WO2005121342A1

WO2005121342A1 - Recombinant enterotoxin c and vaccine with the use of the same

Info

Publication number: WO2005121342A1
Application number: PCT/JP2005/011216
Authority: WO
Inventors: Akio Nakane; Donj-Liang Hu
Original assignee: National University Corporation Hirosaki University
Priority date: 2004-06-14
Filing date: 2005-06-14
Publication date: 2005-12-22
Also published as: JP2005348694A

Abstract

A vaccine having, as an immunogen, a protein which is a mutant of Staphylococcus aureus enterotoxin C, has mutations at the T-cell receptor binding site and the major histocompatibility antigen II-binding site, and thus lacks superantigen activity but still sustains the immunogenicity of enterotoxin C.

Description

Recombinant enterotoxin C and vaccine using it

Technical field

The present invention relates to detoxified proteinaceous vaccines, and more particularly to enterotrophy of Staphylococcus aureus.

The present invention relates to a non-toxic mutant of enterotoxin C, and a vaccine comprising the mutant protein.

Background art

Staphylococcus aureus, especially methicillin-resistant Staphylococcus aureus (MRSA), is an important pathogen of hospital and opportunistic infections. It also contributes to increasing the risk of lifestyle-related diseases. MRSA is resident in the surface and deep parts of living organisms, does not provide effective protection against host infection, and is more susceptible to chronic and recurrent infections, especially in diabetic patients and the elderly, than many other pathogenic bacteria. Antibiotics have been used to treat MRSA, but in recent years multidrug-resistant strains have emerged, making treatment for MRSA increasingly difficult.

So far, studies on vaccines against B. aureus infection have been conducted on killed bacterial vaccines, toxoid vaccines, and capsular vaccines. However, killed bacterial vaccines do not induce sufficient acquired protective immunity, and toxoid vaccines are prepared via a chemical inactivation step, making product characterization difficult. It is undeniable that inactivated toxins may revert to active toxins. Also, the purification of wild-type toxin used for the preparation of toxoid from Staphylococcus aureus is very complicated, the yield is low, and it is used for inactivation. Many of the chemicals used are toxic. For these reasons, previous studies have not yielded satisfactory results and vaccines against B. aureus have not yet been put to practical use.

Enterotoxin, an extracellular protein toxin produced by Staphylococcus aureus, has superantigenic activity and is known to be an important virulence factor. The superantigen produced by Staphylococcus aureus is known to be associated with food poisoning, toxic shock syndrome, and Kawasaki disease syndrome, which is an inflammatory disease. There is a need for the development of non-toxic and safe vaccines against animal infections such as hospital-acquired MRSA infections and pest mastitis, especially in clinical and food production sites.

However, there is no known vaccine which does not have the above-mentioned toxicity due to the loss of superantigen activity and sufficiently maintains immunogenicity against B. aureus. Disclosure of the invention

Therefore, an object of the present invention is to provide an actin which does not have the above-mentioned toxicity due to the loss of superantigen activity and which sufficiently maintains immunogenicity against B. aureus. Means for solving the problem

As a result of various studies to solve the above problems, the present inventors have found that the T cell receptor binding site of enterotoxin C of Staphylococcus aureus and the major tissue-compatible antigen complex (MHC) class II binding site Introducing a mutation into the gene can result in loss or reduction of superantigen activity, thereby reducing the toxicity of enterotoxin C while maintaining the immunogenicity of enterotoxin C. And found that the present invention was completed. Therefore, the present invention relates to a mutant of Staphylococcus aureus enterotoxin C, which has a mutation in the T-cell receptor binding site and the major histocompatibility class II binding site. This provides a protein deficient in superantigen activity and maintaining the immunogenicity of enterotoxin C. As a specific example of such a protein, Asp at position 23 and Tyr at position 94 of enterotoxin C of the staphylococcus aureus having the amino acid sequence shown in SEQ ID NO: 1 are caused by another amino acid. Such proteins include those that have been substituted, thereby deficient in superantigen activity, and maintain the immunogenicity of enterotoxin C.

As a more specific example, the present invention provides an amino acid sequence represented by SEQ ID NO: 2, wherein Asp at position 23 of enterotoxin C of Staphylococcus aureus is substituted with Ala; It provides an enterotoxin C immunogenic protein in which Tyr at position 94 has been replaced by Ala.

The present invention further provides a vaccine against B. aureus comprising the above protein.

