WO2006032707A2 - Plant cells and plants with increased tolerance to environmental stress - Google Patents
Plant cells and plants with increased tolerance to environmental stress Download PDFInfo
- Publication number
- WO2006032707A2 WO2006032707A2 PCT/EP2005/055023 EP2005055023W WO2006032707A2 WO 2006032707 A2 WO2006032707 A2 WO 2006032707A2 EP 2005055023 W EP2005055023 W EP 2005055023W WO 2006032707 A2 WO2006032707 A2 WO 2006032707A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- plant
- seq
- acid molecule
- basf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/16—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from plants
Definitions
- This invention relates generally to transformed plant cells and plants comprising an inactivated or down-regulated gene resulting in increased tolerance and/or resistance to environmental stress as compared to non-transformed wild type cells and methods of producing such plant cells or plants.
- This invention further relates generally to transformed plant cells with increased tolerance and/or resistance to environmental stress as compared to a corresponding non-transformed wild type plant cell, wherein the increased tolerance and/or resistance to environmental stress as compared to a corresponding non -transformed wild type plant cell is altered by an inactivated or down-regulated gene, methods of producing, screening for and breeding such plant cells or plants and method of detecting stress in plants cells or plants.
- this invention relates to transformed plant cells and plants comprising an inactivated or down-regulated gene resulting in increased tolerance and/or resistance to environmental stress, preferably by altering the metabolic activity, as compared to non-transformed wild type cells and methods of producing such plant cells or plants.
- Abiotic environmental stress such as drought stress, salinity stress, heat stress, and cold stress, is a major limiting factor of plant growth and productivity (Boyer. 1982. Science 218, 443-448). Crop losses and crop yield losses of major crops such as rice, maize (corn) and wheat caused by these stresses represent a significant economic and political factor and contribute to food shortages in many underdeveloped and third- world countries.
- Drought, heat, cold and salt stress have a common theme important for plant growth and that is water availability. Plants are exposed during their entire life cycle to conditions of reduced environmental water content. Most plants have evolved strategies to protect themselves against lack of water. However, if the severity and duration of the drought conditions are too great, the effects on plant development, growth and yield of most crop plants are profound. Since high salt content in some soils result in less available water for cell intake, its effect is similar to those observed under drought conditions. Likewise, under freezing temperatures, plant cells loose water as a result of ice formation that starts in the apoplast and withdraws water from the symplast (McKersie and Leshem, 1994. Stress and Stress Coping in Cultivated Plants, Kluwer Academic Publishers).
- Transgenic plants that overproduce osmolytes such as mannitol, fructans, proline or glycine-betaine also show increased resistance to some forms of abiotic stress and it is proposed that the synthesized osmolytes act as ROS scavengers (Tarczynski. et al. 1993 Science 259, 508-510; Sheveleva,. et al. 1997. Plant Physiol.115, 1211-1219).
- the present invention provides a transformed plant cell, preferably with altered metabolic activity compared to a corresponding non transformed wild type plant cell, wherein the increased tolerance and/or resistance to an environmental stress as compared to a corresponding non-transformed wild type plant cell is altered by an inactivated or down-regulated gene.
- the present invention provides a transformed plant cell with increased tolerance and/or resistance to an environmental stress as compared to a corresponding non- transformed wild type plant cell, wherein the increased tolerance and/or resistance to an environmental stress is altered by an inactivated or down-regulated gene.
- the term "inactivated or down-regulated gene” means the transgenic reduction or deletion of the expression of nucleic acid of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79 and/or 81 and/or 95, 97, 99, 101, 103, 105, 107, 109, 111 , 113, 115, 117, 119, 121, 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171 , 173, 175, 177, 179, 181, 183, 185,
- the reduction or deletion of the expression of said nucleic acid results in increased tolerance to an environmental stress as compared to a corresponding non-transformed wild type plant cell.
- the environmental stress is selected from the group consisting of salinity, drought, temperature, metal, chemical, pathogenic and oxidative stresses, or combinations thereof, preferably drought and/or temperature.
- expression refers to the transcription and/or translation of a codogenic gene segment or gene.
- the resulting product is an mRNA or a protein.
- expression products can also include functional RNAs such as, for example, antisense, nucleic acids, tRNAs, snRNAs, rRNAs, RNAi, siRNA, ribozymes etc.
- Expression may be systemic.local or temporal, for example limited to certain cell types, tissuesorgans or time periods.
- sequence may relate to polynucleotides, nucleic acids, nucleic acid molecules, peptides, polypeptides and proteins, depending on the context in which the term “sequence” is used.
- nucleic acid molecule(s) refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. The terms refer only to the primary structure of the molecule.
- the terms "gene(s)”, “polynucleotide”, “nucleic acid sequence”, “nucleotide sequence”, or “nucleic acid molecule(s)” as used herein include double- and single- stranded DNA and RNA. They also include known types of modifications, for example, methylation, "caps", substitutions of one or more of the naturally occurring nucleotides with an analog.
- the DNA or RNA sequence of the invention comprises a coding sequence encoding the herein defined polypeptide.
- a "coding sequence” is a nucleotide sequence, which is transcribed into mRNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'- terminus.
- a coding sequence can include, but is not limited to mRNA, cDNA, BASF/PF 56031 PCT 6
- the overall activity in the volume is reduced, decreased or deleted in cases if the reduction, decrease or deletion is related to the reduction, decrease or deletion of an activity of a gene product, independent whether the amount of gene product or the specific activity of the gene product or both is reduced, decreased or deleted or whether the amount, stability or translation efficacy of the nucleic acid sequence or gene encoding for the gene product is reduced, decreased or deleted.
- reduction include the change of said property in only parts of the subject of the present invention, for example, the modification can be found in compartment of a cell, like an organelle, or in a part of a plant, like tissue, seed, root, leave, flower etc. but is not detectable if the overall subject, i.e. complete cell or plant, is tested.
- the "reduction”, “decrease” or “deletion” is found cellular, thus the term “reduction, decrease or deletion of an acitivity” or “reduction, decrease or deletion of a metabolite content” relates to the cellular reduction, decrease or deletion compared to the wild typ cell.
- the terms “reduction”, “decrease” or “deletion” include the change of said property only during different growth phases of the organism used in the inventive process, for example the reduction, decrease or deletion takes place only during the seed growth or during blooming. Furtheremore the terms include a transitional reduction, decrease or deletion for example because the used RNAi is not stable integrated in the genom of the organism and has therefore only a transient effect.
- the term “reduction”, “decrease” or “deletion” means that the specific activity of an enzyme or other protein or regulatory RNA as well as the amount of a compound or metabolite, e.g. of a polypeptide, a nucleic acid molelcule or the fine chemical of the invention or an encoding mRNA or DNA, can be reduced, decreased or deleted in a volume.
- a compound or metabolite e.g. of a polypeptide, a nucleic acid molelcule or the fine chemical of the invention or an encoding mRNA or DNA
- wild type can be a cell or a part of organisms such as an organelle or tissue, or an organism, in particular a microorganism or a plant, which was not modified or treated according to the herein described process according to the invention.
- the cell or a part of organisms such as an organelle or a tissue, or an organism, in particular a microorganism or a plant used as wild type, control or reference corresponds to the cell, organism or part thereof as much as possible and is in any other property but in the result of the process of the invention as identical to the subject matter of the invention as possible.
- the wild type, control or reference is treated identically or as identical as possible, saying that only conditions or properties might be different which do not influence the quality of the tested property.
- analogous conditions means that all conditions such as, for example, culture or growing conditions, assay conditions (such as buffer composition, temperature, substrates, pathogen strain, concentrations and the like) are kept identical between the experiments to be compared.
- the "reference”, "control”, or “wild type” is preferably a subject, e.g. an organelle, a cell, a tissue, an organism, in particular a plant or a microorganism, which was not modified or treated according to the herein described process of the invention and is in any other property as similar to the subject matter of the invention as possible.
- the reference, control or wild type is in its genome, transcriptome, proteome or metabolome as similar as possible to the subject of the present invention.
- the term "reference-" "control-” or “wild type-”-organelle, -cell, -tissue or -organism, in particular plant or microorganism relates to an organelle, cell, tissue or organism, in particular plant or micororganism, which is nearly genetically identical to the organelle, cell, tissue or organism, in particular microorganism or plant, of the present invention or a part thereof preferably 95%, more peferred are 98%, even more preferred are 99,00%, in particular 99,10%, 99,30%, 99,50%, 99,70%, 99,90%, 99,99%, 99, 999% or more.
- the "reference”, “control”, or “wild type” is preferably a subject, e.g. an organelle, a cell, a tissue, an organism, which is genetically identical to the organism, cell organelle used according to the process of the invention except that nucleic acid molecules or the gene product encoded by them are changed according to the inventive process.
- the reference, control or wild type differs form the subject of the present invention only in the cellular activity of the polypeptide or RNA of the invention, e.g. as result of a reduction, decrease or deletion in the level of the nucleic acid BASF/PF 56031 PCT 8
- RNA molecules of the present invention or a reduction, decrease or deletion of the specific activity of the polypeptide or RNA of the invention, e.g. by or in the expression level or activity of protein or RNA that means its biological activity and/or its biochemical or genetical causes.
- expression means the transcription of a gene into structural RNA
- rRNA rRNA, tRNA, miRNA
- mRNA messenger RNA
- expression can be detected by e.g. Northern, qRT PCR, transcriptional run-on assays or Western blotting and other immuno assays.
- decrease or deletion of the expression that means as consequence of the reduced, decreased or deleted transcription of a gene a related phenotypic trait appears such as the enhanced or increased stress tolerance.
- preferred reference subject is the starting subject of the present process of the invention.
- the reference and the subject matter of the invention are compared after standardization and normalization, e.g. to the amount of total RNA, DNA, or Protein or activity or expression of reference genes, like housekeeping genes, such as ubiquitin.
- the molecule number or the specific activity of the polypeptide of the invention or the number of expression of the nucleic acid molecule of the invention may be reduced, decreased or deleted.
- it is also possible to reduce, decrease or delete the expression of the gene which is naturally present in the organisms for example by modifying the regulation of the gene, or by reducing or decreasing the stability of the mRNA or of the gene product encoded by the nucleic acid molecule of the invention.
- This also applies analogously to the combined reduction, decrease or deletion of the expression of the nucleic acid molecule of the present invention or its gene product together with the manipulation of further acitivities such as enzymes wich confer stress tolerance.
- the reduction, decrease, deletion or modulation according to this invention can be constitutive, e.g. due to a stable permanent transgenic expression or to a stable mutation in the corresponding endogenous gene encoding the nucleic acid molecule of the invention or to a modulation of the expression or of the behaviour of a gene conferring the expression of the polypeptide of the invention, or transient, e.g. due to an transient transformation, a transiently active promotor or temporary addition of a modulator such as an antagonist or inductor, e.g. after transformation with a inducible construct carrying a double-stranded RNA nucleic acid molecule, an antisense nucleic BASF/PF 56031 PCT 9
- a ribozyme of the invention under control of a inducible promoter and adding the inducer, e.g. tetracycline or as described herein below.
- the reduction, decrease or deletion in activity amounts preferably by at least 10%, preferably by at least 30% or at least 60%, especially preferably by at least 70%, 80%, 85%, 90% or more, very especially preferably are at least 95%, more preferably are at least 99% or more in comparison to the control, reference or wild type. Most preferably the reduction, decrease or deletion in activity amounts to 100%.
- inactivation means that the enzymatic or biological activity of the polypeptides encoded is no longer detectable in the organism or in the cell such as, for example, within the plant or plant cell.
- downregulation means that the enzymatic or biological activity of the polypeptides encoded is partly or essentially completely reduced in comparison with the activity of the untreated organism. This can be achieved by different cell-biological mechanisms.
- the activity can be downregulated in the entire organism or, in the case of multi-celled organisms, in individual parts of the organism, in the case of plants for example in tissues such as the seed, the leaf, the root or other parts.
- the enzymatic activity or biological activity is reduced by at least 10%, advantageously at least 20%, preferably at least 30%, especially preferably at least 40%, 50% or 60%, very especially preferably at least 70%, 80%, 85% or 90% or more, very especially preferably are at least 95%, more preferably are at least 99% or more in comparison to the control, reference or wild type. Most preferably the reduction, decrease or deletion in activity amounts to 100%.
- biological activity means the biological function of the protein of the invention.
- activity means the increase in the production of the compound produced by the inventive process.
- biological activity preferably refers to the enzymatic function, transporter carrier function, DNA-packaging function, heat shock protein function, recombination protein function, beta-galactosidase function, Serine/threonine-protein kinase CTR1 function, lipase function, enoyl-CoA hydratase function, UDP-glucose glucosyltransferase function, cell division protein function, flavonol synthase function, tracylglycerol lipase, MADS-box protein function, pectinesterase function, pectin metylesterase function, BASF/PF 56031 PCT 10
- Suitable substrates are low-molecular-weight compounds and also the protein interaction partners of a protein.
- reduction of the biological function refers, for example, to the quantitative reduction in binding capacity or binding strength of a protein for at least one substrate in an organism, a tissue, a cell or a cell compartment - for example by one of the methods described herein below - in comparison with the wild type of the same genus and species to which this method has not been applied, under otherwise identical conditions (such as, for example, culture conditions, age of the plants and the like).
- Reduction is also understood as meaning the modification of the substrate specificity as can be expressed for example, by the kcat/Km value.
- a reduction of the function of at least 10%, advantageously of at least 20%, preferably at least 30%, especially preferably of at least 40%, 50% or 60%, very especially preferably of at least 70%, 80%, 90% or 95%, in comparison with the untreated organism is advantageous.
- a particularly advantageous embodiment is the inactivation of the function. Binding partners for the protein can be identified in the manner with which the skilled worker is familiar, for example by the yeast 2-hybrid system.
- a modification i.e. a decrease
- a decrease in activity in an organism or a part thereof can be caused by adding a chemical compound such as an antagonist to the media, nutrition, soil of the plants or to the plants themselves.
- the transformed plant cells are compared to the corresponding non- transformed wild type of the same genus and species under otherwise identical conditions (such as, for example, culture conditions, age of the plants and the like).
- a change of at least 10%, advantageously of at least 20%, preferably at least 30%, especially preferably of at least 40%, 50% or 60%, very especially preferably of at least 70%, 80%, 90%, 95% or even 100% or more, in comparison with the non-transformed organism is advantageous.
- inactivation or down-regulation of a gene in the plant cell results in altered metabolic activity as compared to a corresponding non-transformed wild type plant cell.
- One preferred wild type plant cell is a non -transformed Arabidopsis plant cell.
- An example here is the Arabidopsis wild type C24 (Nottingham Arabidopsis Stock Centre, UK; NASC Stock N906).
- Other preferred wild type plant cells are a non-transformed from plants selected from the group consisting of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, SaNx species, oil palm, coconut, perennial grass and forage crops.
- More preferred wild type plant cells are a non-transformed Linum plant cell, preferably Linum usitatissimum, more preferably the variety Brigitta, Golda, Gold Merchant, HeIIe, JuNeI, Olpina, Livia, Marlin, Maedgold, Sporpion, Serenade, Linus, Taunus, Lifax or Liviola, a non-transformed Heliantus plant cell, preferably Heliantus annuus, more preferably the variety Aurasol, Capella, Flavia, Flores, jazzy, PaIuIo, Pegasol, PIR64A54, Rigasol, Sariuca, Sideral, Sunny, Alenka, Candisol or Floyd, or a non-transformed Brassica plant cell, preferably Brassica napus, more preferably the variety Dorothy, Evita, Heros, Hyola, Kimbar, Lambada, Licolly, Liconira, Licosmos, Lisonne, Mistral, Passat, Serator, Siapula,
- the inactivated or down-regulated gene or genes directly or indirectly influence the stress tolerance of plants, preferably the metabolic activity of the transformed plant cells.
- Stress tolelance may be confered by one or more inactivated or down-regulated genes encoded by one or more nucleic acid sequences selected from the group consisting of a) nucleic acid molecule encoding on of the polypeptides shown in SEQ ID NO:
- nucleic acid molecule comprising a nucleic acid sequence, which, as a result of the degeneracy of the genetic code, can be derived from a polypeptide sequence depicted in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or
- nucleic acid molecule encoding a polypeptide having at least 50% identity with the amino acid sequence of the polypeptide encoded by the nucleic acid molecule of (a) to (c) and having the biological activity represented by protein according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82 and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114,
- nucleic acid molecule encoding a polypeptide which is isolated with the aid of monoclonal antibodies against a polypeptide encoded by one of the nucleic acid molecules of (a) to (d) and having the biological activity represented by the protein according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82; e) nucleic acid molecule which is obtainable by screening a suitable nucleic acid library under
- nucleic acid sequence selected from the group consisting of sequences according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81 and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171 , 173, 175, 177, 179, 181, 183, 185, 187, 189,
- SEQ ID NO: 1 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81; and/or
- Screening is well known to those skilled in the art and generally refers to the search for a particular attribute or trait.
- this trait in a plant or plant cell is preferably the concentration of a metabolite or estimate the general appearance.
- the methods and devices for screening are familiar to those skilled in the art and include GC (gas chromatography), LC (liquid chromatography), HPLC (high performance (pressure) liquid chromatography), MS (mass spectrometry), NMR (nuclear magnetic resonance) spectroscopy, IR (infra red) spectroscopy, photometric methods etc and combinations of these methods.
- Breeding is also customary knowledge for those skilled in the art. It is understood as the directed and stable incorporation of a particular attribute or trait into a plant or plant cell.
- the various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants.
- Different breeding measures can be taken, depending on the desired properties. All the techniques are well known by a person skilled in the art and include for example, but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
- Hybridization techniques also can include the sterilization of plants to yield male or female sterile plants by mechanical, chemical, or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly BASF/PF 56031 PCT 20
- transgenic seeds and plants according to the invention can therefor be used for the breeding of improved plant lines, which can increase the effectiveness of conventional methods such as herbicide or pesticide treatment or which allow one to dispense with said methods due to their modified genetic properties.
- new crops with improved stress tolerance preferably drought and temperature, can be obtained, which, due to their optimized genetic "equipment", yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions.
- Environmental stress includes but is not limited to salinity, drought, temperature, metal, chemical, pathogenic and oxidative stress, or combinations thereof, preferably drought and/or temperature.
- environmental stress refers to any sub-optimal growing condition and includes, but is not limited to, sub-optimal conditions associated with salinity, drought, temperature, metal, chemical, pathogenic and oxidative stresses, or combinations thereof.
- environmental stress may be salinity, drought, heat, or low temperature, or combinations thereof, and in particular, may be low water content or low temperature.
- drought stress means any environmental stress which leads to a lack of water in plants or reduction of water supply to plants, wherein low temperature stress means freezing of plants below + 4 0 C as well as chilling of plants below 15 0 C and wherein high temperature stress means for example a temperature above 35 0 C.
