WO2006025791A1

WO2006025791A1 - Sars detection

Info

Publication number: WO2006025791A1
Application number: PCT/SE2005/001279
Authority: WO
Inventors: Mikael Leijon; Mehrdad Mousavi-Jazi
Original assignee: Lightup Technologies Ab
Priority date: 2004-09-03
Filing date: 2005-09-02
Publication date: 2006-03-09
Also published as: SE0402128D0

Abstract

The present invention relates to novel primers and probes for the detection of a SARS nucleic acid, having an improved sensitivity and specificity. The invention also relates to a method of using these primers and probes for detection of SARS nucleic acid and a kit comprising the same.

Description

SARS detection

TECHNICAL FIELD

The present invention relates to improved means for detecting a SARS (Sever Acute Respiratory Syndrome) virus by providing novel and optimized primers and probes for amplification and detection of SARS nucleic acid.

BACKGROUND OF THE INVENTION

Severe acute respiratory syndrome (SARS) is a recently recognized febrile severe lower respiratory illness that is caused by infection with a novel coronavirus, SARS-associated coronavirus (SARS-CoV). During the winter of 2002 through the spring of 2003, WHO received reports of >8,000 SARS cases and nearly 800 deaths. In the spring of 2004 new outbreaks were recognized. Early recognition of cases and application of appropriate infection control measures will be critical in the control of future outbreaks.

The SARS virus is believed to be spread by droplets produced by coughing and sneezing, but other routes of infection may also be involved, such as faecal contamination. The mean incubation period of SARS is estimated to be 6.4 days.

Preliminary results, obtained by members of the WHO multicenter collaborative network on SARS diagnosis (see: http://www.who.int/csr/sars/survival 2003 05 04/en/index.html), show that the virus is stable in feces and urine at room temperature for at least 1-2 days. The stability seems to be higher in stools from patients with diarrhea (the pH of which is higher than that of normal stool). In supematants of infected cell cultures, there is only a minimal reduction in the concentration of the virus after 21 days at 4⁰C and -80⁰C. After 48 hours at room temperature, the concentration of the virus is reduced by one log only, indicating that the virus is more stable than the other known human coronaviruses under these conditions. However, heating to 56°C inactivates SARS-CoV relatively quickly. Knowledge of the stability of the SARS virus can be of importance in the development of effective methods for diagnosing SARS. Amplification of short regions of the polymerase gene, (the most strongly conserved part of the coronavirus genome) by reverse transcriptase polymerase chain reaction (RT-PCR) and nucleotide sequencing has revealed that the SARS virus is a novel coronavirus which has not previously been present in human populations. This conclusion is confirmed by serological (antigenic) investigations. The complete ca 29700 nucleotide sequences of many isolates of the SARS virus is now known. The sequence appears to be typical of coronaviruses, with no obviously unusual features, although there are some differences in the make up of the non-structural proteins which are unusual.

The SARS virus genome is a non-segmented, single-stranded, (+)sense RNA, 27-31 kb (dependent on virus) - the longest of any RNA virus. The SARS-CoV genome contains five major open reading frames (ORFs) that encode the replicase polyprotein; the spike (S), envelope (E), and membrane (M) glycoproteins; and the nucleocapsid protein (N).

The availability of the sequence data and functional dissection of the SARS-CoV genome is a necessary prerequisite for developing modern diagnostic tests, antiviral agents, and vaccines.

To expedite the development of better diagnostic tests, laboratories in the WHO collaborating network have made critical biological materials and reagents available to any laboratory having a sustained interest in the development of diagnostic tests, including the commercial sector. A comprehensive bank of clinical specimens, including respiratory specimens and samples of blood, urine, and faeces from SARS patients, has been established. The bank holds specimens representing ail stages of the disease, ranging from the onset of symptoms to recovery.

The presently available diagnostic tests for coronavirus infection fall into two types. Serological testing for anti-coronavirus antibodies consists of indirect fluorescent antibody testing and enzyme-linked immunosorbent assays (ELISA) which detect antibodies against the virus produced in response to infection. Although some patients have detectable coronavirus antibody within 14 days of illness onset, definitive interpretation of negative coronavirus antibody tests is possible only for specimens obtained >21 days after onset of fever. SARS-CoV-specific RNA can be detected in various clinical specimens such as blood, stool, respiratory secretions or body tissues by the polymerase chain reaction (PCR). A number of PCR protocols developed by members of the WHO laboratory network are available on the WHO website (http://www.who.int/csr/sars/primers/en/). Furthermore, a . RT-PCR test kit containing primers and positive and negative controls, developed by the Bernhard Nocht Institute (http://www.bni-hamburg.de/; Drosten et al.), is available commercially (http://www.artus-biotech.de). An inactivated standard preparation is also available for diagnostic purposes through the European Network for Imported Viral Infections (ENIVD; http://www.enivd.de). ENIVD is also preparing an international external quality assessment scheme for SARS-CoV assays.

Molecular testing consists of reverse transcriptase-polymerase chain reaction (RT-PCR) tests specific for the RNA from this novel coronavirus. This can detect infection within the first 10 days after the onset of fever in some SARS patients. Commercial diagnostic tests are now available (Roche Diagnostics GmbH, Mannheim, Germany, Artus GmbH Hamburg, Germany). Additionally DE 20315159U1 describes a kit to for diagnosing SARS virus comprising primers and probes for a real-time reverse transcription polymerase chain reaction.

In addition to allowing the rapid diagnosis of SARS infection, the availability of diagnostic tests will help to address important questions such as the period of virus shedding (and communicability) during convalescence, the presence of virus in different body fluids and excreta, and the presence of virus shedding during the incubation period.

