WO2006037611A2

WO2006037611A2 - Methods for the early diagnosis of viral infections, inflammatory diseases, a predisposition for proliferative disorders or hyperplasia by analysing eag or erg expression levels

Info

Publication number: WO2006037611A2
Application number: PCT/EP2005/010680
Authority: WO
Inventors: Francisco Javier Camacho Arroyo; Walter STÜHMER; Luis A. Pardo; Mike Rothe; Esther Zwick-Wallasch
Original assignee: Centro De Investigación Y De Estudios Avanzados Del Ipn; U3 Pharma Ag; Max-Planck-Gesellschaft zur Förderung der Wissenschaft e.V.
Priority date: 2004-10-01
Filing date: 2005-10-04
Publication date: 2006-04-13
Also published as: WO2006037611A3; MX2007003865A

Abstract

The present invention provides a method for the identification of the predisposition of a subject for a proliferative disorder or a hyperplasia and a method for the early diagnosis of a viral infection or an inflammatory disease, comprising the step of analyzing the level of expression of an ether à go-go (EAG) potassium channel gene and/or an ether à go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells.

Description

Methods for the early diagnosis of viral infections and inflammatory diseases or a predisposition of a subject for proliferative disorders or hyperplasia

The present invention relates to a method for the identification of the predisposition of a subject for a proliferative disorder or a hyperplasia and a method for the early diagnosis of a viral infection or an inflammatory disease, comprising the step of analyzing the level of expression of an ether a go-go (EAG) potassium channel gene and/or an ether a go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells.

Several documents are cited throughout the text of this specification. The disclosure content of each of the documents cited herein (including any manufacturer's specifications, instructions, etc.) is herewith incorporated by reference.

Viral infections, inflammatory diseases and proliferative diseases represent major groups of today's common diseases. At least some of said diseases are life- threatening, while others may result in long lasting or lifelong reduction of the quality of life. Furthermore, the treatment of said diseases requires a high portion of the public and private health budget. Accordingly, the improvement of strategies for the treatment or, even more desirable, the prevention of the manifestation of such diseases is of great importance in medical science.

Based on an increasing understanding of the heterogeneous nature of many pathological conditions, a principle aim of medical/pharmaceutical drug development is the establishment of individual or targeted therapies for the treatment of diseases "personalized medicine". Such specific therapies may e.g. comprise therapeutic antibodies, small molecule inhibitors, nucleic acid interference, an individual diet and the administration of an individually selected or dosed pharmaceutical composition. dosed pharmaceutical composition.

In order for targeted therapy approaches to exert/elicit the most clinical benefit, it is of particular advantage to identify a person in the need of such therapy as early as possible. The same holds true for the treatment of diseases by conventional methods. Accordingly, there is a need of indicators for a predisposition of a subject for a disease and for an initiation of diseases. Candidates for such indicators are marker molecules.

Potassium channels play an important role in several cellular functions such as excitability, contraction, cell cycle progression and metabolism (1). In particular, some members of the ether a go-go (EAG) potassium channels family are modulated through the cell cycle (2-8) and have been suggested to be involved in tumorigenesis (9-17). Rat EAG channels expressed in frog oocytes display rectification induced by mitosis-promoting factor activation (2), and their conducting properties change during cell cycle (3). Retinoic acid down-regulates hEAG current in neuroblastoma cells (4). hEAG is transiently expressed before myoblasts fusion, which is a cell cycle-related event (5, 6). hEAG expression currently decreases during M phase and is modulated by cytoskeletal elements (7). Channel subunits of another member of the EAG channel family, the human ether a go-go related gene (hERG), are differentially expressed throughout the cell cycle (8).

One of the most intriguing aspect of hEAG and hERG channels is their relationship to cellular transformation. Cells transfected with EAG are able to grow in the absence of serum, lose contact inhibition, and induce aggressive tumors when injected into immune-depressed mice (9). EAG mRNA expression in normal tissues is mainly restricted to the brain. It is also expressed transiently in skeletal muscle and slightly expressed in placenta. On the other hand, EAG mRNA is expressed in several cancer cell lines including HeLa, MCF-7, SHSY-5Y, and IGR1 from carcinoma of the cervix, breast tumor, neuroblastoma, and melanoma, respectively (9, 10). Despite the major expression of EAG in normal brain (9), endogenous EAG- mediated currents have been reported only in myoblasts (6) and in the tumoral cell lines SHSY-5Y (4), MCF-7 (11), and IGR1 (10). EAG is expressed in the tumor cell line HeLa (9); however, no EAG-mediated currents have been described in these cells.