- the plant is selected from the group comprised of maize, wheat, rye, o
- the transformed plant cell may be derived from a monocotyledonous or a dicotyledonous plant.
- the monocotyledonous or a dicotyledonous plant may be selected from the group comprised of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, SaNx species, oil palm, coconut, perennial grass, forage crops and Arabidopsis thaliana, preferably Brassica napus, Glycine max, Zea mays or Oryza sativa.
- the transformed plant cell may be derived from a gymnosperm plant and can preferably be selected from the group of spruce, pine and fir.
- the invention also provides a transformed plant generated from said plant cell and which is a monocot or dicot plant.
- BASF/PF 56031 PCT 22 is a transformed plant generated from said plant cell and which is a monocot or dicot plant.
- the transformed plant may be selected from the group comprised of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, SaNx species, oil palm, coconut, perennial grass, forage crops and Arabidopsis thaliana, preferably Brassica napus, Glycine max, Zea mays or Oryza sativa.
- the transformed plant generated from said plant cell is a gymnosperm plant, more preferred a plant selected from the group consisting of spruce, pine and fir.
- the invention not only deals with plants but also with an agricultural product produced by any of the described transformed plants, plant parts such as leafs, petal, anther, roots, tubers, stems, buds, flowers or especially seeds produced by said transformed plant, which are at least genetically heterozygous, preferably homozygous for a gene or its homolog, that when inactivated or down -regulated confers an increased tolerance and/or resistance to environmental stress as compared to a wild type plant.
- Homologs of the aforementioned sequences can be isolated advantageously from yeast, fungi, viruses, algae bacteria, such as Acetobacter (subgen. Acetobacter) aceti; Acidithiobacillus ferrooxidans; Acinetobacter sp.; Actinobacillus sp; Aeromonas salmonicida; Agrobacterium tumefaciens; Aquifex aeolicus; Arcanobacterium pyogenes; Aster yellows phytoplasma; Bacillus sp.; Bifidobacterium sp.; Borrelia burgdorferi; Brevibacterium linens; Brucella melitensis; Buchnera sp.; Butyrivibrio fibrisolvens; Campylobacter jejuni; Caulobacter crescentus; Chlamydia sp.; Chlamydophila sp.; Chlorobium limicola; Citrobacter rodentium; Clos
- PCC 6803 Thermotoga maritima; Treponema sp.; Ureaplasma urealyticum; Vibrio cholerae; Vibrio parahaemolyticus; XyIeIIa fastidiosa; Yersinia sp.; Zymomonas mobilis, preferably Salmonella sp.
- yeasts such as from the genera Saccharomyces, Pichia, Candida, Hansenula, Torulopsis or Schizosaccharomyces, or even more preferred from plants such as Arabidopsis thaliana, maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, borage, safflower, linseed, primrose, rapeseed, canola and turnip rape, manihot, pepper, sunflower, tagetes, solanaceous plant such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa, bushy plants such as coffee, cacao, tea, SaNx species, trees such as oil palm, coconut, perennial grass, such as ryegrass and fescue, and forage crops, such as alfalfa and clover and from spruce, pine or fir for example, more preferably from Saccharomyces cerevisiae or
- Homologs are defined herein as two nucleic acids or proteins that have similar, or “homologous", nucleotide or amino acid sequences, respectively. Homologs include allelic variants, orthologs, paralogs, agonists and antagonists of SRP as defined hereafter.
- a "naturally occurring" SRP refers to a SRP amino acid sequence that occurs in nature.
- the term "homology” means that the respective nucleic acid molecules or encoded proteins are functionally and/or structurally equivalent.
- the nucleic acid molecules that are homologous to the nucleic acid molecules described above and that are derivatives of said nucleic acid molecules are, for example, variations of said nucleic acid molecules which represent modifications having the same biological function, in particular encoding proteins with the same or substantially the same biological function. They may be naturally occurring variations, such as sequences from other plant varieties or species, or mutations. These mutations may occur naturally or may be obtained by mutagenesis techniques.
- the allelic variations may be BASF/PF 56031 PCT 24
- Structurally equivalents can, for example, be identified by testing the binding of said polypeptide to antibodies or computer based predictions. Structurally equivalent have the similar immunological characteristic, e.g. comprise similar epitopes.
- acitivty e.g conferring an increase in the fine chemical amount while increasing the amount of protein, activity or function of said functional equivalent in an organism, e.g. a microorgansim, a plant or plant or animal tissue, plant or animal cells or a part of the same.
- hybridizing it is meant that such nucleic acid molecules hybridize under conventional hybridization conditions, preferably under stringent conditions such as described by, e.g., Sambrook (Molecular Cloning; A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)) or in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1-6.3.6.
- DNA as well as RNA molecules of the nucleic acid of the invention can be used as probes. Further, as template for the identification of BASF/PF 56031 PCT 25
- Northern blot assays as well as Southern blot assays can be performed.
- the Northern blot assay advantageously provides further informations about the expressed gene product: e.g. expression pattern, occurance of processing steps, like splicing and capping, etc.
- the Southern blot assay provides additional information about the chromosomal localization and organization of the gene encoding the nucleic acid molecule of the invention.
- SSC sodium chloride/sodium citrate
- 0.1% SDS 0.1% SDS at 50 to 65°C, for example at 50 0 C, 55°C or 60 0 C.
- these hybridization conditions differ as a function of the type of the nucleic acid and, for example when organic solvents are present, with regard to the temperature and concentration of the buffer.
- the temperature under "standard hybridization conditions” differs for example as a function of the type of the nucleic acid between 42°C and 58°C, preferably between 45°C and 50 0 C in an aqueous buffer with a concentration of 0.1 x 0.5 x, 1 x, 2x, 3x, 4x or 5 x SSC (pH 7.2). If organic solvent(s) is/are present in the abovementioned buffer, for example 50% formamide, the temperature under standard conditions is approximately 40 0 C, 42°C or 45°C.
- the hybridization conditions for DNA:DNA hybrids are preferably for example 0.1 x SSC and 20 0 C, 25°C, 30°C, 35°C, 40 0 C or 45°C, preferably between 30 0 C and 45°C.
- the hybridization conditions for DNA:RNA hybrids are preferably for example 0.1 x SSC and 30°C, 35°C, 40 0 C, 45°C, 50 0 C or 55°C, preferably between 45°C and 55°C.
- a further example of one such stringent hybridization condition is hybridization at 4XSSC at 65°C, followed by a washing in 0.1 XSSC at 65°C for one hour.
- an exemplary stringent hybridization condition is in 50 % formamide, 4XSSC at 42°C.
- the conditions during the wash step can be selected from the range of conditions delimited by low-stringency conditions (approximately 2X SSC at 50 0 C) and high-stringency conditions (approximately 0.2X SSC at 50 0 C, preferably at BASF/PF 56031 PCT 26
- the temperature during the wash step can be raised from low-stringency conditions at room temperature, approximately 22°C, to higher-stringency conditions at approximately 65°C.
- Both of the parameters salt concentration and temperature can be varied simultaneously, or else one of the two parameters can be kept constant while only the other is varied.
- Denaturants for example formamide or SDS, may also be employed during the hybridization. In the presence of 50% formamide, hybridization is preferably effected at 42°C. Relevant factors like i) length of treatment, ii) salt conditions, iii) detergent conditions, iv) competitor DNAs, v) temperature and vi) probe selection can be combined case by case so that not all possibilities can be mentioned herein.
- Northern blots are prehybridized with Rothi- Hybri-Quick buffer (Roth, Düsseldorf) at 68°C for 2h.
- Hybridzation with radioactive labelled probe is done overnight at 68°C.
- Subsequent washing steps are performed at 68°C with IxSSC.
- the membrane is prehybridized with Rothi-Hybri-Quick buffer (Roth, Düsseldorf) at 68°C for 2h.
- the hybridzation with radioactive labelled probe is conducted over night at 68°C. Subsequently the hybridization buffer is discarded and the filter shortly washed using 2xSSC; 0,1% SDS.
- Hybridization conditions can be selected, for example, from the following conditions: a) 4X SSC at 65°C, b) 6X SSC at 45°C, c) 6X SSC, 100 mg/ml denatured fragmented fish sperm DNA at 68°C, d) 6X SSC, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA at 68°C, e) 6X SSC, 0.5% SDS, 100 mg/ml denatured fragmented salmon sperm
- DNA 50% formamide at 42°C, f) 50% formamide, 4X SSC at 42°C, g) 50% (vol/vol) formamide, 0.1 % bovine serum albumin, 0.1 % Ficoll, 0.1 % polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42°C, BASF/PF 56031 PCT 27
- wash steps can be selected, for example, from the following conditions: a) 0.015 M NaCI/0.0015 M sodium citrate/0.1% SDS at 50 0 C. b) 0.1X SSC at 65°C. c) 0.1 X SSC, 0.5 % SDS at 68°C. d) 0.1 X SSC, 0.5% SDS, 50% formamide at 42°C. e) 0.2X SSC, 0.1 % SDS at 42°C. f) 2X SSC at 65°C (low-stringency condition).
- modification is, by way of example, a substitution, addition, deletion, inversion or insertion of one or more nucleotides.
- Manipulation in the present invention is also meant to encompass all changes in the plant cell, including induced or non-induced (spontaneous) mutagenesis, directed or non-directed genetic manipulation by conventional breeding or by modern genetic manipulation methods, e. g.
- RNA interference double-stranded RNA interference
- Natural genetic environment means the natural chromosomal locus in the organism of origin or the presence in a genomic library.
- the natural, genetic environment of the nucleic acid sequence is preferably at least partially still preserved.
- the environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, particularly preferably at least 1000 bp, very particularly preferably at least 5000 bp.
- a plant or plant cell is considered "true breeding" for a particular attribute if it is genetically homozygous for that attribute to the extent that, when the true-breeding plant is self-pollinated, a significant amount of independent segregation of the attribute among the progeny is not observed.
- nucleic acid and “nucleic acid molecule” are intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. This term also encompasses untranslated sequence located at both the 3' and 5' ends of the coding region of the gene: at least about 1000 nucleotides of sequence upstream from the 5' end of the coding region and at least about 200 nucleotides of sequence downstream from the 3' end of the coding region of the gene.
- the nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.
- an "isolated" nucleic acid molecule is one that is substantially separated from other nucleic acid molecules, which are present in the natural source of the nucleic acid. That means other nucleic acid molecules are present in an amount less than 5% based on weight of the amount of the desired nucleic acid, preferably less than 2% by weight, more preferably less than 1 % by weight, most preferably less than 0.5% by weight.
- an "isolated" nucleic acid is free of some of the sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated gene encoding nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- an "isolated" nucleic acid molecule such as a cDNA molecule, can be free from some of the other cellular material with which it is naturally associated, or culture medium when produced by BASF/PF 56031 PCT 29
- a nucleic acid molecule of the present invention e.g., a nucleic acid molecule encoding a gene or a portion thereof or a homolog thereof which confers tolerance and/or resistance to environmental stress in plants, when inactivated or down- regulated, can be isolated using standard molecular biology techniques and the sequence information provided herein.
- mRNA can be isolated from plant cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al., 1979 Biochemistry 18:5294-5299) and cDNA can be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Russia, FL).
- reverse transcriptase e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Russia, FL.
- a nucleic acid molecule of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
- the nucleic acid molecule so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
- oligonucleotides corresponding to a gene encoding nucleotide sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
- Portions of genes or proteins encoded by said gene encoding nucleic acid molecules of the invention are preferably biologically active portions of genes or proteins described BASF/PF 56031 PCT 30
- biologically active portion of a gene or protein encoded by said gene is intended to include a portion, e.g., a domain/motif, of the gene or protein that participates in stress tolerance and/or resistance response in a plant, which is preferably achieved by altering metabolic activity, and finally resulting in increased tolerance and/or resistance to environmental stress.
- a stress analysis of a plant comprising the protein may be performed for example by the above screening method or by estimating the general appearance and health.
- conserved regions from various organisms by carrying out protein sequence alignments with the polypeptide used in the process of the invention, in particular with sequences of the polypeptide of the invention, from which conserved regions, and in turn, degenerate primers can be derived.
- conserved region for the polypeptide of the invention are indicated in the alignments shown in the figures. conserveed regions are those, which show a very little variation in the amino acid in one particular position of several homologs from different origin.
- Prefered portions according to the present invention e.g., peptides or proteins which are, for example, 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in length
- biologically active portions in which other regions of the protein are deleted can be prepared by recombinant techniques and evaluated for one or more of the activities described herein.
- the biologically active portions of the protein include one or more selected domains/motifs or portions thereof having biological activity.
- the present invention especially includes homologs and analogs of naturally occurring proteins and protein encoding nucleic acids in a plant.
- Homologs are defined herein as two nucleic acids or proteins that have similar, or “homologous", nucleotide or amino acid sequences, respectively. Homologs include allelic variants, orthologs, paralogs, agonists and antagonists of the protein as defined hereafter.
- a "naturally occurring” refers to an amino acid sequence that occurs in nature.
- homologs and analogs of naturally occurring proteins and protein encoding nucleic acids of the invenion in a plant are defined herein as two nucleic acids or polypeptides that have similar, or substantially identical, nucleotide or amino acid sequences, respectively. Homologs include allelic variants, orthologs, paralogs, agonists and antagonists of SRPs as defined hereafter.
- a "naturally occurring" protein refers to amino acid sequence that occurs in nature.
- An agonist of the protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress can retain substantially the same, or a subset, of the biological activities of the said protein.
- An antagonist of the said protein can inhibit one or more of the activities of the naturally occurring form of the protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress.
- an antagonist can competitively bind to a downstream or upstream member of the cell membrane component metabolic cascade that includes said protein, or bind to the protein of the invention that mediates transport BASF/PF 56031 PCT 32
- Nucleic acid molecules corresponding to natural allelic variants and analogs, orthologs and paralogs of a protein of the invention cDNA can be isolated based on their identity to the Arabidopsis thaliana, Saccharomyces cerevisiae, E.coli, , preferably Brassica napus, Glycine max, Zea mays or Oryza sativa protein nucleic acids described herein using said proteins cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
- homologs of the protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of said protein for their agonist or antagonist activity.
- a variegated library of protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
- a variegated library of SRP variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential SRP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion polypeptides (e.g., for phage display) containing the set of protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress sequences therein.
- a set of larger fusion polypeptides e.g., for phage display
- Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene is then ligated into an appropriate expression vector.
- Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential protein of the invention sequences.
- Methods for synthesizing degenerate oligonucleotides are known in the art. See, e.g., Narang, S.A., 1983, Tetrahedron 39:3; ltakura et al., 1984, Annu. Rev. Biochem. 53:323; ltakura et al., 1984, Science 198:1056; Ike et al., 1983, Nucleic Acid Res. 11:477.
- libraries of fragments of the protein of the invention coding regions can be used to generate a variegated population of protein fragments for screening and subsequent selection of homologs of a said proteins.
- a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of a protein of the invention coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double BASF/PF 56031 PCT 33
- an expression library can be derived which encodes N-terminal, C-terminal, and internal fragments of various sizes of the protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress.
- Recursive ensemble mutagenesis (REM), a new technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify SRP homologs (Arkin and Yourvan, 1992, PNAS 89:7811 -7815; Delgrave et al., 1993, Polypeptide Engineering 6(3):327-331).
- cell based assays can be exploited to analyze a variegated protein (of the invention) library, using methods well known in the art.
- the present invention further provides a method of identifying a novel protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress, comprising (a) raising a specific antibody response to said protein, or a fragment thereof, as described herein; (b) screening putative SRP material with the antibody, wherein specific binding of the antibody to the material indicates the presence of a potentially novel protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress; and (c) analyzing the bound material in comparison to known proteins, to determine its novelty.
- the present invention includes protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress and homologs thereof.
- sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of one polypeptide BASF/PF 56031 PCT 34
- amino acid residues at corresponding amino acid positions are then compared.
- the molecules are identical at that position.
- the same type of comparison can be made between two nucleic acid sequences.
- the preferable length of sequence comparison for nucleic acids is at least 75 nucleotides, more preferably at least 100 nucleotides and most preferably the entire length of the coding region. It is further preferred that the isolated nucleic acid homolog of the invention encodes a SRP, or portion thereof, that is at least 85% identical to an amino acid BASF/PF 56031 PCT 35
- the percent sequence identity between two nucleic acid or polypeptide sequences may be determined using the Vector NTI 6.0 (PC) software package (InforMax, 7600 Wisconsin Ave., Bethesda, MD 20814). A gap opening penalty of 15 and a gap extension penalty of 6.66 are used for determining the percent identity of two nucleic acids.
- a gap opening penalty of 10 and a gap extension penalty of 0.1 are used for determining the percent identity of two polypeptides. All other parameters are set at the default settings. For purposes of a multiple alignment (Clustal W algorithm), the gap opening penalty is 10, and the gap extension penalty is 0.05 with blosum62 matrix. It is to be understood that for the purposes of determining sequence identity when comparing a DNA sequence to an RNA sequence, a thymidine nucleotide is equivalent to a uracil nucleotide.
- overexpression of the isolated nucleic acid homolog in a plant increases a plant's tolerance to an environmental stress.
- stringent conditions refers in one embodiment to hybridization overnight at 60°C in 10X Denharts solution, 6X SSC, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA. Blots are washed sequentially at 62°C for 30 minutes each time in 3X SSC/0.1 % SDS, followed by 1X SSC/0.1 % SDS and finally 0.1 X SSC/0.1 % SDS.
- highly stringent conditions refers to hybridization overnight at 65°C in 10X Denharts solution, 6X SSC, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA. Blots are washed sequentially at 65°C for 30 minutes each time in 3X SSC/0.1 % SDS, BASF/PF 56031 PCT 36
- a "naturally occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural polypeptide).
- the nucleic acid encodes a naturally occurring Arabidopsis thaliana, Brassica napus, Glycine max, Zea mays or Oryza sativa protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress.
- allelic variants refers to a nucleotide sequence containing polymorphisms that lead to changes in the amino acid sequences of said protein and that exist within a natural population (e.g., a plant species or variety). Such natural allelic variations can typically result in 1 -5% variance in a nucleic acid of the invention.
- Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different plants, which can be readily carried out by using hybridization probes to identify the same SRP genetic locus in those plants. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations in a protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress that are the result of natural allelic variation and that do not alter the functional activity of said protein, are intended to be within the scope of the invention.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g.
- a predicted nonessential amino acid residue in a protein of the invention is preferably replaced with another amino acid residue from the same side chain family.
- mutations can be introduced randomly along all or part of a protein of the invention coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for a SRP activity described herein to identify mutants that retain protein activity.
