of the xa5 cDNA are "swapped" with the analogous portion of other xa5, XaS and TFIIAgamma encoding cDNAs (for an example of domain swapping using tomato disease resistance genes Cf-2 and Cf-5 that confer race specific resistance to infection by the leaf mould pathogen Cladosporium fulvum, see, Seeaϊ and Dixon M.S., Molecular Plant Pathology vol. 4(3): 199-202(4) , (2003), herein incorporated by reference). It is contemplated that is possible to modify the structure of a peptide having an activity (e.g. , such as a disease resistance activity), for such purposes as increasing synthetic activity or altering the affinity of the XA5 protein for a binding partner or a kinetic activity. Such modified peptides are considered functional equivalents of peptides having an activity of a XA5 activity as defined herein. A modified peptide can be produced in which the nucleotide sequence encoding the polypeptide has been altered, such as by substitution, deletion, or addition. In some preferred embodiments of the present invention, the alteration increases or decreases the effectiveness of the xa5 and Xa5 gene product to exhibit a phenotype caused by altered bacterial blight activity. In other words, construct "Y" can be evaluated in order to determine whether it is a member of the genus of modified or variant xa5 genes of the present invention as defined functionally, rather than structurally. Accordingly, in some embodiments the present invention provides nucleic acids comprising an xa5, Xa5 and TFIIAgamma sequence that complement the coding regions of any of SEQ ID NOs:01-53, as well as the polypeptides encoded by such nucleic acids, for example, SEQ ID NOs:78-130. Moreover, as described above, mutant forms of xa5 proteins are also contemplated as being equivalent to those peptides that are'modified as set forth in more detail herein. For example, it is contemplated that isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid {i.e., conservative mutations) will not have a major effect on the biological activity of the resulting molecule. Accordingly, some embodiments of the present invention provide nucleic acids comprising sequences encoding variants of xa5 gene products disclosed herein containing conservative replacements, as well as the proteins encoded by such nucleic acids. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids can be divided into four families: (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine); (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); and (4) uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In similar' fashion, the amino acid repertoire can be grouped as (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) sulfur - containing (cysteine and methionine) (e.g., Stryer ed., Biochemistry, pg. 17-21, 2nd ed, WH Freeman and Co., 1981, herein incorporated by reference). Whether a change in the amino acid sequence of a peptide results in a functional homolog can be readily determined by assessing the ability of the variant peptide to function in a fashion similar to the wild-type protein. Peptides having more than one replacement can readily be tested in the same manner. More rarely, a mutant includes "nonconservative" changes (e.g., replacement of a glycine with a tryptophan). Analogous minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological activity can be found using computer programs (e.g., LASERGENE software, DNASTAR Inc., Madison, Wis.). Accordingly, other embodiments of the present invention provide nucleic acids comprising sequences encoding variants of xa5 gene products disclosed herein containing non-conservative replacements where the biological activity of the encoded protein is retained, as well as the proteins encoded by such nucleic acids. Examples of these changes contemplated in the present invention are demonstrated in SEQ ID NOs:196-217. Examples of these changes contemplated in the present invention, comprising, providing, in Fig. 7, SEQ ID NOs: 180- 194, 285-326, 328- 348. b. Directed Evolution.

Variants of xa5 and TFIIAgamma genes or coding sequences may be produced by methods such as directed evolution or other techniques for producing combinatorial libraries of variants. Thus, the present invention further contemplates a method of generating sets of nucleic acids that encode combinatorial mutants of xa5 proteins, as well as truncation mutants, and is especially useful for identifying potential variant sequences (i.e., homologs) that possess the biological activity of the encoded xa5 proteins. In addition, screening such combinatorial libraries is used to generate, for example, novel encoded xa5 gene product homologs that possess novel binding or other kinetic specificities or other biological activities. The invention further provides sets of nucleic acids generated as described above, where a set of nucleic acids encodes combinatorial mutants of xa5 proteins, or truncation mutants, as well as sets of the encoded proteins. The invention further provides any subset of such nucleic acids or proteins, where the subsets comprise at least two nucleic acids or at least two proteins. It is contemplated that xa5, and in particular Xa5 ITFIIA, and Xa or related disease resistances genes; genes and coding sequences {e.g., any one or more of SEQ ID NOs:01- 53, 58-77, and fragments and variants thereof, and nucleic acids that encode any one or more of proteins of SEQ ID NOs: 78-131, 135-163, and fragments and variants thereof) can be utilized as starting nucleic acids for directed evolution. These techniques can be utilized to develop encoded xa5 product variants having desirable properties such as increased kinetic activity or altered binding affinity.

In some embodiments, artificial evolution is performed by random mutagenesis (e.g. , by utilizing error-prone PCR to introduce random mutations into a given coding sequence). This method requires that the frequency of mutation be finely tuned. As a general rule, beneficial mutations are rare, while deleterious mutations are common. This is because the combination of a deleterious mutation and a beneficial mutation often results in an inactive enzyme. The ideal number of base substitutions for targeted gene is usually between 1.5 and 5 (Moore and Arnold, Nat. Biotech., 14, 458-67 (1996); Leung et al, Technique, 1:11-15 (1989); Eckert and Kunkel, PCR Methods Appl., 1:17-24 (1991); Caldwell and Joyce, PCR Methods Appl., 2:28-33 (1992); and Zhao and Arnold, Nuc. Acids. Res., 25: 1307-08 (1997), all of which are herein incorporated by reference). After mutagenesis, the resulting clones are selected for desirable activity (e.g., screened for abolishing or restoring disease resistance activity in a constitutive mutant, in a wild type background where disease resistance "activity is required, as described above and below). Successive rounds of mutagenesis and selection are often necessary to develop enzymes with desirable properties. It should be noted that chosen mutations are carried over to the next round of mutagenesis.

In other embodiments of the present invention, the polynucleotides of the present invention are used in gene shuffling or special PCR procedures (e.g., Smith, Nature, 370:324-25 (1994); U.S. Pat. Nos. 5,837,458, 5,830,721, 5,811,238, 5,733,731, all of which are herein incorporated by reference). Gene shuffling involves random fragmentation of several mutant DNAs followed by their reassembly by PCR into full- length molecules. Examples of various gene shuffling procedures include, but are not limited to, assembly following DNase treatment, the staggered extension process (STEP), and random priming in vitro recombination. c. Homologs. The Oryza sativa xaS sequence is a member of the TFIIAgamma family according to homology determinations to known genes. The Oryza sativa genome contains at least one other TFIIAgamma family member, TFIIAgammal, which is 85.8% identical to the TFIIAgamma5 polypeptide. Additional TFIIAgamma family proteins were identified in the EST and genomic databases from a wide variety of monocots and dicots, including Arabidopsis, sorghum, barley, wheat, potato, soybean, pea, sunflower, tomato, grape, and loblolly pine etc. (Fig. 4-5 and Table 3); in addition to microorganisms, insects and animals (Fig. 4-5 and Table 3).

In some embodiments of the present invention, nucleic acid sequences corresponding to the xa5, Xa5 genes, TFIIA genes, their homologs, orthologs, paralogs, and mutants are provided as described above.

In some embodiments, the present invention provides isolated variants of the disclosed nucleic acid sequence encoding xa5 and TFIIA genes, and in particular of xa5, Xa5, TFIIAgamma, Xa or related disease resistances genes, and the polypeptides encoded thereby; these variants include mutants, fragments, fusion proteins or functional equivalents genes and protein products.

Some homologs of encoded xa5, XaS, and TFIIAgamma products have intracellular half-lives dramatically different than the corresponding wild-type protein. For example, the altered protein is rendered either more stable or less stable to proteolytic degradation or other cellular process that result in destruction of, or otherwise inactivate the encoded xa5, XaS, and TFIIAgamma product. Such homologs, and the genes that encode them, can be utilized to alter the activity of the encoded xa5, Xa5, and TFIIAgamma products by modulating the half-life of the protein. For instance, a short half-life can give rise to more transient xa5, Xa5, and TFIIAgamma biological effects. Other homologs have characteristics which are either similar to wild-type xa5, Xa5, and TFIIAgamma, or which differ in one or more respects from wild-type xa5, XaS, and TFIIAgamma.

61 In some embodiments of the combinatorial mutagenesis approach of the present invention, the amino acid sequences for a population of xa5 gene product homologs are aligned, preferably to promote the highest homology possible. Such a population of variants can include, for example, xa5, Xa5, and TFIIAgamma gene homologs from one or more species, or xa5, Xa5, and TFIIAgamma gene homologs from the same species but which differ due to mutation. Amino acids that appear at each position of the aligned sequences are selected to create a degenerate set of combinatorial sequences. See, Figs. 8 and 9.

In a preferred embodiment of the present invention, the combinatorial xa5 gene library is produced by way of a degenerate library of genes encoding a library of polypeptides that each include at least a portion of candidate encoded xa5 -protein sequences. For example, a mixture of synthetic oligonucleotides is enzymatically ligated into gene sequences such that the degenerate set of candidate xa5, Xa5, and TFIIAgamma sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins {e.g., for phage display) containing the set of xa5, Xa5, and TFIIAgamma sequences therein.

There are many ways by which the library of potential xa5, Xa5, and TFIIAgamma homologs can be generated from a degenerate oligonucleotide sequence. In some embodiments, chemical synthesis of a degenerate gene sequence is carried out in an automatic DNA synthesizer, and the synthetic genes are ligated into an appropriate gene for expression. The purpose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential xa5, Xa5, and TFIIAgamma sequences. The synthesis of degenerate oligonucleotides is well known in the art (See e.g., Narang, Tetrahedron Lett., 39:3 9 (1983); Itakura et al, Recombinant DNA, in Walton (ed.), Proceedings of the 3rd Cleveland Symposium on Macromolecules,

Elsevier, Amsterdam, pp 273-289 (1981); Itakura et al, Annu. Rev. Biochem., 53:323 (1984); Itakura et al, Science 198:1056 (1984); Ike et al, Nucl. Acid Res., 11:477 (1983), all of which are herein incorporated by reference). Such techniques have been employed in the directed evolution of other proteins (See e.g., Scott et al, Science, 249:386-390 (1980); Roberts et al, Proc. Natl. Acad. Sci. USA, 89:2429-2433 (1992); Devlin et al, Science, 249: 404-406 (1990); Cwirla et al, Proc. Natl. Acad. Sci. USA, 87: 6378-6382 (1990); as well as U.S. Pat. Nos. 5,223,409, 5,198,346, and 5,096,815, all of which are herein incorporated by reference). d. Screening Gene Products.

A wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations, and for screening cDNA libraries for gene products having a certain property. Such techniques are generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of Xa5 homologs. The most widely used techniques for screening large gene libraries typically comprise cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate sequences created by combinatorial mutagenesis techniques.

Accordingly, in some embodiments of the present invention, the gene library is cloned into the gene for a surface membrane protein of a bacterial cell, and the resulting fusion protein detected by panning (WO 88/06630; Fuchs et al. , BioTechnol., 9:1370- 1371 (1991); and Goward et al, TIBS 18:136-140 (1992), all of which are herein incorporated by reference. In other embodiments of the present invention, fluorescently labeled molecules that bind encoded xa5, Xa5, and TFIIAgamma products can be used to score for potentially functional xa5, Xa5, and TFIIAgamma homologs. Cells are visually inspected and separated under a fluorescence microscope, or, where the morphology of the cell permits, separated by a fluorescence-activated cell sorter. In an alternate embodiment of the ^"present invention, the gene library is expressed as a fusion protein on the surface of a viral particle. For example, foreign peptide sequences are expressed on the surface of infectious phage in the filamentous phage system, thereby conferring two significant benefits. First, since these phages can be applied to affinity matrices at very high concentrations, a large number of phage can be screened at one time. Second, since each infectious phage displays the combinatorial gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection. The group of almost identical E. coli filamentous phages M13, fd, and fl are most often used in phage display libraries, as either of the phage gill or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle (See e.g., WO 90/02909; WO 92/09690; Marks et al, J. Biol. Chem., 267:16007-16010 (1992); Griffths et al, EMBO J., 12:725-734 (1993); Clackson et al, Nature, 352:624-628 (1991); and Barbas et al, Proc. Natl. Acad. ScL, 89:4457-4461 (1992), all of which are herein incorporated by reference).