Expression of EAG and EAG-mediated currents in transformed cells seems to be an important event for cell proliferation, because inhibition of EAG expression with antisense oligonucleotides reduces cell proliferation in some cancer cell lines (9). Similarly, EAG-mediated current inhibition by imipramine have been suggested to decrease cell proliferation in IGR1 cells (12). Furthermore, cells expressing nonconducting EAG channels fail to induce tumor formation when injected into immune-depressed mice. EAG mRNA has been described not only in tumor cell lines but also in several human tumors including mammary gland, liver, prostate, uterine cervix, ovary, endometrium, colon, and thyroid; a significant percentage of epithelial tumors show robust EAG expression (13), whereas hERG channels are expressed in several cancer cell lines from different histogenesis including leukemic cells (14-16) and frequently expressed in biopsies from endometrical cancer (17).

In WO 99/54463 is has been described that the analysis of EAG expression and activity can be used for the detection of an onset or progression (disease status) of cancer. However, in this case a patient is already affected by cancer.

In view of the above described high relevance of the recited diseases for the public health the technical problem underlying the present invention was to provide means and methods which enable a prevention or alleviation of said diseases or to detect a predisposition to develop a disease. In the latter case, this will allow taking actions prior to the outbreak or manifestation the diseases.

The solution to said technical problem is achieved by providing the embodiments characterized in the claims.

The present invention provides a method for the identification of the predisposition of a subject for a proliferative disorder or a hyperplasia, comprising the step of analyzing the level of expression of an ether a go-go (EAG) potassium channel gene and/or an ether a go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells wherein

(a) a detection of expression or activity in said sample of tissue or cells which under physiological condition do not show an expression or activity of one or more of said genes is indicative for said predisposition; or

(b) a detection of an increased level of expression or activity in said sample of tissue or cells compared to a basal level characteristic for said samples of tissue or cells under physiological conditions of one or more of said genes is indicative for said predisposition. Furthermore, the present invention provides in an alternative embodiment a method for the early diagnosis of a viral infection or an inflammatory disease, comprising the step of analyzing the level of expression of an ether a go-go (EAG) potassium channel gene and/or an ether a go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells wherein (a) a detection of expression or activity in said sample of tissue or cells which under physiological condition do not show an expression or activity of one or more of said genes is indicative for said diagnosis; or

(b) a detection of an increased level of expression or activity in said sample of tissue or cells compared to a basal level characteristic for said samples of tissue or cells under physiological conditions of one or more of said genes is indicative for said diagnosis.

The term "predisposition for a disease" is understood to describe a status of a subject prior to the outbreak of said disease. Thus, the predisposition of a subject for such disease is analyzed prior to an early onset of the disease itself. The term "early diagnosis of a disease" is understood in the context of the present invention to allow a diagnosis of the disease prior to the development of morphological alterations. Thus, the disease can be diagnosed prior to a manifestation of the disease in its early onset. The term "sample" denotes in the context of the present invention body sample, such as samples of organs, tissues or cells of a subject/patient. Preferable the subject (patient) the sample is taken from is human.

Tissue samples explicitly comprise in the context of the present invention samples of dermal tissue material, such as epidemal detritus, mucosal swabs, such as, but not limited to oral mucosal, tonsillar, rectal, genital or nasal swabs (e.g. pap smears), as well as samples obtained by surgical techniques including minimal invasive techniques such as biopsy as well as more invasive techniques. The preparation of the sample may comprise a cultivation of the obtained material (e.g. in tissue culture) prior to the detection of the expression of the recited genes or the activity of the encoded gene products.

The term "expression" of a gene characterizes the process of transcription of a gene into mRNA in a cell or in the cells of a tissue. Furthermore, in line with the present invention, said term also refers to the translation of said mRNA and, thus, the production to the encoded gene product in said cell or cell in a tissue.

As defined herein above the EAG as well ERG are transmembrane ion channels. Accordingly, the activity of the gene products encoded by the EAG or the ERG genes is to permit the flow of ions through the membrane of a cell. The term "physiological condition" is understood in the context of the present invention to define a state of the body, an organ, a tissue or a cell, wherein their respective functions are non-phathological, i.e. the representative of a normal healthy individual according to established medical guidelines and practice. Thus, said organs, tissues and cells are in this state not effected by any changes that will result in the development of the above recited diseases.