- the encoded polypeptide can be expressed recombinantly and the activity of the polypeptide can be determined by analyzing the stress tolerance of a plant expressing the polypeptide as described herein.
- nucleic acid molecules encoding the protein whose reduction or deletion results in increased tolerance and/or resistance to an environmental stress described above another aspect of the invention pertains to isolated nucleic acid molecules that are antisense thereto.
- Antisense polynucleotides are thought to inhibit gene expression of a target polynucleotide by specifically binding the target polynucleotide and interfering with transcription, splicing, transport, translation, and/or stability of the target polynucleotide. Methods are described in the prior art for targeting the antisense polynucleotide to the chromosomal DNA, to a primary RNA transcript, or to a processed mRNA.
- the target regions include splice sites, BASF/PF 56031 PCT 38
- antisense refers to a nucleic acid comprising a polynucleotide that is sufficiently complementary to all or a portion of a gene, primary transcript, or processed mRNA, so as to interfere with expression of the endogenous gene.
- “Complementary" polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules, specifically, purines will base pair with pyrimidines to form a combination of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA.
- antisense nucleic acid includes single stranded RNA as well as double-stranded DNA expression cassettes that can be transcribed to produce an antisense RNA.
- the antisense nucleic acid can be complementary to an entire SRP coding strand, or to only a portion thereof.
- an antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding a SRP.
- coding region refers to the region of the nucleotide sequence comprising codons that are translated into amino acid residues.
- the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding a SRP.
- noncoding region refers to 5' and 3' sequences that flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
- the antisense nucleic acid molecule can be complementary to the entire coding region of SRP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of SRP mRNA.
- the antisense oligonucleotide can be complementary to the region surrounding the translation start site of PKSRP mRNA.
- An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
- sequence identity will be at least 70%, more preferably at least 75%, 80%, 85%, 90%, 95%, 98% and most preferably 99%.
- an antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
- an antisense nucleic acid e.g., an antisense oligonucleotide
- an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
- modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-meth
- the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
- the antisense nucleic acid molecule of the invention is an ⁇ -anomeric nucleic acid molecule.
- An ⁇ -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al., 1987, Nucleic
- the antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al., 1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
- the antisense nucleic acid molecules of the invention are typically administered to a cell or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a SRP to thereby inhibit expression of the polypeptide, BASF/PF 56031 PCT 40
- the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
- the antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen.
- the antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong prokaryotic, viral, or eukaryotic (including plant) promoter are preferred.
- ribozymes As an alternative to antisense polynucleotides, ribozymes, sense polynucleotides, or double stranded RNA (dsRNA) can be used to reduce expression of a SRP polypeptide.
- ribozyme is meant a catalytic RNA-based enzyme with ribonuclease activity which is capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which it has a complementary region.
- Ribozymes e.g., hammerhead ribozymes described in Haselhoff and Gerlach, 1988, Nature 334:585-591
- a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a SRP-encoding mRNA.
- SRP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W., 1993, Science 261:1411-1418.
- the ribozyme will contain a portion having at least 7, 8, 9, 10, 12, 14, 16, 18 or 20 nucleotides, and more preferably 7 or 8 nucleotides, that have 100% complementarity to a portion of the target RNA.
- Methods for making ribozymes are known to those skilled in the art. See, e.g., U.S. Patent Nos. 6,025,167; 5,773,260; and 5,496,698.
- dsRNA refers to RNA hybrids comprising two strands of RNA.
- the dsRNAs can be linear or circular in structure.
- dsRNA is specific for a polynucleotide encoding either the polypeptide of BASF/PF 56031 PCT 41
- the hybridizing RNAs may be substantially or completely complementary.
- substantially complementary is meant that when the two hybridizing RNAs are optimally aligned using the BLAST program as described above, the hybridizing portions are at least 95% complementary.
- the dsRNA will be at least 100 base pairs in length.
- the hybridizing RNAs will be of identical length with no over hanging 5' or 3' ends and no gaps.
- dsRNAs having 5' or 3' overhangs of up to 100 nucleotides may be used in the methods of the invention.
- the dsRNA may comprise ribonucleotides or ribonucleotide analogs, such as
- dsRNA polyriboinosinic acid:polyribocytidylic acid is described in U.S. patent 4,283,393.
- Methods for making and using dsRNA are known in the art.
- One method comprises the simultaneous transcription of two complementary DNA strands, either in vivo, or in a single in vitro reaction mixture. See, e.g., U.S. Patent No. 5,795,715.
- dsRNA can be introduced into a plant or plant cell directly by standard transformation procedures.
- dsRNA can be expressed in a plant cell by transcribing two complementary RNAs.
- the sense polynucleotide blocks transcription of the corresponding target gene.
- the sense polynucleotide will have at least 65% sequence identity with the target plant gene or RNA. Preferably, the percent identity is at least 80%, 90%, 95% or more.
- the introduced sense polynucleotide need not be full length relative to the target gene or transcript.
- the regions of identity can comprise introns and and/or exons and untranslated regions.
- the introduced sense polynucleotide may be present in the plant cell BASF/PF 56031 PCT 42
- transiently or may be stably integrated into a plant chromosome or extrachromosomal replicon.
- nucleic acid molecules encoding proteins from the same or other species such as protein analogs, orthologs and paralogs, are intended to be within the scope of the present invention.
- analogs refers to two nucleic acids that have the same or similar function, but that have evolved separately in unrelated organisms.
- orthologs refers to two nucleic acids from different species that have evolved from a common ancestral gene by speciation. Normally, orthologs encode proteins having the same or similar functions.
- paralogs refers to two nucleic acids that are related by duplication within a genome.
- Paralogs usually have different functions, but these functions may be related (Tatusov, R.L. et al. 1997 Science 278(5338):631-637).
- Analogs, orthologs and paralogs of naturally occurring proteins can differ from the naturally occurring proteins by post-translational modifications, by amino acid sequence differences, or by both.
- Post-translational modifications include in vivo and in vitro chemical derivatisation of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation, and such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes.
- orthologs of the invention will generally exhibit at least 30%, more preferably 50%, and most preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity or homology with all or part of a naturally occurring protein amino acid sequence and will exhibit a function similar to a protein.
- the homology ( identity) was calculated over the entire amino acid range.
- the program used was PiIeUp (J. MoI. Evolution., 25 (1987), 351 - 360, Higgens et al., CABIOS, 5 1989: 151 - 153) or the program Gap and BestFit [Needleman and Wunsch (J. MoI. Biol. 48; 443 - 453 (1970) and Smith and Waterman respectively (Adv. Appl. Math. 2; 482 - 489 (1981)] which are part of the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)].
- the invention provides a method of producing a transformed plant, wherein inactivation or down-regulation of a gene in the transformed plant results in increased tolerance and/or resistance to environmental stress as compared to a corresponding non-transformed wild type plant, comprising
- the nucleic acid is at least about 30 %, especially at least 50 % homologous to said sequence (see above).
- the homolog sequence stems form a plant selected from the group comprised of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, SaNx species, oil palm, coconut, perennial grass, forage crops and Arabidopsis thaliana, preferably Brassica napus, Glycine max, Zea mays or Oryza sativa.
- Inactivation or down-regulation of said gene or genes may be achieved by all methods known to one skilled in the art, preferably by double-stranded RNA interference (dsRNAi), introduction of an antisense nucleic acid, a ribozyme, an antisense nucleic acid combined with a ribozyme, a nucleic acid encoding a co- suppressor, a nucleic acid encoding a dominant negative protein, DNA- or protein- binding factors targeting said gene or -RNA or -proteins, RNA degradation inducing BASF/PF 56031 PCT 44
- dsRNAi double-stranded RNA interference
- viral nucleic acids and expression systems systems for inducing a homolog recombination of said genes, mutations in said genes or a combination of the above.
- nucleic acid sequences of the invention or their homologs are isolated nucleic acid sequences which encode polypeptides. These nucleic acids or the polypeptides encoded by them and their biological and enzymatic activity are inactivated or downregulated in the method according to the invention which leads to increased resistance and/or tolerance to environmental stress.
- inactivation means that the enzymatic or biological activity of the polypeptides encoded is no longer detectable in the organism or in the cell such as, for example, within the plant or plant cell.
- downregulation means that the enzymatic or biological activity of the polypeptides encoded is partly or essentially completely reduced in comparison with the activity of the untreated organism. This can be achieved by different cell-biological mechanisms.
- the activity can be downregulated in the entire organism or, in the case of multi-celled organisms, in individual parts of the organism, in the case of plants for example in tissues such as the seed, the leaf, the root or other parts.
- the enzymatic activity or biological activity is reduced by at least 10%, advantageously at least 20%, preferably at least 30%, especially preferably at least 40%, 50% or 60%, very especially preferably at least 70%, 80%, 90% or 95%, 99% or even 100% in comparison with the untreated organism.
- a particularly advantageous embodiment is the inactivation of the nucleic acids or of the polypeptides encoded by them.
- a reduction in the activity or the function is preferably achieved by a reduced expression of a gene encoding an endogenous protein.
- a reduction in the protein quantity, the activity or function can be achieved using the following methods: a) introduction of a double-stranded RNA nucleic acid sequence (dsRNA) or of an expression cassette, or more than one expression cassette, ensuring the expression of the latter; b) introduction of an antisense nucleic acid sequence or of an expression cassette ensuring the expression of the latter.
- dsRNA double-stranded RNA nucleic acid sequence
- RNA sequences are also encompassed.
- introduction of an antisense nucleic acid sequence in combination with a ribozyme or of an expression cassette ensuring the expression of the former d) introduction of sense nucleic acid sequences for inducing cosuppression or of an expression cassette ensuring the expression of the former e) introduction of a nucleic acid sequence encoding dominant-negative protein or of an expression cassette ensuring the expression of the latter f) introduction of DNA-, RNA- or protein -bind ing factors against genes, RNA's or proteins or of an expression cassette ensuring the expression of the latter g) introduction of viral nucleic acid sequences and expression constructs which bring about the degradation of RNA, or of an expression cassette ensuring the expression of the former h) introduction of constructs for inducing homologous recombin
- Each of these methods may bring about a reduction in the expression, the activity or the function for the purposes of the invention. A combined use is also feasible. Further methods are known to the skilled worker and may encompass hindering or preventing processing of the protein, transport of the protein or its mRNA, inhibition of ribosomal attachment, inhibition of RNA splicing, induction of an enzyme which degrades RNA and/or inhibition of translational elongation or termination.
- protein quantity refers to the amount of a polypeptide in an organism, a tissue, a cell or cell compartment.
- reduction of the protein quantity refers to the quantitative reduction of the amount of a protein in an organism, a tissue, a cell or a cell compartment - for example by one of the methods described herein below - in comparison with the wild type of the same genus and species to which this method has not been applied under otherwise identical conditions (such as, for example, culture conditions, age of the plants and the like).
- An especially advantageous embodiment is the inactivation of the nucleic acids, or of the polypeptides encoded by them.
- activity preferably refers to the activity of a polypeptide in an organism, a tissue, a cell or a cell compartment.
- reduction in the activity refers to the reduction in the overall activity of a protein in an organism, a tissue, a cell or a cell compartment - for example by one of the methods described herein below - in comparison with the wild type of the same genus and species, to which this method has not been applied, under otherwise identical conditions (such as, for example, culture conditions, age of the plants and the like).
- a reduction in activity of at least 10%, advantageously of at least 20%, preferably at least 30%, especially preferably of at least 40%, 50% or 60%, very especially preferably of at least 70%, 80%, 90% or 95%, 99% or even 100% in comparison with the untreated organism is advantageous.
- a particularly advantageous embodiment is the inactivation of the nucleic acids or of the polypeptides encoded by them.
- function preferably refers to the enzymatic or regulatory function of a peptide in an organism, a tissue, a cell or a cell compartment.
- Suitable substrates are low-molecular-weight compounds and also the protein interaction partners of a protein.
- reduction of the function refers, for example, to the quantitative reduction in binding capacity or binding strength of a protein for at least one substrate in an organism, a tissue, a cell or a cell compartment - for example by one of the methods described herein below - in comparison with the wild type of the same genus and species to which this method has not been applied, under otherwise identical conditions (such as, for example, culture conditions, age of the plants and the like).
- Reduction is also understood as meaning the modification of the substrate specificity as can be expressed for example, by the kcat/Km value.
- a reduction of the function of at least 10%, advantageously of at least 20%, preferably at least 30%, especially preferably of at least 40%, 50% or 60%, very especially preferably of at least 70%, 80%, 90% or 95%, 99% or even 100% in comparison with the untreated organism is advantageous.
- a particularly advantageous embodiment is the inactivation of the function.
- Binding partners for the protein can be identified in the manner with which the skilled worker is familiar, for example by the yeast 2-hybrid system.
- dsRNA double-stranded RNA nucleic acid sequence
- double-stranded RNA interference double-stranded RNA interference
- dsRNAi double-stranded RNA interference
- the techniques and methods described in the above references are expressly referred to. Efficient gene suppression can also be observed in the case of transient expression or following transient transformation, for example as the consequence of a biolistic transformation
- dsRNAi methods are based on the phenomenon that the simultaneous introduction of complementary strand and counterstrand of a gene transcript brings about highly effective suppression of the expression of the gene in question.
- the resulting phenotype is very similar to that of an analogous knock-out mutant (Waterhouse PM et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13959-64).
- Tuschl et al. [Gens Dev., 1999, 13 (24): 3191 - 3197] was able to show that the efficiency of the RNAi method is a function of the length of the duplex, the length of the 3'-end overhangs, and the sequence in these overhangs. Based on the work of Tuschl et al. and assuming that the underlining principles are conserved between different species the following guidelines can be given to the skilled worker:
- dsRNA double-stranded RNA sequences from exons are useful for the method, as sequences from introns have no effect;
- dsRNAi approaches are clearly superior to traditional antisense approaches.
- dsRNA molecules double-stranded RNA molecules
- the term "essentially identical" refers to the fact that the dsRNA sequence may also include insertions, deletions and individual point mutations in comparison to the target sequence while still bringing about an effective reduction in expression.
- the homology as defined above amounts to at least 75%, preferably at least 80%, very especially preferably at least 90%, most preferably 100%, between the
- the part-segment amounts to at least 10 bases, preferably at least 25 bases, especially preferably at least 50 bases, very especially preferably at least 100 bases, most preferably at least 200 bases or at least 300 bases in length.
- an "essentially identical" dsRNA may also be defined as a nucleic acid sequence which is capable of hybridizing with part of a gene transcript (for example in 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA at 50 0 C or 70 0 C for 12 to 16 h).
- the dsRNA may consist of one or more strands of polymerized ribonucleotides.
- Modification of both the sugar-phosphate backbone and of the nucleosides may BASF/PF 56031 PCT 49
- the phosphodiester bonds of the natural RNA can be modified in such a way that they encompass at least one nitrogen or sulfur hetero atom.
- Bases may undergo modification in such a way that the activity of, for example, adenosine deaminase is restricted.
- the dsRNA can be prepared enzymatically; it may also be synthesized chemically, either in full or in part.
- Short dsRNA up to 30 bp which effectively mediate RNA interference, can be for example efficiently generated by partial digestion of long dsRNA templates using E. coli ribonuclease III (RNase III).
- RNase III E. coli ribonuclease III
- the double-stranded structure can be formed starting from a single, self- complementary strand or starting from two complementary strands.
- "sense” and “antisense” sequence can be linked by a linking sequence ("linker") and form for example a hairpin structure.
- the linking sequence may take the form of an intron, which is spliced out following dsRNA synthesis.
- the nucleic acid sequence encoding a dsRNA may contain further elements such as, for example, transcription termination signals or polyadenylation signals.
- the two strands of the dsRNA are to be combined in a cell or an organism advantageously in a plant, this can be brought about in a variety of ways: a) transformation of the cell or of the organism, advantageously of a plant, with a vector encompassing the two expression cassettes, b) cotransformation of the cell or of the organism, advantageously of a plant, with two vectors, one of which encompasses the expression cassettes with the "sense" strand while the other encompasses the expression cassettes with the "antisense” strand.
- Formation of the RNA duplex can be initiated either outside the cell or within the cell.
- the dsRNA is synthesized outside the target cell or organism it can be introduced into the organism or a cell of the organism by injection, microinjection, electroporation, high velocity particles, by laser beam or mediated by chemical compounds (DEAE-dextran, calciumphosphate, liposomes) or in case of animals it is also possible to feed bacteria such as E. coli strains engineered to express double- stranded RNAi to the animals.
- chemical compounds DEAE-dextran, calciumphosphate, liposomes
- the dsRNA may also encompass a hairpin structure, by linking the "sense” and “antisense” strands by a "linker” (for example an intron).
- a "linker” for example an intron.
- the self-complementary dsRNA structures are preferred since they merely require the expression of a construct and always encompass the complementary strands in an equimolar ratio.
- the dsRNA may also encompass a hairpin structure, by linking the "sense” and “antisense” strands by a "linker” (for example an intron).
- a "linker” for example an intron.
- the self-complementary dsRNA structures are preferred since they merely require the expression of a construct and always encompass the complementary strands in an equimolar ratio.
- the expression cassettes encoding the "antisense” or the “sense” strand of the dsRNA or the self-complementary strand of the dsRNA are preferably inserted into a vector and stably inserted into the genome of a plant, using the methods described herein below (for example using selection markers), in order to ensure permanent expression of the dsRNA.
- the dsRNA can be introduced using an amount which makes possible at least one copy per cell.
- a larger amount for example at least 5, 10, 100, 500 or 1 000 copies per cell) may bring about more efficient reduction.
- the method is tolerant with regard to sequence deviations as may be present as a consequence of genetic mutations, polymorphisms or evolutionary divergences.
- the dsRNA can be synthesized either in vivo or in vitro.
- a DNA sequence encoding a dsRNA can be introduced into an expression cassette under the control of at least one genetic control element (such as, for example, promoter, enhancer, silencer, splice donor or splice acceptor or polyadenylation signal). Suitable advantageous constructs are described herein below. Polyadenylation is not required, nor do elements for initiating translation have to be present.
- a dsRNA can be synthesized chemically or enzymatically. Cellular RNA polymerases or bacteriophage RNA polymerases (such as, for example T3, T7 or SP6 RNA polymerase) can be used for this purpose.
- RNA RNA-in-vitro expression of RNA
- a dsRNA which has been synthesized in vitro either chemically or enzymatically can be isolated to a higher or lesser degree from the reaction mixture, for example by extraction, precipitation, electrophoresis, chromatography or combinations of these methods.
- the dsRNA can be introduced directly into the cell or else be applied extracellularly (for example into the interstitial space). Stable transformation of the plant with an expression construct which brings about the expression of the dsRNA is preferred, however. Suitable methods are described herein below.