In another embodiment of the present invention, the recombinant phage antibody system {e.g., RPAS, Pharmacia Catalog number 27-9400-01) is modified for use in expressing and screening of encoded xa5 product combinatorial libraries. The pCANTAB 5 phagemid of the RPAS kit contains the gene that encodes the phage gill coat protein. In some embodiments of the present invention, the xa5 combinatorial gene library is cloned into the phagemid adjacent to the gill signal sequence such that it is expressed as a gill fusion protein. In other embodiments of the present invention, the phagemid is used to transform competent E. coli TGl cells after ligation. In still other embodiments of the present invention, transformed cells are subsequently infected with M13KO7 helper phage to rescue the phagemid and its candidate xa5 gene insert. The resulting recombinant phage contain phagemid DNA encoding a specific candidate xa5 protein and display one or more copies of the corresponding fusion coat protein, hi some embodiments of the present invention, the phage-displayed candidate proteins that display any property characteristic of an xa5 protein are selected or enriched by panning. The bound phage is then isolated, and if the recombinant phages express at least one copy of the wild type gill coat protein, they will retain their ability to infect E. coli. Thus, successive rounds of reinfection of E. coli and panning will greatly enrich for xa5, Xa5, and TFIIAgamma homologs.

In light of the present disclosure, other forms of mutagenesis generally applicable will be apparent to those skilled in the art in addition to the aforementioned rational mutagenesis based on conserved versus non-conserved residues. For example, xa5, Xa5, and TFIIAgamma homologs can be generated and screened using, for example, alanine scanning mutagenesis and the like (Ruf et al, Biochem., 33:1565-1572 (1994); Wang et al, J. Biol. Chem., 269:3095-3099 (1994); Balint Gene 137:109-118 (1993); Grodberg et al, Eur. J. Biochem., 218:597-601 (1993); Nagashima et al, J. Biol. Chem., 268:2888- 2892 (1993); Lowman et al, Biochem., 30:10832-10838 (1991); and Cunningham et al, Science, 244:1081-1085 (1989), all of which are herein incorporated by reference), by linker scanning mutagenesis (Gustin et al, Virol., 193:653-660 (1993); Brown et al, MoI. Cell. Biol., 12:2644-2652 (1992); McKnight and Kingsbury Science, JuI 23 ;217(4557):316-24 (1982), all of which are herein incorporated by reference) or by saturation mutagenesis (Myers etal, Science, 2;232(4750):613-618 (1986); all of which are herein incorporated by reference). e. Truncation Mutants of xa5

In addition, the present invention provides isolated nucleic acid sequences encoding fragments of encoded xa5 products {i.e., truncation mutants), and the polypeptides encoded by such nucleic acid sequences. In preferred embodiments, the xa5 fragment is biologically active. In some embodiments of the present invention, when expression of a portion of a xa5 protein is desired, it may be necessary to add a start codon (ATG) to the oligonucleotide fragment containing the desired sequence to be expressed. It is well known in the art that a methionine at the N-terminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat et al, J. Bacteriol, 169:751-757 (1987), herein incorporated by reference) and Salmonella typhimurium and its in vitro activity has been demonstrated on recombinant proteins (Miller et al, Proc. Natl. Acad. Sci. USA, 84:2718-1722 (1990), herein incorporated by reference). Therefore, removal of an N-terminal methionine, if desired, can be achieved either in vivo by expressing such recombinant polypeptides in a host that produces MAP {e.g., E. coli or CM89 or S. cerevisiae), or in vitro by use of purified MAP.

£ Fusion Proteins Containing xa5

The present invention also provides nucleic acid sequences encoding fusion proteins incorporating all or part of xa5, and the polypeptides encoded by such nucleic acid sequences. The term "fusion" when used in reference to a polypeptide refers to a chimeric protein containing a protein of interest j oined to an exogenous protein fragment (the fusion partner). The term "chimera" when used in reference to a polypeptide refers to the expression product of two or more coding sequences obtained from different genes, that have been cloned together and that, after translation, act as a single polypeptide sequence. Chimeric polypeptides are also referred to as "hybrid" polypeptides. The coding sequences include those obtained from the same or from different species of organisms. The fusion partner may serve various functions, including enhancement of solubility of the polypeptide of interest, as well as providing an "affinity tag" to allow purification of the recombinant fusion polypeptide from a host cell or from a supernatant or from both. If desired, the fusion partner may be removed from the protein of interest after or during purification. In some embodiments, the fusion proteins have a xa5 functional domain with a fusion partner. Accordingly, in some embodiments of the present invention, the coding sequences for the polypeptide (e.g., a xa5 functional domain) is incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. It is contemplated that such a single fusion product polypeptide is able to enhance disease resistance activity, such that the transgenic plant produces altered disease resistance ratios.

In some embodiments of the present invention, chimeric constructs code for fusion proteins containing a portion of a xa5 protein and a portion of another gene. In some embodiments, the fusion proteins have biological activity similar to the wild type xa5 (e.g. , have at least one desired biological activity of a xa5 protein). In other embodiments, the fusion protein has altered biological activity.

In addition to utilizing fusion proteins to alter biological activity, it is widely appreciated that fusion proteins can also facilitate the expression and/or purification of proteins, such as the xa5 protein of the present invention. Accordingly, in some embodiments of the present invention, a xa5 protein is generated as a glutathione-S- transferase (i. e. , GST fusion protein). It is contemplated that such GST fusion proteins enables easy purification of the XA5 protein, such as by the use of glutathione- derivatized matrices (See e.g., Ausabel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1991), herein incorporated by reference).

In another embodiment of the present invention, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of a^lxa5 protein allows purification of the expressed xa5 fusion protein by affinity chromatography using a Ni²⁺ metal resin. In still another embodiment of the present invention, the purification leader sequence is then subsequently removed by treatment with enterokinase (See e.g., Hochuli et at, J. Chromatogr., 411:177 (1987); and Janknecht etal, Proc. Natl. Acad. Sci. USA, 88:8972, all of which are herein incorporated by reference). In yet other embodiments of the present invention, a fusion gene coding for a purification sequence appended to either the N or the C terminus allows for affinity purification; one example is addition of a hexahistidine tag to the carboxy terminus of a xa5 protein that is optimal for affinity purification. Techniques for making fusion genes are well known. Essentially, the joining of various nucleic acid fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment of the present invention, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, in other embodiments of the present invention, PCR amplification of gene fragments is carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that can subsequently be annealed to generate a chimeric gene sequence (See e.g., Current Protocols in Molecular Biology, supra, herein incorporated by reference).

B. xa5, Xa5, TFIIAgamma and TFIIAgammal Gene Polypeptides The present invention provides isolated xa5, Xa5, and TFIIAgamma polypeptides, as well as variants, homologs, mutants or fusion proteins thereof, as described above. In some embodiments of the present invention, the polypeptide is a naturally purified product, while in other embodiments it is a product of chemical synthetic procedures, and in still other embodiments it is produced by recombinant techniques using a prokaryotic or eukaryotic host (e.g., by bacterial, yeast, higher plant, insect and mammalian cells in culture). In some embodiments, depending upon the host employed in a recombinant production procedure, the polypeptide of the present invention is glycosylated or non- glycosylated. In other embodiments, the polypeptides of the invention also includes an initial methionine amino acid residue.

1. Purification of xa5, Xa5, TFIIAgamma and TFIIAgammal Polypeptides The present invention provides purified xa5, Xa5, TFIIAgamma and

TFIIAgammal polypeptides as well as variants, homologs, mutants or fusion proteins thereof, as described above. In some embodiments of the present invention, xa5, Xa5, TFIIAgamma, and TFIIAgammal polypeptides purified from recombinant organisms as described below are provided. In other embodiments, xa5, Xa5, TFIIAgamma, and TFIIAgammal polypeptides purified from recombinant bacterial extracts transformed with Oryza sativa xa5 cDNA, and in particular any one or more of xa5, Xa5, and TFIIAgamma, TFIIAgammal , or related disease resistance cDNA, are provided (as described in the Examples).

The present invention also provides methods for recovering and purifying xa5, Xa5, TFIIAgamma, and TFIIAgammal from recombinant cell cultures including, but not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. The present invention further provides nucleic acid sequences having the coding sequence for a xa5, Xa5, and TFIIAgamma protein {e.g., SEQ ID NOs:78) fused in frame to a marker sequence that allows for expression alone or for both expression and purification of the polypeptide of the present invention. A non-limiting example of a marker sequence is a hexahistidine tag that is supplied by a vector, for example, a pQE- 30 vector which adds a hexahistidine tag to the N terminal of a xa5 gene and which results in expression of the polypeptide in a bacterial host, or, for example, the marker sequence is a hemagglutinin (HA) tag when a mammalian host is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, Cell, 37:767 (1984), herein incorporated by reference). 2. Chemical Synthesis of xa5. Xa5, TFHAgamma, and TFIIAgammal Polypeptides

In an alternate embodiment of the invention, the coding sequence of Xa5 genes, and in particular of any one or more of xa5, Xa5, TFIIAgamma, or related disease resistance genes, is synthesized, in whole or in part, using chemical methods well known in the art (See e.g., Caruthers et al, Nucl. Acids Res. Symp. Ser., 7:215-233 (1980); Crea and Horn, Nucl. Acids Res., May 24;8(10):2331-2348 (1980); Matteucci and Caruthers, Tetrahedron Lett., 21:719 (1980); and Chow and Kempe, Nucl. Acids Res., 9:2807-2817 (1981), all of which are herein incorporated by reference). In other embodiments of the present invention, the protein itself is produced using chemical methods to synthesize either an entire xa5, Xa5, and TFIIAgamma amino acid sequence (for example, SEQ ID NOs:78-130, 179-194, 248, 285-326, 327-348, or a portion thereof, e.g. SEQ ID NO:248. For example, peptides are synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (See e.g., Creighton, Proteins Structures And Molecular Principles, W.H. Freeman and Co, New York N. Y. (1983), herein incorporated by reference). In other embodiments of the present invention, the composition of the synthetic peptides is confirmed by amino acid analysis or sequencing (See e.g., Creighton, supra, herein incorporated by reference).

Direct peptide synthesis can be performed using various solid-phase techniques (Roberge et al , Science, 269:202-204 (1995), herein incorporated by reference) and automated synthesis may be achieved, for example, using ABI 43 IA Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer. Additionally, the amino acid sequence of xa5, Xa5, and TFIIAgamma, or any part thereof, may be altered during direct synthesis and/or combined using chemical methods with other sequences to produce a variant polypeptide.

3. Generation of xa5, Xa5, TFIIAgamma, and TFIIAgammal Antibodies In some embodiments of the present invention, antibodies are generated to allow for the detection and characterization of a xa5, Xa5, and TFIIAgamma proteins. The antibodies may be prepared using various immunogens. In one embodiment, the immunogen is an Oryza sativa xa5, Xa5, and TFIIAgamma peptide {e.g. , an amino acid sequence as depicted in SEQ ID NOs: 179-194), or a fragment thereof, e.g. SEQ ID NO:248, to generate antibodies that recognize a plant TFIIAgamma protein. Such antibodies include, but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and Fab expression libraries.

Various procedures known in the art may be used for the production of polyclonal antibodies directed against an xa5, Xa5, and TFIIAgamma protein. For the production of antibody, various host animals can be immunized by injection with the peptide corresponding to an xa5, Xa5, and TFIIAgamma protein epitope including but not limited to rabbits, mice, rats, sheep, goats, etc. In a preferred embodiment, the peptide is conjugated to an immunogenic carrier {e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH)). Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels {e.g., aluminum hydroxide), surface active substances {e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum).

