WO2006040534A2 - Method of detecting the presence or activity of g - protein coupled receptor 92 (gpr92) - Google Patents

Abstract

We describe a method comprising detecting GPR92 modulated expression of an NF-κB, API, CRE or p53 sensitive reporter, preferably for detecting the presence, quantity, activity or a change in any of these of a GPCR. These methods are useful for identifying agonists and antagonists or inverse agonist of GPCRs. We also provide cells for use in these methods.

Description

METHOD

FIELD

This invention relates to the field of molecular biology, in particular to a protein activity assay. Such an assay may be used in a method of identifying compounds, in particular, a method of identifying agonists and inverse agonists against a GPCR protein, in particular GPR92.

BACKGROUND

It is well established that proteins participating in signal transduction pathways that involve G-proteins and/or second messengers mediate many medically significant biological processes. These proteins are referred to as proteins participating in pathways with G-proteins or "PPG proteins". Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine G-proteins themselves, effector proteins, for example, phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, for example, protein kinase A and protein kinase C.

The membrane protein gene superfamily of G-protein coupled receptors (GPCRs) has been characterised as having seven putative transmembrane domains. The domains are believed to represent transmembrane α-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.

G-protein coupled receptors (also known as 7TM receptors) have been characterised as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include, but are not limited to, calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene- 1, rhodopsins, odorant, and cytomegalovirus receptors.

Most G-protein coupled receptors have single conserved cysteine residues in each of the first two extracellular loops which form disulphide bonds mat are believed to stabilise functional protein structure. The 7 transmembrane regions are designated as TMl, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.

G-protein coupled receptors are found in numerous sites within a mammalian host. Over the past 15 years, nearly 350 therapeutic agents targeting 7 transmembrane (7 TM) receptors have been successfully introduced onto the market.

Thus, G-protein coupled receptors have an established, proven history as therapeutic targets. Accordingly, it is desirous to find compounds and drugs which stimulate GPCR on the one hand and which can inhibit the function of GPCR on the other hand. In general, agonists and antagonists are employed for therapeutic and prophylactic purposes. Identification of agonists and antagonists relies on the development of a reliable assay for GPCR activity.

Many attempts have been made to develop assays or screens for determining ligands to these receptors, so called de-orphaning. In addition, efforts have been made to develop screens for determining compounds that mediate or control the function of the receptors, agonist or antagonists. Many of these attempts have been successful and many GPCRs de-orphanised and as detailed above, there are nearly 350 agents targeting GPCRs. However, there are many that are still to be de-orphanised and many still to which there are no compounds are known that control the function of the GPCR. We now provide a method for screening GPCRs that can be used to determine agonists and antagonists and in particular we provide a screen for GPR92, that to date has no such screen.

SUMMARY

According to a 1 ^st aspect of the present invention, we provide a method comprising detecting G-protein coupled receptor (GPCR) modulated expression of a NF-κB, API, CRE or p53 sensitive reporter.

Preferably, the method is for detecting the presence, quantity, activity or a change in any of these of a GPCR.

Preferably, the GPCR comprises GPR92.

Preferably, the method comprises detecting a lowered expression of the reporter in the presence of a G-protein coupled receptor (GPCR) than in its absence.

Preferably, expression of the reporter is reduced in the presence of the GPCR compared to in its absence by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more.

Preferably, the NF-κB, API, CRE or p53 sensitive reporter comprises an NF- KB response element, an API response element, a CRE response element or a p53 sensitive response element respectively, which is operatively linked to a sequence encoding a polypeptide preferably selected from the group consisting of: β- galactocidase (LacZ), a fluorescent protein, preferably a green fluorescent protein (GFP), or a luciferase, preferably firefly luciferase.

Preferably, expression of the reporter is detected in the presence of an activator protein or a source thereof. Preferably, (a) the reporter comprises a NF-kB sensitive reporter and the activator protein comprises MEKK; (b) the reporter comprises an AP-I sensitive reporter and the activator protein comprises MEKK; (c) the reporter comprises an CRE sensitive reporter and the activator protein comprises protein kinase A (PKA); or (d) the reporter comprises an p53 sensitive reporter and the activator protein comprises _P53.

Preferably, expression of the reporter is detected in a cell which expresses the reporter, an activator protein thereof, and the GPCR, preferably a cell which is transfected with a nucleic acid capable of expressing the reporter, a nucleic acid capable of expressing the activator protein, and a nucleic acid capable of expressing the GPCR.

Preferably, the cell is transfected with: (a) an NF-κB sensitive reporter, preferably pNF-κB-Luc (Stratagene catalogue number 219078), and an expression vector capable of expressing MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059); (b) an AP 1 sensitive reporter, preferably pAP- 1 -Luc (Stratagene catalogue number 219074) and an expression vector capable of expressing MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059); (c) a cAMP response element (CRE) sensitive reporter, preferably pCRE-Luc (Stratagene catalogue number 219076) and an expression vector capable of expressing protein kinase A (PKA), preferably pFC-PKA (Stratagene catalogue number 219071); or (d)a p53 sensitive reporter, preferably p53-Luc (Stratagene catalogue number 219085) and an expression vector capable of expressing p53, preferably pFC-p53 (Stratagene catalogue number 219084).

Preferably, expression of the reporter is detected in the presence of a candidate binding partner or modulator of the GPCR.

There is provided, according to a 2^nd aspect of the present invention, a method for determining whether a molecule is a modulator of a GPCR, the method comprising: (a) performing a method as set out in the first aspect of the invention; (b) performing a method set out in the first aspect of the invention in the presence of a candidate molecule; and (c) comparing the expression levels detected in (a) and (b).

Preferably, the method is for identifying an agonist of a GPCR, in which the method comprises detecting an decrease in expression of the reporter in the presence of the agonist than in the absence thereof.

Preferably, the method is for identifying an antagonist or inverse agonist of a GPCR, in which the method comprises detecting an increase in expression of the reporter in the presence of the antagonist or inverse agonist than in the absence thereof.

We provide, according to a 3 ^rd aspect of the present invention, a method of identifying an agonist or antagonist or inverse agonist of GPR92, comprising a method according to the second aspect of the invention.

As a 4^th aspect of the present invention, there is provided a method of identifying a molecule suitable for the treatment or alleviation of a GPR92 associated disease, the method comprising determining if a candidate molecule is an agonist or antagonist or inverse agonist of GPR92 according to the second aspect of the invention.

We provide, according to a 5^th aspect of the present invention, use of GPR92 in a method according to the second aspect of the invention for identifying a molecule suitable for the treatment or alleviation of a GPR92 associated disease.

Preferably, the GPR92 associated disease is selected from the group consisting of: pain, a motion related disorder, a disorder of motor co-ordination, a disorder of balance, a dementia related disorder, a secretion related disorder or a disorder of urogenital function including erectile dysfunction. Preferably, the GPR 92 associated disease is selected from the group consisting of: trigeminal neuralgia, orofacial pain, pain associated with toothache, irritable bowel syndrome, Barrett's oesophagus, glaucoma, pain associated with cancer, diabetic neuropathies, Herpes infections, HIV infections, migraine and skin sensitivity associated with migraine, allodynia, toothache, neuroma (whether caused by amputation, nerve transaction or trauma), nerve compression (caused by tumours, entrapment or crush), and pain due to damage of the spinal cord or brain; dementia, dyslexia, dyskinesias, tremor, Parkinson's, benign essential tremor, chorea, epilepsy and ballismus, for example occurring through stroke, trauma, degeneration or malignancy; dry-eye disorders, cystic fibrosis, hyperactive bladder, hypercholesterolaemia, dislipdaemias and obesity; erectile function or control of motor fibres in the prostate.

The present invention, in a 6^th aspect, provides a combination of an NF-κB, API, CRE or p53 sensitive reporter together with an activator protein thereof, or nucleic acids encoding such, for use in a method of detection, diagnosis or treatment of a GPCR associated disease, preferably a GPR92 associated disease.

In a 7^th aspect of the present invention, there is provided a kit for the detection, diagnosis or treatment of a GPCR associated disease, preferably a GPR92 associated disease, comprising a NF-κB, API, CRE or p53 sensitive reporter and an activator protein thereof, or nucleic acids encoding such, together with instructions for use.

Preferably, the combination or kit comprises pNF-κB-Luc (Stratagene catalogue number 219078) and pFC-MEKK (Stratagene catalogue number 219059); pAP-1-Luc (Stratagene catalogue number 219074) and pFC-MEKK (Stratagene catalogue number 219059); pCRE-Luc (Stratagene catalogue number 219076) and pFC-PKA (Stratagene catalogue number 219071 ); or p53-Luc (Stratagene catalogue number 219085) and ρFC-p53 (Stratagene catalogue number 219084). According to an 8^th aspect of the present invention, we provide a cell comprising an introduced nucleic acid sequence encoding a reporter under control of a NF-κB, API, CRE or p53 response element, together with an introduced nucleic acid sequence encoding a GPCR.

We provide, according to a 9^th aspect of the invention, a cell transfected with a nucleic acid sequence encoding aNF-κB, API, CRE or p53 sensitive reporter and a nucleic acid sequence encoding a GPCR.

Preferably, the reporter is selected from the group consisting of: NF-κB-Luc, pAP-1-Luc, CRE-Luc andp53-Luc.

There is provided, in accordance with a 10^th aspect of the present invention, a combination of such a cell together with a nucleic acid sequence encoding a an activator protein of the NF-κB, API, CRE or p53 sensitive reporter, preferably pFC- MEKK (Stratagene catalogue number 219059), pFC-PKA (Stratagene catalogue number 219071) or pFC-p53 (Stratagene catalogue number 219084).

As an 11^th aspect of the invention, we provide the use of such a cell or combination in a method of identifying a molecule capable of binding a GPCR, an agonist of a GPCR or an antagonist or inverse agonist of a GPCR.

We provide, according to a 12^th aspect of the invention, use of a ρNF-κB-Luc reporter and pFC-MEKK, or a cell comprising both, in a method of assaying GPCR activity, preferably GPR92 activity.

According to a 13^th aspect of the present invention, we provide a molecule identified by a method as described or a pharmaceutical composition comprising such a compound together with a pharmaceutically acceptable carrier or diluent. There is provided, according to a 14^th aspect of the present invention, use of such a molecule or such a pharmaceutical composition in a method of treating or preventing a GPCR associated disease.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a graph of the dose response obtained with GPR92 on pFC-MEKK stimulated NF-κB-Luc Expression in Flp-in-293 cells (solid squares F 1293 N=I; circles Fl 293 N=2).

Figure 2 is a graph of the dose response obtained with GPR92 on pFC-MEKK stimulated NF-κB-Luc Expression in Flp-in-CHL cells (solid squares FICHL N=I ; circles FICHL N=2).