- the antisense nucleic acid molecule hybridizes with, or binds to, the cellular mRNA and/or the genomic DNA encoding the target protein to be suppressed. This process suppresses the transcription and/or translation of the target protein.
- Hybridization can be brought about in the conventional manner via the formation of a stable duplex or, in the case of genomic DNA, by the antisense nucleic acid molecule binding to the duplex of the genomic DNA by specific interaction in the large groove of the DNA helix.
- the antisense nucleic acid sequence can be complementary to all of the transcribed mRNA of the protein; it may be limited to the coding region, or it may only consist of one oligonucleotide which is complementary to part of the coding or noncoding sequence of the mRNA.
- the oligonucleotide can be complementary to the nucleic acid region which encompasses the translation start for the protein.
- Antisense nucleic acid sequences may have an advantageous length of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides but they may also be longer and encompass at least 100, 200, 500, 1000, 2000 or
- Antisense nucleic acid sequences can be expressed recombinantly or synthesized chemically or enzymatically using methods known to the skilled worker. In the case of chemical synthesis, natural or modified nucleotides may be used. Modified nucleotides may confer increased biochemical stability to the antisense nucleic acid sequence and lead to an increased physical stability of the duplex formed by antisense nucleic acid sequence and sense target sequence.
- substances which can be used are phosphorothioate derivatives and acridine- substituted nucleotides such as 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthin, xanthin, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, ⁇ -D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methyl- guanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3- methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylamino- methyluracil, 5-methoxyaminomethyl-2-thiouracil, ⁇ -D-mannosy
- 2-thiouracil 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil and 2,6- diaminopurine.
- nucleotide sequences which are complementary to the regulatory region of a gene (for example a promoter and/or enhancer) and which form triplex structures with the DNA double helix in this region so that the transcription of the gene is reduced.
- the antisense nucleic acid molecule can be an ⁇ - anomeric nucleic acid.
- Such ⁇ -anomeric nucleic acid molecules form specific double- stranded hybrids with complementary RNA in which - as opposed to the conventional ⁇ -nucleic acids - the two strands run in parallel with one another (Gautier C et al. (1987) Nucleic Acids Res. 15: 6625-6641).
- the antisense nucleic acid molecule can also comprise 2'-O-methylribonucleotides (Inoue et al. (1987) Nucleic Acids Res. 15: 6131-6148) or chimeric RNA-DNA analogs (Inoue et al.
- the antisense nucleic acid molecules of the invention are typically administered to a cell or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide having the biological activity of protein of the invention thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation and leading to the aforementioned compound X increasing activity.
- the antisense molecule of the present invention comprises also a nucleic acid molecule comprising a nucleotide sequences complementary to the regulatory region of an nucleotide sequence encoding the natural occurring polypeptide of the invention, e.g.
- polypeptide sequences shown in the sequence listing or identified according to the methods described herein, e.g., its promoter and/or enhancers, e.g. to form triple helical structures that prevent transcription of the gene in target cells.
- promoter and/or enhancers e.g. to form triple helical structures that prevent transcription of the gene in target cells.
- enhancers e.g. to form triple helical structures that prevent transcription of the gene in target cells.
- Maher, L.J. (1992) Bioassays 14(12):807-15 See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher, L.J. (1992) Bioassays 14(12):807-15.
- RNA and cleave the phosphodiester backbone at specific positions thus functionally deactivating the target RNA
- the ribozyme per se is not modified thereby, but is capable of cleaving further target RNA molecules in an analogous manner, thus acquiring the properties of an enzyme.
- the incorporation of ribozyme sequences into "antisense” RNAs imparts this enzyme- like RNA-cleaving property to precisely these "antisense” RNAs and thus increases their efficiency when inactivating the target RNA.
- the preparation and the use of suitable ribozyme "antisense" RNA molecules is described, for example, by Haseloff et al.
- ribozymes for example "Hammerhead” ribozymes; Haselhoff and Gerlach (1988) Nature 310: 585-591] can be used to catalytically cleave the mRNA of an enzyme to be suppressed and to prevent translation.
- the ribozyme technology can increase the efficacy of an antisense strategy.
- Methods for expressing ribozymes for reducing specific proteins are described in (EP 0 291 533, EP 0 321 201 , EP 0 360 257). Ribozyme expression has also been described for plant cells (Steinecke P et al.
- Suitable target sequences and ribozymes can be identified for example as described by Steinecke P, Ribozymes, Methods in Cell Biology 50, Galbraith et al. eds, Academic Press, Inc. (1995), pp. 449-460 by calculating the secondary structures of ribozyme RNA and target RNA and by their interaction [Bayley CC et al. (1992) Plant MoI. Biol. 18(2): 353-361 ; Lloyd AM and Davis RW et al. (1994) MoI. Gen. Genet. 242(6): 653-657].
- derivatives of the tetrahymena L-19 IVS RNA which have complementary regions to the mRNA of the protein to be suppressed can be constructed (see also US 4,987,071 and US 5,116,742).
- ribozymes can also be identified from a library of a variety of ribozymes via a selection process (Bartel D and Szostak JW (1993) Science 261 : 1411 -1418).
- Van der Krol et al. [(1990) Plant Cell 2: 291 -99].
- the construct introduced may represent the homologous gene to be reduced either in full or only in part.
- the application of this technique to plants has been described for example by Napoli et al. [(1990) The Plant Cell 2: 279-289 and in US 5,010,323].
- the function or activity of a protein can efficiently also be reduced by expressing a dominant-negative variant of said protein.
- the skilled worker is familiar with methods for reducing the function or activity of a protein by means of coexpression of its dominant-negative form [Lagna G and Hemmati-Brivanlou A (1998) Current Topics in Developmental Biology 36: 75-98; Perlmutter RM and Alberola-lla J (1996) Current Opinion in Immunology 8(2): 285-90; Sheppard D (1994) American Journal of Respiratory Cell & Molecular Biology 11(1): 1-6; Herskowitz I (1987) Nature 329 (6136): 219-22].
- These mutations for achieving a dominant-negative variant are preferably carried out at the level of the nucleic acid sequences.
- a corresponding mutation can be performed for example by PCR-mediated in-vitro mutagenesis using suitable oligonucleotide primers by means of which the desired mutation is introduced. To this end, methods are used with which the skilled worker is familiar.
- the "LA PCR in vitro Mutagenesis Kit” (Takara Shuzo, Kyoto) can be used for this purpose. It is also possible and known to those skilled in the art that deleting or changing of functional domains, e. g. TF or other signaling components which can bind but not activate may achieve the reduction of protein activity.
- This segment is preferably located in the promoter region. For the purposes of gene suppression, however, it may also be located in the region of the coding exons or introns.
- the skilled worker can obtain the relevant segments from Genbank by database search or starting from a cDNA whose gene is not present in Genbank by screening a genomic library for corresponding genomic clones.
- factors which are introduced into a cell may also be those which themselves inhibit the target protein.
- the protein-binding factors can, for example, be aptamers [Famulok M and Mayer G (1999) Curr. Top Microbiol. Immunol. 243: 123-36] or antibodies or antibody fragments or single-chain antibodies. Obtaining these factors has been described, and the skilled worker is familiar therewith.
- a cytoplasmic scFv antibody has been employed for modulating activity of the phytochrome A protein in genetically modified tobacco plants [Owen M et al. (1992) Biotechnology (NY) 10(7): 790-794; Franken E et al. (1997) Curr. Opin. Biotechnol. 8(4): 411-416; Whitelam (1996) Trend Plant Sci. 1: 286-272].
- BASF/PF 56031 PCT 57 BASF/PF 56031 PCT 57
- Gene expression may also be suppressed by tailor-made low-molecular-weight synthetic compounds, for example of the polyamide type [Dervan PB and B ⁇ rli RW (1999) Current Opinion in Chemical Biology 3: 688-693; Gottesfeld JM et al. (2000) Gene Expr. 9(1-2): 77-91].
- These oligomers consist of the units 3- (dimethylamino)propylamine, N-methyl-3-hydroxypyrrole, N-methylimidazole and
- N-methylpyrroles can be adapted to each portion of double-stranded DNA in such a way that they bind sequence-specifically to the large groove and block the expression of the gene sequences located in this position.
- Suitable methods have been described in Bremer RE et al. [(2001) Bioorg. Med. Chem. 9(8): 2093-103], Ansari AZ et al. [(2001) Chem. Biol. 8(6): 583-92], Gottesfeld JM et al. [(2001) J. MoI. Biol. 309(3): 615- 29], Wurtz NR et al. [(2001) Org. Lett 3(8): 1201-3], Wang CC et al. [(2001) Bioorg. Med. Chem.
- Inactivation or downregulation can also be efficiently brought about by inducing specific RNA degradation by the organism, advantageously in the plant, with the aid of a viral expression system (Amplikon) [Angell, SM et al. (1999) Plant J. 20(3): 357-362].
- Nucleic acid sequences with homology to the transcripts to be suppressed are introduced into the plant by these systems - also referred to as "VIGS” (viral induced gene silencing) with the aid of viral vectors. Then, transcription is switched off, presumably mediated by plant defense mechanisms against viruses. Suitable techniques and methods are described in Ratcliff F et al. [(2001) Plant J. 25(2): 237- 45], Fagard M and Vaucheret H [(2000) Plant MoI. Biol. 43(2-3): 285-93],
- nucleic acid construct which, for example, comprises at least part of an endogenous gene which is modified by a deletion, addition or substitution of at least one nucleotide in such a way that the functionality is reduced or completely eliminated.
- the modification may also affect the regulatory elements (for example the promoter) of BASF/PF 56031 PCT 58
- the modified region is flanked at its 5' and 3' end by further nucleic acid sequences which must be sufficiently long for allowing recombination.
- Their length is, as a rule, in a range of from one hundred bases up to several kilobases [Thomas KR and Capecchi MR (1987) Cell 51: 503; Strepp et al. (1998) Proc. Natl. Acad. Sci. USA 95(8): 4368-4373].
- the host organism - for example a plant - is transformed with the recombination construct using the methods described herein below, and clones which have successfully undergone recombination are selected using for example a resistance to antibiotics or herbicides.
- the resistance to antibiotics or herbicides can subsequently advantageously be re-eliminated by performing crosses.
- An example for an efficient homologous recombination system in plants has been published in Nat. Biotechnol. 2002 Oct; 20(10):1030-4, Terada R et al.: Efficient gene targeting by homologous recombination in rice.
- Homologous recombination is a relatively rare event in higher eukaryotes, especially in plants. Random integrations into the host genome predominate.
- One possibility of removing the randomly integrated sequences and thus increasing the number of cell clones with a correct homologous recombination is the use of a sequence-specific recombination system as described in US 6,110,736, by means of which unspecifically integrated sequences can be deleted again, which simplifies the selection of events which have integrated successfully via homologous recombination.
- a multiplicity of sequence-specific recombination systems may be used, examples which may be mentioned being Cre/lox system of bacteriophage P1 , the FLP/FRT system from yeast, the Gin recombinase of phage Mu, the Pin recombinase from E. coli and the R/RS system of the pSR1 plasmid.
- the bacteriophage P1 Cre/lox system and the yeast FLP/FRT system are preferred.
- the FLP/FRT and the cre/lox recombinase system have already been applied to plant systems [Odell et al. (1990) MoI. Gen. Genet. 223: 369-378].
- oligonucleotides into the plant [Zhu et al. (2000) Nat. Biotechnol. 18(5): 555-558], and the generation of knock-out mutants with the aid of, for example, T-DNA mutagenesis [Koncz et al. (1992) Plant MoI. Biol. 20(5): 963-976], ENU-(N-ethyl-N- nitrosourea) - mutagenesis or homologous recombination [ENU - (N-ethyl-N-nitrosourea) - mutagenesis or homologous recombination [Hohn B and Puchta (1999) H. Proc. Natl. Acad. Sci.
- Point mutations may also be generated by means of DNA-RNA hybrids also known as "chimeraplasty" [Cole-Strauss et al. (1999) Nucl. Acids Res. 27(5): 1323-1330; Kmiec (1999) Gene Therapy American Scientist 87(3): 240-247].
- the mutation sites may be specifically targeted or randomly selected.
- Nucleic acid sequences as described in item B) to I) are expressed in the cell or organism by transformation/transfection of the cell or organism or are introduced in the cell or organism by known methods, for example as disclosed in item A).
- the interaction of the introduced nucleic acid, which can be active itself, with said gene leads by deletion, inversion or insertion finally to inactivation, i. e. by frameshift, or destruction of said gene.
- binary vectors such as pBinAR can be used (H ⁇ fgen and Willmitzer, 1990 Plant Science 66:221-230).
- suitable binary vectors are such as pBIN19, pBI101, pGPTV or pPZP (Hajukiewicz, P. et al., 1994, Plant MoI. Biol., 25: 989-994).
- An overview of binary vectors and their specific features is given in Hellens et al., 2000, Trends in plant science, 5: 446 - 451.
- Construction of the binary vectors can be performed by ligation of the cDNA in sense or antisense orientation into the T-DNA. 5-prime to the cDNA a plant promoter activates transcription of the cDNA. A polyadenylation sequence is located 3-prime to the cDNA. Tissue-specific expression can be achieved by using a tissue specific promoter as listed below. Also, any other promoter element can be used. For constitutive expression within the whole plant, the CaMV 35S promoter can be used. BASF/PF 56031 PCT 60
- the expressed protein can be targeted to a cellular compartment using a signal peptide, for example for plastids, mitochondria or endoplasmic reticulum (Kermode, 1996 Crit. Rev. Plant Sci. 4(15):285-423).
- the signal peptide is cloned 5-prime in frame to the cDNA to archive subcellular localization of the fusion protein.
- promoters that are responsive to abiotic stresses can be used with, such as the Arabidopsis promoter RD29A.
- the promoter used should be operatively linked to the nucleic acid such that the promoter causes transcription of the nucleic acid which results in the synthesis of a mRNA which encodes a polypeptide.
- the RNA can be an antisense RNA for use in affecting subsequent expression of the same or another gene or genes.
- Alternate methods of transfection include the direct transfer of DNA into developing flowers via electroporation or Agrobacterium mediated gene transfer.
- Agrobacterium mediated plant transformation can be performed using for example the GV3101 (pMP90) (Koncz and Schell, 1986 MoI. Gen. Genet. 204:383-396) or LBA4404 (Ooms et al., Plasmid, 1982, 7: 15-29; Hoekema et al., Nature, 1983, 303: 179-180) Agrobacterium tumefaciens strain. Transformation can be performed by standard transformation and regeneration techniques (Deblaere et al., 1994 Nucl. Acids. Res.
- rapeseed can be transformed via cotyledon or hypocotyl transformation (Moloney et al., 1989 Plant Cell Reports 8:238-242; De Block et al., 1989 Plant Physiol. 91:694-701).
- Agrobacterium and plant selection depend on the binary vector and the Agrobacterium strain used for transformation. Rapeseed selection is normally performed using kanamycin as selectable plant marker.
- Agrobacterium mediated gene transfer to flax can be performed using, for example, a technique described by Mlynarova et al., 1994 Plant Cell Report 13:282-285. Additionally, transformation of soybean can be performed using for example a technique described in European Patent No. 0424 047, U.S.
- a useful method to ascertain the level of transcription or activity of the gene is to perform a Northern blot (for reference see, for example, Ausubel et al., 1988 Current Protocols in Molecular Biology, Wiley: New York).
- This information at least partially demonstrates the degree of transcription of the transformed gene.
- Total cellular RNA can be prepared from cells, tissues or organs by several methods, all well-known in the art, such as that described in Bormann, E.R. et al., 1992 MoI. Microbiol. 6:317-326.
- standard techniques such as a Western blot, may be employed. These techniques are well known to one of ordinary skill in the art. (See for example Ausubel et al., 1988 Current Protocols in Molecular Biology, Wiley: New York).
- the use of Real Time PCR is also possible.
- the invention may further be combined with an isolated recombinant expression vector comprising a stress related protein encoding nucleic acid, wherein expression of the vector or stress related protein encoding nucleic acid, respectively in a host cell results in increased tolerance and/or resistance to environmental stress as compared to the wild type of the host cell.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- plasmid which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
- Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome.
- vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
- Other vectors e.g., non-episomal mammalian vectors
- certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors”.
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- plasmid and "vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
- the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses), which serve equivalent functions.
- a plant expression cassette comprising a nucleic acid construct, which when expressed allows inactivation or down-regulation of a gene encoded by a nucleic acid selected from the group consisting of sequences according to SEQ ID NO: (2n+1) for BASF/PF 56031 PCT 62
- the plant expression cassette preferably contains regulatory sequences capable of driving gene expression in plant cells and operably linked so that each sequence can fulfill its function, for example, termination of transcription by polyadenylation signals.
- Preferred polyadenylation signals are those originating from Agrobacterium tumefaciens T-DNA such as the gene 3 known as octopine synthase of the Ti-plasmid pTiACH ⁇ (Gielen et al., 1984 EMBO J. 3:835) or functional equivalents thereof but also all other terminators functionally active in plants are suitable.
- Plant gene expression must be operably linked to an appropriate promoter conferring gene expression in a time, cell or tissue specific manner.
- Preferred promoters are such that drive constitutive expression (Benfey et al., 1989 EMBO J. 8:2195-2202) like those derived from plant viruses like the 35S CaMV (Franck et al., 1980 Cell 21 :285-294), the 19S CaMV (see also U.S. Patent No. 5352605 and PCT Application No. WO 8402913) or plant promoters like those from Rubisco small subunit described in U.S. Patent No. 4,962,028.
- Additional advantageous regulatory sequences are, for example, included in the plant promoters such as CaMV/35S [Franck et al., Cell 21 (1980) 285 - 294], PRP1 [Ward et al., Plant. MoI. Biol. 22 (1993)], SSU, OCS, Iib4, usp, STLS1, B33, LEB4, nos or in the ubiquitin, napin or phaseolin promoter.
- Additional useful plant promoters are the cytosolic FBPase promoter or ST-LSI promoter of the potato (Stockhaus et al., EMBO J.
- phosphorybosyl phyrophoshate amido transferase promoter of Glycine max gene bank accession No. U87999
- noden specific promoter described in EP-A-O 249 676 are seed specific promoters which can be used for monocotyledons or dicotyledons.
- the construct may also comprise further genes which are to be inserted into the organisms and which are for example involved in stress resistance, i.e. next to inactivating certain genes or incorporating inactivated genes at their place, it is possible to introduce favorable genes that are related to production of proteins which actively increase stress tolerance or resistance. It is therefore feasible and advantageous to insert and express in host organisms regulatory genes such as genes for inducers, repressors or enzymes which intervene by their enzymatic activity in the regulation of one or more or all genes of a biosynthetic pathway. These genes can be heterologous or homologous in origin.