It has been surprisingly found that the detection of an expression of an EAG gene or an ERG gene is an indicator for a predisposition of a subject for a proliferative disorder or a hyperplasia. Furthermore, it was observed that said expression is also an indicator helpful in the early diagnosis of a viral infection or an inflammatory disease. It has been found that prior to the outbreak of corresponding diseases the expression of said genes is primary initiated or significantly unregulated compared to a physiological basal level of expression. The same holds true for the activity of the encoded gene products. The question whether the predisposition is indicated by a primary initiation of the expression of the gene (undesired expression) or the enhancement of an basal expression (undesired overexpression) is dependent from the tissue/cells and the gene which is/are analyzed. For example a wide spread expression on a basal of ERG genes is observed in different tissues of the human body. In contrast it is known in the art that e.g. the Eag1 gene is only expressed under physiological conditions on a basal level e.g. in tissues of the brain, nerves and kidney, whereas there is no significant basal expression of the gene in tissue of cervix uteri, liver, pancreas and prostate.

In the context of the present invention an increase of the expression (undesired overexpression) is understood as an at least 2 times overexpression compared to the basal level under physiological conditions, preferably 5 times, 10 times or 100 times.

As noted herein above, there is e.g. no significant expression for EAG genes, namely Eag1 , in particular tissues. The detection of Eag1 expression in samples of such tissues is indicative for the predisposition of a subject from which said sample is derived from.

It is preferred for the methods of the invention that

(a) tissues and cells which under physiological condition do not show an expression of the EAG gene or activity of the corresponding gene product are selected from samples of a group consisting of samples of cervix uteri, liver, pancreas and prostate; and

(b) tissues and cells for which under physiological conditions a basal level for an expression of the EAG gene or activity of the corresponding gene product is characteristic are selected from samples of a group consisting of samples of brain, nerves and kidney.

In a preferred embodiment of the methods of the invention the nucleic acid sequence of the EAG gene comprises (a) a nucleic acid molecule encoding the polypeptide having the amino acid sequence of SEQ ID: NO 2 or 4;

(b) a nucleic acid molecule having the DNA sequence of SEQ ID: NO 1 or 3;

(c) a nucleic acid molecule hybridizing to the complementary strand of a nucleic acid molecule of (a) or (b); or (d) a nucleic acid molecule being degenerate to the sequence of the nucleic acid molecule of (c).

Furthermore, it is preferred for the methods of the invention that the nucleic acid sequence of the ERG gene comprises (a) a nucleic acid molecule encoding the polypeptide having the amino acid sequence of SEQ ID: NO 6, 8 or 10;

(b) a nucleic acid molecule having the DNA sequence of SEQ ID: NO 5, 7 or 9;

(c) a nucleic acid molecule hybridizing to the complementary strand of a nucleic acid molecule of (a) or (b); or

(d) a nucleic acid molecule being degenerate to the sequence of the nucleic acid molecule of (c).

The term "hybridizing" as used herein refers to polynucleotides/nucleic acid sequences which are capable of hybridizing to the polynucleotides encoding the EAG or ERG proteins as defined herein. Therefore, said polynucleotides may be useful as probes in Northern or Southern Blot analysis of RNA or DNA preparations, respectively, or can be used as oligonucleotide primers in PCR analysis dependent on their respective size. Preferably, said hybridizing polynucleotides comprise at least 10, more preferably at least 15 nucleotides in length while a hybridizing polynucleotide of the present invention to be used as a probe preferably comprises at least 100, more preferably at least 200, or most preferably at least 500 nucleotides in length.

It is well known in the art how to perform hybridization experiments with nucleic acid molecules, i.e. the person skilled in the art knows what hybridization conditions she has to use in accordance with the present invention. Such hybridization conditions are referred to in standard text books such as Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001) N.Y. Preferred in accordance with the present inventions are polynucleotides which are capable of hybridizing to the polynucleotides of the invention or parts thereof, under stringent hybridization conditions.

"Stringent hybridization conditions" refer, i.e. to an overnight incubation at 42⁰C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C. Also contemplated are nucleic acid molecules that hybridize to the polynucleotides of the invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37⁰C in a solution comprising 6X SSPE (2OX SSPE = 3M NaCI; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg/ml salmon sperm blocking DNA; followed by washes at 50⁰C with 1 X SSPE, 0.1 % SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC). It is of note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility. The recited nucleic acid molecules may be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination.

In a more preferred embodiment of the methods of the invention the expression of an EAG gene and/or the expression of an ERG gene in a sample is determined on mRNA level or on protein level and/or the activity of said gene products is determined on an electrophysiological level.