Below a presentation of the currently available diagnostic test methods and their diagnostic significance is given.

Table 1: Currently (July 2003) available diagnostic tests for the SARS-associated coronavirus.

Detection method Clinical Technical Diagnostic significance material/ ' i details specimen '

Virus detection

Virus isolation on Respiratory _s Suitable cell Indicates presence of cell culture tract lines: Vero; infectious virus; negative samples: I biosafety level result does not preclude sputum, I 3 facility SARS

BAL j required

Polymerase chain Respiratory | Different primer reaction (PCR) tract sequences and samples: protocols sputum, available from

BAL, throat the WHO swab, throat website * washing, stool

!

Antibody detection

lmmunfluorescence Serum For detection of IgM IFA usually positive only assay (IFA) specific IgG or IgM from day 10 after the onset of antibodies or both symptoms

Enzyme-linked Serum May be designed Usually positive only from day immunosorbent to detect specific 21 after the onset of assay (ELISA) IgG or IgM symptoms antibodies or both

Neutralization test Serum Requires BSL-3 Under investigation; study use

(NT) facility ("live" virus) only The results of the first clinical studies on SARS are now available and able to shed light on the clinical usefulness of various tests on different patient samples at different time points. In one series, IgG seroconversion was documented in 93% of patients at a mean of 20 days; about 50 % of patients had seroconverted at around 15 days after the onset of symptoms. Ksiazek TG, et al 2003, Peiris JS et al, Lancet 2003a, 2003, Peiris JS, et al, Lancet 2003b, 2003, Poutanen SM et al, 2003, WHO global conference on severe acute respiratory syndrome, 2003.

In the same study, SARS-associated coronavirus RNA was detected in nasopharyngeal aspirates by RT-PCR in 20 patients (32%) at initial presentation (mean 3.2 days after the onset of illness) and in 68% at day 14. Quantification revealed that the viral load peaked on day 10 with a mean geometric value of 1.9 x 10⁷ copies per ml, compared to values of 2.3 x 10⁵ copies per ml and 9.8 x 10⁴ copies per ml on days 5 and 15, respectively. Furthermore, viral RNA was detected in 97% of stool samples collected later in the illness (a mean of 14.2 days after onset). Similarly, viral RNA was detected in 42% of urine samples collected at a mean of 15.2 days after the onset of symptoms.

The authors of that study therefore conclude that although viral RNA detection in the nasopharyngeal aspirate has a sensitivity of only 32% at presentation, testing of multiple nasopharyngeal and fecal samples is able to increase the predictive value of the RT-PCR assay. Ksiazek TG, et al 2003, Peiris JS et al, Lancet 2003a Peiris JS, et al, Lancet 2003b, Poutanen SM et al, 2003, WHO global conference on severe acute respiratory syndrome, 2003.

The development of commercial diagnostic tests for SARS has progressed more slowly than initially hoped. Part of the problem arises from certain unusual features of SARS that make this disease an especially difficult scientific challenge. For many viral diseases, the greatest quantities of the causative agent are excreted during the initial phase of illness, usually in the first few days following the onset of symptoms. This is often the period during which patients pose the greatest risk of infecting others. SARS, however, follows a different pattern. During the initial phase of illness, virus shedding is comparatively low. Virus shedding peaks in respiratory specimens and in stools at around 10 days after onset of clinical illness. In effect, this unusual behavior creates the need for tests having a particularly high sensitivity. Such tests do not yet exist. Because small quantities of the virus are initially shed, available tests, though developed with impressive speed, are unable to reliably detect SARS virus or its genetic material, during the earliest days of illness. The low sensitivity of current virus detection tests is a particular challenge for SARS control, as patients are capable of infecting others during the initial phase and therefore need to be reliably detected and quickly isolated. In SARS patients, detectable immune responses do not begin until day 5 or 6. Reliable antibody tests can detect virus only by around day 10 following the onset of symptoms.

Because presently available tests are not generally able to detect the small amounts of SARS coronavirus (SARS-CoV) initially shed, they do not play a role in patient management and case control.

Therefore, due to the drawbacks of the presently available detection methods for SARS virus, there is still a great need for the development of more sensitive tests for detecting SARS.

SUMMARY OF THE INVENTION

The present invention presents a solution to the problem of low specificity and sensitivity of existing detection methods for SARS virus by providing new and improved primers and probes for detection of a SARS nucleic acid. A great number of primers and probes were produced, tested and modified for their ability to detect a SARS virus and to find the optimised primers and probes of the invention.

The present invention provides a first and a second primer comprising the nucleic acid sequences of SEQ ID NO 1 and 2, respectively, for amplification of SARS nucleic acid, as well as to a probe comprising the nucleic acid sequence of SEQ ID NO 3 for detection of SARS nucleic acid, directed to the SARS N-gene. The invention is also directed to a kit comprising the primers and the probe according to the invention, for amplification and detection, respectively, of a SARS nucleic acid, and to the use of these primers and the probe for amplification and detection of a SARS nucleic acid. Furthermore, a, method for detecting a SARS nucleic acid is contemplated by the present invention, which method comprises the steps of i) performing a RT (reverse transcriptase) polymerase chain reaction (PCR) ii) performing a PCR reaction using a first primer of SEQ ID NO 1 (forward primer) and a second primer of SEQ ID NO 2 (reverse primer) iii) detecting the amplified nucleic acid sequence of step ii) wherein steps i)-iii) can be performed sequentially or steps i)-ii) or steps i)-iϋ) or steps ii)- iii) can be performed simultaneously. Preferably, step iii) is performed using a probe comprising the nucleic acid sequence of SEQ ID NO 3.