- the gene construct advantageously comprises, for expression of the other genes present, additionally 3' and/or 5' terminal regulatory sequences to enhance expression, which are selected for optimal expression depending on the selected host organism and gene or genes.
- These regulatory sequences are intended to make specific expression of the genes and protein expression possible as mentioned above. This may mean, depending on the host organism, for example that the gene is expressed or overexpressed only after induction, or that it is immediately expressed and/or overexpressed.
- the regulatory sequences or factors may moreover preferably have a beneficial effect on expression of the introduced genes, and thus increase it. It is possible in this way for the regulatory elements to be enhanced advantageously at the transcription level by using strong transcription signals such as promoters and/or enhancers. However, in addition, it is also possible to enhance translation by, for example, improving the stability of the mRNA.
- targeting-sequences necessary to direct the gene product in its appropriate cell compartment such as the vacuole, the nucleus, all types of plastids like amyloplasts, chloroplasts, chromoplasts, the extracellular space, mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant cells.
- Selection marker systems like the AHAS marker or other promotors, e.g. superpromotor (Ni et al,., Plant Journal 7, 1995: 661-676), Ubiquitin promotor (CaIMs et al., J. Biol. Chem., 1990, 265: 12486-12493; US 5,510,474; US 6,020,190; Kawalleck et al., Plant. Molecular Biology, 1993, 21: 673-684) or 10S promotor (GenBank Accession numbers M59930 and X16673) may be similar useful for the combination with the present invention and are known to a person skilled in the art.
- superpromotor Ne et al,., Plant Journal 7, 1995: 661-676
- Ubiquitin promotor CaIMs et al., J. Biol. Chem., 1990, 265: 12486-12493; US 5,510,474; US 6,020,190; Kawalleck et al., Plant. Molecular Biology,
- the present invention describes the use of comparing particular attributes or traits, estimating the general appearance or comparing the altered metabolic activity by inactivation or down-regulation of genes to engineer stress- tolerant and/or resistant, i.e. drought-, salt- and/or cold -tolerant and/or resistant plants.
- stress- tolerant and/or resistant i.e. drought-, salt- and/or cold -tolerant and/or resistant plants.
- Screening p. 701 dry weight, wet weight, protein synthesis, carbohydrate synthesis, lipid synthesis, evapotranspiration rates, general plant and/or crop yield, flowering, reproduction, seed setting, root growth, respiration rates, photosynthesis rates, etc.
- Screening p. 701 dry weight, wet weight, protein synthesis, carbohydrate synthesis, lipid synthesis, evapotranspiration rates, general plant and/or crop yield, flowering, reproduction, seed setting, root growth, respiration rates, photosynthesis rates, etc.
- the methods of the invention may be used to detect environmental stress in plant cells or plants by screening the plant cells for particular attributes or traits, estimating the general appearance, analyzing the growth characteristics or screening for altered metabolic activity as compared to non-stress conditions, which allows for selection of resistant or tolerant plants or plant cells and also provides detection of stress in plants or plant cells before symptoms are visable and damage is high.
- the methods of the invention also allow breeding of plant cells or plants towards increased tolerance and/or resistance to environmental stress by screening the plant cells under stress conditions for particular attributes or traits, estimating the general appearance, analyzing the growth characteristics or screening for altered metabolic activity as compared to non-stress conditions and selecting those with increased tolerance and/or resistance to environmental stress for further replication.
- the engineering of one or more stress related genes of the invention may also result in stress related proteins having altered activities which indirectly impact the stress response and/or stress tolerance of plants.
- the normal biochemical processes of metabolism result in the production of a variety of products (e.g., hydrogen peroxide and other reactive oxygen species) which may actively interfere with these same metabolic processes (for example, peroxynitrite is known to react with tyrosine side chains, thereby inactivating some enzymes having tyrosine in the active site (Groves, J.T., 1999 Curr. Opin. Chem. Biol. 3(2):226-235).
- peroxynitrite is known to react with tyrosine side chains, thereby inactivating some enzymes having tyrosine in the active site (Groves, J.T., 1999 Curr. Opin. Chem. Biol. 3(2):226-235).
- sequences disclosed herein, or fragments thereof can be targeted to generate knockout mutations in the genomes of various other plant cells (Girke, T., 1998 The Plant Journal 15:39-48).
- the resultant knockout cells can then be evaluated for their ability or capacity to tolerate various stress conditions, their response to various stress conditions, and the effect on the phenotype and/or genotype of the mutation.
- U.S. Patent No. 6004804 Non-Chimeric Mutational Vectors
- Puttaraju et al. 1999 Spliceosome-mediated RNA trans-splicing as a tool for gene therapy Nature Biotechnology 17:246-252.
- a binary vector was constructed based on the modified pPZP binary vector backbone (comprising the kanamycin-gene for bacterial selection; Hajdukiewicz, P. et al., 1994, Plant MoI. Biol., 25: 989-994) and the selection marker bar-gene (De Block et al., 1987, EMBO J. 6, 2513-2518) driven by the mas2'1' and mas271f promoters (Velten et al., 1984, EMBO J. 3, 2723-2730; Mengiste, Amedeo and Paszkowski, 1997, Plant J., 12, 945-948). The complete vector (Fig. 2) and plasmid are shown in the annex.
- Examples of other usable binary vectors for insertional mutagenesis are pBIN19, pBI101 , pBinAR or pGPTV.
- An overview over binary vectors and their specific features is given in Hellens et al., 2000, Trends in plant Science, 5:446-451 and in Guerineau F., Mullineaux P., 1993, Plant transformation and expression vectors in plant molecular BASF/PF 56031 PCT 68
- Agrobacterium tumefaciens (GV3101pMP90; Koncz and Schell, 1986 MoI. Gen. Genet. 204:383-396) using heat shock or electroporation protocols. Transformed colonies were grown on YEB medium and selected by respective antibiotics (Rif/Gent/Km) for 2 d at 28 °C. These agrobacteria cultures were used for the plant transformation.
- Arabidopsis thaliana of the ecotype C24 were grown and transformed according to standard conditions (Bechtold, N., Ellis, J., Pelletier, G. 1993. In planta Agrobacterium mediated gene transfer by infiltration of Arabidopsis thaliana plants, C. R.
- Transformed plants were selected by the use of their respective resistance marker.
- BASTA®-resistance plantlets were sprayed four times at an interval of 2 to 3 days with 0.02 % BASTA® and transformed plants were allowed to set seeds.
- 50-100 seedlings (F2) were subjected again to marker selection, in case of BASTA- resistance by spaying with 0.1 % BASTA® on 4 consecutive days during the plantlet phase. Plants segregating for a single resistance locus (approximately 3:1 resistant seedling to sensitive seedlings) were chosen for further analysis.
- thaliana plants were grown individually in pots containing a 4:1 (v/v) mixture of soil and quartz sand in a growth chamber (York lndustriekalte GmbH, Mannheim, Germany). To induce germination, sown seeds were kept at 4°C, in the dark, for 3 days. Standard growth conditions were: photoperiod of 16 h light and 8 h dark, 20 0 C, 60% relative humidity, and a photon flux density of 150 ⁇ E. Plants were watered daily until they were approximately 3 weeks old at which time drought was imposed by withholding water. Simultaneously, the relative humidity was reduced in BASF/PF 56031 PCT 69
- Chlorophyll fluorescence measurements of photosynthetic yield confirmed that 14 days of drought stress completely inhibited photosynthesis in the control plants. In most cases the transformed lines maintained photosynthetic function longer (table 3).
- Genomic DNA was purified from approximately 100 mg of leaf tissue from these lines using standard procedures (either spins columns from Qiagen, Hilden, Germany or the Nucleon Phytopure Kit from Amersham Biosciences, Freiburg, Germany). The amplification of the insertion side of the T-DNA was achieved using two different methods. Either by an adaptor PCR-method according to Spertini D, Beliveau C.
- T-DNA specific primers LB1 (5' - TGA CGC CAT TTC GCC TTT TCA - 3'; SEQ ID NO: 83) for the first and LB2 (5' - CAG AAA TGG ATA AAT AGC CTT GCT TCC - 3'; SEQ ID NO: 84) or RB4-2 (5' - AGC TGG CGT AAT AGC GAA GAG - 3'; SEQ ID NO: 85) for the second round of BASF/PF 56031 PCT 70
- PCR-products were identified on agarose gels and purified using columns and standard procedures (Qiagen, Hilden, Germany). PCR-products were sequenced with additional T-DNA-specific primers located towards the borders relative to the primers used for amplification.
- primer LBseq 5' - CAA TAC ATT ACA CTA GCA TCT G - 3'; SEQ ID NO: 90
- primer RBseq 5' - AGA GGC CCG CAC CGA TCG - 3'; SEQ ID NO: 91
- Indicated are the identified annotated open reading frame in the Arabidopsis genome, the estimated size of the obtained PCR product (in base pairs), the T-DNA border (LB: left border, RB: right border) for which the amplification was achieved, the method which resulted in the indicated PCR product (explanation see text above), the respective restriction enzymes in case of adaptor PCR, and the degenerated primer in the case of TAIL PCR.
- Routinely degenerated primers ADP3 (5 ' - WGTGNAGWANCANAGA-3 ' ; SEQ ID NO: 92), ADP6 ( ⁇ ' -AGWGNAGWANCANAGA- 3 ' ; SEQ ID NO: 93) and ADP8 ( ⁇ ' -NTGCGASWGANWAGAA-S ' ; SEQ ID NO: 94) were used next to the other known primers given in table 4.
- the identification of the insertion locus in each case was confirmed by a control PCR, using a T-DNA-specific primer and a primer deduced from the identified genomic locus, near to the insertion side.
- the amplification of a PCR-product of the expected size from the insertion line using these two primers proved the disruption of the identified locus by the T-DNA integration.
- Table 2 Duration of survival of transformed Arabidopsis thaliana after imposition of drought stress on 3-week-old plants. Drought tolerance was measured visually at daily intervals. Survival duration is the average of all plants that survived longer than the wild type control. The Maximum duration is the longest period that any single transformed plant survived longer than the wild type control.
- Table 4 Details on PCR products used to identify the down-regulated genomic locus.
- Fragments of SEQ ID NO: 95 or other nucleic acids of the invention are amplified by PCR using pairs of gene specific primers.
- restriction sites may be added to the primers used for the amplification.
- recombination sites may be added to the primers to enable a recombination reaction.
- the PCR fragment is either cloned or recombined into a binary vector, preferently under control of a strong constitutive, tissue or developmental specific promoters in a way, that the orientation to the promoter is opposite of the direction the gens has in its original genomic position.
- the amplification of the fragment of the SEQ ID NO: 95 was performed using the oligonucleotides that have been deduced from the gene sequence:
- Seqiantifw 5 ' - atagaattcatgcttcgactgatcgacga - 3 ' (SEQ ID NO: 869) Seqiantirev: 5 ' - atagtcgaccaccgggcacattgagcaat - 3 ' (SEQ ID NO: 870)
- RNA extraction Qiagen
- cDNA production Invitrogen
- the PCR reaction contained 5 ⁇ l ThermalAce buffer (Invitrogen), 0,4 ⁇ l dNTPs (25 mM each) (Invitrogen), 0,5 ⁇ l Primer Seqiantifw, 0,5 ⁇ l Primer Seqiantirev, 0,5 ⁇ l ThermalAce (Invitrogen), 0,5 ⁇ l cDNA and 42,6 ⁇ l water.
- the PCR was performed on MJ-Cycler Tetrad (BioZym) with the following programm:
- the PCR product has been purified using a Kit from Qiagen.
- the DNA was subsequently digested with EcoRI / Sail (NEB) at 37 0 C over night.
- the fragment was then cloned into the vector BaseVectorCorn (see figure 1) which has been digested with EcoRI / Sail.
- the cassette comprising the ScBV Promoter, the antisense fragment of Seq1 and the NOS terminator has been cut out using the restriction enzymes Ascl / Pad and has been ligated in the vector TrafoVectorCorn (see figure 2) yielding the vector TrafoVectorCorn_antiSeq1 (Fig. 3).
- RNAi constructs for repression of the genes of the invention Construction of RNAi constructs for repression of the genes of the invention
- Two fragments of SEQ ID NO: 95 are amplified by PCR .
- restriction sites may be added to the primers used for the ampli ⁇ fication.
- recombination sites may be added to the primers to enable a recombination reaction.
- the PCR fragment is either cloned or recombined into a binary vector, preferently under control of a strong constitutive, tissue or developmental specific promoters in a way, that the fragment is introduced twice in the vector as an inverted repeat, the repeats separated by a DNA spacer.
- the amplification of the fragments of the SEQ ID NO: 95 was performed using the oligonucleotides that have been deduced from the gene sequence:
- Seq1rifw1 5 ' - atagtcgacatgcttcgactgatcgacga - 3 ' (SEQ ID NO: 871) Seq1rirev1: 5 ' - atagaattccaccgggcacattgagcaat - 3 ' (SEQ ID NO: 872) Seq1rifw2: 5 ' - atacccgggatgcttcgactgatcgacga - 3 ' (SEQ ID NO: 873) Seq1rirev2: 5 ' - atatctagacaccgggcacattgagcaat - 3 ' (SEQ ID NO: 874) The Oligonucleotides have been solved in water to give a concentration of 20 ⁇ M.
- the PCR reactions contained 5 ⁇ l ThermalAce buffer (Invitrogen), 0,4 ⁇ l dNTPs (25 mM each) (Invitrogen), 0,5 ⁇ l Primer Seq1rifw1, 0,5 ⁇ l Primer Seq1rirev1, 0,5 ⁇ l ThermalAce (Invitrogen), 0,5 ⁇ l cDNA and 42,6 ⁇ l water and 5 ⁇ l ThermalAce buffer (Invitrogen), 0,4 ⁇ l dNTPs (25 mM each) (Invitrogen), 0,5 ⁇ l Primer Seq1rifw2, 0,5 ⁇ l Primer Seq1rirev2, 0,5 ⁇ l
- the PCR products have been purified using a Kit from Qiagen.
- the DNA was subsequently digested with Sail / EcoRI at 37 0 C over night and Smal for 6h at 28 0 C followed by digestion with Xbal overnight at 37 0 C respectively.
- the Smal / Xbal digested fragment was then cloned into the vector BaseVectorCorn_Spacer (see figure 4) wich has been digested with Smal/Xbal.
- the resulting construct was digested with EcoRI / Sail and the EcoRI / Sail PCR fragment was ligated into this vector.
- the expression cassette comprising the ScBV promoter, inverted repeat of Seq1 separated by the spacer sequence and NOS terminator has been cut out using the restriction enzymes Ascl/Pacl and has been ligated in the vector TrafoVectorCorn (see figure 2) yielding the vector.
- restriction sites may be added to the primers used for the amplification.
- recombinationsites may be added to the primers to enable a recombination reaction.
- the PCR fragment is either cloned or recombined into a binary vector, preferently under control of a strong constitutive, tissue or developmental specific promoters in a way, that the orientation to the promoter is identical to the direction the gen has in its original genomic position.
- the amplification of the fragment of the SEQ ID NO: 95 was performed using the oligonucleotides that have been deduced from the gene sequence: Seqicofw: 5 ' - atagtcgacatgcttcgactgatcgacga - 3 ' (SEQ ID NO:875) Seqicorev: 5 ' - atagaattcccaccgggcacattgagcaat - 3 ' (SEQ ID NO:876)
- the Oligonucleotides have been solved in water to give a concentration of 20 ⁇ M.
- the PCR reactions contained 5 ⁇ l ThermalAce buffer (Invitrogen), 0,4 ⁇ l dNTPs (25 mM each) (Invitrogen), 0,5 ⁇ l Primer Seqicofw, 0,5 ⁇ l Primer Seqicorev, 0,5 ⁇ l ThermalAce (Invitrogen), 0,5 ⁇ l cDNA and 42,6 ⁇ l water.
- the PCR was performed on MJ-Cycler Tetrad (BioZym) with the following programm:
- the PCR product has been purified using a Kit from Qiagen.
- the DNA was subsequently digested with EcoRI / Sail (NEB) at 37 0 C over night.
- the fragment was BASF/PF 56031 PCT 79
- BaseVectorCorn (see figure 1) which has been digested with EcoRI / Sail.
- the resulting construct was named BaseVectorCorn_coSeq1.
- the cassette comprising the ScBV Promoter, the cosuppression fragment of Seq1 and the NOS terminator has been cut out using the restriction enzymes Ascl / Pad and has been ligated in the vector TrafoVectorCorn (see figure 2) yielding the vector TrafoVectorCorn_coSeq1 (Fig. 5).
- Transformation of corn (Zea mays L.) is performed with a modification of the method described by lshida et al. (1996. Nature Biotech 14745-50). Transformation is genotype-dependent in corn and only specific genotypes are amenable to transformation and regeneration.
- the inbred line A188 (University of Minnesota) or hybrids with A188 as a parent are good sources of donor material for transformation (Fromm et al. 1990 Biotech 8:833-839), but other genotypes can be used successfully as well.
- Ears are harvested from corn plants at approximately 11 days after pollination (DAP) when the length of immature embryos is about 1 to 1.2 mm.
- Immature embryos are co-cultivated with Agrobacterium tumefaciens that carry "super binary" vectors and transgenic plants are recovered through organogenesis.
- the super binary vector system of Japan Tobacco is described in WO patents WO94/00977 and WO95/06722.
- Vectors are constructed as described.
- Various selection marker genes can be used including the corn gene encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (US patent 6025541).
- AHAS mutated acetohydroxy acid synthase
- various promoters can be used to provide constitutive, developmental, tissue or environmental regulation of gene suppression construct, eg the cosuppresion or the antisense or the RNAi construct.
- the 34S promoter (GenBank Accession numbers M59930 and X16673) is used to provide constitutive expression of the cosuppression or antisense or RNAi constructs .
- Excised embryos are grown on callus induction medium, then corn regeneration medium, containing imidazolinone as a selection agent.
- the Petri plates were incubated in the light at 25 0 C for 2-3 weeks, or until shoots develop.
- the green shoots from each embryo are transferred to corn rooting medium and incubated at 25 0 C for 2- 3 weeks, until roots develop.
- the rooted shoots are transplanted to soil in the greenhouse.
- T1 seeds are produced from plants that exhibit tolerance to the imidazolinone herbicides and are PCR positive for the transgenes.
- the T1 transgenic plants are then evaluated for their improved stress tolerance according to the standard methods eg the withdraw of water and the performance othe the plant in comparison the wildtype or mock transformed plants..
- the seedlings BASF/PF 56031 PCT 80 are then evaluated for their improved stress tolerance according to the standard methods eg the withdraw of water and the performance othe the plant in comparison the wildtype or mock transformed plants..