Different methods for the determination of the expression of a gene on mRNA level or protein level are known in the art and described in several laboratory manuals; see e.g. Mϋlhardt, C. Der Experimentator: Molekularbiologe/Genomics; Spektrum

Akademischer Verlag 2003; Rehm, H. Der Experimentator: Spektrum Akademischer

Verlag; 2002; Lottspeich, F. and Zorbas, H. Bioanalytik Spektrum Akademischer

Verlag 1998.

Moreover, different methods for the determination of the activity of a gene product on an electrophysiological level are known in the art; see e.g. Hamill OP et al.,

Pflϋgers Arch 1981.

It is further preferred that the expression of an EAG gene and/or the expression of an ERG gene in a sample on a mRNA level is determined by RT-PCR, cDNA array or Northern Blot analysis. In the appended examples a possible RT-PCR approach is described in more detail.

Preferably, for the analysis of the expression of an EAG gene by RT-PCR a pair of sense and antisense primers is used selected from the sense primers having a nucleic acid sequence as shown in SEQ ID NO: 11 or 13 and from the antisense primers having a nucleic acid sequence as shown in SEQ ID NO: 12 or 14.

It is preferred in one embodiment of the invention that the detection of the translated protein of said EAG gene and/or ERG gene is effected by immuno- blotting/Westem blot analysis, immunohistochemical analysis, ELISA analysis, immunofluoresce analysis, FACS analysis or antibody array analysis. Appropriate antibodies required for such analysis are known in the art and described e.g. in WO 99/54463 and a further application filed on October 1 , 2004 by the present applicant. Protocols for said analysis are known to the person skilled in the art and represent standard techniques in biochemical laboratories.

In an alternatively preferred embodiment of the methods of the invention the activity of an EAG gene product and/or an ERG gene product in a sample on electrophysiological level is determined by patch clamp analysis.

The technique of patch clamp analysis is known in the art and described in Stϋhmer, W., 1992, Methods in Enzymology 207 and the appended examples.

According to a preferred embodiment of the methods of the invention the sample which is analyzed is a tissue culture of a tissue sample derived by biopsy from said subject. A corresponding approach is described in the appended examples.

It is preferred by the present invention that said viral infection, inflammatory disease, proliferative disorder or hyperplasia is a gynecological disease.

It is also preferred that the recited proliferative disorder is cancer. Preferably, said cancer is cervical cancer. Furthermore, it is preferred that the recited hyperplasia is adenomatous hyperplasia or prostate hyperplasia.

Moreover, it is preferred that the recited viral infection is an infection with Human Papilloma Virus or Hepatitis C Virus (HCV). In addition, it is preferred that the recited inflammatory disease is an pancreatitis. In one alternative embodiment the recited inflammatory disease is a pancreatitis or hepatitis.

The figures show:

Figure 1 : EAG expression in cancerous and normal cervix.

Southern blot analysis of 475-bp hEAG RT-PCR products is shown for RNAs obtained from primary cultures of cervical cancer biopsies (A, lanes 1-5), endocervical adenocarcinoma (A, lane 6), and control cervix (A, lanes 7-12). hEAG signals were detected in control cervixes (B) from patients whose samples were diagnosed as human papilloma virus infection (lane 14), atypical adenomatous hyperplasia of the endometrium (lane 15), and paratubaric serous cystadenoma without atypical cells (lane 16); in 1 case (lane 17) it was not possible to establish a detailed diagnosis, because the endometrium was reported as histologically lysed. hEAG-transfected CHO cells were used for positive control (lanes 13 and 18). Hybridization with a cyclophilin (Cyc) probe from the same RNAs is shown at the bottom of each gel.

Figure 2: Current to voltage relationships in cervical cancer cells. Whole-cell patch-clamp experiments were performed, and ramp protocols from 80 to 120 mV were applied in isolated cells from cervical cancer primary cultures. Linear leak was subtracted after extrapolation of a linear fit to the current measured between 80 and 70 mV to the whole range. Four different I-V curves were found in different cells in every culture. In some cells, clear inward currents were followed by an outward current (A); other cells displayed very small inward currents followed by a slightly inactivating outward current (B); traces with the presence of small outward inactivating currents followed by non inactivating currents were also recorded (C); and finally, some cells showed only non inactivating outward currents (D) where EAG activity was detected. Eh 80 mV.

Figure 3: Voltage- and magnesium- dependent activation of outward currents.

A, unsubtracted currents (left traces) elicited at 60 mV preceded by negative prepulses at different voltages indicated in the amplified extract (right traces).

B, outward currents elicited at 60 mV preceded by negative prepulses at 140 or 60 mV in magnesium-free solutions (left traces) or in solutions containing 10 mmol/L magnesium.