Figure 3 shows a graph of the results of the reporters tested.

Figure 4 is a schematic showing the MEKK pathway.

DETAILED DESCRIPTION

Our invention relates in general to a novel method of assaying the activity of G-Protein Coupled Receptor (GPCR), including GPR92, GPCR54, GPCRl 03 , GPCR87, GPCR135 (WO 01/62797), GPCR126 (WO 01/18207), GPCR86 (WO 01/31014), P2Y5 and P2Y9, compounds that interact with or mediate the function of such GPCRs and screens for such compounds.

In preferred embodiments, the assay is particulary suitable for GPR92.

This and other embodiments of the invention will be described in further detail below. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996-, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IrI Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods ofEnzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies : A Laboratory Manual : Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies : A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855, Lars-Inge Larsson "Immunocytochemistry: Theory and Practice", CRC Press inc., Baca Raton, Florida, 1988, ISBN 0-8493-6078-1, John D. Pound (ed); "Immunochemical Protocols, vol 80", in the series: "Methods in Molecular Biology", Humana Press, Totowa, New Jersey, 1998, ISBN 0-89603-493-3, Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3; and The Merck Manual of Diagnosis and Therapy (17th Edition, Beers, M. H., and Berkow, R, Eds, ISBN: 0911910107, John Wiley & Sons). Each of these general texts is herein incorporated by reference. Each of these general texts is herein incorporated by reference. GPR92 ASSAYS

We have surprisingly found that expression mediated by NF-κB, API, CRE or p53 response elements is modulated by the presence of GPCRs, in particular GPR92. Thus, detection of modulation of NF-κB, API, CRE or p53 mediated polypeptide expression may be used to detect the presence, activity or amount of GPR92. We therefore provide for the use of NF-κB, API, CRE or p53 sensitive reporters for the detection of GPR92.

In particularly preferred embodiments, the GPR92 is exposed to the reporter in the presence of a suitable activator protein, and NF-κB, API, CRE or p53 response element mediated expression of the reporter is detected. Our methods enable the detection of agonists, antagonists, inverse agonists, etc of GPR92 through the expression, presence, quantity, or activity of GPR92, as well as the monitoring of a change in any of these parameters, for example as a result of the presence or activity of an antagonist or agonist or inverse agonist of the relevant GPR92 activity. The methods described here are also suitable for the identification of such modulator molecules.

An agonist may activate the GPR92 receptor to any degree. Similarly, an antagonist may deactivate, or inhibit the activation of, the GPR92 to any degree. The GPR92 receptor may therefore be deactivated partially to any degree to its inherent, basal or background level of activity by an antagonist (partial antagonist) or fully to such a level (antagonist or full antagonist).

The antagonist may deactivate the receptor even further, for example to zero activity (inverse agonist). The term "antagonist" as used in this document therefore specifically includes both full antagonists, partial antagonists and inverse agonists. Also included within the terms "agonist" and "antagonist" are those molecules which modulate the expression of GPR92, at the transcriptional level and / the translational level, as well as those which modulate its activity.

The assays described in this document may in particular be used for GPR92, described in detail in WO02/38607 (EP 1337558).

REPORTERS AND RESPONSE ELEMENTS

The methods and compositions described here involve the detection of protein expression, particularly transcription, from a promoter in combination with an enhancer or response element, which enhancer or response element is activated by a suitable activator protein.

The response element may suitably comprise any of the following: an NF-κB enhancer element, an API enhancer element; a CRE enhancer element or a p53 sensitive enhancer element. The NF-κB enhancer element may comprise the sequence TGGGGACTTTCCGC. The API enhancer element may comprise the sequence TGACTAA or TGA(C/G)TCA. The CRE enhancer element may comprise the sequence AGCCTGACGTCAGAG. The p53 sensitive enhancer element may comprise the sequence TGCCTGGACTTGCCTGG.

The reporter construct may comprise multiple copies of a relevant enhancer element. The reporter construct may therefore comprise a NF-κB enhancer element TGGGGACTTTCCGC x5. The reporter construct may comprise an AP 1 enhancer element TGACTAA or TGA(C/G)TCA x7. The reporter construct may comprise a CRE enhancer element AGCCTGACGTCAGAG x4. The reporter construct may comprise a ρ53 sensitive enhancer element TGCCTGGACTTGCCTGG xl4.

The response element, optionally in the form of an enhancer element, is operatively linked to a transcription unit for a reporter, in a manner which enables transcription of the reporter to be activated in the presence of a cognate activator protein. Thus, the methods and compositions described here may make use of reporter constructs which are sensitive to activation of response elements contained in them. The reporter constructs may preferably comprise expression vectors.

In preferred embodiments, the methods and compositions described here make use of an expression construct such as a reporter construct comprising NF -KB, API, CRE or p53 response element (an "NF-κB, API, CRE or p53 sensitive reporter").

For example, the reporter construct may comprise an NF-κB enhancer element, an API enhancer element, a CRE enhancer element or a p53 sensitive element operatively linked to a coding sequence for a reporter. The reporter construct is suitably in the form of a plasmid, preferably an expression plasmid.

The reporter may comprise any entity whose presence may be detected and preferably quantitated. Reporters and methods of detecting them are well known in the art. They may include any polypeptide which has an enzymatic activity which may be assayed, for example, β-galactocidase or β -lactamase, or any of the various light generating reporters such as fluorescent proteins and luciferase.

We find that transcription of the reporter in such a reporter construct is inhibited, decreased or lowered in the presence of GPR92. Preferably, the expression of the reporter is reduced by at least 50%. Preferably it is reduced to 45% or less, 40% or less, 35% or less, 30% or less, 25% or less or 20% or less in the presence of GPR92 compared to in the absence of GPR92. Where the reporter comprises a light emitting entity, such as a luciferase or a fluorescent protein, the expression of the reporter is preferably quantitated in terms of light photon counts per second (LPCS) by use of any suitable measuring equipment, such as a photometer. ACTIVATOR PROTEINS

The methods and compositions described here detect the GPCR mediated modulation of expression from a response element activated by an transcriptional activator. Thus, the methods and compositions described here further involve the use of suitable activator proteins for activating expression of the reporter.

As used in the assay, the activator protein is provided in order to activate expression from the appropriate response element. One example of an activator protein is a polypeptide that binds to the response element thereby activating it. For example, NF-kB may be used as an activator protein of a NF-κB response element (particularly of a reporter construct comprising such a response element, i..e, a NF-kB sensitive reporter), and a cyclic AMP response element binding protein (CREB) may be used as an activator protein of a cyclic AMP response element (CRE, particularly of a reporter construct comprising such a response element, i.e., a CRE sensitive reporter).

The activator protein may therefore in general comprise a transcription factor, preferably a regulatory transcription factor.

However, our methods and compositions do not necessarily require the use of these particular proteins. For example, any molecule which promotes or leads to such binding and consequent transcription may be used. The activator protein may bind to its respnse element only when it is in a particular state and anything that promotes such an activated state may be used. In particular, activator proteins may include agents which promote dimerization, phosphorylation (kinase), dephosphorylation (phosphatases), protein breakdown (e.g., proteases), or any relevant post-translational modification which results in or promotes the activated state of the activator protein.

Indeed, any protein or other molecule which is capable of activating the relevant response element should be included in the term "activator protein".In general, therefore, the term "activator protein" refers to anything that directly or indirectly leads to the activation of transcription of the relevant sensitive reporter.

The term "activator protein" should also be construed as including any source of an activator protein that binds to the response element. It should also include anything that leads to an increase in activity of, or a level of expression of, such an activator protein.

It will also be evident that any active subunit of an activator protein can be used for activation activity, and in particular catalytic subunits should also be included (for example a catalytic subunit of protein kinase A for activating a CRE, as described in Thiel et al (2005), BMC MoI Biol. 2005 Jan 19;6(1):2). The activator protein or its catalytic subunit may preferably have constitutive activity. Alternatively, or in addition, the activity may be an inducible activity, for example by exposure to an inducer molecule.

An activator protein may include a co-factor required for activation function.

A preferred activator protein for an NF-κB sensitive reporter comprises MEKK

(Swiss prot ID: Q13233).

A preferred activator protein for an API sensitive reporter comprises MEKK (Swiss prot ID: Q13233).

A preferred activator protein for an CRE sensitive reporter comprises protein kinase A (PKA) (Swiss prot IDs: subunit alpha P 17612, subunit beta P22694, subunit gamma P22612).

A preferred activator protein for an p53 sensitive reporter comprises p53 (Swiss prot ID: P04637). COMPONENTS OF PROTEIN CASCADES AS ACTIVATOR PROTEINS

The term "activator protein" should be taken to include any component of protein activation cascades which result in the activation of the relevant protein that binds to and activates a response element, and anything that activates such a cascade.

Included are components of signal transduction cascades, signalling cascades and second messenger pathways.

Thus, for example, NF-κB modulated expression of an NF-κB sensitive reporter may be activated by the use of MEKK as well as the use of a source of MEKK, or anything that activates or increases the expression of MEKK, for example. As described in further detail below, any element of the MEKK cascade may be used in combination with a NF-κB sensitive reporter. However, in preferred embodiments, MEKK itself is used as the activator protein.

The activator protein is preferably provided by expression from a suitable expression construct, which may be transfected in a cell together (simultaneously or sequentially) with a reporter construct as described.This is particularly useful where cell or organism based assays are used.

In some embodiments, an upstream component of the cascade is used. In other embodiments, the most upstream component of the cascade is employed.

It will be evident that it is not essential that a single activator protein be used, and embodiments which include the use of two or more, or a plurality of, activator proteins are possible. For example, we envisage the use of two or more activator proteins, for example members of the same or different protein activation cascade. The one or more components of an activation cascade may suitably be provided in the form of one or more expression vectors which expresses the or each cascade component.

NF-κB Response Element

Where the response element comprises an NF-κB response element, an example of an activator protein comprises NF-κB (GenBank Accession Number NM_003998 or SwissProt ID: P19838; plO5 subunit P19838, plOO subunit Q00653). As shown in Figure 4, NF-κB binding to the NF-κB response element directly activates transcription of a reporter.

However, any member of a protein activation cascade that leads to NF-κB dimerisation may be used to activate expression from the NF-κB response element, e.g., from an expression construct containing that element. Thus, for example, any member of the MEKK or MEKK 1-4 cascade may be employed. Anything that promotes nuclear translocation of NF-kB, or degradation of iKB, may also be used as an activator protein.