- T1 generation of single locus insertions of the T-DNA will segregate for the transgene in a 1 :2:1 ratio.
- progeny containing one or two copies of the transgene (3/4 of the progeny) are tolerant of the imidazolinone herbicide, and exhibit greater tolerance of drought stress than those progeny lacking the transgenes.
- Tolerant plants have higher seed yields, maintained their stomatal aperture and showed only slight changes in osmotic potential and proline levels, whereas the susceptible non-transgenic control plants closed their stomata and exhibited increased osmotic potential and proline levels.
- Homozygous T2 plants exhibited similar phenotypes.
- Hybrid plants (F1 progeny) of homozygous transgenic plants and non-transgenic plants also exhibited increased environmental stress tolerance.
- Seeds are sterilized by immersion in 70% (v/v) ethanol for 6 min and in 25 % commercial bleach (NaOCI) supplemented with 0.1% (v/v) Tween for 20 min, followed by rinsing 4 times with sterile double distilled water. Seven-day old seedlings are propagated by removing the radicle, hypocotyl and one cotyledon from each seedling. Then, the epicotyl with one cotyledon is transferred to fresh germination media in petri dishes and incubated at 25 0 C under a 16-hr photoperiod (approx. 100 ⁇ E-m-2s-1) for three weeks. Axillary nodes (approx.
- RNAi constructs can be used to carry the antisense, cosuppression or RNAi constructs .
- Many are based on the vector pBIN19 described by Bevan (Nucleic Acid Research. 1984. 12:8711-8721) that includes a plant gene expression cassette flanked by the left and right border sequences from the Ti plasmid of Agrobacterium tumefaciens.
- a plant gene expression cassette consists of at least two components - a selection marker gene with a suitable promoter and a plant promoter regulating the transcription of the cDNA or the antisense fragment or the RNAi construct.
- Various selection marker genes can be used including the Arabidopsis gene encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (US patents 57673666 and 6225105).
- various promoters can be used to regulate the cosuppression, RNAi oder antisense construct to provide constitutive, developmental, tissue or environmental regulation.
- the 34S promoter (GenBank Accession numbers M59930 and X16673) is used to provide constitutive expression the gene repression constructs.
- the explants are washed and transferred to selection media supplemented with 500 mg/L timentin. Shoots are excised and placed on a shoot elongation medium. Shoots longer than 1 cm are placed on rooting medium for two to four weeks prior to transplanting to soil.
- the primary transgenic plants are analyzed by PCR to confirm the presence of T- DNA. These results are confirmed by Southern hybridization in which DNA is electrophoresed on a 1 % agarose gel and transferred to a positively charged nylon membrane (Roche Diagnostics).
- the PCR DIG Probe Synthesis Kit (Roche Diagnostics) is used to prepare a digoxigenin-labelled probe by PCR, and used as recommended by the manufacturer.
- the transgenic plants are then evaluated for their improved stress tolerance according to the method standard methods, or like described in the following.
- the seedlings receive no water for a period up to 3 weeks at which time the plant and soil are desiccated. At various times after withholding water, a normal watering schedule is resumed.
- susceptible non-transgenic control plants close their stomata and exhibit increased osmotic potential and proline levels.
- Transgenic plants that displaytolerance to salinity or cold have higher seed yields, photosynthesis and dry matter production than susceptible plants.
- Agrobacterium tumefaciens LBA4404 containing a binary vector carrying an antisense or an cosuppression or an RNAi constructs as described in the examples above is used for canola transformation.
- Many different binary vector systems have been described for plant transformation (e.g. An, G. in Agrobacterium Protocols. Methods in Molecular Biology vol 44, pp 47-62, Gartland KMA and MR Davey eds. Humana Press, Totowa, New Jersey). Many are based on the vector pBIN19 described by Bevan (Nucleic Acid Research. 1984.
- a plant gene expression cassette consists of at least two components - a selection marker gene with a suitable promoter and a plant promoter regulating the transcription of the cDNA or a fragment of it for cosupression or the antisense fragment or the RNAi construct.
- selection marker genes can be used including the Arabidopsis gene encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (US patents 57673666 and 6225105).
- various promoters can be used to regulate the constructs for reducing gene expression to provide constitutive, developmental, tissue or environmental regulation of transcription.
- the 34S promoter (GenBank Accession numbers M59930 and X16673) is used to provide constitutive expression.of the gene repression constructs.
- Canola seeds are surface -sterilized in 70% ethanol for 2 min., and then in 30% Clorox with a drop of Tween-20 for 10 min, followed by three rinses with sterilized distilled water. Seeds are then germinated in vitro 5 days on half strength MS medium without hormones, 1% sucrose, 0.7% Phytagar at 23oC, 16 hr. light. The cotyledon petiole explants with the cotyledon attached are excised from the in vitro seedlings, and BASF/PF 56031 PCT 83
- inoculated with Agrobacterium by dipping the cut end of the petiole explant into the bacterial suspension.
- the explants are then cultured for 2 days on MSBAP-3 medium containing 3 mg/l BAP, 3 % sucrose, 0.7 % Phytagar at 23 0 C, 16 hr light.
- the petiole explants are transferred to MSBAP-3 medium containing 3 mg/l BAP, cefotaxime, carbenicillin, or timentin (300 mg/l) for 7 days, and then cultured on MSBAP-3 medium with cefotaxime, carbenicillin, or timentin and selection agent until shoot regeneration.
- the shoots When the shoots are 5 - 10 mm in length, they are cut and transferred to shoot elongation medium (MSBAP-0.5, containing 0.5 mg/l BAP). Shoots of about 2 cm in length are transferred to the rooting medium (MSO) for root induction.
- MSBAP-0.5 shoot elongation medium
- MSO rooting medium
- Samples of the primary transgenic plants are analyzed by PCR to confirm the presence of T-DNA. These results are confirmed by Southern hybridization in which DNA is electrophoresed on a 1 % agarose gel and transferred to a positively charged nylon membrane (Roche Diagnostics).
- the PCR DIG Probe Synthesis Kit (Roche Diagnostics) is used to prepare a digoxigenin-labelled probe by PCR, and used as recommended by the manufacturer.
- the transgenic plants are then evaluated for their improved stress tolerance according to the method standard methods, or like described in the following.
- the seedlings receive no water for a period up to 3 weeks at which time the plant and soil are desiccated.
- a normal watering schedule is resumed.
- the lengths of leaf blades, and the fresh and dry weights of the shoots is determined.
- tolerant plants are able to resume normal growth whereas susceptible plants have died or suffer significant injury resulting in shorter leaves and less dry matter. It is found that transgenic Rapeseed/Canola reduced in the expression of stress related genes from Brassica napus, are more tolerant to environmental stress than non- transgenic control plants.
- Tolerant plants have higher seed yields, maintain their stomatal aperture and show only slight changes in osmotic potential and proline levels, whereas the susceptible non-transgenic control plants close their stomata and exhibited increased osmotic potential and proline levels. Plants that have tolerance to salinity or cold have higher seed yields, photosynthesis and dry matter production than susceptible plants.
- Gene sequences can be used to identify identical or heterologous genes from cDNA or genomic libraries. Identical genes (e. g. full-length cDNA clones) can be isolated via BASF/PF 56031 PCT 84
- nucleic acid hybridization using for example cDNA libraries.
- 100,000 up to 1,000,000 recombinant bacteriophages are plated and transferred to nylon membranes.
- DNA is immobilized on the membrane by e. g. UV cross linking.
- Hybridization is carried out at high stringency conditions. In aqueous solution, hybridization and washing is performed at an ionic strength of 1 M NaCI and a temperature of 68°C.
- Hybridization probes are generated by e.g. radioactive ( 32 P) nick transcription labeling (High Prime, Roche, Mannheim, Germany). Signals are detected by autoradiography.
- Partially identical or heterologous genes that are similar but not identical can be identified in a manner analogous to the above-described procedure using low stringency hybridization and washing conditions.
- the ionic strength is normally kept at 1 M NaCI while the temperature is progressively loared from 68 to 42°C.
- Radiolabeled oligonucleotides are prepared by phosphorylation of the 5-prime end of two complementary oligonucleotides with T4 polynucleotide kinase. The complementary oligonucleotides are annealed and ligated to form concatemers. The double stranded concatemers are then radiolabeled by, for example, nick transcription. Hybridization is normally performed at low stringency conditions using high oligonucleotide concentrations.
- c-DNA clones can be used to produce recombinant polypeptide for example in E. coli (e.g. Qiagen QIAexpress pQE system). Recombinant polypeptides are then normally affinity purified via Ni-NTA affinity chromatography (Qiagen). Recombinant polypeptides are then used to produce specific antibodies for example by using standard techniques for rabbit immunization. Antibodies are affinity purified using a Ni- NTA column saturated with the recombinant antigen as described by Gu et al., 1994, BioTechniques 17:257-262.
- the antibody can then be used to screen expression cDNA libraries to identify identical or heterologous genes via an immunological screening (Sambrook, J. et al., 1989, "Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory Press or Ausubel, F. M. et al., 1994, “Current Protocols in Molecular Biology", John Wiley & Sons).
- the genes of the invention and their homologous ORFs in other species may also be down regulated by introducing a synthetic specific repressor.
- a gene for a chimeric zinc finger protein which binds to a specific region in the regulatory or coding region of the genes of interests or its homologs in other spezies is constructed.
- the artificial zinc finger protein comprises a specific DNA-binding domain consting for example of zinc finger and optional an repression like the EAR domain (Hiratsu et al., 2003. Plant J. 34(5), 733-739 Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis.)
- PCR reactions are run on the DNA pools with specific combinations of T-DNA or transposon border primers and gene specific primers.
- General rules for primer design can again be taken from Krysan et al., 1999 (Plant Cell 1999, 11 , 2283-2290).
- Rescreening of lower levels DNA pools lead to the identification of individual plants in which the gene of interest is disrupted by the insertional mutagen.
- These methods can as well be applied to crop populations that are mutated with insertional mutagenesis such as corn (Fernandes J, Dong Q, Schneider B, Morrow DJ, Nan GL, Brendel V, Walbot V.Genome Biol. 2004;5(10):R82. Epub 2004 Sep 23 Genome-wide mutagenesis of Zea mays L.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0515913-0A BRPI0515913A (pt) | 2004-09-24 | 2005-09-23 | célula de planta transformada, planta transformada, semente,métodos de produção de uma planta transformada, e de indução de toleráncia e/ou resistência aumentada à tensão ambiental, cassete de expressão de planta, métodos de detecção de tensão ambiental em células de planta ou plantas, e de triagem e de procriação de células de planta ou plantas, molécula de ácido nucleico isolada, polipeptìdeo isolado, anticorpo, e, planta |
| AU2005286427A AU2005286427B2 (en) | 2004-09-24 | 2005-09-23 | Plant cells and plants with increased tolerance to environmental stress |
| EP05794660.0A EP1794304B1 (en) | 2004-09-24 | 2005-09-23 | Plant cells and plants with increased tolerance to environmental stress |
| CA002579927A CA2579927A1 (en) | 2004-09-24 | 2005-09-23 | Plant cells and plants with increased tolerance to environmental stress |
| US11/663,915 US20090217406A1 (en) | 2003-04-15 | 2005-09-23 | Plant cells and plants with increased tolerance to environmental stress |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US61315404P | 2004-09-24 | 2004-09-24 | |
| US60/613,154 | 2004-09-24 | ||
| US61873704P | 2004-10-14 | 2004-10-14 | |
| US60/618,737 | 2004-10-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006032707A2 true WO2006032707A2 (en) | 2006-03-30 |
| WO2006032707A3 WO2006032707A3 (en) | 2006-12-07 |
Family
ID=36090375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/055023 Ceased WO2006032707A2 (en) | 2003-04-15 | 2005-09-23 | Plant cells and plants with increased tolerance to environmental stress |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1794304B1 (OSRAM) |
| AU (1) | AU2005286427B2 (OSRAM) |
| CA (1) | CA2579927A1 (OSRAM) |
| MX (1) | MX2007003357A (OSRAM) |
| WO (1) | WO2006032707A2 (OSRAM) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008077892A1 (en) * | 2006-12-22 | 2008-07-03 | Basf Plant Science Gmbh | Peroxidase gene nematode inducible promotors and methods of use |
| WO2008092659A1 (en) * | 2007-02-01 | 2008-08-07 | Enza Zaden Beheer B.V. | Disease resistant plants |
| DE112008001453T5 (de) | 2007-05-22 | 2010-04-29 | Basf Plant Science Gmbh | Pflanzenzellen und Pflanzen mit erhöhter Toleranz und/oder Resistenz gegenüber Umweltstress und erhöhter Biomasseproduktion-KO |
| EP2392662A2 (en) | 2007-04-23 | 2011-12-07 | Basf Se | Plant produtivity enhancement by combining chemical agents with transgenic modifications |
| EP2455475A1 (en) * | 2007-02-01 | 2012-05-23 | Enza Zaden Beheer B.V. | Disease resistant plants |
| CN102766196A (zh) * | 2011-05-06 | 2012-11-07 | 上海医药工业研究院 | 一组阳离子抗菌肽及其制备方法和应用 |
| EP2602263A3 (en) * | 2007-11-21 | 2013-11-13 | Roskilde Universitet | Polypeptides comprising an ice-binding activity |
| US10501754B2 (en) | 2007-02-01 | 2019-12-10 | Enza Zaden Beheer B.V. | Disease resistant potato plants |
| US10597675B2 (en) | 2013-07-22 | 2020-03-24 | Scienza Biotechnologies 5 B.V. | Downy mildew resistance providing genes in sunflower |
| US10787673B2 (en) | 2007-02-01 | 2020-09-29 | Enza Zaden Beheer B.V. | Disease resistant Brassica plants |
| EP3780946A4 (en) * | 2018-04-18 | 2022-03-30 | Pioneer Hi-Bred International, Inc. | IMPROVEMENT OF AGRONOMIC CHARACTERISTICS IN MAIZE BY MODIFICATION OF ENDOGENOUS MADS BOX TRANSCRIPTION FACTORS |
| US11299746B2 (en) | 2014-06-18 | 2022-04-12 | Enza Zaden Beheer B.V. | Disease resistant pepper plants |
| WO2022177484A1 (en) * | 2021-02-19 | 2022-08-25 | Erik Andreasson | Method of providing broad-spectrum resistance to plants, and plants thus obtained |
| US11685926B2 (en) | 2007-02-01 | 2023-06-27 | Enza Zaden Beheer B.V. | Disease resistant onion plants |
| US12173302B2 (en) | 2014-01-14 | 2024-12-24 | Enza Zaden Beheer B.V. | Disease resistant petunia plants |
| US12234470B2 (en) | 2018-04-18 | 2025-02-25 | Pioneer Hi-Bred International, Inc. | Genes, constructs and maize event DP-202216-6 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101326017B1 (ko) * | 2010-10-27 | 2013-11-07 | 한국생명공학연구원 | 남세균 유래 내염성 SyGT 유전자 및 이의 용도 |
Citations (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4024222A (en) | 1973-10-30 | 1977-05-17 | The Johns Hopkins University | Nucleic acid complexes |
| US4283393A (en) | 1979-03-13 | 1981-08-11 | Merck & Co., Inc. | Topical application of interferon inducers |
| WO1984002913A1 (en) | 1983-01-17 | 1984-08-02 | Monsanto Co | Chimeric genes suitable for expression in plant cells |
| EP0249676A2 (en) | 1986-01-28 | 1987-12-23 | Sandoz Ltd. | Method for the expression of genes in plants |
| EP0291533A1 (en) | 1986-12-03 | 1988-11-23 | University Patents Inc | RNA RIBOZYME POLYMERASES, RESORIBONUCLEASE DEORPHOSPHORYLASES AND METHODS. |
| US4801100A (en) | 1985-03-15 | 1989-01-31 | Inco Alloys International, Inc. | System for discharging ball mills |
| US4801340A (en) | 1986-06-12 | 1989-01-31 | Namiki Precision Jewel Co., Ltd. | Method for manufacturing permanent magnets |
| EP0321201A2 (en) | 1987-12-15 | 1989-06-21 | Gene Shears Pty. Limited | Ribozymes |