The present invention further provides a nucleic acid encoding the above protein. The present invention also provides a vector comprising the above nucleic acid. The present invention also provides a host cell transformed with the above vector.

The present invention further provides a method for producing a protein as described above, wherein the host cell is cultured, and the protein is collected from the culture. Brief Description of Drawings

Figure 1 shows the addition of various forms of enterotoxin C and the production of IFN-y (Fig. 1A) and TNF-α (Fig. 1 における) in spleen cell culture. 6 is a graph showing the relationship between

FIG. 2 is a graph showing the progress of the survival rate of mice after inoculation of mice immunized with various subjects with Staphylococcus aureus.

FIG. 3 is a graph showing the number of Staphylococcus aureus present in each organ of mice after inoculating mice immunized with various subjects with Staphylococcus aureus.

FIG. 4 is a graph showing the amounts of various antibodies produced in the serum of mice immunized with various subjects. BEST MODE FOR CARRYING OUT THE INVENTION

A to R are known as enterotoxins of Staphylococcus aureus, and the present invention relates to enterotoxin C. The nucleic acid, eg, DNA, encoding native enterotoxin C that is the basis for the non-toxic variant of enterotoxin C of the present invention is a Staphylococcus aureus, eg, an FRI strain of Staphylococcus aureus (Dr. Bergdoll. MS. 1983. Enterotoxins, in CSF Easton and C. Adlam (ed), Staphylococci and Staphyiococcal infections. Academic Press, United Kingdom. Enterotoxin C has the amino acid sequence of SEQ ID NO: 2, and is coded by a nucleic acid having the base sequence of SEQ ID NO: 1, for example.

However, enterotoxin C, which is the source of the non-toxic mutant of enterotoxin C of the present invention, has not only the amino acid sequence shown in SEQ ID NO: 2 but also allelic variations and other natural variations. Or one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 by deletion, addition or insertion, and by Z or other amino acids. It also includes proteins having an amino acid sequence modified by substitution and having native enterotoxin C activity. The nucleic acid encoding native enterotoxin C can also be cloned from the DNA of Staphylococcus aureus using a probe or primer pair designed from the sequence shown in SEQ ID NO: 1. Accordingly, the native enterotoxin C that forms the basis of the non-toxic mutant of enterotoxin C of the present invention includes, under high stringent conditions, a nucleic acid having the base sequence of SEQ ID NO: 1 or a fragment thereof. , Preferably encoded by a nucleic acid that hybridizes to a fragment having a length of at least 15 bases, and has native enterotoxin C activity, i.e., superantigen activity and enteromouth toxin C immunogenicity. It also includes proteins.

Enterotoxin C has, in its molecule, a binding site for the T cell receptor (amino acid sequences 20 and 23 in the amino acid sequence shown in SEQ ID NO: 2) and a binding site for major histocompatibility class II. In the amino acid sequence shown in SEQ ID NO: 2, amino acid numbers 90, 94 and 103) are included, whereby the interaction between T cell receptor and major histocompatibility class II is recognized. Intermediates that cause T cells to become tumor necrosis factor-1α (TNF-α), interferon-1γ (IFN-y), interleukin-12 (IL-2), It secretes Kin-6 (IL-6) and induces superantigen activity of enterotoxin C.

According to the present invention, immunization of enterotoxin C is achieved by introducing mutations into the binding site for the T cell receptor and the binding site for the major histocompatibility complex class II in the enterotoxin C molecule. It can delete or reduce superantigen activity while maintaining its originality. The mutation site can be selected in the range of the above-mentioned binding site (1). As a specific example, in the amino acid sequence of SEQ ID NO: 2, the mutation site is within the binding site for T cells. Asp at position 23 present and Tyr at position 94 present in the binding site for major tissue-compatible antigen class II No.

Examples of the type of mutation include deletion of the specific site described above, or substitution with another amino acid. For example, Asp at position 23 in SEQ ID NO: 2 can be substituted with an amino acid other than Asp, and Tyr at position 94 can be substituted with an amino acid other than Tyr. . Preferably, neutral amino acids such as Ala, Val, Leu, Ile and the like can be mentioned, and Ala is particularly preferable. The mutation can be introduced according to a conventional method, for example, by site-specific point mutagenesis.