LEGENDS TO FIGURES

Figure 1 shows the sensitivity of a system for detecting SARS BNI-1 , in which a commercially available analysis for SARS nucleic acid was modified. Amplifications of a sequential dilution of the standard material SARS BNI-1 (Ambion Diagnostics, Austin, USA) is shown with the number of copies/PCR reaction indicated. The duplicates represent two separate runs starting from the same cDNA material.

Figure 2 shows the sensitivity improvements utilizing a novel nucleocapsid gene assay (N-gene assay) according to the present invention. Upper panel: 1.2 copies of SARS genome/PCR (upper panel), lower panel: 0.6 copies of SARS genome/PCR. For the LUT-SARS assay, the amplification curves are shown dashed and vertically displaced to a fluorescence level of 2 for clarity. Results from N- gene assay are displayed with solid lines.

Figure 3 is another demonstration of the sensitivity of the N-gene assay of the present invention. The number of copies of SARS genome/PCR reaction is indicated for each PCR reaction run. NTC is "non-template control".

Figure 4 shows a comparison of the N-gene assay of the present invention (LightUp) and a commercially available kit (SARS kit, cat. no. 03 604 438, Roche Diagnostics GmbH Mannheim, Germany) for detection of SARS. The Equalis SARS panels containing the Frankfurt-1 and the HKU-1 strains were used to compare the N-gene assay of the present invention (full lines) and the Roche SARS kit (dashed lines). The strain and the number of copies per milliliter are indicated in each panel.

Figure 5 shows the specificities of the LightUp BNI polymerase and the nucleocapsid (N- gene) gene assays against viruses causing similar clinical symptoms. Top panel: BNI polymerase gene assay, bottom panel: N-gene assay (bottom panel) was tested for specificity against several viruses known to cause similar clinical symptoms. The tested viruses are indicated with dashed lines, SARS virus with solid lines.

DEFINITIONS

In the present context a "primer" refers to an oligonucleotide hybridisable to a complementary nucleic acid sequence which primer is utilized in a polymerase chain reaction for amplification of a nucleic acid molecule.

Probes for hybridization to nucleic acids, with which we may refer to both deoxyribonucleic acids (DNA) and ribonucleic acids (RNA), are used to demonstrate the presence of specific target sequences in complex mixtures.

A "probe" comprises a nucleic acid sequence and/or a nucleic acid sequence analogue, such as, but not limited to, a DNA or a PNA sequence, capable of hybridising to a target nucleic acid sequence. Such a nucleic acid sequence or nucleic acid sequence analogue may be referred to as a nucleic acid sequence recognizing part, due to its ability to recognize and hybridize to a target nucleic acid. A nucleic acid sequence recognizing part is a molecule that sequence specifically binds to nucleic acids. A nucleic acid sequence recognizing part may be a nucleic acid such as DNA or RNA. A nucleic acid sequence recognizing part may also be structurally different from a nucleic acid. It may be an oligodeoxyribonucleic acid analog that has modified or replaced backbone, unnatural sugar moieties, different configuration and/or different stereochemistry, such as a PNA molecule. It may also be a peptide or protein that binds sequence specifically to nucleic acids.

A probe according to the invention further comprises a reporter group that allows detection of the probe. Said reporter group is in the present context attached by any means to said sequence recognizing part. In the present context, a reporter group is preferably a group that is detectable via spectroscopic, photochemical, biochemical, immunochemical and/or chemical means. In the context of the present invention, when a probe is referred to, it may refer to the sequence recognizing part and/or to the reporter group.

A "property" may in the context of a reporter group which "changes its properties" refer to any property of a reporter group, e.g. fluorescence or luminescence, wherein a change in said property from one state to another can be detected by any appropriate means. The terms "nucleic acid", "nucleic acid molecule" or "nucleic acid sequence" refers to a deoxyribonucleotide or ribonucleotide (e.g. mRNA) polymer in either a single-stranded or a double-stranded form, and encompasses, unless otherwise limited to any other structure, analogues of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. Analogues include, but are not limited to, oligodeoxyribonucleic acid analogs (NAA) that have a modified or replaced backbone, unnatural sugar moieties, different configuration and/or different stereochemistry compared to natural deoxyribonucleotides and ribonucleotides, such as peptide nucleic acids (PNA).

By "PNA" is meant a peptide nucleic acid. Peptide nucleic acids (PNA) may be characterized as DNA mimics with a modified or replaced backbone. More specifically, PNA is a DNA analogue in which the phosphate backbone is replaced with a neutral "peptide-like" backbone.

By a "complementary sequence" or a "complementary nucleic acid sequence" is meant the opposite strand of one of the strands of a double-stranded nucleic acid molecule. A complementary sequence may also in the present context be complementary to at least a part of another sequence. A complementary strand may also in the present context be referred to as a "C-strand".

In the present context "homology" or "homologous" refers to the identity in sequence between two nucleic acid sequences. In one context of the present invention, a "homologous sequence" is at least 80% identical to another sequence, such as about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical with a nucleic acid according to the invention. In the present context, "homologous" and "identical" may be used interchangeably.

By a nucleic acid or a fragment thereof having a sequence being at least, for example 95% identical to a reference nucleic acid sequence, is intended that the nucleic acid sequence is identical to the reference sequence, except that the nucleic acid sequence may include up to 5 point mutations per each 100 nucleic acids of the reference nucleic acid sequence. In other words, to obtain a nucleic acid sequence having a nucleic acid sequence at least 95% identical to a reference nucleic acid sequence: up to 5% of the nucleic acids in the reference sequence may be deleted or substituted with another nucleic acid, or a number of nucleic acids up to 5% of the total nucleic acids in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at either end of the reference nucleic acid sequence or anywhere between those end positions, interspersed either individually nucleic acids in the reference sequence or in one or more contiguous groups within the reference sequence.