C, voltage-dependent activation (time to reach 80% of maximal amplitude, mean, n 6 for each condition; bars, SD₁) at different external magnesium concentrations.

Activation is strongly dependent on prepulse voltage and extracellular magnesium as expected for EAG channels.

Figure 4: Liver tissue sample stained for EAG1. (a) shows a Interface hepatitis with inflammatory cells and Piecemeal necrosis (b) a Nutritive-toxic hepatitis with fat droplets

Figure 5: EAG staining in pancreas tissue. lmmunhistochemistry demonstrates immunoreactivity for EAG 1 in panreatitis but not in connective tissue (a). In addtion EAG 1 expression was found in Mucinous metaplasia (b).

Figure 6: shows no EAG 1 staining in (a) normal prostatic ducts whereas in (b) regions of benign prostate hyperplasia were immunoreactive

The invention is now described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of scope of the present invention.

Figure 7:

The figure shows the inhibition of cervix carcinoma cell proliferation by mouse anti-

Eag1 antibody lmAb3 conjugated with the immunotoxin saporin. The following examples illustrate the invention.

Example 1 : quantitative RT-PCR Total RNA was extracted from primary cultures of cervical cancer cells and directly from normal cervical tissue with Trizol reagent (Invitrogen). hEAG-transfected Chinese hamster ovary (CHO) cells were used as positive control. RNA was subjected to reverse transcription reaction, and PCR amplifications were performed with the following sense and antisense primers: 5 GCTTTTGAGAACGTGGATGAG-3 (SEQ ID NO:11) and 5

CGAAGATGGTGGCATAGAGAA-3 (SEQ ID NO: 12). These amplifications yielded a 475-bp hEAG1 product. The constitutive gene cyclophilin was also amplified as control, using the following sense and antisense primers: 5 -CCC CAC CGT GTT CTT CGACAT-3 and 5 -AGG TCC TTA CCG TTC TGG TCG-3 , respectively, which yielded a 453-bp product. Reverse transcription-PCR (RT-PCR) product identity was determined by nucleotide sequence in an automatic capillary genetic analyzer (ABI PRISM 3100, Applied Biosystems). The PCR products were separated in agarose gels, blotted onto nylon membranes, and hybridized with [³²P]dCTP-labeled nested probes. Probes were obtained with the following upper and lower primers: for the 228-bp hEAG1 probe, 5 -TGGTCCTGCTGGTGTGTG- 3 (SEQ ID NO:13) and 5 -ACAACGAGGAGATGTAGACA G-3 (SEQ ID NO: 14); and for the 187-bp cyclophilin probe, 5 -CACACGCCATAATGGCACTGGTGG-3 and 5 - AAAGACCACATGCTTGCCATC CAGC-3 . In all of the cases, filters were washed after 18-hour hybridization and exposed to X-ray films. Southern blot probes were also confirmed by sequence.

EAG expression was studied by RT-PCR and Southern blot analysis in 5 primary cultures from cervical cancer biopsies, in 1 fresh cervical cancer tissue, and in 12 noncancerous biopsies from normal cervixes. Fig. IA shows EAG gene expression in 100% of the primary cultures from cervical cancer (Lanes 1-5). It is worth mentioning that in a patient who was submitted to hysterectomy without any previous evidence of cervical malignancy (negative pap smears), postsurgery pathological studies showed an unexpected endocervical adenocarcinoma expressing EAG. Hence, because this EAG expression was found in a cancerous tissue, it was grouped together with the samples from primary cultures of cancer cells (Fig. 1>4, lane 6). Studies of EAG expression in control cervical biopsies displayed samples either negative or positive for EAG, despite all of them coming from patients with negative pap smears. Southern blot experiments from control cervical tissue negative for EAG are also shown in Fig. 1A (Lanes 7-12); 8 of 12 samples were negative for EAG (only 6 are shown).

Eag expression was observed in 4 control biopsies of normal cervical tissue. Interestingly, 1 of these control EAG-positive samples (Fig. 18, lane 14) came from a patient with human papilloma virus infection, the most important etiological factor associated with cervical cancer. Two other patients in whom EAG expression was found in normal cervix presented atypical adenomatous hyperplasia of the endometrium in 1 case and paratubaric serous cystadenoma without atypical cells in the other (Fig. 18, lanes 15 and 16, respectively). In 1 patient of the EAG-positive control samples (Fig. 18, lane 17) the endometrium was reported as histologically lysed, so a diagnosis could not be determined. hEAG-transfected CHO cells were used as positive control (Fig. 1 , lanes 13 and 18).