The non-toxic mutant of Staphylococcus aureus enterotoxin C of the present invention is obtained by introducing the above-described mutation into the DNA encoding native enterotoxin C, and then appropriately expressing the mutated DNA. By transfecting a host cell with this vector, culturing the transformant, and collecting a non-toxic enterotoxin C mutant from the culture. . As a host, prokaryotic cells, for example, bacterial cells, typically E. coli cells, eukaryotic microbial cells, for example, fungal cells, for example, yeast cells or filamentous fungal cells, can be used. Examples include yeast belonging to the genus Saccharomyces, and examples of the filamentous fungi include filamentous fungi belonging to the genus Aspergillus. Furthermore, examples of higher eukaryotic cells include cultured plant cells and animal cultured cells. Use for these host cells is a routine technique and does not constitute a feature of the present invention.

The expression vector of the present invention comprises at least a DNA encoding a nontoxic mutant of enterotoxin C and a control sequence for controlling the expression of the DNA. A control sequence such as a promoter can be selected depending on the host cell, and a conventional promoter or the like can be appropriately used.

Construction of expression vector, transformation of host with expression vector Can also be carried out according to the usual method.

Culturing of host cells for production of a non-toxic enterotoxin C mutant can be carried out according to a conventional method, depending on the type of host, the type of promoter, and the like. The target enterotoxin c non-toxic mutant can be collected from the culture according to a conventional method used for protein recovery and purification. For example, a non-toxic enterotoxin C mutant produced by culturing an Escherichia coli host or the like can be obtained by obtaining a solution containing the mutant protein from the host culture and then using SDS-PAGE and anti-enterotoxin C antibody. By the in-gel precipitation reaction, a non-toxic enterotoxin C mutant having high purity, immunogenicity and lacking or reduced superantigen activity can be obtained.

The enterotoxin C non-toxic mutant of the present invention lacks or has reduced superantigen activity. This means that, for example, spleen cells are cultured in the presence and absence of the mutant, and the culture supernatant is Cytokins such as tumor necrosis factor-α (TNF-α), interferon-γ (IFN-V), interleukin-1 (IL-2), and interleukin-6 (I 6), etc., and the difference between the above cytokins depending on the presence or absence of the enterotoxin C mutant (the amount of cytokine production is greater in the presence than in the absence of the enterotoxin C variant). Can be confirmed. As is clear from FIG. 1 showing the results of Example 2, in the presence of the enterotoxin C mutant of the present invention, the production of interferon-1 and tumor necrosis factor-α was reduced, and the superantigen activity was reduced. Inhibition was confirmed.

The non-toxic enterotoxin C mutant of the present invention has the immunogenicity of enterotoxin C and has a vaccine effect against infection with Staphylococcus aureus. To confirm this, the non-toxic enterotoxin C mutant of the present invention (position 23 in the amino acid sequence of SEQ ID NO: 2) was used. Wherein Asp in the above is substituted by Ala and Tyr at position 94 is replaced by Ala; in the present specification, particularly in Examples, it may be referred to as “dmSECj”, 23 An endotoxin C mutant in which only Asp at position 1 is replaced by Ala (referred to as “mSEC” in the present specification, particularly in the Examples), a recombinant endogenous endotoxin C (refer to the present specification) In particular, in Examples, it may be referred to as "rSEC;"), only cholera toxin (which may be referred to as CT) that functions as an adjuvant, and only phosphate buffer (referred to as PBS) The following experiments were performed using and.

(A) Infection survival test in mice

(a) 20 μg / mouse dmSEC only [dmSEC]; (b) 20 μg / mouse draSEC and CT as adjuvant [dmSEC + CT]; and (c) only Nasal administration was performed to BALB / c mice, and booster immunization was performed 2 and 4 weeks later. One week after the second booster, Staphylococcus aureus (MRSA clinical isolate, SEC producing strain) was intravenously infected with a lethal dose (500,000 live mice / mouse). As is evident from FIG. 2 showing the results of A in Example 3, the survival rate of mice infected with Staphylococcus aureus in the case of enterotoxin C (dmSEC) of the present invention was lower than that of cholera toxin (CT) alone. Survival rates increased significantly, especially when cholera toxin (CT) was used as adjuvant for enterotoxin C (dmSEC) [dmSEC + CT].