In the present invention, a local algorithm program may be used to determine identity. Local algorithm programs, (such as Smith Waterman) compare a subsequence in one sequence with a subsequence in a second sequence, and find the combination of subsequences and the alignment of those subsequences, which yields the highest overall similarity score. Internal gaps, if allowed, are penalized. Local algorithms work well for comparing two multidomain proteins, which have a single domain or just a binding site in common.

Methods to determine identity and similarity are codified in publicly available programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J et al (1994)) BLASTP, BLASTN, and FASTA (Altschul, S.F. et al (1990)). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S.F. et al, Altschul, S.F. et al (1990)). Each sequence analysis program has a default scoring matrix and default gap penalties. In general, a molecular biologist would be expected to use the default settings established by the software program used.

"PCR" or "PCR reaction" refers in the present context to a polymerase chain reaction, which is a method well known to the person skilled in the art. An example of a PCR reaction is given in the experimental section.

A "real-time PCR reaction" refers to a PCR reaction in which the amplified nucleic acid is detected simultaneously as the PCR reaction proceeds, after a threshold is achieved, which threshold is dependent on the specific conditions used for a certain PCR reaction. "Hybridisation" or to "hybridise" refers to the association between two at least in part complementary nucleic acid strands, a nucleic acid and a nucleic acid analogue, or two nucleic acid analogues to form a double stranded molecule.

"Target nucleic acid" or "target" refers to a nucleic acid sequence to be analysed or detected, e.g. a nucleic acid to which a probe hybridises. The term refers to both the subsequence to which the probe is directed and to a larger nucleic acid sequence comprising the subsequence.

DETAILED DESCRIPTION

The present invention relates to improved primers intended for the detection of SARS virus in a sample facilitated by providing novel primers and/or probes for amplification and/or detection of a SARS nucleic acid. The advantages of the primers and the probes of the present invention are their high specificity and sensitivity compared to those that have earlier been available, as demonstrated in the experimental section.

The primers and probes according to the present invention are directed to the SARS N- gene. The first primer is a forward primer, comprising the nucleic acid sequence of SEQ ID NO 1 whereas the second primer is a reverse primer comprising the nucleic acid sequence of SEQ ID NO 2. These primers, when used in a PCR reaction, allow amplification of the SARS N-gene in a very sensitive and specific manner (see Experimental Section). The present invention allows as little as 100 copies of SARS genome/ml to be detected. Encompassed by the present invention are also primers being at least 80% homologous to SEQ ID NO 1 and/or 2.

Below the SARS N-gene (C-strand) and the forward and reverse primers of this invention are shown. Additionally, the nucleic acid sequence of the probe, SEQ ID NO 3, directed to the SARS N-gene of the present invention, is shown. The target sequence for probe SARS N4 (comprising SEQ ID NO 3) is marked in bold in the SARS N-gene sequence.

SARS N-gene (C-strand)

TTACCGCGACTACGTGATGAGGAGCGAGAAGAGGCTTGACTGCCGCCTCTGCTTCC CTCTGCGTAGAAGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTGTAGCACGGTGGC AGCATTGTTATTAGGATTGCGGGTGCCAATGTGGTCTTTGGGTGTATTCAAGGCTCC CTCAGTTGCAACCCATACGATGCCTTCTTTGTTAGCGCCGTAGGGAAGTG (SEQ ID NO 6)

SARS-N-F7 (forward primer): 5' TTACCGCGACTACGTGATGA 3^' (SEQ ID NO 1)

SARS-N-R5 (reverse primer): 5^' CACTTCCCTACGGCGCTAAC 3^' (SEQ ID NO 2)

Probe SARS-N4: Reporter group-CCCGCAATCC (SEQ ID NO 3)

Target: GGATTGCGGG (SEQ ID NO 7)

PCR product length: 216 bp

A probe suitable for the present invention comprises a nucleic acid sequence recognizing part and a reporter group. In one embodiment, a probe comprises a sequence comprising SEQ ID NO 3, a complementary sequence thereof (SEQ ID NO 7), or any analogue of SEQ ID NO 3 or SEQ ID NO 7. It is also to be understood that said probe may comprise at least a part of SEQ ID NO 3, SEQ ID NO 7, or a complementary sequence or analogue thereof. The present invention also relates to a probe comprising a sequence comprising at least 80% homology to the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof (i.e. 80% homologous to SEQ ID NO 7). Also contemplated by the present invention are probes comprising up to 2 nucleotides more or less than SEQ ID NO 3, i.e. probes being of about 8, 9, 10, 11 or 12 nucleotides in length.

An analogue according to the present invention is a nucleic acid analogue, preferably a PNA (peptide nucleic acid).