The MEKKl -4 family of MAPKKK have all been reported to activate MKK4 and MKK7 MAPKKs in vitro leading to activation of JNK (Davis, 2000 Cell 103, 239-252). MEKKl-/- embryonic stem cells have been shown to be deficient in JNK activation (Yujiri EtAl, 1998 Science 282, 1911-1914). MKK4 can also activate ρ38MAPK (Tournier et al, 1999 MoI. Cell. Biol. 19, 1569-1581). JNK can phosphorylate IKK, which phosphorylates IKB (Chu et al, 1999 Immunity 6, 721-31), removing its negative regulation of NF-κB activity (DiDonato et al, 1997 Nature 388, 548-554) see Figure 4.

GPR92 may act in a negative manner on any part of the signalling cascade shown to block activation of NF-κB. It is also possible that GPR92 mediates its effect through a different signalling cascade for example by a negative feedback loop. As used in this document, the term "member of the MEKK cascade" is intended to refer to any mitogen activated kinase which leads directly or indrectly to the activation of NF-kB. For example, a member of the MEKK cascade can include any of the proteins set out in Figure 4, for example, MEKKl, MEKK2, MEKK3, MEKK4, MKK4, P38MAPK, MKK7, JNK, IKK, etc.

Thus, MEKKl (SwissProt ID: Ql 3233) may be used as an activator protein. Alternatively, or in addition, MEKK2 (SwissProt ID r: Q9Y2U5) maybe used as an activator protein. Alternatively, or in addition, MEKK3 (SwissProt ID: Q99759) may be used as an activator protein. Alternatively, or in addition, MEKK4 (SwissProt ID: Q9Y6R4) may be used as an activator protein. Alternatively, or in addition, MKK4 (SwissProt ID: P45985) may be used as an activator protein. Alternatively, or in addition, P38MAPK (SwissProt ID: 062602) may be used as an activator protein. Alternatively, or in addition, MKK7 (SwissProt ID: 014733) may be used as an activator protein. Alternatively, or in addition, JNK (SwissProt ID: P45983) may be used as an activator protein. Alternatively, or in addition, IKK (SwissProt ID: O15111) may be used as an activator protein.

Cyclic AMP Response Element (CRE)

Where a reporter comprising a cyclic AMP Response Element (CRE) is employed, the activator protein may comprise anything that activates transcription from that reporter.

In particular, the activator protein may comprise a cyclic AMP response element binding protein (CREB). The activator protein may comprise a catalytic subunit of CREB (Harootunian et al (1993) MoI Biol Cell 1993, 4:993-1002; Grewal et al (2000) J Biol Chem 2000, 275:34433-34441; Streeper et al (2000) J Biol Chem 2000, 275:12108-12118; Streeper et al (2001) J Biol Chem 2001, 276:19111-19118.).

CREB protein has a GenBank Accession number NM_134442 or NM_004379, SwissProt ID: P16220. In addition, the activator protein may comprise any protein whose presence or activity leads to activation of CREB. CREB is inactive in the dephosphorylated state and turns into an activator upon phosphorylation. The activator protein may comprise anything that leads to the phosphorylation of CREB.

The key enzyme leading to CREB activation is the cAMP-dependent protein kinase (PKA), but CREB serves also as a substrate for calcium/calmodulin-dependent protein kinase IV (Sun et al (1994) Genes Dev 8:2527-2539) and the mitogen-and stress-activated kinases MSKl and 2 (Wiggin et al (2002) MoI Cell Biol 22:2871- 2881).

Accordingly, any one or more of calcium/calmodulin-dependent protein kinase rv, MSKl and MSK2 may be employed in the assays as an activator protein.

AP-I Response Element

The AP-I response element is also known as the TPA (tetradecanoyl-phorbol- 13-acetate) response element (TRE)

The transcription factors known to bind AP-I sites include jun family (c-Jun,

JunB, and JunD) and fos family members. The jun family members can either form homodimers or heterodimers among themselves or dimerize with the fos family members. These homodimeric jun or heterodimeric jun-fos complexes can then bind to AP-I sites, resulting in enhanced transcription. Accordingly, an activator protein suitable for the activation of transcription of an AP-I sensitive reporter may comprise any of the jun family including c-Jun, JunB, and JunD or any of the fos family members, or heterodimers or homodimers of any of these.

AP-I transcriptional activity is also known to be regulated by the protein levels and post-translational modification of jun and fos family member proteins. Accordingly, anything that modulates either may be used as an activator protein.

Furthermore, the JNK, Erk and p38 MAP kinase pathways have all been implicated in the regulation of either the protein levels of AP-I transcription factors or phosphorylation of them, and members of any of these cascades maybe employed as an activator protein.

SPECIFIC ACTIVATOR / RESPONSE ELEMENT COMBINATIONS

In particularly preferred embodiments involving an NF-κB sensitive reporter,

MEKK itself is employed - thus, we provide for a particularly preferred method of detecting GPR92 through use of an NF-κB sensitive reporter and pFC-MEKK (Stratagene catalogue number 219059).

In a further preferred embodiment, the method includes use of an API sensitive reporter, in combination with any member of a MEKK cascade. Preferably, the method employs an API sensitive reporter in combination with MEKK. Preferably, MEKK is provided by pFC-MEKK (Stratagene catalogue number 219059). The API sensitive reporter is preferably pAP-1-Luc (Stratagene catalogue number 219074).

In another preferred embodiment, the method includes use of a cAMP response element (CRE) sensitive reporter, in combination with any member of a protein kinase A (PKA) cascade, preferably protein A. Preferably, protein A is provided by pFC-PKA (Stratagene catalogue number 219071). Preferably, the reporter is pCRE-Luc (Stratagene catalogue number 219076).

In a further embodiment, the method includes use of a p53 sensitive reporter, in combination with any member of a p53 activation cascade, preferably p53 itself.

Preferably, p53 is provided by pFC-p53 (Stratagene catalogue number 219084). The p53 sensitive reporter is preferably p53-Luc (Stratagene catalogue number 219085). EXAMPLEREPORTERVECTORS

Reporter constructs suitable for use in the methods and compositions described here are available commercially. One example is the TransLucent Reporter Vector available from Panomics, Inc (Redwood City, California, USA).

TransLucent Reporter Vectors

Each TransLucent Reporter Vector contains a cώ-acting DNA binding element that is recognized by a specific transcription factor. Binding at this site results in the expression of firefly luciferase, an enzyme capable of catalyzing a powerful bioluminescent reaction. Light emitted from the chemical reaction is directly proportional to the amount of expressed enzyme and thus the binding activity of the targeted transcription factor.

The TransLucent Reporter Vectors have been specially constructed to report the binding activity of a single transcription factor (see below). Multiple copies of the cis-acting enhancer element have been inserted into each vector upstream of a minimal TA promoter and the TATA box from the Herpes simplex virus thymidine kinase promoter. This promoter sequence drives expression of the luciferase gene (luc). The backbone of the vector contains an ampicillin resistance gene for cloning purposes, an origin of replication, and an fl origin for single-stranded DNA production.

Examples of suitable TransLucent Reporter Vectors together with the relevant response elements follow. The response element in pNFκB-Luc (Panomics Catalogue Number LR0051) is a NFKB response element. pNFκB-Luc is designed for monitoring the activation of the nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFKB) signal transduction pathway. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. The response element in pAPl(2)-Luc (Panomics Catalogue Number LR0003) is the API response element. pAPl(2)-Luc is designed for monitoring the induction of the protein kinase C (PKC) signal transduction pathway, as well as related pathways such as the MAPK pathway.

The response element in pCRE-Luc (Panomics Catalogue Numbers LR0093 and LROOl 5) is the cyclic AMP response element CRE. pCRE-Luc is designed to measure transcriptional activity of cAMP binding protein (CREB). Several signal transduction pathways are associated with the cAMP response element (CRE), including Jun N-terminal kinase (JNK), p38, and protein kinase A (PKA). Induction of these pathways enables endogenous transcription factors, such as CREB or ATF, to bind CRE.

The response element in pp53-Luc (Panomics Catalogue Number LR0057) is the p53 response element. pp53-Luc is designed for monitoring p53-mediated signal transduction pathways. p53 is a tumor suppressor that plays a crucial role in a number of cellular processes, including the suppression of cell proliferation after DNA damage.

Stratagene Reporter Vectors

Luciferase based reporters comprising various response elements may also be used in the assays described in conjunction with appropriate activator proteins. For example, pNF-κB-Luc (Stratagene catalogue number 219078) comprises an NF-κB response element. pAP-1-Luc (Stratagene catalogue number 219074) comprises an AP-I response element. pCRE-Luc (Stratagene catalogue number 219076) comprises a cyclic AMP response element. p53-Luc (Stratagene catalogue number 219085) comprises a p53 response element. LUCIFERASE ASSAY

In a preferred embodiment, the reporter comprises luciferase and the presence and quantity of reporter expression is determined or quantitated using a luciferase assay.

As a means of measuring promoter response in cells, the luciferase assay is simple, straightforward, and very effective. The reporter vector comprising the response element is first transfected into cells together with a source of activator protein, such as an expression vector capable of expressing the activator protein. After a limited amount of time, the cells are lysed and the substrate of luciferase, luciferin, is introduced into the cellular extract along with Mg and excess ATP. Under these conditions, luciferase enzyme expressed by the reporter vector will catalyze the oxidative carboxylation of luciferin. The luminescence from this chemical reaction can be read and quantified by a luminometer or scintillation counter. The amount of light detected from the cell lysate correlates directly with expression activated from the response element.

The luciferase assay can therefore be used to assess modulation of such expression activity by GPCR simply and effectively.

ACTIVATORS OF IKK

The IKKs are part of a kinase complex involved in the phosphorylation of IKKS and are known to be activated in response to a number of different stimuli. A number of factors are believed to be able to mediate this activation (see Hayden & Gosh 2004 for a review). The complex is also implicated in binding with a number of different scaffold proteins along with the β-arrestms and as such it may not be a universal mechanism for regulating NF-κB activity. ACTION OF NF-κB

NF-KB is a ubiquitously expressed transcription factor that up-regulates gene expression by binding to NF-κB response elements. There are five members of the NF-κB family expressed in mammalian cells; p50 (NF-κBl), p52 (NF-κB2), p65 (ReIA), c-Rel & ReIB, which form hetero and homodimers within the cell. Inhibitory proteins (IKBS) bind to the NF-κB dimers retaining them in the cytosol in an inactive form. There are five known IKKS in mammalian cells; IκKα and IκKβ being the best understood. Stimuli leading to NF-κB dimer activation converge on a kinase complex composed of NF-κB inducing kinase (NIK) and IKB kinase (KKa, IKKβ & IKKγ). This results in the phosphorylation of IKBS leading to dissociation from the NF-κB dimer. In the case of IKB α, phosphorylation targets it for degradation by the ubiquitination pathway. The nuclear targeting signal of NF-κB is unmasked, allowing it to translocate to the nucleus and bind to NF-κB response elements and promoting transcription.