RT-PCR product identity was determined by nucleotide sequence (data not shown). The amplified products were identical to the sequence reported for hEAGL We determined that the cells from the cancerous biopsies studied herein express the two different mRNA spliced variants reported for hEAG1 gene.

Example 2: electrophysiology

Whole-cell recordings were acquired from isolated cells with the patchclamptechnique using an EPC-9 amplifier (HEKA Electronics, Germany)and analyzed with Igor Pro (WaveMetrics). Two to three M patch pipetteswere obtained by double-pulling Kimax capillaries. Internal solution contained(mmol/L) 140 KCI, 10 EGTA, and 10 HEPES/KOH (pH 7.2). Externalsolution contained (mmol/L) 115 NaCI, 2 CaCI2, 2 MgCI2, and 10 HEPES/NaOH (pH 7.2); in some experiments we used free-magnesium solutions or solutions containing 2, 5, or 10 mmol/L MgCI2. No capacitance compensation was performed. Holding potential was 80 mV, unless indicated. Experiments were performed at room temperature (2O⁰C to 22⁰C). Whole cell patch clamp experiments were performed in 5 primary cultures from cervical cancer cells. Before exploring EAG activity, we applied voltage ramp protocols (from 80 mV to 120 mV) to study the current to voltage relationship. Four different shapes of I-V curves in every culture were found (Fig. 2). Some cells (Fig. 2A) displayed clear inward currents from 30 mV to 10 mV, probably mediated through sodium or calcium channels, followed by an outward non-inactivating current. Other cells showed a small outward current at very negative potentials (Fig. 2B) followed by a small inward current near 25 mV then followed by an inactivating or rectifying outward current. Fig. AC shows an I-V curve with a very small inward current at 50 mV followed by outward current, and finally Fig. 2D displays exclusively non-inactivating outward currents. Cells showing such I-V curve had the highest current density and were the only cells where we detected EAG activity. We looked for EAG activity in tumor cells by studying their voltage and magnesium dependent activation. Very negative prepulses have an especially strong effect on EAG activation; the more negative the prepulse potential, the slower the EAG activation (Cole-Moore shift, ref. 20);similarly, the higher the extracellular magnesium concentration, the slower the EAG activation. Fig. ZA shows the potential dependent activation of the outward currents recorded in cervical cancer cells. Unsubtracted traces of currents elicited at 60 mV preceded by pulses at different potentials are shown on the left. Prepulse values are indicated for each pulse in magnified traces on the right; the more negative the prepulse, the slower the channel activation. Magnesium-dependent activation is shown in Fig. 3B. Outward current elicited at 60 mV and preceded by a 140 or 60 mV prepulse were obtained either in the free-magnesium external solutions(left traces) or in solutions containing 10 mmol/L magnesium(right traces). As expected for EAG, activation is clearly delayed in the presence of magnesium, the effect being more pronounced by applying a very negative prepulse. Fig. 3C shows the required time to reach 80% of the maximum outward current amplitude at different prepulse voltages and extracellular magnesium concentrations. Time to 80% values is bigger at higher magnesium concentrations and very negative prepulses as described for EAG channels.

Example 3: identification of HPV16

Human Papilloma Virus 16. Expression of the E7 gene was studied. Genomic DNA was obtained with phenol-chloroform. PCR amplifications were performed with the following sense and antisense specific primers:5

GACAGCTCAGAGGAGGAGGATG-S and 5 -GACTCTACGCTTCGGTTGTGC-3 . The product was separated in agarose gels. CaSki cells (American Type Culture Collection, Manassas, VA) were used as E7-positive control.