A reporter group can in the present context be any group that allows detection of the probe. Suitable groups are radioactive isotopes, enzymes, particularly enzymes capable of acting on chromogenic, fluorigenic or luminescent substrates such as a peroxidase or an alkaline phosphatase, chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, analogues of nucleotide bases and ligands such as biotin. Preferably, the reporter group is a fluorescent group, even more preferably a cyanine dye. Especially preferred probes for the present invention include probes that change their signal properties when hybridizing to a target nucleic acid (see e.g. PCT/SE97/00953). The signal property of the probe can e.g. be luminescence or fluorescence. Changes in a fluorescent signal property can e.g. be detected by fluorescence intensity measurements and changes in fluorescence life time, polarization or anisotropy. Probes suitable for the present invention include probes of the type LightUp^® probe (e.g. PCT/SE97/00953), Taqman^® probe (U.S. Patent 5,723,591), Molecular Beacon^® (Tyagi, S. and Kramer, F.R. (1996), Molecular beacons: probes that fluoresce upon hybridization. Nature

Biotechnology 14:303-308, Kostrikis, L.G., Tyagi, S., Mhlanga, M. M., Ho₁ D. D., and Kramer, F.R. (1998), Spectral genotyping of human alleles. Science 279:1228-1229, Tyagi, S., Bratu, D. P., and Kramer, F.R. (1998), Multicolor molecular beacons for allele discrimination, Nature Biotechnology 16:49-53, Matsuo, T. (1998), In situ visualization of messenger RNA for basic fibroblast growth factor in living cells, Biochim. Biophys. Acta. 1379: 178-184, Piatek, A.S., Tyagi, S., Pol, A.C., Telenti, A., Miller, L.P., Kramer, F.R., and Alland, D. (1998), Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis, Nature Biotechnology 16:359-363, hybridization probes and the like. A preferred type of probe is the LightUp^® probe (the properties of which are described in PCT/SE97/00953).

The present invention relates to primers corresponding to SEQ ID NO 1 and SEQ ID NO 2, as well as to a primer which comprises at least a part of SEQ ID NO 1 or 2. The present invention also relates to primers having at least 80% homology to the nucleic acid sequences of SEQ ID NO 1 and 2, respectively. A primer may have up to 4 nucleotides more or less than the sequences of SEQ ID NO 1 and/or 2, respectively, thereby being of 16-24 nucleotides in length, such as about 16, 17, 18, 19, 20, 21 , 22, 23 or 24 nucleotides in length. Additional nucleotides may be attached to either end of the primer. Nucleotides may be removed from either end of the primer.

A sample analyzed in accordance with the invention may be of any origin, such as a clinical sample from blood, stool, respiratory secretions or from body tissues from animals or humans or samples of non-clinical origin.

The present invention also relates to a method of diagnosis which comprises taking a clinical sample from a mammal, such as a human being, preparing such sample by appropriate means, such as means described by the present invention, and determine if said mammal is infected with a SARS virus by detecting the presence of a SARS virus using any means as described by the present invention. In most cases the SARS RNA has to be extracted from the sample before analysis. Depending on the origin of the sample, different methods for RNA-extraction are suitable, which are well known to the skilled person. Guidelines for how to handle samples containing SARS and extract SARS nucleic acid can be found at e.g. www.who.org or www.cdc.gov.

Primers comprising the nucleic acid sequences of SEQ ID NO 1 and/or 2, are preferably provided in a kit in separate or in the same container. A kit of the present invention can optionally also comprise a probe comprising the sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof, that specifically hybridizes to the SARS N-gene for convenient detection of amplified SARS nucleic acid. Encompassed by the present invention are also primers being at least 80% homologous to SEQ ID NO 1 and/or 2, and a probe comprising a sequence being at least 80% homologous to SEQ ID NO 3, provided alone or together in a kit.

A kit according to the present invention preferably also comprises buffers and reagents (such as NTPs and Mg²⁺) and enzymes for carrying out a PCR reaction (polymerase chain reaction) and/or a reverse transcriptase PCR reaction (RT-PCR). Examples of enzymes include DNA-polymerases, such as heat-stable DNA polymerases originating from the thermophilic bacterium Thermus Aquaticus, for use in a PCR reaction, and reverse transcriptase for use in a RT-PCR reaction. Examples of suitable buffers to be used in a RT-PCR and a PCR reaction according to the invention are given in the experimental section.

A kit according to the present invention preferably also comprises a standard nucleic acid (in the form of an RNA molecule) as a qualitative and/or quantitative control for monitoring RNA extraction and/or amplification reactions. The standard nucleic acid can be added to a sample prior to RNA extraction or added to a sample after RNA extraction as a quantitative and/or qualitative standard for monitoring SARS virus present in a sample. The standard can of course also be analyzed separately from the sample. The standard can be any RNA for which suitable primers for amplification and optionally probes for detection of amplified nucleic acid is available or can be constructed. One example of a standard suitable for the present invention is the "Armorde RNA SARS (BNI-1) and "Armorde RNA SARS (CoV-NC)" (cat. no. 42090 and 42091 , respectively, Ambion Diagnostics, Austin, USA). When the standard is used as an internal control, added to a sample to be analysed, it allows both control of the extraction procedure and control of the PCR reactions, such as possible problems with inhibition.

In one aspect, the present invention also relates to the use of a first primer comprising the nucleic acid sequence of SEQ ID NO 1 , and a second primer comprising the nucleic acid sequence of SEQ ID NO 2, or a combination thereof, for amplification of a SARS virus nucleic acid. Preferably a probe comprising the nucleic acid sequence of SEQ ID NO 3 or an analogue or a complementary sequence thereof, is used in combination with the primers for detection of amplified nucleic acid. In another aspect, the present invention also relates to the use of a probe comprising a nucleic acid sequence according to SEQ

ID NO 3, for detection of SARS virus. Encompassed by the present invention is also the use of primers being at least 80% homologous to SEQ ID NO 1 and/or 2, as well as the use of a probe comprising a sequence being at least 80% homologous to SEQ ID NO 3, for amplification of a SARS virus nucleic acid.