Recently β-arrestin 1 and 2 have been shown to bind to IκKα and also to NIK,

IKKα and IKKβ. I (Witherow et al 2004). Over expression of β-arrestin 1 or 2 in HeLa or Jurkat cells was able to attenuate TNFα stimulated NF-κB activity and also carbachol stimulated NF-κB activity when these cells were also transfected with Ml muscarinic receptor. Interestingly the suppression of endogenous levels of β-arrestin 1 only; led to an increase in NF-κB activity in response to TNFα. This suggests that endogenous levels of β-arrestin 1 are possibly responsible for inhibition of NF-κB activity in response to certain stimuli. This would be mediated by the sequestering of the inactive form of NF-κB in the cytoplasm. It could be postulated that the observed inhibition of MEKK driven NF-κB activity by over-expression of GPR92 utilises β- arrestin 1 to prevent NF-κB translocation to the nucleus and thus stop up-regulation of transcription of the reporter. SCREENS FOR MODULATORS OF GPCRS

The GPCR assay described here is particularly suitable for identifying modulators of GPCRs, for example, agonists or antagonists of GPR92.

Such assays typically involve detecting modulation of expression of a NF-κB, API , CRE or p53 sensitive reporter in the presence of GPCR, for example GPR92, in conjunction with a candidate molecule. The GPCR is exposed to the candidate molecule before or during the detection of expression. Expression of the reporter is detected in the absence of such exposure as a control. The presence of the GPCR depresses expression of the reporter, and where the candidate molecule is an antagonist, the expression of the reporter is increased compared to the control (i.e., expression is restored at least partially). If expression of the reporter is decreased, the molecule can be considered a candidate agonist of the GPCR. It will be appreciated that screens described in this document for antagonists may equally be used for identifying inverse agonists of the GPCR.

The candidate molecule may preferably be provided in the form of a library, as described in detail below.

The term "compound" refers to a chemical compound (naturally occurring or synthesised), such as a biological macromolecule (e.g., nucleic acid, protein, non- peptide, or organic molecule), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues, or even an inorganic element or molecule. Such compounds, agonists and antagonists of GPR92, as well as their uses, are described in detail in for example WO02/38607 (EP1337558).

In particular, antagonists and agonists of GPCR may be used to treat any GPCR associated disease, preferably a GPR92 associated disease, either on their own, or in the form of pharmaceutical compositions (see below). CELL BASED ASSAYS

The assays described here may be configured in several ways. For example, a cell-based assay may involve the use of a cell into which is introduced a reporter construct, for example in the form of a plasmid, GPR92 and a suitable activation protein.

The GPR92 and the activation protein are suitably introduced in the form of expression vectors which are capable of expressing the GPR92 and the activation protein (a single expression vector may also be used). The components may be introduced into the cell by any means known in the art, for example, by plasmid or expression vector transfection (e.g., electroporation, calcium phosphate mediated transfection, etc). The transfection may be transient or stable. The cell may also be genetically engineered to include any one or more of these components in its genome, through means known in the art.

In embodiments in which the method is used for screening for modulators of GPR92, the cell may be exposed to a candidate molecule for example in the form of a library. Expression levels of the reporter in such cells is compared to expression levels in control cells not expressed to the candidate molecule, and those cells in which the reporter levels are significantly different are chosen for further study.

In vitro or cell free assays are also possible. Such assays may employ a reporter, an activator protein (or a nucleic acid sequence capable of expressing this) and a GPR92 (or a nucleic acid sequence capable of expressing this). A suitable cell free assay may be configured by use of an extract from any of the cells described above. CELL LINES

We provide for the use of cell lines comprising stably integrated elements of the assay, for use in such assays for GPR92 and modulators of GPR92.

Thus, a cell line may comprise a reporter whose expression is mediated by any of NF-κB, AP 1 , CRE or p53. The cell line may comprise a response element operatively linked to a reporter sequence, as described above, which is integrated into its genome. Methods for constructing such cell lines are well known in the art. The cell line may further comprise a nucleic acid sequence capable of expressing GPR92, in a constitutive or inducible manner. A source of the relevant activator protein, for example, the activator protein or an expression vector capable of expressing the activator protein, is introduced to the cell, and expression of the reporter detected. As an alternative, the sequence encoding the activation protein may be linked to an inducible promoter, to enable the integration of the activation protein encoding sequence into the genome of the cell.

Other ways of configuring the assay using stably integrated cell lines will be evident to the skilled reader.

SCREENING OF LIBRARIES

Instead of testing each candidate compound individually in the methods described here, a library or bank of candidate ligands may advantageously be produced and screened.

Thus, for example, a bank of over 200 putative receptor ligands has been assembled for screening. The bank comprises: transmitters, hormones and chemokines known to act via a human seven transmembrane (7TM) receptor; naturally occurring compounds which may be putative agonists for a human 7TM receptor, non- mammalian, biologically active peptides for which a mammalian counterpart has not yet been identified; and compounds not found in nature, but which activate 7TM receptors with unknown natural ligands. This bank is used to screen the receptor for known ligands, using both functional (i.e. calcium, cAMP, microphysiometer, oocyte electrophysiology, etc, see elsewhere) as well as binding assays as described in further detail elsewhere. However, a large number of mammalian receptors exist for which there remains, as yet, no cognate activating ligand (agonist) or deactivating ligand (antagonist). Thus, active ligands for these receptors may not be included within the ligands banks as identified to date.

Where the candidate compounds are proteins, in particular antibodies or peptides, libraries of candidate compounds may be screened using phage display techniques. Phage display is a protocol of molecular screening which utilises recombinant bacteriophage. The technology involves transforming bacteriophage with a gene that encodes one compound from the library of candidate compounds, such that each phage or phagemid expresses a particular candidate compound. The transformed bacteriophage (which preferably is tethered to a solid support) expresses the appropriate candidate compound and displays it on their phage coat. Specific candidate compounds which are capable of binding to a polypeptide or peptide are enriched by selection strategies based on affinity interaction. The successful candidate agents are then characterised. Phage display has advantages over standard affinity ligand screening technologies. The phage surface displays the candidate agent in a three dimensional configuration, more closely resembling its naturally occurring conformation. This allows for more specific and higher affinity binding for screening purposes.

Another method of screening a library of compounds utilises eukaryotic or prokaryotic host cells which are stably transformed with recombinant DNA molecules expressing a library of compounds. Such cells, either in viable or fixed form, can be used for standard binding-partner assays. Thus, in the particular assay described here, cells which comprise an NF-κB, API , CRE or p53 sensitive reporter, and which express GPR92, may be transformed or transfected with such a library, and expression of the reporter detected.

See also Parce et al. (1989) Science 246:243-247; and Owicki et al. (1990) Proc. Nat'l Acad. Sci. USA 87;4007-4011 , which describe sensitive methods to detect cellular responses.

Examples of potential GPR92 antagonists include antibodies or, in some cases, nucleotides and their analogues, including purines and purine analogues, oligonucleotides or proteins which are closely related to the ligand of the GPR92, e.g., a fragment of the ligand, or small molecules which bind to the receptor but do not elicit a response, so that the activity of the receptor is prevented.

The materials necessary for such screening to be conducted may be packaged into a screening kit. Such a screening kit is useful for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for GPR92 polypeptides or compounds which decrease or enhance the production of GPR92 polypeptides. The screening kit comprises a cell transfected with a nucleic acid sequence encoding a NF-κB, API, CRE or p53 sensitive reporter and a nucleic acid sequence encoding a GPR92, or a cell comprising an introduced nucleic acid sequence encoding a reporter under control of a NF-κB, API, CRE or p53 response element, together with an introduced nucleic acid sequence encoding a GPR92, at least one of which is comprised in the genome of the cell, optionally together with means for detecting reporter expression, and/or a library. The screening kit may optionally comprise instructions for use.

GPR92

The term "GPR92" is used in this document is intended to refer to the G- protein coupled receptor described in WO02/38607 (EP1337558) and as described in further detail below. GPR92 POLYPEPTIDES

As used here, the term "GPR92" or "GPR92 polypeptide" is intended to refer to a polypeptide comprising the amino acid sequence shown in SEQ ID No. 3 or SEQ ID NO: 5, or a homologue, variant or derivative thereof. Preferably, the polypeptide comprises or is a homologue, variant or derivative of the sequence shown in SEQ ID NO: 3.

"Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids.

"Polypeptides" include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications.

Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-inking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-inks, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Proteins - Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al.,

"Analysis for protein modifications and nonprotein cofactors", Meth Enzymol (1990) 182:626-646 and Rattan et aL, "Protein Synthesis: Posttranslational Modifications and Aging", Ann NY Acad Sd (1992) 663:48-62.

The terms "variant", "homologue", "derivative" or "fragment" in relation to the present document include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acid from or to a sequence. Unless the context admits otherwise, references to "GPR92" and "GPR92 GPCR" or "GPR92 polypeptide" include references to such variants, homologues, derivatives and fragments of GPR92.

Preferably, as applied to GPR92, the resultant amino acid sequence has GPCR activity, more preferably having at least the same activity of the GPR92 GPCR shown as SEQ ID NO: 3 or SEQ ID NO: 5. In particular, the term "homologue" covers identity with respect to structure and/or function providing the resultant amino acid sequence has GPCR activity. With respect to sequence identity (i.e. similarity), preferably there is at least 70%, more preferably at least 75%, more preferably at least 85%, even more preferably at least 90% sequence identity. More preferably there is at least 95%, more preferably at least 98%, sequence identity. These terms also encompass polypeptides derived from amino acids which are allelic variations of the GPR92 GPCR nucleic acid sequence. Where reference is made to the "receptor activity" or "biological activity" of a receptor such as GPR92 GPCR, these terms are intended to refer to the metabolic or physiological function of the GPR92 receptor, including similar activities or improved activities or these activities with decreased undesirable side effects. Also included are antigenic and immunogenic activities of the GPR92 receptor. Examples of GPCR activity, and methods of assaying and quantifying these activities, are known in the art, and are described in detail elsewhere in this document.

As used herein a "deletion" is defined as a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent. As used herein an "insertion" or "addition" is that change in a nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues, respectively, as compared to the naturally occurring substance. As used herein "substitution" results from the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively.

GPR92 polypeptides may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent amino acid sequence. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

Conservative substitutions may be made, for example according to the table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

ALIPHATIC Non-polar G A P

I L V

GPR92 polypeptides may further comprise heterologous amino acid sequences, typically at the N-terminus or C-terminus, preferably the N-terminus. Heterologous sequences may include sequences that affect intra or extracellular protein targeting (such as leader sequences). Heterologous sequences may also include sequences that increase the immunogenicity of the GPR92 polypeptide and/or which facilitate identification, extraction and/or purification of the polypeptides. Another heterologous sequence that is particularly preferred is a polyamino acid sequence such as polyhistidine which is preferably N-terminal. A polyhistidine sequence of at least 10 amino acids, preferably at least 17 amino acids but fewer than 50 amino acids is especially preferred.