Example 4: lmmunohistochemistry

Tissues from the tissue register Klinikum Kassel were analysed by immunohistochemistry in order to elucidate the role of EAG 1 in non malignant disorders as for example inflammatory or hyperproliferative diseases as well as tissues affected by virus infection. The use of fixed tissue was approved by the review board of the Klinikum Kassel. Tissue was fixed for 16 to 20 hours in 4% neutral buffered formalin and then embedded in paraffin. With a microtome 2-4 μm thin sections of selected tissue blocks were cut, mounted on silanized glass slides (Sigma) and dried at 60⁰C for 30 min and at 38⁰C overnight. Sections were deparaffinized by incubation in xylene bath for 5 minutes twice, in acetone for 5 minutes twice and finally in distilled water for 5 minutes. Heat pretreatment of the sections was done in 10 mM citrate buffer, pH 6.0 in a micowave oven for 30 minutes at 250W, followed by washing in distilled water. Endogenous peroxidase was blocked by incubation in a freshly prepared solution of 0.3% H₂O₂ in methanol for 20 minutes at room temperature followed by washing in distilled water for 5 minutes. Except for counterstaining with hematoxylin and mounting, the following steps were performed overnight using the Tecan- lmmunostainer Genesis RSP 200 (Software: Gemini 3.40), which proceeds regarding manufacturer's EnVision+-staining procedure (DAKO Cytomation, ChemMate rabbit/mouse): Slides were rinsed twice in PBS/0.05% TWEEN pH 7.4 for 7 minutes and incubated with antibody eag-1 (provided by U3) for 4 hours (1 :200 dilution in Antibody Diluent (DAKO)). The reaction was stopped with 100 μl PBS/0.05% TWEEN pH 7.4 per slide. After washing in 1400 μl PBS/0.05% TWEEN pH 7.4 for 7 minutes, the slides were incubated with secondary antibody/peroxidase- conjugate (30 minutes, 150 μl/slide, DAKO HRP/rabbit-mouse ChemMate). After washing as before the staining reaction was achieved with 120 μl/slide DAB solution (DAKO; 1 :50 dilution in substrate buffer) for 10 minutes. The reaction was stopped with 100 μl PBS/0.05% TWEEN pH 7.4 for 20 min, followed by washing with 1400 μl PBS/0.05% TWEEN pH 7.4 for 7 minutes and then slides were washed every two hours with PBS/0.05% TWEEN pH 7.4, totally three times. Finally the slides were rinsed in water, counterstained with Harris' hematoxylin and covered with a glass slide. To exclude unspecific binding of the lgG2b molecule, control sections were incubated with lgG2b negative control (DAKO) instead of eag- 1 antibody.

As demonstrated in the drawings of the invention we were able to show that surprisingly EAG 1 was expressed in prostate hyperplasia (fig 1), in pancreatitis (fig 2) and hepatitis (fig 3). These data emphasize a functional role for EAG in the course of non malignant disorders.

Example 5:

Inhibition of human cervix carcinoma cell proliferation by human anti-EAG1 antibody lmAb3 of the invention conjugated to the immunotoxin saporin

The effect of the saporin-conjugated anti-EAG1 antibody lmAb3-SAP on cervix carcinoma cell proliferation was tested. Conjugation of the anti-Eag1 antibody lmAb3 to saporin (lmAb3-SAP) via disulfide linkage and purification of the conjugated antibody lmAb3-SAP was performed by Advanced Targeting Systems (San Diego, CA₁ USA).

1000 cancer cells/well were seeded in 100 μl 10% FCS-containing culture medium on 96-well plates overnight. After 24h, cells were washed with PBS and incubated for 24h in 60 μl/well medium containing 10% FCS. Cells were treated in quadruplicates with 1μg/ml saporin-conjugated anti-Eag1 monoclonal antibody lmAb3-SAP or control IgG-SAP diluted in 40 μl/well. Cells were then incubated at 37⁰C in 5% CO₂ for 3 days. In order to assess proliferation and cell viability 20 μl/well CellTiter 96^® AQ_ueOus One Solution reagent (Promega) containing the tetrazolium salt MTS and the electron coupling reagent phenazine methosulfate (PMS) was added to each well and incubated at 37°C for various periods ranging from 10 min up to 3 hours. The quantity of the formazan product was measured by the amount of 590nm absorbance using an ELISA plate reader. The results shown in fig. 1 demonstrate that lmAb3-SAP inhibits cell proliferation of HeLa cells, a cervix adenocarcinoma cell line known to be HPV-18 positive. In addition it is shown that lmAb3-SAP significantly interferes with cell proliferation of three further cervix carcinoma cell lines CERV-215, CERV-196 and CERV-186 (CLS) reported to be H PV- 16 positive.

References:

I . HiIIe B. Ion channels of excitable membranes. 3rd. ed. Massachusetts: Sinauer Associated Inc; 2001. 2. Brϋggemann A. et al.; Proc. Natl Acad Sci USA 1997;94:537-42.

3. Pardo LA. et al.; J Cell Biol 1998; 143:767-75.

4. Meyer R. and Heinemann SH.; J Physiol 1998;508:49-56.

5. Occhiodoro T. et al.; FEBS Lett 1998;434: 177-82.

6. Bijlenga P. et al.; J Physiol 1998;512:317-23. 7. Camacho J. et al.; Pflugers Arch 2000;441 : 167-74.

8. Crociani O. et al.; J Biol Chem 2003;278:2947-55.

9. Pardo LA. et al.; EMBO J 1999; 18:5540-7.

10. Meyer R. et al.; J Membr Biol 1999;171 :107-15.

I 1. Ouadid-Ahidouch H. et al.; Receptors Channels 2001 ;7:345-56. 12. Gavrila-Ruch O. et al.; J Membr. Biol 2002; 188: 137-49.