The present invention also relates to a method for detecting SARS virus in a sample comprising the steps of i) performing a RT polymerase chain reaction (RT-PCR) ii) performing a PCR reaction using a first primer of SEQ ID NO 1 and a second primer of SEQ ID NO 2 iii) detecting the amplified nucleic acid sequence of step ii) wherein steps i)-iii) can be performed sequentially or steps i)-ii) or steps i)-iii) or steps ii)- iii) can be performed simultaneously.

In this method, sample RNA (such as mRNA) to be analyzed for the presence of SARS virus is reversibly transcribed into cDNA to provide a DNA sample for further analysis. Methods for performing reverse transcription of RNA are well known to the person skilled in the art. In this step a reverse transcriptase enzyme, such as Superscript III Rnas H^' Reverse Transcriptase (cat. no. 18080-044, Invitrogen Corp., Carlsbad, California, USA), is allowed to reversibly transcribe sample RNA into DNA in the presence of any primers enabling transcription of SARS RNA. Generic RT primers, such as random hexamer or oligo(dT)-primers can be used for this step. Preferably, random primers, such as Invitrogen cat. no 48190-011 , are used in this step. The DNA produced in step i) according to the method of the invention is thereafter amplified in a common PCR reaction utilizing the N-gene primers of SEQ ID NO 1 and 2 according to the invention, i.e. step ii). The amplified sequence is then detected in step iii) by any suitable method. Common methods for nucleic acid detection include gel electrophoresis and different hybridization techniques utilizing probes specific for the target sequence. In one embodiment of the present invention, dyes such as SYBRGreen (Molecular Probes Inc.) and BEBO (WO 02/090443), that generate a fluorescence signal when double stranded DNA is formed in a PCR reaction, are used. Preferably a probe comprising the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof, as described above, is used for detection of amplified nucleic acid according to the present invention. Encompassed by the present invention are also primers being at least 80% homologous to SEQ ID NO 1 and/or 2, as well as a probe comprising a sequence being at least 80% homologous to SEQ ID NO 3, for the detection and amplification of a SARS virus nucleic acid.

Preferably, the presence of target SARS sequence is detected in a real-time PCR reaction, wherein steps ii) and iii) are performed simultaneously. In a real-time PCR reaction, the amount of amplified nucleic acid is measured during every cycle of the polymerase chain reaction using e.g. a probe, or dyes binding to double stranded nucleic acid. As the nucleic acid is amplified, the amplified nucleic acid can be detected after a threshold, dependent on the specific reaction conditions used, is achieved. Preferably, a probe specific for the amplified nucleic acid sequence is used to detect amplified nucleic acid. In order for a real-time PCR reaction of the present invention to be carried out with a satisfactory result, it is important that the unhybridized probe's background signal is easily distinguishable from its signal when hybridized to target nucleic acid. Preferably, a probe comprising the nucleic acid sequence of SEQ ID NO 3 of the present invention is used for detection of amplified sequence. Analogues or a complementary sequence of SEQ ID NO 3 are also contemplated as probe sequences. Encompassed by the present invention are also probes being at least 80% homologous to SEQ ID NO 3 for detection of amplified sequence. The design of probes suitable for the present invention is described above.

Steps i)-iii) of the method of the present invention can be performed sequentially. Alternatively, two or more steps can be performed simultaneously by adding all the reagents necessary for the reactions in the same reaction vessel. Another, equally preferred method of the present invention also comprises the steps of amplifying and detecting a standard nucleic acid as a qualitative and/or quantitative control for monitoring the success of extraction, amplification and/or detection steps of the method of the invention. Suitable standard nucleic acids are described in the above.

EXPERIMENTAL SECTION

The following buffer was used for the RT-PCR reactions:

Table 2: Buffer for RT-PCR reactions

RT-PCR reactions were run with the following temperature profile: 50⁰C 30 min, 95°C 1 min. For RT-PCR reactions 5 μl of extracted samples ("template RNA) or water (control) was used, as described in Table 2. For RT-PCR reactions, a MasterCycler gradient PCR 5331, version 2.30.31 (Eppendorf, Hamburg, Germany) was used. 3 μl of the resulting cDNA was then used for the PCR step described below.

For the PCR reactions, a 5 x LUT PCT buffer containing Mg²⁺-containing Trisbuffer was used.

The following mixture was then prepared for the PCR reaction: Table 3: PCR reaction mixture

To this mixture, 3 μl of the cDNA described above was added before the PCR reaction was started. The PCR reactions were run on a LightCycler 1.0 (cat. no. 1 909 304, GmbH,

Amnnheim. Germany) with automatic gain set and display mode F1. Software version 3.5 was used. The following temperature profile was used for the PCR reactions: 95⁰C 180 sec, 95°C 0 sec, 58⁰C 6 sec measurement 58⁰C 6 sec, 74⁰C 15 sec, 4O⁰C 30 sec (steps marked in bold are repeated (50 times). For measurements, acquisition mode was "single" and analysis mode was "quantification".

The above RT-PCR and PCR reaction conditions were used for all the examples below.

Example 1: Sensitivity of a modified system (LUT-SARS) for detection of SARS BNI gene.

In this experiment the primers of the commercially available Armorde RNA SARS (BNI-1) (cat. no. 420-90, Ambion Diagnostics, Austin, USA) was used. However, one of the primers, BNIoutS2, was modified by deletion of the 5' nucleotide (A) to achieve a better sensitivity and specificity in the PCR system used in the present invention. The sequence of the forward primer used was therefore 5^' TGAATTACCAAGTCAATGGTTAC 3'(SEQ ID NO 4). As the reverse primer, the reverse primer BNIinAS of Ambion's kit was used. For detection the following optimized probe was constructed: Reporter group- CCTCTCCAGC (SEQ ID NO 5). For a description of the reporter group it is referred to the section describing probes suitable for the present invention above. SARS BNI-1 standard material (Ambion Diagnostics, Austin, USA) was used as sample RNA to test the assay. As can be seen in Figure 1 as little as two copies of SARS BNI-1 can be detected by using these optimized primer and probe of the present invention.