The GPR92 GPCR polypeptides may be in the form of the "mature" protein or may be a part of a larger protein such as a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or an additional sequence for stability during recombinant production.

GPR92 polypeptides are advantageously made by recombinant means, using known techniques. However they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis. Polypeptides may also be produced as fusion proteins, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and β- galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences, such as a thrombin cleavage site. Preferably the fusion protein will not hinder the function of the protein of interest sequence.

GPR92 polypeptides may be in a substantially isolated form. This term is intended to refer to alteration by the hand of man from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide, nucleic acid or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide, nucleic acid or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.

It will however be understood that the GPR92 protein may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated. A polypeptide may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 90%, for example, 95%, 98% or 99% of the protein in the preparation is a GPR92 GPCR polypeptide.

The methods and compositions described here may also make use of peptides comprising a portion of a GPR92 polypeptide. Thus, fragments of GPR92 GPCR and its homologues, variants or derivatives are included. The peptides may be between 2 and 200 amino acids, preferably between 4 and 40 amino acids in length. The peptide may be derived from a GPR92 GPCR polypeptide as disclosed here, for example by digestion with a suitable enzyme, such as trypsin. Alternatively the peptide, fragment, etc may be made by recombinant means, or synthesised synthetically,

The term "peptide" includes the various synthetic peptide variations known in the art, such as a retroinverso D peptides. The peptide may be an antigenic determinant and/or a T-cell epitope. The peptide may be immunogenic in vivo. Preferably the peptide is capable of inducing neutralising antibodies in vivo. By aligning GPR92 GPCR sequences from different species, it is possible to determine which regions of the amino acid sequence are conserved between different species ("homologous regions"), and which regions vary between the different species ("heterologous regions").

The GPR92 polypeptides may therefore comprise a sequence which corresponds to at least part of a homologous region. A homologous region shows a high degree of homology between at least two species. For example, the homologous region may show at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95% identity at the amino acid level using the tests described above. Peptides which comprise a sequence which corresponds to a homologous region may be used in therapeutic strategies as explained in further detail below. Alternatively, the GPR92 GPCR peptide may comprise a sequence which corresponds to at least part of a heterologous region. A heterologous region shows a low degree of homology between at least two species.

GPR92 POLYNUCLEOTIDES AND NUCLEIC ACIDS

The methods and compositions described here may make use of GPR92 polynucleotides, GPR92 nucleotides and GPR92 nucleic acids, methods of production, uses of these, etc, as described in further detail elsewhere in this document.

The terms "GPR92 polynucleotide", "GPR92 nucleotide" and "GPR92 nucleic acid" may be used interchangeably, and are intended to refer to a polynucleotide/nucleic acid comprising a nucleic acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 10, or a homologue, variant or derivative thereof. Preferably, the polynucleotide/nucleic acid comprises or is a homologue, variant or derivative of the nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, most preferably, SEQ ID NO: 2. The terms "GPR92 polynucleotide",

"GPR92 nucleotide" and "GPR92 nucleic acid" should be understood to specifically include both cDNA and genomic GPR92 sequences, for example, the mouse GPR92 genomic sequence shown below (SEQ ID NO: 10).

These terms are also intended to include a nucleic acid sequence capable of encoding a GPR92 polypeptide and/or a peptide. Thus, GPR92 GPCR polynucleotides and nucleic acids comprise a nucleotide sequence capable of encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5, or a homologue, variant or derivative thereof. Preferably, the GPR92 GPCR polynucleotides and nucleic acids comprise a nucleotide sequence capable of encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3, or a homologue, variant or derivative thereof.

"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA₅ DNA that is a mixture of single- and double-stranded regions, single- and double- stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.

It will be understood by the skilled person that numerous nucleotide sequences can encode the same polypeptide as a result of the degeneracy of the genetic code. As used herein, the term "nucleotide sequence" refers to nucleotide sequences, oligonucleotide sequences, polynucleotide sequences and variants, homologues, fragments and derivatives thereof (such as portions thereof). The nucleotide sequence may be DNA or RNA of genomic or synthetic or recombinant origin which may be double-stranded or single-stranded whether representing the sense or antisense strand or combinations thereof. The term nucleotide sequence may be prepared by use of recombinant DNA techniques (for example, recombinant DNA).

Preferably, the term "nucleotide sequence" means DNA.

The terms "variant", "homologue", "derivative" or "fragment" in relation to the present document include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acids from or to the sequence of a GPR92 nucleotide sequence. Unless the context admits otherwise, references to "GPR92" and "GPR92 GPCR" include references to such variants, homologues, derivatives and fragments of GPR92.

Preferably, the resultant nucleotide sequence encodes a polypeptide having

GPCR activity, preferably having at least the same activity of the GPCR shown as SEQ ID NO: 3 or SEQ ID NO: 5. Preferably, the term "homologue" is intended to cover identity with respect to structure and/or function such that the resultant nucleotide sequence encodes a polypeptide which has GPCR activity. With respect to sequence identity (i.e. similarity), preferably there is at least 70%, more preferably at least 75%, more preferably at least 85%, more preferably at least 90% sequence identity. More preferably there is at least 95%, more preferably at least 98%, sequence identity. These terms also encompass allelic variations of the sequences.

GPR92 ASSOCIATED DISEASES

As described in WO02/38607 (EP1337558), the phenotypes of mice lacking

GPR92 indicate a role for GPR92 in the perception of pain, the maintenance of motor co-ordination and balance and in regulating secretion and urogenital function. WO02/38607 (EP1337558) describes the use of modulators (agonists and antagonists) of GPR92 for treating disorders in such functions, as well as screens to identify such modulators by determining whether a candidate molecule is an agonist or antagonist of GPR92.

We therefore specifically disclose the use of the assay methods described herein for identifying whether a molecule is an agonist or antagonist of a GPR92 polypeptide preferably comprising an amino acid sequence shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9 or a sequence having at least 90% sequence identity thereto. Specifically, we disclose the use of the assays described in this document in such screens for GPR92 modulators. The method generally comprises determining if a candidate molecule has any effect on the GPR92 modulated expression of a NF-κB, AP 1 , CRE or p53 sensitive reporter as described elsewhere in this document.

Modulators of GPR92, including agonists, antagonists and inverse agonists thereof, maybe used to treat any of the GPR92 associated diseases.

GPR92 associated diseases include pain, motion related disorders, disorders of motor co-ordination, disorders of balance, dementia related disorders, secretion related disorders and disorders of urogenital function including erectile dysfunction.

GPR92 associated diseases include pain, which may comprise any of trigeminal neuralgia, orofacial pain, pain associated with toothache, irritable bowel syndrome, Barrett's oesophagus, glaucoma, pain associated with cancer, diabetic neuropathies, Herpes infections, HIV infections, migraine and skin sensitivity associated with migraine, allodynia, toothache, neuroma (whether caused by amputation, nerve transaction or trauma), nerve compression (caused by tumours, entrapment or crush), and pain due to damage of the spinal cord or brain. GPR92 associated diseases include motion related disorders, which may comprise any of a disorder of motor co-ordination, a disorder of balance, a dementia related disorder.

GPR92 associated diseases include dementia, dyslexia, dyskinesias, tremor, Parkinson's, benign essential tremor, chorea, epilepsy and ballismus, for example occurring through stroke, trauma, degeneration or malignancy.

GPR92 associated diseases include secretion related disorders, which may comprise any of dry-eye disorders, cystic fibrosis, hyperactive bladder, hypercholesterolaemia, dislipdaemias and obesity

GPR92 associated diseases include disorders of urogenital function, which may comprise erectile dysfunction or control of motor fibres in the prostate.

Thus, GPR92 related diseases include any of the following: trigeminal neuralgia, orofacial pain, pain associated with toothache, irritable bowel syndrome, Barrett's oesophagus, glaucoma, pain associated with cancer, diabetic neuropathies, Herpes infections, HFV infections, migraine and skin sensitivity associated with migraine, allodynia, toothache, neuroma (whether caused by amputation, nerve transaction or trauma), nerve compression (caused by rumours, entrapment or crush), and pain due to damage of the spinal cord or brain; dementia, dyslexia, dyskinesias, tremor, Parkinson's, benign essential tremor, chorea, epilepsy and ballismus, for example occurring through stroke, trauma, degeneration or malignancy; dry-eye disorders, cystic fibrosis, hyperactive bladder, hypercholesterolaemia, dislipdaemias and obesity; erectile function or control of motor fibres in the prostate.

Agents which bind to, agonise or antagonise GPR92, identifiable by a method as disclosed in this document, may be used to treat or diagnose a disease in which there is a disorder in any of these. Assays for detecting GPR92 activity, including modulation thereof, may be used to detect or diagnose any of these diseases.

FORMULATION AND ADMINISTRATION

Agonists and antagonist small molecules may be formulated in combination with a suitable pharmaceutical carrier. Such formulations comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. Formulation should suit the mode of administration, and is well within the skill of the art. We further describe pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions.

Compounds identified as modulators, agonists and antagonists of GPCRs by the methods and compositions described here may be employed alone or in conjunction with other compounds, such as therapeutic compounds.

Preferred forms of systemic administration of the pharmaceutical compositions include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergents. In addition, if properly formulated in enteric or encapsulated formulations, oral administration may also be possible. Administration of these compounds may also be topical and/or localize, in the form of salves, pastes, gels and the like.

The dosage range required depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100 μg/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.

PHARMACEUTICAL COMPOSITIONS

We further provide a pharmaceutical composition comprising administering a therapeutically effective amount of a compound identified as modulator, agonist or antagonist of a GPCR by the methods and compositions described here and optionally a pharmaceutically acceptable carrier, diluent or excipients (including combinations thereof).

The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).

Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used. There may be different composition/formulation requirements dependent on the different delivery systems. By way of example, the pharmaceutical composition comprising the compound may be formulated to be delivered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route. Alternatively, the formulation may be designed to be delivered by both routes.

Where the agent is to be delivered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.

Where appropriate, the pharmaceutical compositions can be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.

ADMINISTRATION

Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular patient. The dosages below are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited.

The pharmaceutical compositions may be administered by direct injection. The composition may be formulated for parenteral, mucosal, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration. Typically, each protein may be administered at a dose of from 0.01 to 30 mg/kg body weight, preferably from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.

The pharmaceutical compositions may be administered by a number of different routes such as injection (which includes parenteral, subcutaneous and intramuscular injection) intranasal, mucosal, oral, intra- vaginal, urethral or ocular administration.