| EP0360257A2 (en) | 1988-09-20 | 1990-03-28 | The Board Of Regents For Northern Illinois University | RNA catalyst for cleaving specific RNA sequences |
| US4962028A (en) | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
| EP0397687A1 (en) | 1987-12-21 | 1990-11-22 | Upjohn Co | TRANSFORMATION BY AGROBACTERIUM OF GERMINATION PLANT SEEDS. |
| US5010323A (en) | 1988-05-09 | 1991-04-23 | Hoffman Clifford J | Interactive overlay driven computer display system |
| EP0424047A1 (en) | 1989-10-17 | 1991-04-24 | Pioneer Hi-Bred International, Inc. | Tissue culture method for transformation of plant cells |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| WO1991013980A1 (en) | 1990-03-16 | 1991-09-19 | Calgene, Inc. | Novel sequences preferentially expressed in early seed development and methods related thereto |
| US5116742A (en) | 1986-12-03 | 1992-05-26 | University Patents, Inc. | RNA ribozyme restriction endoribonucleases and methods |
| US5164310A (en) | 1988-06-01 | 1992-11-17 | The Texas A&M University System | Method for transforming plants via the shoot apex |
| WO1993007256A1 (en) | 1991-10-07 | 1993-04-15 | Ciba-Geigy Ag | Particle gun for introducing dna into intact cells |
| US5231020A (en) | 1989-03-30 | 1993-07-27 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| WO1994000977A1 (fr) | 1992-07-07 | 1994-01-20 | Japan Tobacco Inc. | Procede de transformation d'une monocotyledone |
| US5352605A (en) | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
| WO1995006722A1 (en) | 1993-09-03 | 1995-03-09 | Japan Tobacco Inc. | Method of transforming monocotyledon by using scutellum of immature embryo |
| WO1995015389A2 (en) | 1993-12-02 | 1995-06-08 | Olsen Odd Arne | Promoter |
| WO1995023230A1 (en) | 1994-02-24 | 1995-08-31 | Olsen Odd Arne | Promoter from a lipid transfer protein gene |
| US5496698A (en) | 1992-08-26 | 1996-03-05 | Ribozyme Pharmaceuticals, Inc. | Method of isolating ribozyme targets |
| US5504200A (en) | 1983-04-15 | 1996-04-02 | Mycogen Plant Science, Inc. | Plant gene expression |
| US5510474A (en) | 1988-05-17 | 1996-04-23 | Mycogen Plant Science, Inc. | Plant ubiquitin promoter system |
| US5593874A (en) | 1992-03-19 | 1997-01-14 | Monsanto Company | Enhanced expression in plants |
| US5608152A (en) | 1986-07-31 | 1997-03-04 | Calgene, Inc. | Seed-specific transcriptional regulation |
| WO1997032016A1 (en) | 1996-03-01 | 1997-09-04 | The Ohio State Research Foundation | Method for transforming plant tissue |
| US5698425A (en) | 1990-08-20 | 1997-12-16 | Novartis Finance Corporation | Method of protecting plants by transformation with genes for the synthesis of antipathogenic substances |
| US5712135A (en) | 1990-11-23 | 1998-01-27 | Plant Genetic Systems, N.V. | Process for transforming monocotyledonous plants |
| US5767366A (en) | 1991-02-19 | 1998-06-16 | Louisiana State University Board Of Supervisors, A Governing Body Of Louisiana State University Agricultural And Mechanical College | Mutant acetolactate synthase gene from Ararbidopsis thaliana for conferring imidazolinone resistance to crop plants |
| US5773260A (en) | 1989-09-25 | 1998-06-30 | Innovir Laboratories, Inc. | Ribozyme compositions and expression vectors |
| US5789214A (en) | 1988-03-08 | 1998-08-04 | Novartis Finance Corporation | Method of inducing gene transcription in a plant |
| US5795715A (en) | 1991-12-18 | 1998-08-18 | Cis Bio International | Process for preparing double-stranded RNA, and its applications |
| US5804693A (en) | 1988-03-08 | 1998-09-08 | Novartis Finance Corporation | Chemically regulatable and anti-pathogenic DNA sequences and uses thereof |
| WO1998045461A1 (en) | 1997-04-09 | 1998-10-15 | Rhone-Poulenc Agro | An oleosin 5' regulatory region for the modification of plant seed lipid composition |
| WO1999016890A2 (en) | 1997-09-30 | 1999-04-08 | The Regents Of The University Of California | Production of proteins in plant seeds |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US5990387A (en) | 1988-06-10 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US6004804A (en) | 1998-05-12 | 1999-12-21 | Kimeragen, Inc. | Non-chimeric mutational vectors |
| US6025541A (en) | 1994-09-08 | 2000-02-15 | American Cyanamid Company | Method of using as a selectable marker a nucleic acid containing AHAS promoter useful for expression of introduced genes in plants |
| WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| WO2000044895A1 (de) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Verfahren und medikament zur hemmung der expression eines vorgegebenen gens |
| WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
| US6110736A (en) | 1993-01-29 | 2000-08-29 | Purdue Research Foundation | Site-directed recombination in plants |
| WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
| WO2000068374A1 (en) | 1999-05-10 | 2000-11-16 | Syngenta Participations Ag | Regulation of viral gene expression |
| WO2001052620A2 (en) | 2000-01-21 | 2001-07-26 | The Scripps Research Institute | Methods and compositions to modulate expression in plants |
| WO2002009797A1 (en) | 2000-08-02 | 2002-02-07 | Becton Dickinson And Company | Pen needle and safety shield system |
| WO2003020015A2 (en) | 2001-08-30 | 2003-03-13 | Purdue Research Foundation | Methods to produce transgenic plants resistant to osmotic stress |
| US20040031072A1 (en) | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| WO2004092349A2 (en) | 2003-04-15 | 2004-10-28 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance to environmental stress |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2420555C (en) * | 2000-08-24 | 2012-10-23 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
| WO2002022675A2 (en) * | 2000-09-15 | 2002-03-21 | Syngenta Participations Ag | Plant genes, the expression of which are altered by pathogen infection |
| ATE429502T1 (de) * | 2001-05-31 | 2009-05-15 | Performance Plants Inc | Zusammensetzungen und methoden für eine erhöhung der stresstoleranz in pflanzen |
| EP2316953A3 (en) * | 2003-10-20 | 2011-10-05 | CropDesign N.V. | Identification of novel E2F target genes and use thereof |
-
2005
- 2005-09-23 AU AU2005286427A patent/AU2005286427B2/en not_active Expired - Fee Related
- 2005-09-23 CA CA002579927A patent/CA2579927A1/en not_active Abandoned
- 2005-09-23 WO PCT/EP2005/055023 patent/WO2006032707A2/en not_active Ceased
- 2005-09-23 EP EP05794660.0A patent/EP1794304B1/en not_active Expired - Lifetime
-
2007
- 2007-03-22 MX MX2007003357A patent/MX2007003357A/es active IP Right Grant
Patent Citations (64)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4130641A (en) | 1973-10-30 | 1978-12-19 | Ts O Paul O P | Induction of interferon production by modified nucleic acid complexes |
| US4024222A (en) | 1973-10-30 | 1977-05-17 | The Johns Hopkins University | Nucleic acid complexes |
| US4283393A (en) | 1979-03-13 | 1981-08-11 | Merck & Co., Inc. | Topical application of interferon inducers |
| US5352605A (en) | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
| WO1984002913A1 (en) | 1983-01-17 | 1984-08-02 | Monsanto Co | Chimeric genes suitable for expression in plant cells |
| US5504200A (en) | 1983-04-15 | 1996-04-02 | Mycogen Plant Science, Inc. | Plant gene expression |
| US4801100A (en) | 1985-03-15 | 1989-01-31 | Inco Alloys International, Inc. | System for discharging ball mills |
| EP0249676A2 (en) | 1986-01-28 | 1987-12-23 | Sandoz Ltd. | Method for the expression of genes in plants |
| US4801340A (en) | 1986-06-12 | 1989-01-31 | Namiki Precision Jewel Co., Ltd. | Method for manufacturing permanent magnets |
| US4962028A (en) | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
| US5608152A (en) | 1986-07-31 | 1997-03-04 | Calgene, Inc. | Seed-specific transcriptional regulation |
| US4987071A (en) | 1986-12-03 | 1991-01-22 | University Patents, Inc. | RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods |
| US6025167A (en) | 1986-12-03 | 2000-02-15 | Competitive Technologies, Inc. | RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods |
| EP0291533A1 (en) | 1986-12-03 | 1988-11-23 | University Patents Inc | RNA RIBOZYME POLYMERASES, RESORIBONUCLEASE DEORPHOSPHORYLASES AND METHODS. |
| US5116742A (en) | 1986-12-03 | 1992-05-26 | University Patents, Inc. | RNA ribozyme restriction endoribonucleases and methods |
| EP0321201A2 (en) | 1987-12-15 | 1989-06-21 | Gene Shears Pty. Limited | Ribozymes |
| US5169770A (en) | 1987-12-21 | 1992-12-08 | The University Of Toledo | Agrobacterium mediated transformation of germinating plant seeds |
| EP0397687A1 (en) | 1987-12-21 | 1990-11-22 | Upjohn Co | TRANSFORMATION BY AGROBACTERIUM OF GERMINATION PLANT SEEDS. |
| US5376543A (en) | 1987-12-21 | 1994-12-27 | The University Of Toledo | Agrobacterium mediated transformation of germinating plant seeds |
| US5804693A (en) | 1988-03-08 | 1998-09-08 | Novartis Finance Corporation | Chemically regulatable and anti-pathogenic DNA sequences and uses thereof |
| US5789214A (en) | 1988-03-08 | 1998-08-04 | Novartis Finance Corporation | Method of inducing gene transcription in a plant |
| US5010323A (en) | 1988-05-09 | 1991-04-23 | Hoffman Clifford J | Interactive overlay driven computer display system |
| US6020190A (en) | 1988-05-17 | 2000-02-01 | Mycogen Plant Science, Inc. | Plant ubiquitin promoter system |
| US5510474A (en) | 1988-05-17 | 1996-04-23 | Mycogen Plant Science, Inc. | Plant ubiquitin promoter system |
| US5164310A (en) | 1988-06-01 | 1992-11-17 | The Texas A&M University System | Method for transforming plants via the shoot apex |
| US5990387A (en) | 1988-06-10 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| EP0360257A2 (en) | 1988-09-20 | 1990-03-28 | The Board Of Regents For Northern Illinois University | RNA catalyst for cleaving specific RNA sequences |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5283184A (en) | 1989-03-30 | 1994-02-01 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5231020A (en) | 1989-03-30 | 1993-07-27 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5773260A (en) | 1989-09-25 | 1998-06-30 | Innovir Laboratories, Inc. | Ribozyme compositions and expression vectors |
| EP0424047A1 (en) | 1989-10-17 | 1991-04-24 | Pioneer Hi-Bred International, Inc. | Tissue culture method for transformation of plant cells |
| US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
| WO1991013980A1 (en) | 1990-03-16 | 1991-09-19 | Calgene, Inc. | Novel sequences preferentially expressed in early seed development and methods related thereto |
| US5698425A (en) | 1990-08-20 | 1997-12-16 | Novartis Finance Corporation | Method of protecting plants by transformation with genes for the synthesis of antipathogenic substances |
| US5712135A (en) | 1990-11-23 | 1998-01-27 | Plant Genetic Systems, N.V. | Process for transforming monocotyledonous plants |
| US5767366A (en) | 1991-02-19 | 1998-06-16 | Louisiana State University Board Of Supervisors, A Governing Body Of Louisiana State University Agricultural And Mechanical College | Mutant acetolactate synthase gene from Ararbidopsis thaliana for conferring imidazolinone resistance to crop plants |
| US6225105B1 (en) | 1991-02-19 | 2001-05-01 | Louisiana State University Board Of Supervisors A Governing Body Of Louisiana State University Agricultural And Mechancial College | Mutant acetolactate synthase gene from Arabidopsis thaliana for conferring imidazolinone resistance to crop plants |
| WO1993007256A1 (en) | 1991-10-07 | 1993-04-15 | Ciba-Geigy Ag | Particle gun for introducing dna into intact cells |
| US5795715A (en) | 1991-12-18 | 1998-08-18 | Cis Bio International | Process for preparing double-stranded RNA, and its applications |
| US5593874A (en) | 1992-03-19 | 1997-01-14 | Monsanto Company | Enhanced expression in plants |
| WO1994000977A1 (fr) | 1992-07-07 | 1994-01-20 | Japan Tobacco Inc. | Procede de transformation d'une monocotyledone |
| US5496698A (en) | 1992-08-26 | 1996-03-05 | Ribozyme Pharmaceuticals, Inc. | Method of isolating ribozyme targets |
| US6110736A (en) | 1993-01-29 | 2000-08-29 | Purdue Research Foundation | Site-directed recombination in plants |
| WO1995006722A1 (en) | 1993-09-03 | 1995-03-09 | Japan Tobacco Inc. | Method of transforming monocotyledon by using scutellum of immature embryo |
| WO1995015389A2 (en) | 1993-12-02 | 1995-06-08 | Olsen Odd Arne | Promoter |
| WO1995023230A1 (en) | 1994-02-24 | 1995-08-31 | Olsen Odd Arne | Promoter from a lipid transfer protein gene |
| US6025541A (en) | 1994-09-08 | 2000-02-15 | American Cyanamid Company | Method of using as a selectable marker a nucleic acid containing AHAS promoter useful for expression of introduced genes in plants |
| WO1997032016A1 (en) | 1996-03-01 | 1997-09-04 | The Ohio State Research Foundation | Method for transforming plant tissue |
| WO1998045461A1 (en) | 1997-04-09 | 1998-10-15 | Rhone-Poulenc Agro | An oleosin 5' regulatory region for the modification of plant seed lipid composition |
| WO1999016890A2 (en) | 1997-09-30 | 1999-04-08 | The Regents Of The University Of California | Production of proteins in plant seeds |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US6004804A (en) | 1998-05-12 | 1999-12-21 | Kimeragen, Inc. | Non-chimeric mutational vectors |
| WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| WO2000044895A1 (de) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Verfahren und medikament zur hemmung der expression eines vorgegebenen gens |
| WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
| WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
| US20040031072A1 (en) | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| WO2000068374A1 (en) | 1999-05-10 | 2000-11-16 | Syngenta Participations Ag | Regulation of viral gene expression |
| WO2001052620A2 (en) | 2000-01-21 | 2001-07-26 | The Scripps Research Institute | Methods and compositions to modulate expression in plants |
| WO2002009797A1 (en) | 2000-08-02 | 2002-02-07 | Becton Dickinson And Company | Pen needle and safety shield system |
| WO2003020015A2 (en) | 2001-08-30 | 2003-03-13 | Purdue Research Foundation | Methods to produce transgenic plants resistant to osmotic stress |
| WO2004092349A2 (en) | 2003-04-15 | 2004-10-28 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance to environmental stress |
Non-Patent Citations (161)
| Title |
|---|
| ALLEN, PLANT PHYSIOL., vol. 107, 1995, pages 1049 - 1054 |
| ALTSCHUL ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 410 |
| ANANDALAKSHMI R ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 22, 1998, pages 13079 - 84 |
| ANGELL, SM ET AL., PLANT J., vol. 20, no. 3, 1999, pages 357 - 362 |
| ANSARI AZ ET AL., CHEM. BIOL., vol. 8, no. 6, 2001, pages 583 - 92 |
| ARKIN; YOURVAN, PNAS, vol. 89, 1992, pages 7811 - 7815 |
| BABIC ET AL., PLANT CELL REP, vol. 17, 1998, pages 183 - 188 |
| BAEUMLEIN ET AL., PLANT J., vol. 2, no. 2, 1992, pages 233 - 239 |
| BAJAJ ET AL., MOLECULAR BREEDING, vol. 5, no. 6, 1999, pages 493 - 503 |
| BARTEL D; SZOSTAK JW, SCIENCE, vol. 261, 1993, pages 1411 - 1418 |
| BARTEL, D.; SZOSTAK, J.W., SCIENCE, vol. 261, 1993, pages 1411 - 1418 |
| BAYLEY CC ET AL., PLANT MOL. BIOL., vol. 18, no. 2, 1992, pages 353 - 361 |
| BECHTOLD, N.; ELLIS, J.; PELLETIER, G.: "In planta Agrobacterium mediated gene transfer by infiltration of Arabidopsis thaliana plants", C. R. ACAD. SCI. PARIS, vol. 316, 1993, pages 1194 - 1199 |
| BEERLI RR ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 25, 1998, pages 14628 - 14633 |
| BENFEY ET AL., EMBO J., vol. 8, 1989, pages 2195 - 2202 |
| BENT, A. F.; CLOUGH, J. C.: "Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana", PLANT J., vol. 16, 1998, pages 735 - 743 |
| BEVAN, NUCLEIC ACID RESEARCH, vol. 12, 1984, pages 8711 - 8721 |
| BIOCHEMISTRY IN: LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 17 |
| BOYER., SCIENCE, vol. 218, 1982, pages 443 - 448 |
| BRAY, TRENDS PLANT SCI., vol. 2, 1997, pages 48 - 54 |
| BREMER RE ET AL., BIOORG. MED. CHEM., vol. 9, no. 8, 2001, pages 2093 - 103 |
| CALLIS ET AL., J. BIOL. CHEM., vol. 265, 1990, pages 12486 - 12493 |
| CHIANG SY ET AL., J. BIOL. CHEM., vol. 275, no. 32, 2000, pages 24246 - 54 |
| CHIRGWIN ET AL., BIOCHEMISTRY, vol. 18, 1979, pages 5294 - 5299 |
| COLE-STRAUSS ET AL., NUCL. ACIDS RES., vol. 27, no. 5, 1999, pages 1323 - 1330 |
| COONEY ET AL., SCIENCE, vol. 241, 1988, pages 456 - 459 |
| DE BLOCK ET AL., EMBO J., vol. 6, 1987, pages 2513 - 2518 |
| DE BLOCK ET AL., PLANT PHYSIOL., vol. 91, 1989, pages 694 - 701 |
| DE FEYTER R ET AL., MOL. GEN. GENET., vol. 250, no. 3, 1996, pages 329 - 338 |
| DEBLAERE ET AL., NUCL. ACIDS. RES., vol. 13, 1994, pages 4777 - 4788 |