For preparation of monoclonal antibodies directed toward a XA5 protein, it is contemplated that any technique that provides for the production of antibody molecules by continuous cell lines in culture finds use with the present invention (See e.g. , Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, herein incorporated by reference). These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (Kδhler and Milstein, Nature, 256:495-497 (1975), herein incorporated by reference), as well as the trioma technique, the human B-cell hybridoma technique (See e.g., Kozbor et al, Immunol. Tod., 4:72 (1983), herein incorporated by reference), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al, in Monoclonal

Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985), herein incorporated by reference).

In an additional embodiment of the invention, monoclonal antibodies are produced in germ-free animals utilizing technology such as that described in PCT/US90/02545). Furthermore, it is contemplated that human antibodies may be generated by human hybridomas (Cote et al, Proc. Natl. Acad. Sci. USA, 80:2026-2030 (1983), herein incorporated by reference) or by transforming human B cells with EBV virus in vitro (Cole et al, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96 (1985), herein incorporated by reference).

In addition, it is contemplated that techniques described for the production of single chain antibodies (U.S. Patent 4,946,778, herein incorporated by reference) find use in producing an xa5, Xa5, and TFIIAgamma protein-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al, Science, 246:1275-1281 (1989), herein incorporated by reference) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an XA5 protein.

It is contemplated that any technique suitable for producing antibody fragments finds use in generating antibody fragments that contain the idiotype (antigen binding region) of the antibody molecule. For example, such fragments include but are not limited to: F(ab')2 fragment that can be produced by pepsin digestion of the antibody molecule; Fab' fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and Fab fragments that can be generated by treating the antibody molecule with papain and a reducing agent.

In the production of antibodies, it is contemplated that screening for the desired antibody is accomplished by techniques known in the art {e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels, for example), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays, etc.), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.

In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many methods are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. As is well known in the art, the immunogenic peptide should be provided free of the carrier molecule used in any immunization protocol. For example, if the peptide was conjugated to KLH, it may be conjugated to BSA, or used directly, in a screening assay. In some embodiments of the present invention, the foregoing antibodies are used in methods known in the art relating to the expression of an xa5, Xa5, and TFIIAgamma protein (e.g. , for Western blotting), measuring levels thereof in appropriate biological samples, and the like. The antibodies can be used to detect an xa5, Xa5, and TFIIAgamma protein in a biological sample from a plant. The biological sample can be an extract of a tissue, or a sample fixed for microscopic examination.

The biological samples are then be tested directly for the presence of an xa5, Xa5, and TFIIAgamma protein using an appropriate strategy (e.g. , ELISA or radioimmunoassay) and format (e.g., micro wells, dipstick (e.g., as described in WO 93/03367 herein incorporated by reference), and the like. Alternatively, proteins in the sample can be size separated (e.g., by polyacrylamide gel electrophoresis (PAGE), in the presence or not of sodium dodecyl sulfate (SDS), and the presence of an XA5 protein detected by immunoblotting (Western blotting). Immunoblotting techniques are generally more effective with antibodies generated against a peptide corresponding to an epitope of a protein, and hence, are particularly suited to the present invention.

C. Expression of Cloned xa5, XaS, TFIIAgamma, and TFIIAgammal Genes 1. Vectors for Production of xa5, Xa5, TFIIAgamma, and

TFIIAgammal

The nucleic acid sequences of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the nucleic acid sequence may be included in any one of a variety of expression vectors for expressing a polypeptide. The terms "expression vector" and "expression cassette" refer to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. The terms "bacterial resistance expression cassette," "disease resistance cassette" and "disease resistance expression cassette" refer to a recombinant DNA molecule containing a desired coding sequence operably linked to an appropriate nucleic acid sequence necessary for the expression of the operably linked coding sequence in a particular host organism for altering disease resistance. In one embodiment, altering disease resistance is increasing disease resistance in plants.

The methods of the present invention contemplate the use of a heterologous gene encoding an xa5, Xa5, TFIIAgamma, and TFIIAgammal gene, or encoding a sequence designed to decrease or increase, xa5, Xa5, TFIIAgamma, and TFIIAgammal gene expression, as described previously. Heterologous genes include but are not limited to naturally occurring coding sequences, as well variants encoding mutants, variants, truncated proteins, and fusion proteins, as described above.

Heterologous genes intended for expression in plants are first assembled in expression cassettes comprising a promoter. Methods which are well known to or developed by those skilled in the art may be used to construct expression vectors containing a heterologous gene and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Exemplary techniques are widely described in the art (See e.g., Sambrook. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N. Y., and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N. Y., herein incorporated by reference).

In general, these vectors comprise a nucleic acid sequence encoding xa5, Xa5, and TFIIAgamma gene, or encoding a sequence designed to decrease xa5, Xa5, and TFIIAgamma gene expression, (as described above) operably linked to a promoter and other regulatory sequences {e.g., enhancers, polyadenylation signals, etc.) required for expression in a plant.

The expression cassettes may further comprise any sequences required for expression of mRNA. Such sequences include, but are not limited to transcription terminators, enhancers such as introns, viral sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments. A variety of transcriptional terminators are available for use in expression of sequences using the promoters of the present invention. Transcriptional terminators are responsible for the termination of transcription beyond the transcript and its correct polyadenylation. Appropriate transcriptional terminators and those which are known to function in plants include, but are not limited to, the CaMV 35S terminator, the tail terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminator (See e.g., Odell et al, Nature 313:810 (1985); Rosenberg et al, Gene, 56:125 (1987); Guerineau et al, MoI. Gen. Genet., 262:141 (1991); Proudfoot, Cell, 64:671 (1991); Sanfacon et al, Genes Dev., 5:141 ; Mogen et al, Plant Cell, 2:1261 (1990); Munroe et al, Gene, 91:151 (1990); Bellas ef al, Nucleic Acids Res. 17:7891 (1989); Joshi e/ α/., Nucleic Acid Res., 15:9627 (1987), all of which are incorporated herein by reference).

In addition, in some embodiments; constructs for expression of the gene of interest include one or more of sequences' found to enhance gene expression from within the transcriptional unit. These sequences can be used in conjunction with the nucleic acid sequence of interest to increase expression in plants. Various intron sequences have been shown to enhance expression, particularly in monocotyledonous cells. For example, the introns of the maize Adhl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells (Callis et al, Genes Develop. 1: 1183 (1987), herein incorporated by reference). Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.

In some embodiments of the present invention, the construct for expression of the nucleic acid sequence of interest also includes a regulator such as a nuclear localization signal (Kalderon et al, Cell 39:499 (1984); Lassner et al, Plant Molecular Biology 17:229 (1991)), a plant translational consensus sequence (Joshi, Nucleic Acids Research 15:6643 (1987)), an intron (Luehrsen and Walbot, Mol.Gen. Genet. 225:81 (1991)), and the like, operably linked to the nucleic acid sequence encoding an xa5, Xa5, and TFIIAgamma gene.

In preparing the construct comprising the nucleic acid sequence encoding a XA5 gene, or encoding a sequence designed to decrease xa5, Xa5, and TFIIAgamma gene expression, various DNA fragments can be manipulated, so as to provide for the DNA sequences in the desired orientation (e.g., sense or antisense) orientation and, as appropriate, in the desired reading frame. For example, adapters or linkers can be employed to join the DNA fragments or other manipulations can be used to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resection, ligation, or the like is preferably employed, where insertions, deletions or substitutions (e.g., transitions and transversions) are involved.

Numerous transformation vectors are available for plant transformation. The selection of a vector for use will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers are preferred. Selection markers used routinely in transformation include the nptll gene which confers resistance to kanamycin and related antibiotics (Messing and Vierra, Gene 19: 259 (1982); Bevan et al, Nature 304:184 (1983), all of which are incorporated herein by reference), the bar gene which confers resistance to the herbicide phosphinothricin (White et al. , Nucl Acids Res. 18:1062

(1990); Spencer et al, Theor. Appl. Genet. 79: 625 (1990), all of which are incorporated herein by reference), the hph gene which confers resistance to the antibiotic hygromycin (Blochlinger and Diggelmann, MoI. Cell. Biol. 4:2929 (1984, incorporated herein by reference)), and the dhfr gene, which confers resistance to methotrexate (Bourouis et al, EMBO J., 2: 1099 (1983), herein incorporated by reference).

In some preferred embodiments, a Ti (T-DNA) plasmid) vector is adapted for use in soiAgrobacterium mediated transfection process (See e.g., U.S. Pat. Nos. 5,981,839; 6,051,757; 5,981,840; 5,824,877; and 4,940,838; all of which are herein incorporated by reference). Construction of recombinant Ti and Ri plasmids in general follows methods typically used with the more common vectors, such as pBR322. Additional use can be made of accessory genetic elements sometimes found with the native plasmids and sometimes constructed from foreign sequences. These may include but are not limited to structural genes for antibiotic resistance as selection genes.

There are two systems of recombinant Ti and Ri plasmid vector systems now in use. The first system is called the "cointegrate" system. In this system, the shuttle vector containing the gene of interest is inserted by genetic recombination into a non-oncogenic Ti plasmid that contains both the cis-acting and trans-acting elements required for plant transformation as, for example, in the pMLJl shuttle vector and the non-oncogenic Ti plasmid pGV3850. The use of T-DNA as a flanking region in a construct for integration into a Ti- or Ri-plasmid has been described in EPO No. 116,718 and PCT Application Nos. WO 84/02913, 02919 and 02920 all of which are herein incorporated by reference). See also Herrera-Estrella, Nature 303:209-213 (1983); Fraley et al, Proc. Natl. Acad. Sci, USA 80:4803-4807 (1983); Horsch et al, Science 223:496-498 (1984); and DeBlock et al, EMBO J. 3:1681-1689 (1984), all of which are herein incorporated by reference). The second system is called the "binary" system in which two plasmids are used; the gene of interest is inserted into a shuttle vector containing the cis-acting elements required for plant transformation. The other necessary functions are provided in trans by the non-oncogenic Ti plasmid as exemplified by the pBIN19 shuttle vector and the non- oncogenic Ti plasmid PAL4404. Some of these vectors are commercially available. In other embodiments of the invention, the nucleic acid sequence of interest is targeted to a particular locus on the plant genome. Site-directed integration of the nucleic acid sequence of interest into the plant cell genome may be achieved by, for example, homologous recombination using Agrobacterium-deτived sequences. Generally, plant cells are incubated with a strain of Agrobacterium which contains a targeting vector in which sequences that are homologous to a DNA sequence inside the target locus are flanked by Agrobacterium transfer-DNA (T-DNA) sequences, as previously described (U.S. Pat. No. 5,501,967 herein incorporated by reference). One of skill in the art knows that homologous recombination may be achieved using targeting vectors that contain sequences that are homologous to any part of the targeted plant gene, whether belonging to the regulatory elements of the gene, or the coding regions of the gene. Homologous recombination may be achieved at any region of a plant gene so long as the nucleic acid sequence of regions flanking the site to be targeted is known. Agrobacterium tumefaciens is a common soil bacterium that causes crown gall disease by transferring some of its DNA to the plant host. The transferred DNA (T-DNA) is stably integrated into the plant genome, where its expression leads to the synthesis of plant hormones and thus to the tumorous growth of the cells. A putative macromolecular complex forms in the process of T-DNA transfer out of the bacterial cell into the plant cell. In yet other embodiments, the nucleic acids of the present invention are utilized to construct vectors derived from plant (+) RNA viruses (e.g., brome mosaic virus, tobacco mosaic virus, alfalfa mosaic virus, cucumber mosaic virus, tomato mosaic virus, and combinations and hybrids thereof). Generally, the inserted XA5 polynucleotide can be expressed from these vectors as a fusion protein (e.g. , coat protein fusion protein) or from its own subgenomic promoter or other promoter. Methods for the construction and use of such viruses are described in U.S. Pat. Nos. 5,846,795; 5,500,360; 5,173,410; 5,965,794; 5,977,438; and 5,866,785, all of which are incorporated herein by reference.