The pharmaceutical compositions may be conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, maybe 1% to 2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the vaccine composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. as a suspension. Reconstitution is preferably effected in buffer. FURTHER ASPECTS

Further aspects and embodiments of the invention are now set out in the following numbered Paragraphs; it is to be understood that the invention encompasses these aspects:

Paragraph 1. A method comprising detecting GPCR modulated expression of an NF-κB, API, CRE or p53 sensitive reporter.

Paragraph 2. A method according to Paragraph 1 for detecting the presence, quantity, activity or a change in any of these of a GPCR.

Paragraph 3. A method according to Paragraph 1 or 2, in which a expression of the reporter is reduced in the presence of the GPCR compared to in its presence, preferably by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more.

Paragraph 4. A method according to Paragraph 1, 2 or 3, in which expression of the reporter is driven by an activator protein or a source thereof.

Paragraph 5. A method according to any preceding Paragraph, in which the

GPCR is selected from the group consisting of: GPR92, GPCR54, GPCRl 03, GPCR87, GPCR135 (WO 01/62797), GPCR126 (WO 01/18207) and GPCR86 (WO 01/31014), preferably GPR92.

Paragraph 6. A method according to any preceding Paragraph, in which the reporter is selected from the group consisting of: β-galactocidase (LacZ), a fluorescent protein, preferably a green fluorescent protein (GFP), or a luciferase, preferably firefly luciferase. Paragraph 7. A method according to any preceding Paragraph, in which expression of the reporter is detected in a cell which expresses the reporter, an activator protein thereof, and the GPCR.

Paragraph 8. A method according to Paragraph 7, in which the cell is transfected with a nucleic acid capable of expressing the reporter, a nucleic acid capable of expressing the activator protein, and a nucleic acid capable of expressing the GPCR.

Paragraph 9. A method according to Paragraph 7, in which the cell comprises a nucleic acid capable of expressing the reporter, a nucleic acid capable of expressing the activator protein, and a nucleic acid capable of expressing the GPCR under control of a NF-κB, AP 1 , CRE or p53 response element, at least one of which is comprised in the genome of the cell.

Paragraph 10. A method according to any preceding Paragraph, in which the reporter comprises an NF-κB sensitive reporter, preferably pNF-κB-Luc (Stratagene catalogue number 219078) and the activator protein comprises MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059).

Paragraph 11. A method according to any preceding Paragraph, in which the reporter comprises an API sensitive reporter, preferably pAP-1-Luc (Stratagene catalogue number 219074) and the activator protein comprises MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059).

Paragraph 12. A method according to any preceding Paragraph, in which the reporter comprises an cAMP response element (CRE) sensitive reporter, preferably pCRE-Luc (Stratagene catalogue number 219076) and the activator protein comprises protein kinase A (PKA), preferably pFC-PKA (Stratagene catalogue number 219071). Paragraph 13. A method according to any preceding Paragraph, in which the reporter comprises an p53 sensitive reporter, preferably p53-Luc (Stratagene catalogue number 219085) and the activator protein comprises p53, preferably pFC-p53 (Stratagene catalogue number 219084).

Paragraph 14. A method for identifying a molecule capable of binding a

GPCR, the method comprising exposing a GPCR to a candidate molecule, and detecting expression of a reporter in a method according to any of Paragraphs 1 to 13.

Paragraph 15. A method for identifying an agonist or antagonist of a GPCR, the method comprising exposing a GPCR to a candidate molecule, and detecting modulation of expression of a reporter according to any of Paragraphs 1 to 13 in the presence and/or absence of the candidate molecule.

Paragraph 16. A method according to Paragraph 15 for identifying an agonist of a GPCR, in which the method comprises detecting an decrease in expression of the reporter in the presence of the agonist than in the absence thereof.

Paragraph 17. A method according to Paragraph 15 for identifying an antagonist of a GPCR, in which the method comprises detecting an increase in expression of the reporter in the presence of the antagonist than in the absence thereof.

Paragraph 18. A molecule identified by a method according to any of Paragraphs 15, 16 or 17, or a pharmaceutical composition comprising such a compound together with a pharmaceutically acceptable carrier or diluent.

Paragraph 19. Use of a molecule or a pharmaceutical composition according to Paragraph 18 in a method of treating or preventing a GPCR associated disease. Paragraph 20. A combination of an NF-κB, API, CRE or p53 sensitive reporter together with an activator protein thereof, or nucleic acids encoding such, for use in a method of detection, diagnosis or treatment of a GPCR associated disease.

Paragraph 21. A kit for the detection, diagnosis or treatment of a GPCR associated disease, comprising aNF-κB, API, CRE or p53 sensitive reporter and an activator protein thereof, or nucleic acids encoding such, together with instructions for use.

Paragraph 22. A use according to Paragraph 19, a combination according to Paragraph 20 or a kit according to Paragraph 21, in which the GPCR associated disease is selected from the group consisting of: bacterial, fungal, protozoan and viral infections, particularly infections caused by HIV-I or HIV-2; pain; cancers; diabetes, obesity; anorexia; bulimia; asthma; parkinson's disease; thrombosis; acute heart failure; hypotension; hypertension; erectile dysfunction; urinary retention; metabolic bone diseases such as osteoporisis and osteo petrosis; angina pectoris; myocardial infarction; ulcers; asthma; allergies; rheumatoid arthritis; inflammatory bowel disease; irritable bowel syndrome benign prostatic hypertrophy; and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease or Gilles dela Tourett's syndrome.

Paragraph 23. A combination according to Paragraph 20 or a kit according to

Paragraph 21, which comprises pNF-κB-Luc (Stratagene catalogue number 219078) and pFC-MEKK (Stratagene catalogue number 219059); pAP-1-Luc (Stratagene catalogue number 219074) and pFC-MEKK (Stratagene catalogue number 219059); pCRE-Luc (Stratagene catalogue number 219076) and pFC-PKA (Stratagene catalogue number 219071); or p53-Luc (Stratagene catalogue number 219085) and pFC-p53 (Stratagene catalogue number 219084). Paragraph 24. A cell transfected with a nucleic acid sequence encoding a NF- KB, API, CRE or p53 sensitive reporter and a nucleic acid sequence encoding a GPCR.

Paragraph 25. A cell comprising an introduced nucleic acid sequence encoding a reporter under control of a NF-κB, AP 1 , CRE or p53 response element, together with an introduced nucleic acid sequence encoding a GPCR, at least one of which is comprised in the genome of the cell.

Paragraph 26. A cell according to Paragraph 24 or 25, in which the reporter is selected from the group consisting of: NF-κB-Luc, pAP-1-Luc, CRE-Luc and p53- Luc.

Paragraph 27. A combination of a cell according to Paragraph 24, 25 or 26, together with a nucleic acid sequence encoding a an activator protein of the NF-κB, API, CRE or p53 sensitive reporter, preferably pFC-MEKK (Stratagene catalogue number 219059), pFC-PKA (Stratagene catalogue number 219071) or ρFC-ρ53 (Stratagene catalogue number 219084).

Paragraph 28. A transgenic non-human animal comprising a cell according to Paragraph 25 or 26.

Paragraph 29. Use of a cell according to Paragraph 24, 25 or 26 or a combination according to Paragraph 27, or a transgenic non-human animal according to Paragraph 28 in a method of identifying a molecule capable of binding a GPCR, an agonist of a GPCR or an antagonist of a GPCR.

Paragraph 30. Use of a pNF-κB-Luc reporter and pFC-MEKK, or a cell or transgenic non-human animal comprising both, in a method of assaying GPCR activity. Paragraph 31. A method, use, combination, kit cell or transgenic non-human animal substantially as hereinbefore described with reference to and as shown the accompanying drawings.

EXAMPLES

Example 1. Detection of GPR92 GPCR with NF-κB and MEKK Using Transient Transfection Methodology

pCDNA5/FRT/GPR92 comprises the coding sequence of GPR92, described in WO0238607, cloned into plasmid pCDNA5/FRT (Invitrogen Corporation, Carlsbad, California, USA; catalogue numbers K6010-01, K6010-02 and V6010-20). pcDNA5/FRT/JE denotes an "empty" expression vector, without any GPCR sequence.

pCDNA5 and the Flp-In™ system is described in detail in U.S. Patent Nos. 5,654,182 and 5,677,177, as well as Sauer, B. (1994) Cur. Opin. in Biotech. 5:521-527 and O'Gorman, S. et al. (1991) Science, 251:1351-1355.

Cells are seeded into white, clear bottom 1/2 area plates (Corning Costar) at a density of 30,000 cells per well in 1 OOμl of full media 24 hrs prior to transfection.

On the day of transfection, the cell monolayer is at a confluency of between 60- 80%. Cells are transfected using Polyfect (Qiagen) using the protocol for transfecting HEK-293 cells in 96 well plate as detailed below.

For each well:

pNF-κB-Luc (Stratagene) 0.1 μg

pFC-MEKK (Stratagene) 0.05μg pCDNA5/FRT (Invitrogen) +

PCDNA5/FRT/GPR92 0.1 μg

Total plasmid DNA 0.25 μg is added

Varying quantities of pCDNA5/FRT/GPR92 are used, and an amount of pCDNA5/FRT (Invitrogen) added so that the total for the two plasmids is 0.1 μg.

To each well basal media buffer (no serum) to 15μl total volume is added, lμl of Polyfect is mixed with 9μl of basal media buffer and added to the dilute DNA. The mixture is incubated for 5-10 minutes at RT.

The media is removed from the 96 well plate, and 50μl of full media is added to the DNA/Polyfect solution and mix, followed by 75μl of dilute DNA complexes to each well. The mixture is incubated for 3hrs at 37⁰C, 5% CO2, after which the media is replaced with lOOμl/well phenol red free media with serum.

18 hrs prior to assay, the media is replaced with 50μl/well 0.5% serum phenol red free media.

Compounds to be tested are added 8 hrs prior to addition of Luclite at 1 Ox final concentration and incubated at 37⁰C₅ 5% CO2.

On the day of assay, Luclite substrate solution is equilibrated to RT and to each well 50μl of Luclite is added under reduced light conditions. The plates are then read using a luminometer. For each of the experiments described here, a stock solution of transfetion reagent was created, 8 wells in a 96 well plate are transfected for each point, and data from each point is combined to generate a mean and Stdev.

Example 2. Results of GPR92 Dose Response

Figure 1 refers to data obtained with the FI293 cell line. Figure 2 refers to data obtained with the FICHL cell line. ID50 values obtained are:

FI293 cell line

N=I 0.1127μg pCDNA/FRT/GPR92/ well

N=2 0.2197μg pCDNA/FRT/GPR92/ well

FICHL cell line

N=I 0.0898μg pCDNA/FRT/GPR92/well

N=2 0.227 μg pCDNA/FRT/GPR92/well

The results clearly show that expression of the reporter is reduced in the presence of GPR92, compared to in its absence.