| DELGRAVE ET AL., POLYPEPTIDE ENGINEERING, vol. 6, no. 3, 1993, pages 327 - 331 |
| DERVAN PB, PROC. NATL. ACAD. SCI. USA, vol. 98, no. 8, 2001, pages 4103 - 8 |
| DERVAN PB; BURII RW, CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 3, 1999, pages 688 - 693 |
| DREIER B ET AL., J. BIOL. CHEM., vol. 276, no. 31, 2001, pages 29466 - 78 |
| FAGARD M; VAUCHERET H, PLANT MOL. BIOL., vol. 43, no. 2-3, 2000, pages 285 - 93 |
| FAMULOK M; MAYER G, CURR. TOP MICROBIOL. IMMUNOL., vol. 243, 1999, pages 123 - 36 |
| FERNANDES J; DONG Q; SCHNEIDER B; MORROW DJ; NAN GL; BRENDEL V; WALBOT V., GENOME BIOL, vol. 5, no. 10, 2004, pages R82 |
| FIRE A. ET AL., NATURE, vol. 391, 1998, pages 806 - 811 |
| FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294 |
| FRANKEN E ET AL., CURR. OPIN. BIOTECHNOL., vol. 8, no. 4, 1997, pages 411 - 416 |
| FROMM ET AL., BIOTECH, vol. 8, 1990, pages 833 - 839 |
| GAULTIER ET AL., NUCLEIC ACIDS. RES., vol. 15, 1987, pages 6625 - 6641 |
| GAUTIER C ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 6625 - 6641 |
| GIELEN ET AL., EMBO J., vol. 3, 1984, pages 835 |
| GIRKE, T., THE PLANT JOURNAL, vol. 15, 1998, pages 39 - 48 |
| GORING ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 1770 - 1774 |
| GOTTESFELD JM ET AL., GENE EXPR., vol. 9, no. 1-2, 2000, pages 77 - 91 |
| GOTTESFELD JM ET AL., J. MOL. BIOL., vol. 309, no. 3, 2001, pages 615 - 29 |
| GROVES, J.T., CURR. OPIN. CHEM. BIOL., vol. 3, no. 2, 1999, pages 226 - 235 |
| GU ET AL., BIOTECHNIQUES, vol. 17, 1994, pages 257 - 262 |
| GUAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, no. 20, 2002, pages 13296 - 13301 |
| GUAN, PROC. NATL. ACAD. SCI. USA, vol. 99, no. 20, 2002, pages 13296 |
| HAJDUKIEWICZ, P. ET AL., PLANT MOL. BIOL., vol. 25, 1994, pages 989 - 994 |
| HAJUKIEWICZ, P. ET AL., PLANT MOL. BIOL., vol. 25, 1994, pages 989 - 994 |
| HASELHOFF; GERLACH, NATURE, vol. 310, 1988, pages 585 - 591 |
| HASELHOFF; GERLACH, NATURE, vol. 334, 1988, pages 585 - 591 |
| HASELOFF ET AL., NATURE, vol. 310, 1988, pages 585 - 591 |
| HELENE C ET AL., ANN. NY ACAD. SCI., vol. 660, 1992, pages 27 - 36 |
| HELENE C, ANTICANCER DRUG RES., vol. 6, no. 6, 1991, pages 569 - 84 |
| HELENE, C. ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 27 - 36 |
| HELENE, C., ANTICANCER DRUG DES., vol. 6, no. 6, 1991, pages 569 - 84 |
| HELLENS ET AL., TRENDS IN PLANT SCIENCE, vol. 5, 2000, pages 446 - 451 |
| HERSKOWITZ I, NATURE, vol. 329, no. 6136, 1987, pages 219 - 22 |
| HIGGENS ET AL., CABIOS, vol. 5, 1989, pages 151 - 153 |
| HIRATSU ET AL., PLANT J., vol. 34, no. 5, 2003, pages 733 - 739 |
| HOEKEMA ET AL., NATURE, vol. 303, 1983, pages 179 - 180 |
| HOFGEN; WILLMITZER, PLANT SCIENCE, vol. 66, 1990, pages 221 - 230 |
| HOHN B; PUCHTA, H. PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 8321 - 8323 |
| IKE ET AL., NUCLEIC ACID RES., vol. 11, 1983, pages 477 |
| INOUE ET AL., FEBS LETT, vol. 215, 1987, pages 327 - 330 |
| INOUE ET AL., FEBS LETT., vol. 215, 1987, pages 327 - 330 |
| INOUE ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 6131 - 6148 |
| ISHIDA ET AL., NATURE BIOTECH, 1996, pages 14745 - 50 |
| ITAKURA ET AL., ANNU. REV. BIOCHEM., vol. 53, 1984, pages 323 |
| ITAKURA ET AL., SCIENCE, vol. 198, 1984, pages 1056 |
| J. BIOL. CHEM., vol. 275, no. 42, 2000, pages 32617 - 32627 |
| J. MOL. BIOL., vol. 303, no. 4, 2000, pages 489 - 502 |
| J. MOL. EVOLUTION., vol. 25, 1987, pages 351 - 360 |
| JEON ET AL., PLANT J., vol. 22, 2000, pages 561 - 570 |
| JORGENSEN ET AL., PLANT MOL. BIOL., vol. 31, no. 5, 1996, pages 957 - 973 |
| KANG JS; KIM JS, J. BIOL. CHEM., vol. 275, no. 12, 2000, pages 8742 - 8748 |
| KAWALLECK ET AL., PLANT. MOLECULAR BIOLOGY, vol. 21, 1993, pages 673 - 684 |
| KERMODE, CRIT. REV. PLANT SCI., vol. 15, no. 4, 1996, pages 285 - 423 |
| KERMODE, CRIT. REV. PLANT SCI., vol. 4, no. 15, 1996, pages 285 - 423 |
| KIM JS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, no. 8, 1997, pages 3616 - 3620 |
| KLUG A, J. MOL. BIOL., vol. 293, no. 2, 1999, pages 215 - 218 |
| KMIEC, GENE THERAPY AMERICAN SCIENTIST, vol. 87, no. 3, 1999, pages 240 - 247 |
| KONCZ ET AL., PLANT MOL. BIOL., vol. 20, no. 5, 1992, pages 963 - 976 |
| KONCZ; SCHELL, MOL. GEN. GENET., vol. 204, 1986, pages 383 - 396 |
| KOPREK ET AL., PLANT J., vol. 24, 2000, pages 253 - 263 |
| KRYSAN ET AL., PLANT CELL, vol. 11, 1999, pages 2283 - 2290 |
| LAGNA G; HEMMATI-BRIVANLOU A, CURRENT TOPICS IN DEVELOPMENTAL BIOLOGY, vol. 36, 1998, pages 75 - 98 |
| LIGHTNER; CASPAR, METHODS IN MOLECULAR BIOLOGY, vol. 82 |
| LIU Y-G; MITSUKAWA N; OOSUMI T; WHITTIER RF, PLANT J., vol. 8, 1995, pages 457 - 463 |
| LLOYD AM; DAVIS RW ET AL., MOL. GEN. GENET., vol. 242, no. 6, 1994, pages 653 - 657 |
| MAHER LJ, BIOASSAYS, vol. 14, no. 12, 1992, pages 807 - 815 |
| MAHER, L.J., BIOASSAYS, vol. 14, no. 12, 1992, pages 807 - 15 |
| MAPP AK ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, no. 8, 2000, pages 3930 - 3935 |
| MATZKE MA ET AL., PLANT MOL. BIOL., vol. 43, 2000, pages 401 - 415 |
| MCKERSIE ET AL., PLANT PHYSIOL., vol. 111, 1996, pages 1177 - 1181 |
| MCKERSIE ET AL., PLANT PHYSIOLOGY, vol. 119, 1999, pages 839 - 847 |
| MEINKOTH; WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
| MENGISTE; AMEDEO; PASZKOWSKI, PLANT J., vol. 12, 1997, pages 945 - 948 |
| MLYNAROVA ET AL., PLANT CELL REPORT, vol. 13, 1994, pages 282 - 285 |
| MOL JN ET AL., FEBS LETT, vol. 268, no. 2, 1990, pages 427 - 430 |
| MOLONEY ET AL., PLANT CELL REPORTS, vol. 8, 1989, pages 238 - 242 |
| MOSER ET AL., SCIENCE, vol. 238, 1987, pages 645 - 650 |
| NAPOLI ET AL., PLANT CELL, vol. 2, 1990, pages 279 - 289 |
| NAPOLI ET AL., THE PLANT CELL, vol. 2, 1990, pages 279 - 289 |
| NAT. BIOTECHNOL., vol. 20, no. 10, October 2002 (2002-10-01), pages 1030 - 4 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
| NI ET AL., PLANT JOURNAL, vol. 7, 1995, pages 661 - 676 |
| ODELL ET AL., MOL. GEN. GENET., vol. 223, 1990, pages 369 - 378 |
| OOMS ET AL., PLASMID, vol. 7, 1982, pages 15 - 29 |
| ORDIZ MI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, no. 20, 2002, pages 13290 - 13295 |
| ORDIZ MI, PROC. NATL. ACAD. SCI. USA, vol. 99, no. 20, 2002, pages 13290 |
| OWEN M ET AL., BIOTECHNOLOGY (NY), vol. 10, no. 7, 1992, pages 790 - 794 |
| PERLMUTTER RM; ALBEROLA-ILA J, CURRENT OPINION IN IMMUNOLOGY, vol. 8, no. 2, 1996, pages 285 - 90 |
| PROC. NATL. ACAD. SCI. USA, vol. 97, no. 4, 2000, pages 1495 - 1500 |
| PUTTARAJU ET AL.: "Spliceosome-mediated RNA trans-splicing as a tool for gene therapy", NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 246 - 252 |
| RATCLIFF F ET AL., PLANT J., vol. 25, no. 2, 2001, pages 237 - 45 |
| RUIZ MT, PLANT CELL, vol. 10, no. 6, 1998, pages 937 - 46 |
| RYU CH; YOU JH; KANG HG; HUR J; KIM YH; HAN MJ; AN K; CHUNG BC; LEE CH; AN G., PLANT MOL BIOL., vol. 54, no. 4, March 2004 (2004-03-01), pages 489 - 502 |
| SALLAUD C; GAY C; LARMANDE P; BES M; PIFFANELLI P; PIEGU B; DROC G; REGAD F; BOURGEOIS E; MEYNARD D, PLANT J., vol. 39, no. 3, August 2004 (2004-08-01), pages 450 - 64 |
| SCHWEIZER P ET AL., PLANT J 2000, vol. 24, 2000, pages 895 - 903 |
| SEGAL DJ; BARBAS CF, CURR. OPIN. CHEM. BIOL., vol. 4, no. 1, 2000, pages 10 - 39 |
| SESSIONS ET AL., PLANT CELL, vol. 14, 2002, pages 2985 - 2994 |
| SHAEIWITZ, J.A.; HENRY, J.D.: "Biochemical separations", ULMANN'S ENCYCLOPEDIA OF INDUSTRIAL CHEMISTRY, vol. B3, 1988, pages 1 - 27 |
| SHARROCKS AD ET AL., INT. J. BIOCHEM. CELL BIOL., vol. 29, no. 12, 1997, pages 1371 - 1387 |
| SHEEHY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 8805 - 8809 |
| SHEPPARD D, AMERICAN JOURNAL OF RESPIRATORY CELL & MOLECULAR BIOLOGY, vol. 11, no. 1, 1994, pages 1 - 6 |
| SHEVELEVA ET AL., PLANT PHYSIOL., vol. 115, 1997, pages 1211 - 1219 |
| SMITH ET AL., MOL. GEN. GENET., vol. 224, 1990, pages 447 - 481 |
| SMITH ET AL., MOL. GEN. GENETICS, vol. 224, 1990, pages 477 - 481 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489 |
| SPERTINI D; BEIIVEAU C.; BELLEMARE G., BIOTECHNIQUES, vol. 27, 1999, pages 308 - 314 |
| SPEULMANN ET AL., PLANT CELL, vol. 11, 1999, pages 1853 - 1866 |
| STEINECKE P ET AL., EMBO J, vol. 11, no. 4, 1992, pages 1525 - 1530 |
| STOCKHAUS ET AL., EMBO J., vol. 8, 1989, pages 2445 |
| STREPP ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 8, 1998, pages 4368 - 4373 |
| TANNER NK, FEMS MICROBIOL. REV., vol. 23, no. 3, 1999, pages 257 - 275 |
| TARCZYNSKI. ET AL., SCIENCE, vol. 259, 1993, pages 508 - 510 |
| TATUSOV, R.L. ET AL., SCIENCE, vol. 278, no. 5338, 1997, pages 631 - 637 |
| THOMAS KR; CAPECCHI MR, CELL, vol. 51, 1987, pages 503 |
| TISSIER ET AL., PLANT CELL, vol. 11, 1999, pages 1841 - 1852 |
| TSAI SY ET AL., ADV. DRUG DELIV. REV., vol. 30, no. 1-3, 1998, pages 23 - 31 |
| TUSCHL ET AL., GENS DEV., vol. 13, no. 24, 1999, pages 3191 - 3197 |
| VAN DER KROL ET AL., PLANT CELL, vol. 2, 1990, pages 291 - 99 |
| VAN DER KROLL ET AL., THE PLANT CELL, vol. 2, 1990, pages 291 - 299 |
| VELTEN ET AL., EMBO J., vol. 3, 1984, pages 2723 - 2730 |
| WANG CC ET AL., BIOORG. MED. CHEM., vol. 9, no. 3, 2001, pages 653 - 7 |
| WARD ET AL., PLANT. MOL. BIOL., vol. 22, 1993 |
| WATERHOUSE PM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 13959 - 64 |
| WHITELAM, TREND PLANT SCI., vol. 1, 1996, pages 286 - 272 |
| WI SOO JIN ET AL., MOLECULES AND CELLS, vol. 13, no. 2, 2002, pages 209 - 220 |
| WURTZ NR ET AL., ORG. LETT, vol. 3, no. 8, 2001, pages 1201 - 3 |
| XIONG ET AL., THE PLANT CELL, vol. 15, 2003, pages 745 - 759 |
| YANG, D. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 9942 |
| YOUNG ET AL., PLANT PHYSIOL., vol. 125, 2001, pages 513 - 518 |
| ZHANG L ET AL., J. BIOL. CHEM., vol. 275, no. 43, 2000, pages 33850 - 33860 |
| ZHU ET AL., NAT. BIOTECHNOL., vol. 18, no. 5, 2000, pages 555 - 558 |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8691962B2 (en) | 2006-12-22 | 2014-04-08 | Basf Plant Science Gmbh | Peroxidase gene nematode inducible promotors and methods of use |
| WO2008077892A1 (en) * | 2006-12-22 | 2008-07-03 | Basf Plant Science Gmbh | Peroxidase gene nematode inducible promotors and methods of use |
| US8742207B2 (en) | 2007-02-01 | 2014-06-03 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455481A3 (en) * | 2007-02-01 | 2012-07-11 | Enza Zaden Beheer B.V. | Disease resistant plants |
| JP2010517518A (ja) * | 2007-02-01 | 2010-05-27 | エンザ・ザーデン・ベヘール・ベスローテン・フェンノートシャップ | 耐病性植物 |
| US9546373B2 (en) | 2007-02-01 | 2017-01-17 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455475A1 (en) * | 2007-02-01 | 2012-05-23 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455474A1 (en) * | 2007-02-01 | 2012-05-23 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455473A1 (en) * | 2007-02-01 | 2012-05-23 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455476A1 (en) * | 2007-02-01 | 2012-05-23 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455477A3 (en) * | 2007-02-01 | 2012-06-13 | Enza Zaden Beheer B.V. | Disease resistant plants |
| US11685926B2 (en) | 2007-02-01 | 2023-06-27 | Enza Zaden Beheer B.V. | Disease resistant onion plants |
| EP2455479A3 (en) * | 2007-02-01 | 2012-07-11 | Enza Zaden Beheer B.V. | Disease resistant plants |
| US9932600B2 (en) | 2007-02-01 | 2018-04-03 | Enza Zaden Beheer B.V. | Disease resistant tomato plants |
| EP2455480A3 (en) * | 2007-02-01 | 2012-07-18 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455483A3 (en) * | 2007-02-01 | 2012-08-08 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455482A3 (en) * | 2007-02-01 | 2012-08-15 | Enza Zaden Beheer B.V. | Disease resistant plants |
| US10787673B2 (en) | 2007-02-01 | 2020-09-29 | Enza Zaden Beheer B.V. | Disease resistant Brassica plants |
| US10501754B2 (en) | 2007-02-01 | 2019-12-10 | Enza Zaden Beheer B.V. | Disease resistant potato plants |
| WO2008092505A1 (en) * | 2007-02-01 | 2008-08-07 | Enza Zaden Beheer B.V. | Disease resistant plants |
| US9994861B2 (en) | 2007-02-01 | 2018-06-12 | Enza Zaden Beheer B.V. | Disease resistant grape plants |
| WO2008092659A1 (en) * | 2007-02-01 | 2008-08-07 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2455478A3 (en) * | 2007-02-01 | 2012-06-13 | Enza Zaden Beheer B.V. | Disease resistant plants |
| US9121029B2 (en) | 2007-02-01 | 2015-09-01 | Enza Zaden Beheer B.V. | Disease resistant plants |
| EP2392662A2 (en) | 2007-04-23 | 2011-12-07 | Basf Se | Plant produtivity enhancement by combining chemical agents with transgenic modifications |
| DE112008001453T5 (de) | 2007-05-22 | 2010-04-29 | Basf Plant Science Gmbh | Pflanzenzellen und Pflanzen mit erhöhter Toleranz und/oder Resistenz gegenüber Umweltstress und erhöhter Biomasseproduktion-KO |
| US8859230B2 (en) | 2007-11-21 | 2014-10-14 | Roskilde Universitet | Polypeptides comprising an ice-binding activity |
| US10266576B2 (en) | 2007-11-21 | 2019-04-23 | Roskilde Universitet | Polypeptides comprising an ice-binding activity |
| EP2602263A3 (en) * | 2007-11-21 | 2013-11-13 | Roskilde Universitet | Polypeptides comprising an ice-binding activity |
| US9241511B2 (en) | 2007-11-21 | 2016-01-26 | Roskilde Universitet | Polypeptides comprising an ice-binding activity |
| CN102766196B (zh) * | 2011-05-06 | 2014-10-29 | 上海医药工业研究院 | 一组阳离子抗菌肽及其制备方法和应用 |
| CN102766196A (zh) * | 2011-05-06 | 2012-11-07 | 上海医药工业研究院 | 一组阳离子抗菌肽及其制备方法和应用 |
| US10597675B2 (en) | 2013-07-22 | 2020-03-24 | Scienza Biotechnologies 5 B.V. | Downy mildew resistance providing genes in sunflower |
| US12173302B2 (en) | 2014-01-14 | 2024-12-24 | Enza Zaden Beheer B.V. | Disease resistant petunia plants |
| US11299746B2 (en) | 2014-06-18 | 2022-04-12 | Enza Zaden Beheer B.V. | Disease resistant pepper plants |
| EP3780946A4 (en) * | 2018-04-18 | 2022-03-30 | Pioneer Hi-Bred International, Inc. | IMPROVEMENT OF AGRONOMIC CHARACTERISTICS IN MAIZE BY MODIFICATION OF ENDOGENOUS MADS BOX TRANSCRIPTION FACTORS |
| US12234470B2 (en) | 2018-04-18 | 2025-02-25 | Pioneer Hi-Bred International, Inc. | Genes, constructs and maize event DP-202216-6 |
| US12371702B2 (en) | 2018-04-18 | 2025-07-29 | Pioneer Hi-Bred International, Inc. | Improving agronomic characteristics in maize by modification of endogenous mads box transcription factors |
| US12553060B2 (en) | 2018-04-18 | 2026-02-17 | Pioneer Hi-Bred International, Inc. | Genes, constructs and maize event DP-202216-6 |
| WO2022177484A1 (en) * | 2021-02-19 | 2022-08-25 | Erik Andreasson | Method of providing broad-spectrum resistance to plants, and plants thus obtained |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005286427A1 (en) | 2006-03-30 |
| AU2005286427B2 (en) | 2011-09-15 |
| EP1794304B1 (en) | 2013-06-19 |
| CA2579927A1 (en) | 2006-03-30 |
| WO2006032707A3 (en) | 2006-12-07 |
| MX2007003357A (es) | 2008-08-31 |
| EP1794304A2 (en) | 2007-06-13 |
| MX307545B (OSRAM) | 2013-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| MX2007003357A (es) | Células de plantas y plantas con tolerancia incrementada a tensión ambien | |
| AU2006270321B2 (en) | Yield increase in plants overexpressing the ACCDP genes | |
| US8552255B2 (en) | Nucleic acid sequences encoding proteins associated with abiotic stress response | |
| US8637736B2 (en) | Stress-related polypeptides and methods of use in plants | |
| US20090217406A1 (en) | Plant cells and plants with increased tolerance to environmental stress | |
| EP1668140A2 (en) | Regulation of plant biomass and stress tolerance | |
| US8993838B2 (en) | Yield increase in plants overexpressing the SHSRP genes | |
| CA2798495A1 (en) | Plant cells and plants with increased tolerance to environmental stress | |
| AU2006270193A1 (en) | Yield increase in plants overexpressing the MTP genes | |
| US20090055970A1 (en) | Yield increase in plants overexpressing the hsrp genes | |
| AU2011254020A1 (en) | Plant Cells and Plants with Increased Tolerance to Environmental Stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580040076.6 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005794660 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2579927 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005286427 Country of ref document: AU Ref document number: MX/a/2007/003357 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11663915 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2005286427 Country of ref document: AU Date of ref document: 20050923 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005286427 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005794660 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0515913 Country of ref document: BR |