(B) Bacterial residue test

In the above method (A), mice are bled to death on the third day after infection with Staphylococcus aureus, and the number of bacteria present in the spleen, liver and kidney is determined by the number of colonies on agar plates (CFU). And asked. As is clear from FIG. 3 showing the results of Example 3B, when the enterotoxin C non-toxic mutant (draSEC) of the present invention was administered together with cholera toxin (CT), in the spleen and liver, The number of Staphylococcus aureus decreased significantly. (C) Production of various antibodies

In the above experiment, various anti-enterotoxin C antibodies in the sera of the mice after 5 to 6 weeks were measured by ELISA using recombinant enterotoxin C as an antigen. As is clear from FIG. 4 showing the results of C in Example 3, most of the antibodies were treated with the nontoxic mutant of enterotoxin C of the present invention (dmSEC), and the native recombinant enterotoxin C was compared with the native recombinant enterotoxin C. The production levels of the antibodies were almost the same as in the case of administration, and it was confirmed that the immunogenicity for enterotoxin C was maintained in the nontoxic mutant of enterotoxin C of the present invention.

As described above, the non-toxic mutant of enterotoxin C of the present invention lacks or reduces superantigen activity, and thus has no or reduced toxicity, and reduces the immunogenicity of enterotoxin C. Since it is maintained, it has vaccine activity against Staphylococcus aureus infection, and is therefore a prophylactic or therapeutic agent for MRSA hospital infection, red mastitis, and other diseases associated with Staphylococcus aureus infection. And useful.

The non-toxic mutant of enterotoxin C of the present invention can be formulated into a vaccine preparation by blending it with a commonly used pharmaceutical carrier according to a conventional method. Vaccine formulations are usually administered parenterally, for example, by injection. Example

Next, the present invention will be described more specifically with reference to examples.

Example 1. Preparation of a nontoxic mutant of enterotoxin C

1. Cloning of DNA coding for enterotoxin C (SEC) Staphylococcus aureus FRI 361 strain (Bergdoll, MS. 1983, Enterotoxins, in CSF East on and then Adlam (ed), S taphylococc i and Staphylococcal infect ions. Academic Press, United Kindom.) Force, et al. (Betley. MJ and Mekalanos, JJ 1988. J. Bacteriol. 170: 34-41.) The DNA was isolated. In order to construct a recombinant SEC (rSEC) expression vector, the sec2 gene was replaced with a primer ((primer sequence 5'_CCCCG GATTCGAGAGCCAACCAGACCCTACG (distribution ϋ number: 3; and 5'-CCCCGAATTCT TATCCATTCTTTGTTGTAAGGTGG) (J number: 4) and subcloned into the Escherichia coli vector pGEM3Zf (+) by PCR method.The sec2 gene was excised with BamHI and EcoRI, and daltathione S- The expression vector (pKC2Xl) was constructed by introducing it into pGEX-6P-1, an expression vector for glutation S-transferase (GST) .. 2. Preparation of enterotoxin C non-toxic mutant (dmSEC)

From the vector PKC2X1, the Asp at position 23 (included in the binding site to the T cell receptor) and Tyr at position 94 from the N-terminus of the enterotoxin C molecule (included in the binding site of MHC class II) Was changed to Ala codon GCT at position 23 and the Tyr codon TAT at position 94 was changed to Ala codon GCT to replace each with Ala. Expression vectors (pGXmSEC and pGXdmSEC) containing the mutated DNA fragment were constructed. Next, Escherichia coli DH5a strain was transformed with this expression vector to obtain transformants pGXmSEC / DH52 and pGXdmSEC / DH52.

This transformant was cultured in 2XYTA medium containing ampicillin, and the protein extracted from the cells was purified using a GST purification module. Example 2. Reduction of superantigen activity

A splenocyte of a BALB / c mouse was prepared and suspended in RPMI1640 medium supplemented with 10% fetal bovine serum at a concentration of 1 million cells / ml, and (a) the enterotoxin C mutant of the present invention was added thereto. (DmSEC), (b) Endoxy A variant (mSEC) in which Asp at position 23 of protein C was replaced with Ala, and a naturally-occurring enterotoxin (rSEC) recombinantly produced were added at various concentrations, and then added in a carbon dioxide culture device. After incubation for 72 hours, interferon-γ (IFN-γ) and tumor necrosis factor-1a (TNF-α) in the culture supernatant were measured by ELISA. The results are shown in Figure 1.

As it is apparent from this figure, RSEC whereas for induction the production of a concentration-dependent manner I FN- _γ, dmSEC did not induce little production of IFN-gamma. In addition, the induction amount of TNF-α was significantly lower in dmSEC than in rSEC. Induction of the production of cytokins such as IFN-y and TNF-α in spleen cell cultures is an indicator of superantigen activity.The results of Example 2 show the results of Example 2 In comparison, it shows that the superantigen activity of the enterotoxin C mutant of the present invention is significantly reduced.