Although only two cell lines were transfected and used in different screens it will be recognised by those skilled in the art that the screen is cell independent and its is envisaged that any suitable laboratory cell line can be used for the screen. Example 3. Detection of GPR92 GPCR Using Cell Lines with Stable Incorporation of pNF-κB-Luc and GPR92

Generation of Cell Lines Expressing pNF-κB-Luc and GPR92

A recombinant cell line stably containing the pNF-κB-Luc reporter construct and expressing GPR92, at an appropriate level to give a dynamic range of response above and below that seen with the gene product on its own in response to transfection with pFC-MEKK or application of an activator of the NF-κB signalling pathway is established.

Assay Procedure with pFC-MEKK Transfection

Cells having stably incorporated pNF-κB-Luc and GPR92 are seeded into white, clear bottom 1/2 area plates (Corning Costar) at a density of 30,000 cells per well in lOOμl of full media 24 hrs prior to transfection.

On the day of transfection the cell monolayer are at a confluency of between 60-80%. Cells having stably incorporated pNF-κB-Luc and GPR92 are transfected using Polyfect (Qiagen) using the protocol for transfecting HEK-293 cells in 96 well plate as detailed below.

For each well the following is added:

pFC-MEKK (Stratagene) 0.05 μg

Non specific DNA 0.2μg

Total plasmid DNA 0.25 μg Basal media buffer (no serum) is added to 15μl total volume, and mixed with 1 μl of Polyfect with 9μl of basal media buffer. The dilute DNA is mixed with the buffer and incubated for 5-10 minutes at RT.

The media is removed from the 96 well plate. 50μl of full media is added to the DNA/Polyfect solution and mixed. 75μl of dilute DNA complexes is added to each well and incubated for 3hrs at 37°C, 5% CO2.

The media is replaced with lOOμl/well phenol red free media with serum.

18 hrs prior to assay the media is replaced with 50μl/well 0.5% serum phenol red free media. Each of the compounds tested are added 8 hrs prior to addition of luclite at 1 Ox final concentration and incubated at 37°C, 5% CO2.

On the day of assay Luclite substrate solution is equilibrated to RT and 50μl of Luclite added to each well under reduced light conditions. The plates are read using a luminometer.

Example 4. Assay Procedure with an Activator of the NF-κB Signalling Pathway

The cells are plated out the day before into appropriate white clear-bottomed plates in phenol red free media.

On the day of assay, sufficient luciferase assay substrate is made up to the correct concentration, following the manufacturers instructions and equilibrated to room temperature.

8 hrs prior to addition of the luciferase substrate, the activator of the NF-κB signalling pathway is added to a 10x final concentration. The compounds to be tested are then added to a 10x final concentration and incubated at 37°C, 5% CO2. In dim light conditions luciferase substrate is added and the plate read using a luminometer.

The activity of the compounds tested in reducing the activity of the GPCR or enhancing the GPCR activity is determined against the measurement of the control.

Example 5. Detection of GPR92 GPCR with API and MEKK Using Transient Transfection Methodology

The experiments described in Examples 1 to 4 are repeated with an API sensitive reporter and a source of MEKK. Luciferase is used as the reporter. 0.1 μg of reporter vector, 0.1 μg expression vector and 0.05 μg of positive plasmid are used in each experiment. Non-specific plasmid material is used to make up the total amount of DNA in experiments not having all three components present.

The plasmids used are:

pAP-1-Luc (Stratagene catalogue number 219074)

pFC-MEKK (Stratagene catalogue number 219059)

Results are shown in the Table below. JE denotes an empty expression vector, i.e., without the GPCR encoding sequence present.

Reporter Vector Transfection Ave. LCPS Stdev LCPS

3 Apl + pcDNA5/FRT/JE 44.76 16.75

4 Apl + pcDNA5/FRT/GPR92 134.19 51.65

5 Apl + pcDNA5/FRT/JE + pFC-MEKK 9626.13 1000.99

6 Apl + pcDNA5/FRT/GPR92 + pFC-MEKK 595.14 66.13 Example 6. Detection of GPR92 GPCR with CRE and Protein Kinase A (PKA) Using Transient Transfection Methodology

The experiments described in Examples 1 to 4 are repeated with an CRE sensitive reporter and a source of Protein Kinase A (PKA). Luciferase is used as the reporter. 0.1 μg of reporter vector, 0.1 μg expression vector and 0.05μg of positive plasmid are used in each experiment. Non-specific plasmid material is used to make up the total amount of DNA in experiments not having all three components present.

The plasmids used are:

pCRE-Luc (Stratagene catalogue number 219076)

pFC-PKA (Stratagene catalogue number 219071 ).

Results are shown in the Table below. JE denotes an empty expression vector, i.e., without the GPCR encoding sequence present.

Reporter Vector Transfection Ave. LCPS Stdev LCPS

7 CRE + pcDNA5/FRT/JE 132.47 8.23

8 CRE + pcDNA5/FRT/GPR92 600.17 21.09

9 CRE + pcDNA5/FRT/JE + pFC-PKA 4851.00 247.39

10 CRE + pcDNA5/FRT/GPR92 + pFC-PKA 1688.67 281.67

Example 7. Detection of GPR92 GPCR with p53 and p53Using Transient Transfection Methodology

The experiments described in Examples 1 to 4 are repeated with an p53 sensitive reporter and a source of p53. Luciferase is used as the reporter. O.lμg of reporter vector, O.lμg expression vector and 0.05μg of positive plasmid are used in each experiment. Non-specific plasmid material is used to make up the total amount of DNA in experiments not having all three components present.

The plasmids used are:

p53-Luc (Stratagene catalogue number 219085)

pFC-p53 (Stratagene catalogue number 219084)

Results are shown in the Table below. JE denotes an empty expression vector, i.e., without the GPCR encoding sequence present.

Reporter Vector Transfection Ave. LCPS Stdev LCPS

23 p53 + pcDNA5/FRT/JE 40.34 19.67

24 p53 + pcDNA5/FRT/GPR92 14.73 10.08

25 p53 + pcDNA5/FRT/JE + pFC-53 6275.20 588.93

26 p53 + pcDNA5/FRT/GPR92 + pFC-53 2839.15 151.40

Example 8. Additional Reporter Systems

Similar experiments to those described above were carried out with a number of luciferase reporter vectors. 0.1 μg of reporter vector, 0.1 μg expression vector and 0.05μg of positive plasmid were used in each experiment. Non-specific plasmid material is used to make up the total amount of DNA in experiments not having all three components present. Similar results are obtained

Examples 9 to 12 describe the generation of stable assay cell lines expressing GPR92, MEKK activator and NF-κB sensitive β-lactamase reporters Example 9. Construction of GPR92 Expression Vector

The single exon gene encoding human GPR92 gene is amplified from HEK- 293 gDNA using the following primers:

5' primer

5' ATTATTAAGCTTACGATGTTAGCCAACAGCTCCTC 3'

3' primer

5' TTTAATGGATCCTCAGAGGGCGGAATCCTGGGGACACTG 3'

The resultant PCR product is cloned directly into a cloning vector and sequence verified. The verified gene is then re-amplified using the following primers to add an N-terminal His-tag for cell sorting and cloned into pcDNA3.1 (+)

5' primer + His6

AATAAAAAGCTTACCATGGCGTACTACCATCACCATCACCATCAC TTAGCCAACAGCTCCTCAACCAACAG

3' primer

5 ' TTTAATGGATCCTCAGAGGGCGGAATCCTGGGGACACTG 3 '

Example 10. Construction of Tetracycline Responsive MEKK Expression Vector

The catalytic domain of the MEKK family of kinases is cloned from pFC- MEKK (Stratagene) using the following primers:

5 ' primer 5 ' TATATAAGCTTATGGCGATGTCAGCG 3 ' 3 ' primer 5 ' ATATACTCGAGCTACC ACGTGGTACG 3 '

The resulting fragment is cloned into pCRBlunt (Invitrogen) and sequence verified. Sequence verified MEKK is subcloned into pcDNA5/FRT/TO at the HindIII and Xhol sites.

Example 11. Generation of Flp-in-TREx293/MEKK/NFKB-δfo Cell Lines

Flp-in-TREx293 cells (Invitrogen) are maintained in DMEM with 2mM L- Glutamine, 10% Foetal Clone III (Hyclone), supplemented with lOOμg/ml Zeocin (Invivogen) & 150μg/ml Blastocidin (Invivogen).

Flρ-in-TREx293 cells are transfected with pcDNA5/FRT/TO/MEKK and stable integrants selected for using the above media supplemented with 125μg/ml hygromycin (Invivogen) & 150μg/ml Blastocidin (Invivogen). Stable clones are analysed by induction of MEKK expression with the addition of tetracycline followed by detection of MEKK on Western blots.

The resulting Flp-in-TREx293/MEKK cells are transfected with a modified pLsnύ-bsd/NVKB-bla (Invitrogen) (modified to include a gene encoding puromycin resistance) using lipofectamine (Invitrogen) and stable integrants selected for using the above media supplemented with lμg/ml Puromycin (Invivogen), 125μg/ml Hygromycin (Invivogen) & 150μg/ml Blastocidin (Invivogen). Clones are isolated by cell sorting following induction of reporter expression following on from induction of MEKK expression with Tetracycline.

The resulting Flρ-m-TREx293/MEKK/NFKB~£/α cells are transfected with pcDNA3.1/His-GPR92 using lipofectamine (Invitrogen). Cells are labelled using anti- His tag antibodies and sorted by FACS for a range of expression levels. Stable cell lines are generated by selection under G418. Example 12. β-Lactamase Assay Format

Cells made using the previous Example were seeded at 2.5x10⁴ cells / well in black clear bottom 96 well plates. The next day cells are loaded with CC2F-AM according to the manufacturers' protocol.

Tetraclycine is added and the cells incubated for several hours. The test compound is added and incubated for 4 hours before reading plate on a fluorescent plate reader. The excitation wavelength is 409nm and emission wavelength detection is at 447nm.

Agonists of GPR92 are detected by a decrease in the signal relative to control wells and an inverse agonist is detected by an increase in the signal relative to control wells.

Example 13. Non-responsive Activator / Response Element Pairs

The table below shows the negative results obtained from the following reporters: SRE-Luc (Cat No 219080), SRF-Luc (Cat No 219082), ISRE-Luc (Cat No 219089), GAS-Luc (Cat No 219091), NFAT-Luc (Cat No 219088), TARE-Luc (Cat No 240039), C/EBP-Luc (Cat No 240122), DRl -Luc (Cat No 240114), DR3-Luc (Cat No 240116), DR5-Luc (Cat No 240120), Egr-Luc Cat No 240130), LILRE-Luc (Cat No 240132), GRE-Luc (Cat No 240134). Experiments are conducted as described in Examples 1 to 5.