In some embodiments of the present invention, the nucleic acid sequence of interest is introduced directly into a plant. One vector useful for direct gene transfer techniques in combination with selection by the herbicide Basta (or phosphinothricin) is a modified version of the plasmid pCIB246, with a CaMV 35S promoter in operational fusion to the E. coli GUS gene and the CaMV 35S transcriptional terminator (WO 93/07278). In some embodiments of the present invention, vectors include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences (e.g., derivatives of plant tumor sequences, T-DNA sequences, derivatives of SV40, bacterial plasmids, phage DNA; baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA₅ and viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies). It is contemplated that any vector may be used as long as it is replicable and viable in the host.

In particular, some embodiments of the present invention provide recombinant constructs comprising one or more of the nucleic sequences as broadly described above (e.g., SEQ ID NOs:01-53, 58-77, 195-247, and 349-360. In some embodiments of the present invention, the constructs comprise a vector, such as a plasmid or eukaryotic vector, or viral vector, into which a nucleic acid sequence of the invention has been inserted, in a forward or reverse orientation. In preferred embodiments of the present invention, the appropriate nucleic acid sequence is inserted into the vector using any of a variety of procedures. In general, the nucleic acid sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. Such vectors include, but are not limited to, the following vectors: 1) Bacterial ~ pYeDP60, pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNHl^βa, ρNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); and 2) Eukaryotic - pMLBART, Agrobacterium tumefaciens strain GV3101 , pSV2CAT, pOG44, PXTl, pSG (Stratagene) ρSVK3, pBPV, pMSG, and pSVL (Pharmacia). Any other plasmid or vector may be used as long as they are replicable and viable in the host. In some preferred embodiments of the present invention, plant expression vectors comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences for expression in plants. In other embodiments, DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

In certain embodiments of the present invention, the nucleic acid sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. Examples of plant promoters useful in the present invention are not limited to and include, a promoter derived from cauliflower mosaic virus such as CaMV35S (pBI221: EMBO. J. 6: 3901-3907, 1987; U.S Patent 5,436,391, herein incorporated by reference), rbcS (ribulose 1.5-bisphosphate carboxylase), Cab (chlorophyll a/b binding protein)(Science 244: 174, 1989), actin, (U.S. Patent Nos., 5,641,876, 5,684,239, 5,981,842, 6,429,357; International Patent Nos., WO 00/70067 and CA2372859, all of which are herein incorporated by reference) and the like. Examples of plant promoters in rice useful in the present invention are not limited to and include those described in U.S. Patent Appln. No., 20040016025A1 ; 20030066108A1 ; 20040187175A1; all of which are herein incorporated by reference; and those used to construct transformed rice plants as described in U.S Patent 5,436,391 and U.S. Patent Appln. No. 20040187175A1; all of which are herein incorporated by reference. Exemplary constitutive plant promoters include, but are not limited to SD

Cauliflower Mosaic Virus (CaMV SD; see e.g., U.S. Pat. No. 5,352,605, incorporated 20

herein by reference), mannopine synthase, octopine synthase (ocs), superpromoter {see e.g., WO 95/14098, herein incorporated by reference), and ubi3 promoters {see e.g., Garbarino and Belknap, Plant MoI. Biol. 24:119-127 (1994), herein incorporated by reference). Such promoters have been used successfully to direct the expression of heterologous nucleic acid sequences in transformed plant tissue.

Promoters include but are not limited to constitutive promoters, tissue-, organ-, and developmentally-specific promoters, and inducible promoters. Examples of promoters include but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine amino peptidase ("LAP," Chao et al, Plant Physiol 120: 979-992 (1999), herein incorporated by reference); a chemically-inducible promoter from tobacco, Pathogenesis-Related 1 (PRl) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); a tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); a heat shock promoter (U.S. Patent 5,187,267, herein incorporated by reference); a tetracycline-inducible promoter (US Pat 5,057,422, herein incorporated by reference); and seed-specific promoters, such as those for seed storage proteins {e.g., phaseolin, napin, oleosin, and a promoter for soybean beta conglycin (Beachy et al, EMBO J. 4: 3047-3053 (1985), herein incorporated by reference). All references cited herein are incorporated in their entirety. Examples of inducible promoters include pathogen attack, anaerobic conditions, or the presence of light. Exemplary inducable promoters include the xa5 promoter of the present invention, see, SEQ ID NOs:178 and 359.

Promoters useful in the present invention include, but are not limited to, the LTR or SV40 promoter, the E. coli lac or trp, the phage lambda P_L and P_R, T3 and T7 promoters, and the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionein-I promoters and other promoters known to control expression of gene in prokaryotic or eukaryotic cells or their viruses. In other embodiments of the present invention, recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance in E. coli). In some embodiments of the present invention, transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Enhancers useful in the present invention include, but are not limited to, the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

In other embodiments, the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. In still other embodiments of the present invention, the vector may also include appropriate sequences for amplifying expression.

2. Host Cells for Production of xa5, Xa5, TFIIAgamma, and TFIIAgammal hi a further embodiment, the present invention provides host cells containing the above-described constructs. The term "host cell" refers to any cell capable of replicating and/or transcribing and/or translating a heterologous gene. Thus, a "host cell" refers to any eukaryotic or prokaryotic cell (e.g., plant cells, algal cells such as C. reinhardtii, bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, fish cells, and insect cells), whether located in vitro or in vivo. For example, host cells may be located in a transgenic plant. In some embodiments of the present invention, the host cell is a higher eukaryotic cell (e.g., a plant cell). In other embodiments of the present invention, the host cell is a lower eukaryotic cell (e.g., a yeast cell). The terms "eukaryotic " and "eukaryote" are used in it broadest sense. It includes, but is not limited to, any organisms containing membrane bound nuclei and membrane bound organelles. Examples of eukaryotes include but are not limited to animals, plants, alga, diatoms, and fungi.

In still other embodiments of the present invention, the host cell can be a prokaryotic cell (e.g., a bacterial cell). The terms "prokaryote" and "prokaryotic" are used in it broadest sense. It includes, but is not limited to, any organisms without a distinct nucleus. Examples of prokaryotes include but are not limited to bacteria, blue- green algae, archaebacteria, actinomycetes and mycoplasma. In some embodiments, a host cell is any microorganism. As used herein the term "microorganism" refers to microscopic organisms and taxonomically related macroscopic organisms within the categories of algae, bacteria, fungi (including lichens), protozoa, viruses, and subviral agents. Specific examples of host cells include, but are not limited to, Escherichia coli, Salmonella typhimurium, Bacillus subtilis, and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, as well as Saccharomycees cerivisiae, Schizosaccharomycees pombe, Drosophila S2 cells, Spodoptera Sf9 cells, Chinese hamster ovary (CHO) cells, COS-7 lines of monkey kidney fibroblasts, (Gluzman, Cell 23:175 (1981), herein incorporated by reference), 293T, C127, 3T3, HeLa and BHK cell lines, NT-I (tobacco cell culture line), root cell and cultured roots in rhizosecretion (Gleba et al. , Proc Natl Acad Sci USA 96: 5973-5977 (1999), herein incorporated by reference). Examples of host cells for bacterial blight activity are described in U.S. Patent No. 5,744,341 to Cunningham, et al. (July 4, 1995), herein described by reference. The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. In some embodiments, introduction of the construct into the host cell can be accomplished by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (See e.g., Davis et al, Basic Methods in Molecular Biology, (1986), herein incorporated by reference). Alternatively, in some embodiments of the present invention, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Proteins can be expressed in eukaryotic cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N. Y., (1989), herein incorporated by reference.

In some embodiments of the present invention, following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means {e.g., temperature shift or chemical induction) and cells are cultured for an additional period. In other embodiments of the present invention, cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. In still other embodiments of the present invention, microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.

IV. Methods of Modifying Disease resistance phenotype by Manipulating xa5, Xa5, TFIIAgamma, and TFIIAgammal Gene Expression The present invention also provides methods of using xa5, Xa5, and TFIIAgamma genes. In some embodiments, the sequences are used for research purposes. For example, nucleic acid sequences comprising coding sequences of a xa5 gene, for example any one or more of xa5, Xa5, and TFIIAgamma, or related disease resistance are used to discover other disease resistance genes. In other embodiments, endogenous plant xa5 genes, such as any one or more of xa5, Xa5, TFIIAgamma, or related disease resistance genes, are silenced, for example with antisense FUSfA or by cosuppression, and the effects on bacterial blight activity observed.

In other embodiments, modifications to nucleic acid sequences encoding TFIIAgamma genes, such as any one or more of xa5, Xa5, and TFIIAgamma, or related disease resistance and susceptibility genes, are made, and the effects observed in vivo; for example, modified nucleic sequences encoding at least one xa5 gene are utilized to transform plants in which endogenous Xa5 genes are silenced by antisense RNA technology, and the effects observed. In other embodiments, xa5 genes, either unmodified or modified, are expressed in vitro translation and/or transcription systems, and the interaction of the transcribed and/or translation product with other system components (such as nucleic acids, proteins, lipids, carbohydrates, or any combination of any of these molecules) are observed.

In other embodiments, xa5, Xa5, and TFIIAgamma gene sequences are utilized to alter a disease resistance phenotype, and/or to control the ratio of a disease resistance in a host. In yet other embodiments, xa5 gene sequences are utilized to confer a disease resistance phenotype, and/or to decrease a disease resistance phenotype or to increase the production of a particular disease resistance, or to promote the production of novel disease resistance pigments. Examples of compositions are described in U.S. Patent Applns; 20040123343A1; 20030131385A1, all of which are herein incorporated by reference; while compositions and methods are described in U.S. Patent Appln, 20020092041 Al; 20030172411A1; 20020148004A1; and U.S. Patents, 5,977,434; 5,952,485, 5,859,339), all of which are herein incorporated by reference. Thus, it is contemplated that nucleic acids encoding an xa5 polypeptide of the present invention may be utilized to either increase or decrease the level of xa5 mRNA and/or protein in transfected cells as compared to the levels in wild-type cells. Examples are described in U.S. Patent No. 5,859,339; 5,952,485; 5,977,434; all of which are herein incorporated by reference.

In some embodiments, the present invention provides methods to over-ride a disease resistance phenotype, and/or to promote overproduction of disease resistance, in plants that require disease resistance, by disrupting the function of at least one xa5 gene in the plant. In these embodiments, the function of at least one xa5 gene is disrupted by any effective technique, including but not limited to antisense, co-suppression, and RNA interference, as is described above and below.

In yet other embodiments, the present invention provides methods to alter a disease resistance phenotype and/or add a disease resistance in plants in which disease resistance is not usually found and/or add a novel or rare disease resistance in plants in which disease resistance is not otherwise found, by expression of at least one heterologous xa5 gene. Thus, in some embodiments, nucleic acids comprising coding sequences of at least one xa5 gene, for example any one or more of xa5, Xa5, and TFIIAgamma, are used to transform plants without a pathway for producing a particular disease resistance. It is contemplated that some particular plant species or cultivars do not have any xa5 resistance genes; for these plants, it is necessary to transform a plant with the necessary xa5 genes required to confer the preferred disease resistance profile phenotype.

It is contemplated that other particular plant species or cultivars may possess at least one xa5 resistance gene; thus, for these plants, it is necessary to transform a plant with those xa5 genes that can interact with endogenous xa5 and XaS genes in order to confer a preferred disease resistance profile phenotype. The presence of xa5 genes in a species or cultivar can be tested by a number of ways, including but not limited to using probes from genomic or cDNA xa5 coding sequences, for example, with SEQ ID NOs:01 and fragments thereof, or PCR testing, for example with SEQ ID NOs: 164 and 165, or by using antibodies specific to XA5 polypeptides. The additional xa5 gene(s) needed to confer the desired phenotype can then be transformed into a plant to confer the phenotype. In these embodiments, plants are transformed with xa5 genes as described above and below.