Example 2: Sensitivity of the novel system for detection of SARS N-gene (N-gene assay) as compared to the LUT-SARS assay

The present example shows the unexpectedly high sensitivity of the system for detection of SARS N-gene of the present invention using the forward primer of SEQ ID NO 1 , the reverse primer of SEQ ID NO 2 and probe of SEQ ID NO 3 (N-gene assay). As a comparision, the LUT-SARS assay described in Example 1 above, was used as a control.

A SARS-CoV material was diluted to 1.2 copies/PCR reaction or 0.6 copies/PCR reaction. Four replicates were run for each of the two assays and gene copy number detected tested. The results are depicted in Figure 2. As shown above in Example 1, the optimized LUT-SARS assay of the present invention has a very high sensitivity. Still, the LUT-SARS assay failed to detect SARS-CoV in any of the replicates. In contrast, the N-gene assay of the invention was able to detect three of four replicates on the 1.2 copies/PCR level and one of four replicates on the 0.6 copies/PCR level. This demonstrates the extremely high sensitivity obtained using the novel N-gene assay of the present invention.

Example 3: Sensitivity of the novel system for detection of SARS N-gene (N-gene assay)

The sensitivity of the N-gene assay was further investigated by utilizing detection of SARS nucleic acid in the form of Armorde RNA-NC (cat. no. 420-91 , Ambion Diagnostics, Austin, USA) As can be seen in Figure 3, as low as 0.5 copies of SARS genome/PCR reaction could be detected by the N-gene assay of the present invention.

Example 4: Comparison of the N-gene assay of the present invention and a commercially available assay

The sensitivity and specificity of the N-gene assay of the present invention was compared to the commercially available SARS kit (cat. no. 03 604 438, Roche Diagnostics GmbH, Mannheim, Germany). Two different strains of SARS virus (Frankfurt -1 and HKU-1), present at different concentrations, were detected either using the N-gene assay comprising the primers of SEQ ID NO 1 and 2 and the probe of SEQ ID NO 3 of the present invention or the Roche SARS kit following the manufactures instructions. The two assays were also compared for false positive results in samples without any SARS RNA. The results are shown in Figure 4.

Example 5: Specificities of the N-gene assay and the LUT-SARS assay.

The specificity of the N-gene and LUT-SARS assays described above were tested against viruses which cause similar symptom or disease (Adeno 2;Adenoid 6 SJV, Coxsachie B5; Dalldorf N.53112 USA, Echo; 18 Metcalf SMCL, RSV, lnfluensa A, lnfluensa B, Parainfluensa 1 ; Sendai 2, 1980-1-24, Parainfluensa 2;1965-3-17, Parainfluensa 3; Kl, p3, 1987-11-13, Parainfluensa 4; strain 19503-V2773, 1969-9-9, Parainfluensa 1 ; patient strain, and Parainfluensa 2; patient strain). The specificity was also tested against pure human DNA, or extracted material from whole blood (results from whole blood are not shown). No cross reactivity against mentioned viruses or human DNA was observed. The NTC (non-template control) showed no trace of unspecific signal or carryover. Two copies of SARS corona virus was used as positive control. The results are shown in Figure 5.

REFERENCES

1. Tyagi, S. and Kramer, F.R. (1996). Molecular beacons: probes that fluoresce upon hybridization. Nature Biotechnology 14:303-308.

2. Kostrikis, LG., Tyagi, S., Mhlanga, M. M., Ho, D.D., and Kramer, F.R. (1998). Spectral genotyping of human alleles. Science 279:1228-1229.

3. Tyagi, S., Bratu, DP., and Kramer, F.R. (1998). Multicolor molecular beacons for allele discrimination. Nature Biotechnology 16:49-53.

4. Matsuo, T. (1998). In situ visualization of messenger RNA for basic fibroblast growth factor in living cells. Biochim. Biophys. Acta. 1379: 178-184. 5. Piatek, A.S., Tyagi, S., Pol, A.C., Telenti, A., Miller, L.P., Kramer, F.R., and Alland,

D. (1998). Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis. Nature Biotechnology 16:359-363.

6. Drosten C, Gunther S, Preiser W, et al. Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome. N Engl J Med 2003a; 348: 1967-76. Published online Apr 10, 2003. http://SARSReference.com/lit.php?id=12690091

7. Ksiazek TG, Erdman D, Goldsmith CS, et al. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. New Eng J Med 2003, 348:1953-66. Published online Apr 10, 2003. http://SARSReference.com/lit.php?id=12690092 8. Peiris JS, Lai ST, Poon LL, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 2003a, 361 :1319-25. Published online Apr 8, 2003. http://image.thelancet.com/extras/03art347 7web.pdf

9. Peiris JS, Chu CM, Cheng VC, et al. Clinical progression and viral load in a community outbreak of coronavirus-associated SARS pneumonia: a prospective study. Lancet 2003b; 361 : 1767-72. Published online May 9, 2003. http://imaqe.thelancet.com/extras/03art443 2web.pdf

10. Poutanen SM, Low DE, Henry B, et al. Identification of severe acute respiratory syndrome in Canada. N Engl J Med 2003; 348:1995-2005. http.V/SARSReference. com/lit. php?id=12671061 11. WHO global conference on severe acute respiratory syndrome (SARS). WkIy

Epidemiol Rec. 2003 Aug 22;78(34):299-303

Claims

24CLAIMS

I . A kit for amplifying a SARS virus nucleic acid comprising a first and a second primer having at least 80% homology to the nucleic acid sequences of SEQ ID NO 1 and SEQ ID NO 2, respectively.