13. Pardo L. et al.; Eur J Cancer 2002;38 Suppl 7:104.

14. Bianchi L. et al.; Cancer Res 1998;58:815-22.

15. Smith GAM. et al.; J Biol Chem 2002;277: 18528-34.

16. Pillozzi S. et al.; Leukemia 2002;16:1791-8. 17. Cherubini A. et al.; Br J Cancer 2000;83: 1722-9.

18. Stuhmer, W., 1992, Methods in Enzymology 207

19. Hamill OP, et al., Pflugers Arch. 1981 ; 391 : 85-100.

Claims

1. A method for the identification of the predisposition of a subject for a proliferative disorder or a hyperplasia, comprising the step of analyzing the level of expression of an ether a go-go (EAG) potassium channel gene and/or an ether a go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells wherein

(b) a detection of an increased level of expression or activity in said sample of tissue or cells compared to a basal level characteristic for said samples of tissue or cells under physiological conditions of one or more of said genes is indicative for said predisposition.

2. A method for the identification of the early diagnosis of a viral infection or an inflammatory disease, comprising the step of analyzing the level of expression of an ether a go-go (EAG) potassium channel gene and/or an ether a go-go related gene (ERG) or the activity of a corresponding gene product in a sample of tissue or cells wherein

(a) a detection of expression or activity in said sample of tissue or cells which under physiological condition do not show an expression or activity of one or more of said genes is indicative for said diagnosis; or

3. The method according to claim 1 or 2, wherein the

4. The method according to anyone of claims 1 to 3, wherein the nucleic acid sequence of the EAG gene comprises

(a) a nucleic acid molecule encoding the polypeptide having the amino acid sequence of SEQ ID: NO 2 or 4;

(b) a nucleic acid molecule having the DNA sequence of SEQ ID: NO 1 or 3;

5. The method according to anyone of claims 1 to 4, wherein the nucleic acid sequence of the ERG gene comprises

(a) a nucleic acid molecule encoding the polypeptide having the amino acid sequence of SEQ ID: NO 6, 8 or 10;

(b) a nucleic acid molecule having the DNA sequence of SEQ ID: NO 5, 7 or 9;

6. The method of anyone of claims 1 to 5, wherein the expression of an EAG gene and/or the expression of an ERG gene in a sample is determined on mRNA level or on protein level and/or the activity of said gene products is determined on an electrophysiological level .

7. The method according to claim 6, wherein the expression of an EAG gene and/or the expression of an ERG gene in a sample on an mRNA level is determined by RT-PCR, cDNA array or Northern Blot analysis.

8. The method according to claim 7, wherein for the analysis of the expression of an EAG gene by RT-PCR a pair of sense and antisense primers is used selected from the sense primers having a nucleic acid sequence as shown in SEQ ID NO: 11 or 13 and from the antisense primers having a nucleic acid sequence as shown in SEQ ID NO: 12 or 14.

9. The method according to claim 6, wherein the detection of the translated protein of said EAG gene and/or ERG gene is effected by immuno- blotting/Western blot analysis, immunohistochemical analysis, ELISA analysis, immunofluoresce analysis, FACS analysis or antibody array analysis.

10. The method according to claim 6, wherein the activity of an EAG gene product and/or an ERG gene product in a sample on electrophysiological level is determined by patch clamp analysis.

11. The method of anyone of claims 1 to 10, wherein said sample is a tissue culture of a tissue sample derived by biopsy from said subject.

12. The method of anyone of claims 1 to 11 , wherein said viral infection, inflammatory disease, proliferative disorder or hyperplasia is a gynecological disease.

13. The method of anyone of claims 1 to 12, wherein said proliferative disorder is cancer.

14. The method according to claim 13, wherein said cancer is cervical cancer.

15. The method of anyone of claims 1 to 12, wherein said hyperplasia is adenomatous hyperplasia or prostate hyperplasia.

16. The method of anyone of claims 1 to 12, wherein said viral infection is an infection with Human Papilloma Virus or Hepatitis C Virus (HCV).

17. The method of anyone of claims 1 to 11 , wherein said inflammatory disease is a pancreatitis or a hepatitis.