As described above, in some embodiments, it is contemplated that the nucleic acids encoding an XA5 or TFIIAgammal polypeptide of the present invention may be utilized to decrease the level of xa5 mRNA and/or protein in transfected cells as compared to the levels in wild-type cells. In some of these embodiments, the nucleic acid sequence encoding an XA5 protein of the present invention is used to design a nucleic acid sequence encoding a nucleic acid product that interferes with the expression of the nucleic acid encoding an XA5 polypeptide, where the interference is based upon a coding sequence of the encoded XA5 polypeptide. Exemplary methods are described further below.

One method of reducing xa5 expression utilizes expression of antisense transcripts. Antisense RNA has been used to inhibit plant target genes in a tissue-specific manner {e.g., van der Krol et al. (1988) Biotechniques 6:958-976, herein incorporated by reference). Antisense inhibition has been shown using the entire cDNA sequence as well as a partial cDNA sequence (e.g., Sheehy et al. (1988) Proc. Natl. Acad. Sci. USA 85:8805-8809; Cannon et al. (1990) Plant MoI. Biol. 15:39-47, herein incorporated by reference). There is also evidence that 3' non-coding sequence fragment and 5' coding sequence fragments, containing as few as 41 base-pairs of a 1.87 kb cDNA, can play important roles in antisense inhibition (Ch'ng et al. (1989) Proc. Natl. Acad. Sci. USA 86:10006-10010, herein incorporated by reference).

Accordingly, in some embodiments, an XA5 encoding-nucleic acid of the present invention are oriented in a vector and expressed so as to produce antisense transcripts. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed. The expression vector is then transformed into plants and the antisense strand of RNA is produced. The nucleic acid segment to be introduced generally will be substantially identical to at least a portion of the endogenous gene or genes to be repressed. The sequence, however, need not be perfectly identical to inhibit expression. The vectors of the present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.

Furthermore, for antisense suppression, the introduced sequence also need not be full length relative to either the primary transcription product or fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. Normally, a sequence of between about 30 or 40 nucleotides and about full-length nucleotides should be used, though a sequence of at least about 100 nucleotides is preferred, a sequence of at least about 200 nucleotides is more preferred, and a sequence of at least about 500 nucleotides is especially preferred.

Catalytic RNA molecules or ribozymes can also be used to inhibit expression of the target gene or genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs. A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs that are capable of self-cleavage and replication in plants. The RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs). Examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, Solanum nodiflorum mottle virus and subterranean clover mottle virus. The design and use of target RNA-specific ribozymes is described in Haseloff, et a (1988) Nature 334:585-591, herein incorporated by reference. Ribozymes targeted to the mRNA of a lipid biosynthetic gene, resulting in a heritable increase of the target enzyme substrate, have also been described (Merlo, et al, (1998) Plant Cell 10: 1603-1621, herein incorporated by reference). Another method of reducing xa5 expression utilizes the phenomenon of cosuppression or gene silencing (See e.g., U.S. Pat. No. 6,063,947, herein incorporated by reference). The phenomenon of cosuppression has also been used to inhibit plant target genes in a tissue-specific manner. Cosuppression of an endogenous gene using a full- length cDNA sequence as well as a partial cDNA sequence (730 bp of a 1770 bp cDNA) are known (e.g. , Napoli et al (1990) Plant Cell 2:279-289; van der Krol et al (1990) Plant Cell 2:291-299; Smith et al. (1990) MoI. Gen. Genetics 224:477-481, herein incorporated by reference). Accordingly, in some embodiments the nucleic acid sequences encoding an xa5 of the present invention are expressed in another species of plant to effect cosuppression of a homologous gene. Generally, where inhibition of expression is desired, some transcription of the introduced sequence occurs. The effect may occur where the introduced sequence contains no coding sequence per se, but intron or untranslated sequences homologous to sequences present in the primary transcript of the endogenous sequence. The introduced sequence generally will be substantially identical to the endogenous sequence intended to be repressed. This minimal identity will typically be greater than about 65%, but a higher identity might exert a more effective repression of expression of the endogenous sequences. Substantially greater identity of more than about 80% is preferred, though about 95% to absolute identity would be most preferred. As with antisense regulation, the effect should apply to any other proteins within a similar family of genes exhibiting homology or substantial homology.

For cosuppression, the introduced sequence in the expression cassette, needing less than absolute identity, also need not be full length, relative to either the primary transcription product or fully processed mRNA. This may be preferred to avoid concurrent production of some plants that are overexpressers. A higher identity in a shorter than full-length sequence compensates for a longer, less identical sequence.

Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non-coding segments will be equally effective. Normally, a sequence of the size ranges noted above for antisense regulation is used.

An effective method to down regulate a gene is by hairpin RNA constructs. Guidance to the design of such constructs for efficient, effective and high throughput gene silencing have been described (Wesley SV et al. (2001) Plant J. 27: 581-590, herein incorporated by reference).

Another method to decrease expression of a gene (either endogenous or exogenous) is via siRNAs. siRNAs can be applied to a plant and taken up by plant cells; alternatively, siRNAs can be expressed in vivo from an expression cassette. RNAi refers to the introduction of homologous double stranded RNA (dsRNA) to target a specific gene product, resulting in post-transcriptional silencing of that gene. This phenomena was first reported in Caenorhahditis elegans by Guo and Kemphues (Par-1, A gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed, 1995, Cell, 81 (4) 611-620) and subsequently Fire et al. (Potent and specific genetic interference by double-stranded RNA in

Caenorhabditis elegans, 1998, Nature 391: 806-811) discovered that it is the presence of dsRNA, formed from the annealing of sense and antisense strands present in the in vitro RNA preps, that is responsible for producing the interfering activity.

The present invention contemplates the use of RNA interference (RNAi) to downregulate the expression of Xa5 genes. The term "RNA interference" or "RNAi" refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene. The gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial. In both plants and animals, RNAi is mediated by RNA-induced silencing complex (RISC), a sequence-specific, multicomponent nuclease that destroys messenger RNAs homologous to the silencing trigger. RISC is known to contain short RNAs (approximately 22 nucleotides) derived from the double-stranded RNA trigger, although the protein components of this activity are unknown. However, the 22- nucleotide RNA sequences are homologous to the target gene that is being suppressed.

Thus, the 22-nucleotide sequences appear to serve as guide sequences to instruct a multicomponent nuclease, RISC, to destroy the specific mRNAs. Carthew has reported (Curr. Opin. Cell Biol. 13(2):244-248 (2001) that eukaryotes silence gene expression in the presence of dsRNA homologous to the silenced gene. Biochemical reactions that recapitulate this phenomenon generate RNA fragments of 21 to 23 nucleotides from the double-stranded RNA. These stably associate with an RNA endonuclease, and probably serve as a discriminator to select mRNAs. Once selected, mRNAs are cleaved at sites 21 to 23 nucleotides apart.

In preferred embodiments, the dsRNA used to initiate RNAi, may be isolated from native source or produced by known means, e.g., transcribed from DNA. The promoters and vectors described in more detail below are suitable for producing dsRNA. RNA is synthesized either in vivo or in vitro. In some embodiments, endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. In other embodiments, the RNA is provided transcription from a transgene in vivo or an expression construct. In some embodiments, the RNA strands are polyadenylated; in other embodiments, the RNA strands are capable of being translated into a polypeptide by a cell's translational apparatus. In still other embodiments, the RNA is chemically or enzymatically synthesized by manual or automated reactions. In further embodiments, the RNA is synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). If synthesized chemically or by in vitro enzymatic synthesis, the RNA may be purified prior to introduction into the cell. For example, RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no or a minimum of purification to avoid losses due to sample processing. In some embodiments, the RNA is dried for storage or dissolved in an aqueous solution. In other embodiments, the solution contains buffers or salts to promote annealing, and/or stabilization of the duplex strands. In some embodiments, the dsRNA is transcribed from the vectors as two separate stands. In other embodiments, the two strands of DNA used to form the dsRNA may belong to the same or two different duplexes in which they each form with a DNA strand of at least partially complementary sequence. When the dsRNA is thus-produced, the DNA sequence to be transcribed is flanked by two promoters, one controlling the transcription of one of the strands, and the other that of the complementary strand. These two promoters may be identical or different. In some embodiments, a DNA duplex provided at each end with a promoter sequence can directly generate RNAs of defined length, and which can join in pairs to form a dsRNA. See, e.g., U.S. Pat. No. 5,795,715, herein incorporated by reference. RNA duplex formation may be initiated either inside or outside the cell. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition. RNA molecules containing a nucleotide sequence identical to a portion of the target gene are preferred for inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Thus, sequence identity may optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript. The length of the identical nucleotide sequences may be at least 25, 50, 100, 200, 300 or 400 bases.

There is no upper limit on the length of the dsRNA that can be used. For example, the dsRNA can range from about 21 base pairs (bp) of the gene to the full length of the gene or more. In one embodiment, the dsRNA used in the methods of the present invention is about 1000 bp in length. In another embodiment, the dsRNA is about 500 bp in length. In yet another embodiment, the dsRNA is about 22 bp in length. In some preferred embodiments, the sequences that mediate RNAi are from about 21 to about 23 nucleotides. That is, the isolated RNAs of the present invention mediate degradation of the target RNA (e.g., major sperm protein, chitin synthase, or RNA polymerase II). The double stranded RNA of the present invention need be sufficiently similar to natural RNA that it has the ability to mediate RNAi for the target RNA. In one embodiment, the present invention relates to RNA molecules of varying lengths that direct cleavage of specific mRNA to which their sequence corresponds. It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi cleavage of the target mRNA. In some embodiments, the amount of target RNA (e.g., Xa5mRNA) is reduced in the cells of the plant exposed to target specific double stranded RNA as compared to cells of the plant or a control plant that have not been exposed to target specific double stranded RNA. In still further embodiments, knockouts may be generated by homologous recombination. Generally, plant cells are incubated with a strain of Agrobacterium that contains a targeting vector in which sequences that are homologous to a DNA sequence inside the target locus are flanked by Agrobacterium transfer-DNA (T-DNA) sequences, as previously described (U.S. Patent No. 5,501,967, herein incorporated by reference). One of skill in the art knows that homologous recombination may be achieved using targeting vectors that contain sequences that are homologous to any part of the targeted plant gene, whether belonging to the regulatory elements of the gene, or the coding regions of the gene. Homologous recombination may be achieved at any region of a plant gene so long as the nucleic acid sequence of regions flanking the site to be targeted is known.

A. Transgenic Plants, Seeds, and Plant Parts

Plants are transformed with at least one heterologous gene encoding an xa5 gene, or encoding a sequence designed to decrease Xa5 or TFIIAgammal) gene expression, according to any procedure well known or developed in the art. It is contemplated that these heterologous genes, or nucleic acid sequences of the present invention and of interest, are utilized to increase the level of the polypeptide encoded by heterologous genes, or to decrease the level of the protein encoded by endogenous genes. It is contemplated that these heterologous genes, or nucleic acid sequences of the present invention and of interest, are utilized augment and/or increase the level of the protein encoded by endogenous genes. It is also contemplated that these heterologous genes, or nucleic acid sequences of the present invention and of interest, are utilized to provide a polypeptide encoded by heterologous genes. The term "transgenic" when used in reference to a plant or fruit or seed for example a "transgenic plant," "transgenic fruit," "transgenic seed," or a "transgenic host cell" refers to a plant or fruit or seed that contains at least one heterologous or foreign gene in one or more of its cells. The term

"transgenic plant material" refers broadly to a plant, a plant structure, a plant tissue, a plant seed or a plant cell that contains at least one heterologous gene in one or more of its cells.