2. A kit for amplifying a SARS virus nucleic acid comprising a first primer comprising the nucleic acid sequence of SEQ ID NO 1 , and a second primer comprising the nucleic acid sequence of SEQ ID NO 2.

3. A kit according to any of claims 1-2, further comprising a probe wherein the probe comprises a nucleic acid sequence comprising at least 80% homology to the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

4. A kit according to any of claims 1-2, further comprising a probe comprising the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

5. A kit according to any of claims 3-4, wherein the analogue is a PNA sequence.

6. A kit according to any of claims 1-5, further comprising reagents and enzymes for carrying out a PCR reaction.

7. A kit according to any of claims 1-6, further comprising reagents and enzymes for carrying out a reverse transcriptase PCR reaction.

8. A kit according to any of claims 1-7, further comprising a standard nucleic acid as a qualitative and/or quantitative control for monitoring RNA extraction and/or amplification reaction.

9. A kit according to any of claims 3-8, wherein the probe comprises a reporter group.

10. A kit according to claim 9, wherein the reporter group changes its properties when the probe binds to a target sequence.

I 1. A kit according to claims 9-10, wherein the reporter group is a fluorescent molecule.

12. A kit according to claim 11 , wherein the fluorescent molecule is a cyanine dye.

13. Use of a combination of a first primer and a second primer, having at least 80% homology to the nucleic acid sequences of SEQ ID NO 1 and SEQ ID NO 2, respectively, for amplification of a SARS virus nucleic acid. 25

14. Use of a combination of a first primer comprising the nucleic acid sequence of

SEQ ID NO 1 and a second primer comprising the nucleic acid sequence of SEQ ID NO 2, for amplification of a SARS virus nucleic acid.

15. Use according to any of claims 13-14, further comprising the use of a probe comprising a nucleic acid sequence comprising at least 80% homology to the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

16. Use according to any of claims 13-14, further comprising the use of a probe comprising the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

17. Use according to any of claims 15-16, wherein the analogue is a PNA sequence.

18. Use according to any of claims 13-17, further comprising the use of a nucleic acid standard as a qualitative and/or quantitative control for monitoring RNA extraction and/or amplification reaction.

19. Use according to any of claims 15-18, wherein the probe comprises a reporter group.

20. Use according to claim 19, wherein the reporter group changes its properties when the probe binds to a target sequence.

21. Use according to claims 19-20, wherein the reporter group is a fluorescent molecule.

22. Use according to claim 21 , wherein the fluorescent molecule is a cyanine dye.

23. Method for detecting a SARS virus in a sample comprising the steps of i) performing a RT (reverse transcriptase) polymerase chain reaction (PCR) ii) performing a PCR reaction, using as a first primer a primer having at least

80% homology to SEQ ID NO 1 and a second primer having at least 80% homology to SEQ ID NO 2 iii) detecting the amplified nucleic acid sequence of step ii) wherein steps i)-iii) can be performed sequentially or steps i)-ii) or steps i)-iii) or steps ii)-iii) can be performed simultaneously.

24. Method according to claim 23, wherein the first and second primer comprises the nucleic acid sequences of SEQ ID NO 1 and SEQ ID NO 2, respectively.

25. Method according to any of claims 23-24, wherein the detection in step iii) is performed by hybridizing the amplified nucleic acid sequence to a probe 26

comprising a nucleic acid sequence comprising at least 80% homology to the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

26. Method according claim 25, wherein the probe comprises the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

27. Method according to any of claims 25-26, wherein the analogue sequence is a PNA sequence.

28. Method according to claim 23, wherein step iii) is performed using one or more fluorescent dye(s).

29. Method according to any of claims 25-27, wherein the probe comprises a reporter group.

30. Method according to claim 29, wherein the reporter group changes its properties when the probe binds to a target sequence.

31. Method according to claims 29-30, wherein the reporter group is a fluorescent molecule.

32. Method according to claim 31 , wherein the fluorescent molecule is a cyanine dye.

33. Method according to any of claims 23-32, which further comprises the steps of amplifying and detecting a standard nucleic acid.

34. Method according to any of claims 23-33, wherein step ii) and iii) are performed as a real-time PCR reaction.

35. A primer for detecting a SARS virus, wherein said primer comprises at least 80% homology to the nucleic acid sequence of SEQ ID NO 1.

36. A primer for detecting a SARS virus, wherein said primer comprises the nucleic acid sequence of SEQ ID NO 1.

37. A primer for detecting a SARS virus, wherein said primer comprises at least 80% homology to the nucleic acid sequence of SEQ ID NO 2.

38. A primer for detecting a SARS virus, wherein said primer comprises the nucleic acid sequence of SEQ ID NO 2.

39. A probe for detecting a SARS virus, wherein said probe comprises a nucleic acid sequence comprising at least 80% homology to the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof. 27

40. A probe for detecting a SARS virus, wherein said probe comprises the nucleic acid sequence of SEQ ID NO 3, or an analogue or a complementary sequence thereof.

41. A probe according to any of claims 39-40, wherein the analogue is a PNA sequence.

42. A probe according to any of claims 39-41 , further comprising a reporter group.

43. A probe according to claim 42, wherein the reporter group changes its properties when the probe binds to a target sequence.

44. A probe according to claim 42-43, wherein the reporter group is a fluorescent molecule.

45. A probe according to claim 44, wherein the fluorescent molecule is a cyanine dye.