Example 3 Maintenance of Immunogenic Activity of Enterotoxin C

The non-toxic enterotoxin C mutant of the present invention has immunogenicity of enterotoxin C and has a vaccine effect on infection with Staphylococcus aureus. To confirm this, the non-toxic enterotoxin C mutant of the present invention (in the amino acid sequence of SEQ ID NO: 2, the Asp at position 23 was replaced by Ala, and In this specification, particularly in the examples, “dmSE (sometimes referred to as“: ”), an enterotoxin in which only Asp at position 23 has been substituted with Ala. C variant (referred to herein as "mSEC" in particular, in the Examples), recombinantly produced native enterotoxin C (referred to herein as "rSEC" in the Examples, particularly in the Examples), adjuvant The following experiments were performed using only cholera toxin (sometimes referred to as CT) and phosphate buffer alone (referred to as PBS), which function as (A) Infection survival test in mice

(a) 20 μg of dmSEC only in mouse [dmSEC]; (b) BALB of 20 μg / mouse of dmSEC and CT as adjuvant [dmSEC + CT]; and (c) CT only / c mice were intranasally administered, and booster nasal immunization was performed 2 and 4 weeks later. One week after the second booster immunization, a lethal dose of Staphylococcus aureus (MRSA clinical isolate, SEC-producing strain) was injected via the tail vein (500,000 viable cells / mouse) for 15 days. The survival state of the mice was observed. As is clear from FIG. 2, the survival rate of mice infected with Staphylococcus aureus increased in the case of enterotoxin C (dmSEC) of the present invention as compared to the case of cholera toxin (CT) alone. When cholera toxin (CT) was used as an adjuvant for toxin C (dmSEC) [dmSEC + CT], the survival rate was greatly increased. This confirmed that the non-toxic mutant of enterotoxin C of the present invention was effective as a vaccine against Staphylococcus aureus.

(B) Bacterial residue test

In the above method (A), mice are bled to death on day 3 after infection with Staphylococcus aureus, and the number of bacteria present in the spleen, liver and kidney is determined by the number of colonies (CFU) on agar plates. And asked. As is clear from FIG. 3, when the enterotoxin C non-toxic mutant (dmSEC) of the present invention was administered together with cholera toxin (CT), the number of Staphylococcus aureus in the spleen and liver significantly increased. Dropped.

(C) Production of various antibodies

In the above experiments, various anti-enterotoxin C antibodies in the sera of the mice after 5 to 6 weeks were measured by ELISM using recombinant enterotoxin C as an antigen. As is evident from FIG. 4, most of the measured antibodies were administered with the non-toxic variant of enterotoxin C of the present invention (dmSEC) and with the native recombinant enterotoxin. The antibody production level was almost the same as when C was administered, confirming that the nontoxic mutant of enterotoxin C of the present invention maintained immunogenicity for enterotoxin C. Was.

Claims

1. A mutant of Staphylococcus aureus enterotoxin C that has mutations in the T-cell receptor binding site and the major histocompatibility complex II binding site. Deficient in superantigen activity and immunogenicity of enerotoxin C

Eleven-one bite blue

Is maintaining the protein.

2. SEQ ID NO: 2

Asp at position 23 and Tyr at position 94 of telotoxin C have been replaced by other amino acids, thereby deficient in superantigen activity, and the immunogenicity of enterotoxin C. A protein that maintains sex.

3. SEQ ID NO: Asp at position 23 of enterotoxin C of Staphylococcus aureus having the amino acid sequence shown in SEQ ID NO: 2 has been substituted with Ala, and Tyr at position 94 has been substituted with Ala. Enterotoxin C immunogenic protein.

4. A vaccine against Staphylococcus aureus comprising the protein according to any one of claims 1 to 3.

5. The vaccine according to claim 4, which is effective against hospital-acquired MRSA and animal infectious diseases such as mastitis.

6. A nucleic acid encoding the protein according to claim 2 or 3.

7. A vector comprising the nucleic acid according to claim 6.

8. A host cell transformed with the vector of claim 7.

9. The method for producing a protein according to claim 2 or 3, wherein the host cell according to claim 7 is cultured, and the protein is collected from the culture.