1. Plants The methods of the present invention are not limited to any particular plant.

Indeed, a variety of plants are contemplated, including but not limited to rice (Oryza sativa), tomato, peppers, cotton, barley, sorghum, sunflower, corn, wheat, Brassica, , marigolds, and soybean. The term "plant" is used in it broadest sense. It includes, but is not limited to, any species of woody, ornamental or decorative, crop or cereal, fruit or vegetable, fruit plant or vegetable plant, flower or tree, macroalga or microalga, phytoplankton and photosynthetic algae (e.g., green algae Chlamydomonas reinhardtii). It also refers to a uniclelluar plant (e.g. microalga) and a plurality of plant cells that are largely differentiated into a colony (e.g. volvox) or a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a fruit, a seed, a shoot, a stem, a leaf, a flower petal, etc. The term "plant tissue" includes differentiated and undifferentiated tissues of plants including those present in roots, shoots, leaves, pollen, seeds and tumors, as well as cells in culture (e.g., single cells, protoplasts, embryos, callus, etc.). Plant tissue may be in planta, in organ culture, tissue culture, or cell culture. The term "plant part" as used herein refers to a plant structure or a plant tissue. In some embodiments of the present invention transgenic plants are crop plants. The term "crop" or "crop plant" is used in its broadest sense. The term includes, but is 36220

not limited to, any species of plant or alga edible by humans or used as a feed for animals or fish or marine animals, or consumed by humans, or used by humans (natural pesticides), or viewed by humans (flowers) or any plant or alga used in industry or commerce or education. 2. Transformation Techniques

Once a nucleic acid sequence encoding aXa5 gene is operatively linked to an appropriate promoter and inserted into a suitable vector for the particular transformation technique utilized (e.g., one of the vectors described above), the recombinant DNA described above can be introduced into the plant cell in a number of art-recognized ways. Those skilled in the art will appreciate that the choice of method might depend on the type of plant targeted for transformation. In some embodiments, the vector is maintained episomally. In other embodiments, the vector is integrated into the genome. In some embodiments, direct transformation in the plastid genome is used to introduce the vector into the plant cell (See e.g., U.S.'Nos. 5,451,513; 5,545,817; 5,545,818; PCT application WO 95/16783 all of which are incorporated herein by reference). The basic technique for chloroplast transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the nucleic acid encoding the RNA sequences of interest into a suitable target tissue (e.g., using biolistics or protoplast transformation with calcium chloride or PEG). The 1 to 1.5 kb flanking regions, termed targeting sequences, facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome. Initially, point mutations in the chloroplast 16S rRNA and rpsl2 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab et al, PNAS, 87:8526 (1990); Staub and Maliga, Plant Cell, 4:39 (1992), all of which are incorporated herein by reference). The presence of cloning sites between these markers allowed creation of a plastid targeting vector introduction of foreign DNA molecules (Staub and Maliga, EMBO J., 12:601 (1993)). Substantial increases in transformation frequency are obtained by replacement of the recessive rRNA or r-protein antibiotic resistance genes with a dominant selectable marker, the bacterial aadA gene encoding the spectinomycin-detoxifying enzyme aminoglycoside-3'-adenyltransferase (Svab and Maliga, PNAS, 90:913 (1993)). Other selectable markers useful for plastid transformation are known in the art and encompassed within the scope of the present invention. Plants homoplasmic for plastid genomes containing the two nucleic acid sequences separated by a promoter of the present invention are obtained, and are preferentially capable of high expression of the RNAs encoded by the DNA molecule. In other embodiments, vectors useful in the practice of the present invention are microinjected directly into plant cells by use of micropipettes to mechanically transfer the recombinant DNA (Crossway, MoI. Gen. Genet, 202:179 (1985)). In still other embodiments, the vector is transferred into the plant cell by using polyethylene glycol (Krens et al, Nature, 296:72 (1982); Crossway et al, BioTechniques, 4:320 (1986)); fusion of protoplasts with other entities, either minicells, cells, lysosomes or other fusible lipid-surfaced bodies {e.g. Fraley et al, Biochemistry, Dec 23 ;19(26):6021-6029 (1980)); protoplast transformation (EP 0 292 435); direct gene transfer {e.g. Paszkowski etal, Biotechnology 24:387-392 (1992); Potrykus et al, MoI Gen Genet. 199(2): 169- 177 (1985) including direct gene transfer into protoplasts {e.g. in Arabidopsis thaliana, Damm et al, MoI Gen Genet. May;217(l):6-12 (1989); in rice Meijer et al, Plant MoI Biol May;16(5):807-820) (1991); all of which are herein incoroporated by reference).

In still further embodiments, the vector may also be introduced into the plant cells by electroporation(e.g. Fromm, et al, Proc. Natl. Acad. Sci. USA, Sep;82(17):5824-5828 (1985) and Nature Feb 27-Mar 5;319(6056):791-793 (1986); Riggs and Bates Proc. Natl. Acad. Sci. USA Aug;83(15):5602-5606 (1986)). In this technique, plant protoplasts are electroporated in the presence of plasmids containing the gene construct. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and form plant callus. In yet other embodiments, the vector is introduced through ballistic particle acceleration using devices {e.g., available from Agracetus, Inc., Madison, Wis. and Dupont, Inc., Wilmington, Del). (See e.g. , U.S. Pat. No. 4,945,050; and McCabe et al. , Biotechnology 6:923 (1988), all of which are herein incorporated by reference). See also, Weissinger et al, Annual Rev. Genet. 22:421 (1988); Sanford et al, Particulate Science ^{ and Technology, 5:27 (1987) (onion); Svab et al, Proc. Natl. Acad. Sci. USA, 87:8526 (1990) (tobacco chloroplast); Christou et α/., Plant Physiol., 87:671 (1988) (soybean); McCabe et al, Bio/Technology 6:923 (1988) (soybean); Klein et al, Proc. Natl. Acad. Sci. USA, 85:4305 (1988) (maize); Klein et al, Bio/Technology, 6:559 (1988) (maize); Klein etal, Plant Physiol, 91:4404 (1988) (maize); Fromm et al, Bio/Technology, 8:833 (1990); and Gordon-Kamm et al, Plant Cell, 2:603 (1990) (maize); Koziel et al, Biotechnology, 11:194 (1993) (maize); Hill et al, Euphytica, 85:119 (1995) and Koziel etal, Annals of the New York Academy of Sciences 792:164 (1996); Shimamoto etal, Nature 338: 274 (1989) (rice); Christou et al, Biotechnology, 9:957 (1991) (rice); Datta et al, Bio/Technology 8:736 (1990) (rice); European Application EP 0 332 581 (orchardgrass and other Pooideae); Vasil et al, Biotechnology, 11 : 1553 (1993) (wheat); Weeks et al, Plant Physiol, 102: 1077 (1993) (wheat); Wan et al, Plant Physiol. 104: 37 (1994) (barley); Jahne et al, Theor. Appl. Genet. 89:525 (1994) (barley); Knudsen and Muller, Planta, 185:330 (1991) (barley); Umbeck et al, Bio/Technology 5: 263 (1987) (cotton); Casas et al, Proc. Natl. Acad. Sci. USA 90:11212 (1993) (sorghum); Somers et al, Bio/Technology 10:1589 (1992) (oat); Torbert et al, Plant Cell Reports, 14:635 (1995) (oat); Weeks et al, Plant Physiol, 102:1077 (1993) (wheat); Chang et al, WO 94/13822 (wheat) and Nehra et al, The Plant Journal, 5:285 (1994) (wheat); all of which are herein incorporated by reference.

In addition to direct transformation, in some embodiments, the vectors comprising a nucleic acid sequence encoding an xa5 gene are transferred using Agrobacterium- mediated transformation (Hinchee et al, Biotechnology, 6:915 (1988); Ishida et al,

Nature Biotechnology 14:745 (1996), all of which are herein incorporated by reference). Agrobacterium is a representative genus of the gram-negative family Rhizobiaceae. Its species are responsible for plant tumors such as crown gall and hairy root disease. In the dedifferentiated tissue characteristic of the tumors, amino acid derivatives known as opines are produced and catabolized. The bacterial genes responsible for expression of opines are a convenient source of control elements for chimeric expression cassettes. Heterologous genetic sequences {e.g., nucleic acid sequences operatively linked to a promoter of the present invention), can be introduced into appropriate plant cells, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti plasmid is transmitted to plant cells on infection by Agrobacterium tumefaciens, and is stably integrated into the plant genome (Schell, Science, 237: 1176 (1987)). Species which are susceptible infection by Agrobacterium may be transformed in vitro.

3. Regeneration.

After selecting for transformed plant material that can express a heterologous gene encoding an xa5 gene or variant thereof, whole plants are regenerated. Plant regeneration from cultured protoplasts is described in Evans et al, Handbook of Plant Cell Cultures, Vol. 1: (MacMillan Publishing Co. New York, 1983); and Vasil I. R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. 1, 1984, and Vol. Ill, 1986, herein incorporated by reference. It is known that many plants can be regenerated from cultured cells or tissues, including but not limited to all major species of sugarcane, sugar beet, cotton, fruit and other trees, legumes and vegetables, and monocots {e.g., the plants described above). Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts containing copies of the heterologous gene is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted.

Alternatively, embryo formation can be induced from the protoplast suspension. These embryos germinate and form mature plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. Shoots and roots normally develop simultaneously. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. The reproducibility of regeneration depends on the control of these variables.

4. Generation of Transgenic Lines

Transgenic lines are established from transgenic plants by tissue culture propagation. The presence of nucleic acid sequences encoding an exogenous xa5 gene or mutants or variants thereof may be transferred to related varieties by traditional plant breeding techniques. Examples of transgenic lines are described herein and in Example 1. These transgenic lines are then utilized for evaluation of bacterial blight activity, disease resistance ratios, phenotype, color, pathogen resistance and other agronomic traits. B. Evaluation of Bacterial blight activity

The transgenic plants and lines are tested for the effects of the transgene on disease resistance phenotype. The parameters evaluated for disease resistance are compared to those in control untransformed plants and lines. Parameters evaluated include rates of bacterial blight activity, effects of light, heat, cold; effects on altering steady-state ratios and effects on bacterial blight activity. Rates of bacterial blight activity can be expressed as a unit of time, or in a particular tissue or as a developmental state; for example, bacterial blight activity Oryza sativa can be measured in leaves. These tests are conducted both in the greenhouse and in the field. The terms "altered disease resistance ratios" and "altering bacterial blight resistance" refers to any changes in bacterial blight activity.

The present invention also provides any of the isolated nucleic acid sequences described above operably linked to a promoter. In some embodiments, the promoter is a heterologous promoter. In other embodiments, the promoter is a plant promoter. The present invention also provides a vector comprising any of the nucleic acid sequences described above. In some embodiments, the vector is a cloning vector; in other embodiments, the vector is an expression vector. In some further embodiments, the nucleic acid sequence in the vector is linked to a promoter. In some further embodiments, the promoter is a heterologous promoter. In other further embodiments, the promoter is a plant promoter.

The present invention also provides a transgenic host cell comprising any of the nucleic acid sequences of the present invention described above, wherein the nucleic acid sequence is heterologous to the host cell. In some embodiments, the nucleic acid sequence is operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above.

The present invention also provides a transgenic organism comprising any of the nucleic acid sequences of the present invention described above, wherein the nucleic acid sequence is heterologous to the organism. In some embodiments, the nucleic acid sequence is operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above. The present invention also provides a transgenic plant, a transgenic plant part, a transgenic plant cell, or a transgenic plant seed, comprising any of the nucleic acid sequences of the present invention described above, wherein the nucleic acid sequence is heterologous to the transgenic plant, a transgenic plant part, a transgenic plant cell, or a transgenic plant seed. In some embodiments, the nucleic acid sequence is operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above.