Reporter Vector Transfection Ave. LCPS Stdev LC

27 ISRE + pcDNA5/FRT/JE 90.07 10.46 .

28 ISRE + pcDNA5/FRT/GPR92 43.83 11.83

29 GAS + pcDNA5/FRT/JE 15.32 1.66

30 GAS +pcDNA5/FRT/GPR92 19.30 1.95 31 NFAT + pcDNA5/FRT/JE 9.05 1.27

32 NFAT + pcDNA5/FRT/GPR92 44.28 16.19

33 TARE + pcDNA5/FRT/JE 52.50 12.95

34 TARE + pcDNA5/FRT/GPR92 22.70 11.36

35 EBP + pcDNA5/FRT/JE 67.73 30.82

36 EBP + pcDNA5/FRT/GPR92 55.46 46.17

37 DRl + pcDNA5/FRT/JE 13.30 2.83

38 DRl + pcDNA5/FRT/GPR92 13.73 2.34

39 DR3 + pcDNA5/FRT/JE 8.13 3.52

40 DR3 + ρcDNA5/FRT/GPR2 12.48 12.33

41 DR5 + pcDNA5/FRT/JE 38.79 3.65

42 DR5 + pcDNA5/FRT/GPR92 46.19 9.21

43 Egr + pcDNA5/FRT/JE 31.18 6.17

44 Egr + pcDNA5/FRT/GPR92 23.57 3.09

45 LILRE + pcDNA5/FRT/JE 160.57 18.01

46 LILRE + pcDNA5/FRT/GPR92 65.20 35.54

47 GRE + pcDNA5/FRT/JE 9.83 3.04

48 GRE + pcDNA5/FRT/GPR92 11.81 5.58

JE denotes an empty expression vector, i.e., without the GPCR encoding sequence present.

REFERENCES

Hayden MS & Ghosh S 2004 Signaling to NF-κB, Genes & Development 18 2195-2224. Witherow DS, Garrison TR, Miller WE & Lefkowitz RJ 2004 β-arrestin inhibits NF-κB activity by means of its interaction with the NF-κB inhibitor IκBα, PNAS 101 8603-8607.

Each of the applications and patents mentioned in this document, and each document cited or referenced in each of the above applications and patents, including during the prosecution of each of the applications and patents ("application cited documents") and any manufacturer's instructions or catalogues for any products cited or mentioned in each of the applications and patents and in any of the application cited documents, are hereby incorporated herein by reference. Furthermore, all documents cited in this text, and all documents cited or referenced in documents cited in this text, and any manufacturer's instructions or catalogues for any products cited or mentioned in this text, are hereby incorporated herein by reference.

Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments and that many modifications and additions thereto may be made within the scope of the invention. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the claims. Furthermore, various combinations of the features of the following dependent claims can be made with the features of the independent claims without departing from the scope of the present invention.

Claims

1. A method comprising detecting G-protein coupled receptor (GPCR) modulated expression of aNF-κB, API, CRE or p53 sensitive reporter.

2. A method according to Claim 1 for detecting the presence, quantity, activity or a change in any of these of a GPCR.

3. A method according to Claim 1 or 2, in which the GPCR comprises GPR92.

4. A method according to Claim 1, 2 or 3 comprising detecting a lowered expression of the reporter in the presence of a G-protein coupled receptor (GPCR) than in its absence.

5. A method according to Claim 4, in which expression of the reporter is reduced in the presence of the GPCR compared to in its absence by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more.

6. A method according to any preceding claim, in which the NF-κB, AP 1 , CRE or p53 sensitive reporter comprises an NF-κB response element, an API response element, a CRE response element or a p53 sensitive response element respectively, which is operatively linked to a sequence encoding a polypeptide preferably selected from the group consisting of: β-galactocidase (LacZ), a fluorescent protein, preferably a green fluorescent protein (GFP), or a luciferase, preferably firefly luciferase.

7. A method according to any preceding claim, in which expression of the reporter is detected in the presence of an activator protein or a source thereof.

8. A method according to any preceding claim, in which: (a) the reporter comprises a NF-kB sensitive reporter and the activator protein comprises MEKLK; (b) the reporter comprises an AP-I sensitive reporter and the activator protein comprises MEKK; (c) the reporter comprises an CRE sensitive reporter and the activator protein comprises protein kinase A (PKA); or (d) the reporter comprises an p53 sensitive reporter and the activator protein comprises p53.

9. A method according to any preceding claim, in which expression of the reporter is detected in a cell which expresses the reporter, an activator protein thereof, and the GPCR, preferably a cell which is transfected with a nucleic acid capable of expressing the reporter, a nucleic acid capable of expressing the activator protein, and a nucleic acid capable of expressing the GPCR.

10. A method according to Claim 9, in which the cell is transfected with:

(a) an NF-κB sensitive reporter, preferably pNF-κB-Luc (Stratagene catalogue number 219078), and an expression vector capable of expressing MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059);

(b) an API sensitive reporter, preferably pAP-1-Luc (Stratagene catalogue number 219074) and an expression vector capable of expressing MEKK, preferably pFC-MEKK (Stratagene catalogue number 219059);

(c) a cAMP response element (CRE) sensitive reporter, preferably pCRE- Luc (Stratagene catalogue number 219076) and an expression vector capable of expressing protein kinase A (PKA), preferably pFC-PKA (Stratagene catalogue number 219071); or

(d) a p53 sensitive reporter, preferably p53-Luc (Stratagene catalogue number 219085) and an expression vector capable of expressing p53, preferably ρFC-p53 (Stratagene catalogue number 219084).

11. A method according to any preceding claim, in which expression of the reporter is detected in the presence of a candidate binding partner or modulator of the GPCR.

12. A method for determining whether a molecule is a modulator of a GPCR, the method comprising: (a) performing a method as set out in any of Claims 1 to 10; (b) performing a method set out in any of Claims 1 to 10 in the presence of a candidate molecule; and (c) comparing the expression levels detected in (a) and (b).

13. A method according to Claim 12 for identifying an agonist of a GPCR, in which the method comprises detecting an decrease in expression of the reporter in the presence of the agonist than in the absence thereof.

14. A method according to Claim 12 for identifying an antagonist or inverse agonist of a GPCR, in which the method comprises detecting an increase in expression of the reporter in the presence of the antagonist or inverse agonist than in the absence thereof.

15. A method of identifying an agonist or antagonist or inverse agonist of GPR92, comprising a method according to any of Claims 11 to 14.

16. A method of identifying a molecule suitable for the treatment or alleviation of a GPR92 associated disease, the method comprising determining if a candidate molecule is an agonist or antagonist or inverse agonist of GPR92 according to any of Claims 11 to 14.

17. Use of GPR92 in a method according to any of Claims 11 to 14 for identifying a molecule suitable for the treatment or alleviation of a GPR92 associated disease.

18. A method or use according to any of Claims 16 or 17, in which the GPR92 associated disease is selected from the group consisting of: pain, a motion related disorder, a disorder of motor co-ordination, a disorder of balance, a dementia related disorder, a secretion related disorder or a disorder of urogenital function including erectile dysfunction.

19. A method or use according to Claim 16, 17 or 18, in which the GPR 92 associated disease is selected from the group consisting of: trigeminal neuralgia, orofacial pain, pain associated with toothache, irritable bowel syndrome, Barrett's oesophagus, glaucoma, pain associated with cancer, diabetic neuropathies, Herpes infections, HIV infections, migraine and skin sensitivity associated with migraine, allodynia, toothache, neuroma (whether caused by amputation, nerve transaction or trauma), nerve compression (caused by tumours, entrapment or crush), and pain due to damage of the spinal cord or brain; dementia, dyslexia, dyskinesias, tremor, Parkinson's, benign essential tremor, chorea, epilepsy and ballismus, for example occurring through stroke, trauma, degeneration or malignancy; dry-eye disorders, cystic fibrosis, hyperactive bladder, hypercholesterolaemia, dislipdaemias and obesity; erectile function or control of motor fibres in the prostate.

20. A combination of an NF-κB, API, CRE or p53 sensitive reporter together with an activator protein thereof, or nucleic acids encoding such, for use in a method of detection, diagnosis or treatment of a GPCR associated disease, preferably a GPR92 associated disease.

21. A kit for the detection, diagnosis or treatment of a GPCR associated disease, preferably a GPR92 associated disease, comprising a NF-κB₅ API, CRE or p53 sensitive reporter and an activator protein thereof, or nucleic acids encoding such, together with instructions for use.

22. A combination according to Claim 20 or a kit according to Claim 21 , which comprises pNF-κB-Luc (Stratagene catalogue number 219078) and pFC-MEKK (Stratagene catalogue number 219059); pAP-1-Luc (Stratagene catalogue number 219074) and pFC-MEKK (Stratagene catalogue number 219059); pCRE-Luc (Stratagene catalogue number 219076) and pFC-PKA (Stratagene catalogue number 219071); or p53-Luc (Stratagene catalogue number 219085) and pFC-p53 (Stratagene catalogue number 219084).

23. A cell comprising an introduced nucleic acid sequence encoding a reporter under control of a NF-κB, API, CRE or p53 response element, together with an introduced nucleic acid sequence encoding a GPCR.

24. A cell transfected with a nucleic acid sequence encoding a NF-κB, API, CRE or p53 sensitive reporter and a nucleic acid sequence encoding a GPCR.

25. A cell according to Claim 23 or 24, in which the reporter is selected from the group consisting of: NF-κB-Luc, pAP-1-Luc, CRE-Luc and p53-Luc.

26. A combination of a cell according to Claim 23, 24 or 25, together with a nucleic acid sequence encoding a an activator protein of the NF-κB, API, CRE or p53 sensitive reporter, preferably pFC-MEKK (Stratagene catalogue number 219059), pFC-PKA (Stratagene catalogue number 219071) or pFC-p53 (Stratagene catalogue number 219084).

27. Use of a cell according to Claim 23, 24 or 25 or a combination according to

Claim 26 in a method of identifying a molecule capable of binding a GPCR, an agonist of a GPCR or an antagonist or inverse agonist of a GPCR.

28. Use of a pNF-κB-Luc reporter and pFC-MEKK, or a cell comprising both, in a method of assaying GPCR activity, preferably GPR92 activity.

29. Use of an agonist or antagonist or inverse agonist of GPR92 identified by a method according to any of Claims 12 to 14 for the preparation of a pharmaceutical composition for the treatment of a GPR92 associated disease in an individual.

30. A molecule identified by a method according to any preceding claim or a pharmaceutical composition comprising such a compound together with a pharmaceutically acceptable carrier or diluent.

31. Use of a molecule or a pharmaceutical composition according to Claim 30 in a method of treating or preventing a GPCR associated disease.

32. A method, use, combination, kit or cell substantially as hereinbefore described with reference to and as shown the accompanying drawings.