The present invention also provides a method for producing an xa5 polypeptide, comprising culturing a transgenic host cell comprising a heterologous nucleic acid sequence, wherein the heterologous nucleic acid sequence is any of the nucleic acid sequences of the present invention described above which encode an xa5 polypeptide or variant thereof, under conditions sufficient for expression of the encoded xa5 polypeptide, and producing a xa5 polypeptide in the transgenic host cell. In some embodiments, the nucleic acid sequence is' operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above. The present invention also provides a method for producing a xa5 polypeptide, comprising growing a transgenic host cell comprising a heterologous nucleic acid sequence, wherein the heterologous nucleic acid sequence is any of the nucleic acid sequences of the present invention described above encoding a xa5 polypeptide or a variant thereof, under conditions sufficient for expression of the encoded xa5 polypeptide, and producing the xa5 polypeptide in the transgenic host cell.

The present invention also provides a method for altering the phenotype of a plant, comprising providing an expression vector comprising any of the nucleic acid sequences of the present invention described above, and plant tissue, and transfecting the plant tissue with the vector under conditions sucli that a plant is obtained from the transfected tissue and the nucleic acid sequence is expressed in the plant and the phenotype of the plant is altered. In some embodiments, the nucleic acid sequence encodes a xa5 polypeptide or variant thereof. In other embodiments, the nucleic sequence encodes a nucleic acid product which interferes with the expression of a nucleic acid sequence encoding a xa5 polypeptide or variant thereof, wherein the interference is based upon the coding sequence of the xa5 protein or variant thereof. In some embodiments, the nucleic acid sequence is operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above.

The present invention also provides a method for altering the phenotype of a plant, comprising growing a transgenic plant comprising an expression vector comprising any of the nucleic acid sequences of the present invention described above under conditions such that the nucleic acid sequence is expressed and the phenotype of the plant is altered. In some embodiments, the nucleic acid sequence encodes a xa5 polypeptide or variant thereof. In other embodiments, the nucleic sequence encodes a nucleic acid product which interferes with the expression of a nucleic acid sequence encoding a xa5 polypeptide or variant thereof, wherein the interference is based upon the coding sequence of the xa5 protein or variant thereof. In some embodiments, the nucleic acid sequence is operably linked to any of the promoters described above. In other embodiments, the nucleic acid is present in any of the vectors described above.

EXPERIMENTAL

The following examples serve to illustrate certain embodiments and aspects of the present invention and are not to be construed as liming the scope thereof. In the experimental disclosures which follow, the following abbreviations apply: N (normal); M (molar); mM (millimolar); μM (micromolar); mol (moles); mmol

(millimoles); μmol (micromoles); nmol (nanomoles); pmol (picomoles); g (grams); mg (milligrams); μg (micrograms); ng (nanograms); pg (picograms); L or 1 (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); °C (degrees Centigrade). The following is a description of exemplary materials and methods that were used in subsequent Examples.

EXAMPLE 1 Recombinant screen. Two-thousand three hundred and seventy-five individuals individuals from an F2 population (gift from Matthew Blair) of a cross between the susceptible indica variety IR24, containing Xa5, and the resistant isoline IRBB5, which has an introgression containing xa5, (Ogawa, et al., Near-isogenic lines as international differentials for resistance to bacterial blight of rice, Rice Genetics, Newsletter 5: 106-109 (1988)) were grown in 2 inch deepots in the Guterman greenhouse of Cornell University. DNA was extracted using the Matrix Mill method (Paris and Carter, Cereal DNA: a rapid thigh- throughput extraction method for marker assisted selection, Plant MoI. Biol. Rep. 18: 357-360 (2000)).

The microsatellites RM601, RM603, RM607, RM609 and RM611 (Blair, et al, High resolution genetic mapping and candidate gene identification at the xa5 locus for bacterial blight resistance in rice (Oryza sativa L.) Theor. Appl. Genet. 107: 62-73 (2003) were amplified using standard PCR protocols, run on 4% PAGE gels and silver stained as described (Panaud, et al., Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice {Oryza sativa L.), MoI. Gen. Genet. 252: 597-607 (1996)). Tillers of recombinant F2 individuals were divided and transplanted into 6 inch pots. One tiller was inoculated with X. oryzae pv. oryzae PXO 86 (race2) and one tiller was allowed to set seed.

Twenty F3 seeds of each recombinant F2 individual were planted, inoculated 55- 60 days after planting, and analyzed for phenotype and segregation within a family. Reactions were scored as resistant if average lesion length was three cm or less and susceptible if average lesion length was greater than 3 centimeter. Several plants of the cultivar Nipponbare were inoculated and scored in the same manner.

EXAMPLE 2

Bacterial growth and inoculation. Xanthomonas oryzae pv. oryzae PXO 86 was cultured on media containing 2Og sucrose, 5g peptone, 0.5g Ca(NO3)2, 0.43g Na2HPO4 and 0.05g FeSO4 per liter and allowed to grow at 28-30°C for 3-4 days. Bacteria were collected into sterile distilled water and adjusted to a concentration of OD600 = 1. Plants were inoculated by the leaf-clipping method (Kauffman, et al., An improved technique for evaluating resistance of race varieties to Xanthomonas oryzae, Plant Dis. Rep. 57:537-541 (1973)) 55-65 days after planting and were scored 14 days after inoculation. EXAMPLE 3 RT-PCR.

Tissue was collected from susceptible IR24 plants and its resistant isoline IRBB5 at 2, 4, 8, 24, and 48 hours after inoculation in three separate experiments. Uninoculated and wounded plants were used as controls. Leaves were wounded by tearing a 2-3 cm piece of leaf tissue. Total RNA was extracted with RNAeasy mini-plant RNA extraction kit (Qiagen, Valencia, CA). One μg total RNA was treated with DNAse (Invitrogen, Carlsbad, CA) and amplified into cDNA with reverse transcriptase (Invitrogen) following manufacturer's instructions. As a control, water was used in place of reverse transcriptase for the RT- reaction. The reaction was diluted threefold and 2 μl cDNA was used for amplification of TFIIAgaτnma and αctin; 4 μl cDNA was used for amplification of Q94HL4. Twenty, 25, 30, 35, and 40 cycles were used for amplification. Seven μl TFIIAgamma, αctin, and TFIIAgamtna RT-, andl5 μl Q94HL4 PCR products were loaded on 1% agarose gels. Primers were designed to span introns of TFIIAgamm&S , Q94HL4 and αctin; each reverse primer was anchored in the 3'UTR. BLAST searches were used to ensure that primers were specific to the candidate gene of interest. The primers used were: TFIIAgamma F 5' - GAAGCCTTGGAGAACCAAGTC - 3' (SEQ ID NO:164) and TFIIAgαmmq R: 5' - GGTGACTCCGCACAATTTCT - 3' (SEQ ID NO:165); Q94HL4 F: 5'- GCACCTTTATGGCCATCCCCACTAT - 3' (SEQ ID NO:166) and Q94HL4 R: 5'- GGTATACATGTGCCGAAGGTC - 3' (SEQ ID NO: 167) and αctin F: 5'-CGTCCTCTCTCTGTATGCCAG - 3' (SEQ ID NO: 168) and αctin R: 5'- CTGGTACCCTCATCAGGCAT - 3' (SEQ ID NO:169).

EXAMPLE 4

Sequence analysis of resistant and susceptible cultivars.

Susceptible and resistant cultivars were chosen from the group of Aus-Boro rices (Garris, et αl., Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xα5 locus of rice (Oryzα sαtivα L.) Genetics 165: 759-69 (2003)). Primers were designed at 0.5-lkb intervals throughout the candidate gene region and used to amplify susceptible and resistant sequences with PFU polymerase (Invitrogen, Carlsbad, CA). Amplified products were sequenced at the Cornell Biotechnology Resource Center.

EXAMPLE 5 Database Searches and Sequence Alignment.

Databases at The National Center for Biotechnological Information (NCBI) and The Institute for Genome Research (TIGR) were searched using BLAST (Altschul et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389-3402 (1997)). Sequences were aligned using the ClustalW program of the European Bioinformatics Institute (www.ebi.ac.uk) and the MegAlign program of DNAstar (GeneCodes, Ann Arbor, MI). Then reported gene prediction was used with (Blair, et ah, High resolution genetic mapping and candidate gene identfication at the xa5 locus for bacterial blight reisistance in rice (Oryza sativa L.) Theor. Appl. Genet. 107: 62-73 (2003)) with mRNA and genomic IR24 sequence alignment to find the first codon of the gene encoding the hypothetical protein Q94HL4 (GenBank GI:33151122).

EXAMPLE 6

Positional cloning identifies xa5 in an 8.1 kb region containing TFIIAgamma. Previous results in our lab had narrowed xa5 to an approximately 100kb segment in the sub-telomeric region of chromosome 5 (Blair, et al., High resolution genetic mapping and candidate gene identfication at the xa5 locus for bacterial blight resistance in rice {Oryza sativa L.), Theor. Appl. Genet. 107: 62-73 (2003)). A screen of approximately 2345 F2 individuals from a cross between susceptible IR24 and resistant IRBB5 identified 27 recombinants within thelOOkb region between microsatellite markers RM601 and RM611. Of these individuals, 14 had recombination breakpoints between RM601 and RM603, 2 had breakpoints between RM603 and RM607, 7 between RM607 and RM609 and 4 between RM609 and RM611 (Figure 1).

To further narrow the region containing the critical recombination breakpoint, single nucleotide polymorphisms (SNPs) were identified in the region between the recombinant markers. Once the breakpoint had been isolated to a pair of SNPs, the 5 kb region between these was sequenced. F2 individual 3-E9 had heterozygous (susceptible) sequence at RM603 and (resistant) IRBB5 sequence at RM607. The recombination breakpoint in this individual was upstream of the ABC transporter and TFIIAgamma, which are transcribed from opposite strands (Figure 1). F3 individuals derived from 3-E9 were resistant, indicating that the xa5 gene was located proximal (3') of the breakpoint in the IRBB5 sequence.

Individual 17-H7 had heterozygous (susceptible) sequence at RM603 and (resistant) IRJBB5 sequence at RM607. The heterozygous sequence continued from RM603 until a breakpoint in the second exon of TFIIAgamma (Fig. 1), after which the sequence was homozygousIRBB5. F3 family members derived from this individual were resistant.

Individual 10-D9 had IR24 (susceptible) sequence at RM603 and RM607. This sequence continued until approximately 2.2 kb downstream of the 3 'UTR of TFIIAgamma, and subsequently was heterozygous. While members of this F3 family had homozygous IR24 (susceptible) sequence until this breakpoint, one-quarter were homozygous for IRBB5 (resistant) after the breakpoint. When inoculated, members of family 10-D9 were susceptible, indicating that thexα5 gene was located distal (5') of the recombination breakpoint (Figure 1).

Additional recombinants confirmed that xa5 was located in this region. Individual 7-E3had IR24 (susceptible) sequence at RM603 and RM 607, and heterozygous sequence at RM609.Sequencing revealed that this individual had a recombination breakpoint in the middle of the gene encoding the hypothetical protein Q94HL4. Thus one-quarter of F3 family members had homozygous IR24 sequence from RM607 until the middle of the coding region of this gene, whereupon the sequence became homozygous IRBB5. Members of this family were susceptible, demonstrating that the xa5 gene was distal (5') of this breakpoint, consistent with our other findings.

As individuals in family 10-D9 were susceptible and members in family 17-H7 were resistant, the xa5 gene was localized between the recombinant breakpoints of these two families. The breakpoints encompassed approximately 5.9 kb of TFIIAgamma and 2.2 kb of downstream intergenic sequence on the IR24 BAC (Figure 1). EXAMPLE 7

Sequencing and expression analysis of the gene encoding hypothetical proteinQ94HL4 reveals no differences between susceptible and resistant cultivars.

To fully evaluate a possible role of the 2.2 kb region downstream of TFIIAgammq in regulating the expression of Q94HL4, first the coding region of the Q94HL4 hypothetical protein was sequenced and found it to be identical between IR24 (susceptible) and IRBB5 (resistant) isolines. Then the PLACE promoter prediction program was used (Higo, et ah, Plant cis-acting regulatory DNA elements (PLACE) database: 1999, Nucleic Acids Research, 27: 297-300 (1999)) to scan the 22 kb region for enhancer elements in IR24, the internationally sequenced susceptible japonica variety Nipponbare (The Rice Choromosome 10 Sequencing Consortium, In-depth view of structure, activity, and evolution of rice chromosome 10, Science 300: 1566-9 (2003) and IRBB5 (resistant). No enhancer elements were found that segregated with susceptible and resistant phenotypes. There were 26 polymorphisms within this 2.2 kb region, including a 327 bp fragment that was absent in IRBB5but present in IR24 (Table 1). However, of these, 18 (including the 327 bp indel) were shared between IRBB5 (resistant) and the susceptible japonica Nipponbare, suggesting that they are not involved in the resistance conferred by xa5.

Table 1: Polymorphisms between susceptible cultivars IR24 and Nipponabare and resistant IRBB5 in the 2.2 kb region presented sequentially from the end of the Nipponbare TFIIAgamma cDNA (GI 32975200) to the nearest recombinant breakpoint. The eight polymorphisms which segregate for susceptibility are highlighted in gray.

To investigate the possible functional significance of the polymorphisms in this region, the expression patterns of both Q94HL4 and TFIIA gamma in susceptible and resistant plants were compared with and without inoculation with race 2 of X. oryzae pv. oryzae. RT-PCR analysis showed that transcripts from both Q94HL4 and TFIIAgamma were detectable in resistant and susceptible cultivars at tested timepoints and in wounded controls (Fig. 2). With little difference in the coding sequence of Q94HL4 and similar expression between the resistant and susceptible isolines, and given the position of the breakpoint in recombinant 10-D9, there appeared to be little evidence to merit further consideration of Q94HL4 as xa5. These results left open the possibility that a mutation in the coding region of TFIIAgamma was responsible for xa5 resistance.

EXAMPLE 8

Sequencing of TFIIAgamma reveals two nucleotide substitutions that result in a single amino acid change.

The start codon, splice junctions, and 3'UTR of the TFIIAgamma gene were defined by aligning a Nipponbare TFIIAgamma cDNA (GI 32975200) to the IR24 (susceptible) BAC. Then the coding region of TFIIAgamma in the resistant IRBB5 isoline and was sequenced and compared it to the IR24 sequence. This identified two nucleotide substitutions, resulting in an amino acid substitution from valine to glutamic acid at position 39 in the resistant cultivar, a significant change from a hydrophobic to hydrophilic amino acid (Figure 3A). There were also 5 single basepair substitutions between IR24 (susceptible) and IRBB5 (resistant) within the 380 base pair3'UTR. However, 5/5 of these substitutions were identical in Nipponbare (susceptible) and IRBB5 (resistant), indicating that they do not play a role in xa5 resistance.

Examination of the structure of TFIIAgamma further showed that the variable amino acid at position 39 resided in a solvent exposed surface, suggesting that it may play a role in protein-protein interactions (Bleichenbacher, et ah, Novel interactions between the components of human and yeast TFIIAgammaTBP/DNA complexes, J. MoI. Biol. 332: 783-93 (2003)). This single amino acid change in TFIIAgamma is consistent with the stable expression of this gene in both susceptible and resistant plants, and leads to the hypothesis that it functions both as general transcription factor and as xa5. EXAMPLE 9

Association between haplotype and phenotype.

To further explore the association between this amino acid polymorphism and the phenotype, the region of TFIIAgamma was sequenced around the nucleotide substitutions in 27 resistant and 9 susceptible accessions from the group of Aus-Boro rices (Blair and McCouch, Microsatellite and sequence-tagged site markers diagnostic for the rice bacterial leaf blight resistance gene xα-5, Theor. Appl. Genet. 95: 174-184 (1997)). Next the association in the susceptible japonica variety, Nipponbare was compared to sequenced varieties listed in Table 2. Nine/nine susceptible Aus-Boro varieties and seven of the 27 resistant varieties were previously assayed with X. oryzaepv. oryzae race 2 in our laboratory (Garris et ah, Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.) Genetics 165: 759-69 (2003)), while the remaining 20 resistant accessions had previously been allele tested for xa5 (Sidhu, et ah, Genetic analysis of bacterial blight resistance in seventy-four cultivars of rice, Oryza sativa L., Theor. Appl. Genet. 53: 105-111 (1978); Olufowote, et al., Inheritance of bacterial blight disease in rice, Phytopathology 67: 772-775 (1977); Singh, et al., A new gene for resistance to bacterial blight in rice, Crop Sci. 23: 558-560 (1983)). In addition, Nipponbare was tested using the same assay and was confirmed susceptible. A single resistant haplotype was found that conserved across 27/27 resistant lines. There were two haplotypes among tiie eleven (nine Aus-Boro, IR24, and

Nipponbare) susceptible accessions, each of which carried nucleotides that reuslt in a valine at position 39. One susceptible haplotype also had a silent mutation within the coding region (Figure 3B). The japonica Nipponbare contained the same susceptible haplotype as IR24 (Figure 3B). EXAMPLE 10

Complementation Analysis for establishing a role for a Xa5 susceptibility allele. A resistant cultivar of IRBB 105, a japonica, was transformed with the dominant susceptible allele, Xa5 expressing a gene comprising (SEQ ID No:03). Inoculation assays with bacteria (see, Example 2) showed that progeny T2 plant families were segregating 3:1 for susceptibility. These results demonstrate that one copy of the dominant allele is enough to provide susceptibility, further suggesting that Xa5 may be a virulence target of the bacterium. As used herein, "virulence target" refers to a protein target of a bacterially produced ligand, wherein when interaction of target and ligand will alter virulence of the bacterium. As used herein, "virulence factor" refers to any gene product, such as an effecter protein, which enhances the ability of an organism to cause disease. For example, virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein.

EXAMPLE 11 xa5 / Avrxa5 interactions.

A ligand for one or both of the products ofxa5 alleles is a putative product or modification product of avrxa 5 . A yeast two-hybrid system was designed in order to determine which xa allele product interacts with a putative avrxa5 product. Allele products of xa5, xa5 (SEQ ID NO:01) and Xa5 (SEQ ID NO:02) were tested and found to interact weakly with a putative avrxa5 product in the yeast two hybrid system.

However, the dominant susceptible gene product Xa5 appears to interact more strongly than the recessive resistant xa5 product to a putative avrxa5 product.

EXAMPLE 12

Dose-Dependency demonstrating tolerance based resistance.

The inventors tested whether the xa5 lociis was completely recessive by examining lesion length and bacterial growth in resistant, susceptible, and heterozygous rice plants. Following inoculation, see Example 2, the investigators found no significant difference in lesion length or bacterial growth between the homozygous susceptible and heterozygous plants. Resistant plants also showed similar levels of bacterial growth as did susceptible plants. However, unlike susceptible plants, resistant plants showed small lesions or no lesions. This indicates that resistant plants allow bacterial multiplication, but not movement, down the leaf, suggesting that xa5 resistance is a form of tolerance. Furthermore, these results demonstrate that recessive resistant plants would be more desirable for providing bacterial blight resistance.

EXAMPLE 13

Xa5 provides resistance in both seedling and pre-flowering plants. The investigators tested whether xa5 alleles provides resistance in seedlings. The inventors showed through inoculation and measurement of lesion length of 2, 3, 4, 5, 6, and 8 week old plants, that xa5 is operative in each of these stages. Furthermore, heterozygotes are equally as susceptible to bacterial infections as homozygous susceptible plants at all stages of growth examined.

EXAMPLE 14

Expression levels of XaS and its paralog in seedling and pre-flowering plants. Rice has two copies of TFIIAy, xa5 (TFIIAy5) and a paralog on chromosome 1 (TFIIAyI). Both copies of TFIIAy, TFIIAy5 and TFIIAyI, are expressed in seedlings and pre-flowering plants. Similarly, both copies are expressed in healthy, wounded, and inoculated plants. Preliminary RT-PCR results suggest that TFIIAyI is expressed at a lower level than TFIIAy5 (xaS).

Arabidopsis plants express one copy of TFIIAy. Of the two copies of TFIIAy, xa5 appears to be the more ancient in phylogeny as it more identicle to the Arabidopsis TFIIAy than is TFIIAy(I). Further phylogenetic studies are contemplated. Thus it appears that TFIIAyI is a duplication of TFIIAy5 in the monocot plants.

EXAMPLE 15

Separating resistant rice plants from susceptible rice plants by Xa5 alleles. In order to separate resistant plants from susceptible plants, a cleaved amplified polymorphic sequence, also known as PCR-RFLP (CAPS) marker was found to identify each allele of xa5. Rice germplasm was isolated and PCR amplifed using SEQ ID NOs: 164 and 165, for providing rice plant DNA samples. These PCR products were then digested with endonuclease Bsrl for identifying a susceptible allele or SmII for identifying a resistant allele using methods well-known in the art. The size of the cut fragments are identified on ethidium bromide stained agarose gels for determining whether susceptible and /or resistant products are present in the rice germplasm sample. Thus heterozygous and homozygous susceptible and resistant plants may be readily identified for rice breeding programs.

Table 2: Aus-Boro varieties used in the association experiment.

^aIRBB5 has an Aus-Boro introgression containing xa5 in an IR24 (Indicά) background.

TABLE 3. Relationship of Oryza sativa Xa5-R (TFIIAgamma) to plants and other organisms.

* = partial SEQ

** = homologous within potential active region

*** = homology to small regions using align not BLAST

NSH= no significant homology

Table 4. Transgenic rice plants.

AU publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims

1. A nucleic acid comprising a sequence encoded by a sequence selected from the group consisting of SEQ ID NO:01 and sequences at least 54% identical to SEQ ID

NO:01, wherein said sequence encodes a protein having bacterial blight resistance activity.

2. An isolated nucleic acid molecule comprising a polynucleotide encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein said sequence encodes a protein having bacterial blight resistance activity.

3. The nucleic acid molecule of Claim 2, wherein said polypeptide further comprises a conserved domain having at least an 38% sequence identity to SEQ ID NO:248.

4. A vector construct comprising a nucleic acid selected from the group consisting of a nucleic acid sequence at least 54% identical to SEQ ID NO:01 and a nucleic acid sequence encoding a polypeptide at least 35% identical to SEQ ID NO:78, wherein said sequence encodes a protein having bacterial blight resistance activity.

5. The vector of Claim 4, wherein said nucleic acid is operably linked to an exogenous promoter.

6. The vector of Claim 5, wherein said exogenous promoter is a eukaryotic promoter.

7. The vector of Claim 6, wherein said eukaryotic promoter is active in a plant

8. The vector of Claim 4, wherein the vector is a plant vector.

9. The vector of Claim 8, wherein the plant vector is a T-DNA vector.

10. A transgenic plant comprising the vector of Claim 4.

11. A method for altering bacterial blight resistance, comprising: a) providing a vector construct comprising a nucleic acid encoding a polypeptide, wherein the polypeptide alters bacterial blight infections; and b) producing a plant comprising the vector, wherein the plant exhibits altered bacterial blight resistance.

12. The method of Claim 11, wherein said altered bacterial blight resistance is an increase in resistance to Xanthomonas bacterial infections.

13. The method of Claim 11, wherein said polypeptide at least 35% identical to SEQ ID NO NO:78.

14. The method of Claim 11, wherein said polypeptide is encoded at least in part by a fragment selected from the group consisted of SEQ ID NOs: 195-217.

15. The method of Claim 11, wherein said nucleic acid sequence encodes a polypeptide at least 38% identical to SEQ ID NO:248.

16. The method of Claim 11 , wherein said plant is selected from the group consisting of rice, cotton, soybean, potato, sorghum, maize, wheat, barley, sugarcane, tomato, and pepper plants.

17. The method of Claim 11 , wherein said nucleic acid is operably linked to an exogenous promoter.

18. The method of Claim 11 , wherein said exogenous promoter is tissue specific.

19. The method of Claim 11 , wherein said vector is a T-DNA vector. 0. The method of Claim 11 , further comprising propagating said plant.