WO2005108575A1

WO2005108575A1 - T-type calcium channel splice variant compositions and methods

Info

Publication number: WO2005108575A1
Application number: PCT/CA2005/000713
Authority: WO
Inventors: Gerald W. Zamponi; Isabelle Latour; John E. Mcrory; Jawed Hamid
Original assignee: Neuromed Pharmaceuticals Ltd.
Priority date: 2004-05-10
Filing date: 2005-05-10
Publication date: 2005-11-17
Also published as: CA2566041A1

Abstract

Cell proliferative conditions are associated with expression of a previously unknown Cav3.1 T-type calcium channel splice variant, Cav3.1ac. Also, it has been determined that the Cav3.1ac T-type splice variant interacts with annexin III (ANX III). This interaction is useful in identifying substances to treat cell proliferation. Also, diagnostics and prognostics of cell proliferative disorders and methods for treating such disorders are disclosed.

Description

T-TYPE CALCIUM CHANNEL SPLICE VARIANT COMPOSITIONS AND METHODS

Cross-Reference to Related Application [0001] This application claims benefit of U.S. Provisional Application 60/569,879 filed 10 May 2004. The contents of this application are incorporated herein by reference in their entirety.

Technical Field [0002] The invention relates to Ca_v3,l calcium channel splice variants and their involvement in cell proliferative conditions, and to a novel interaction between a newly discovered Ca_v3.1 calcium channel splice variant and annexin in. The invention also relates to methods and composition for prognosing, diagnosing and treating cell proliferative conditions.

Background [0003] Primary brain tumors are classified according to the presumed cell of origin. Glia-derived brain tumors are categorized as glioma and account for the majority of primary brain tumors (Sutherland etal., 1987), High-grade glioma are often associated with a poor prognosis, as the tumor may proliferate rapidly, invade neighboring areas of the brain and often recurs following surgical resection and/or radiotherapy (reviewed in Walker and Kaye, 2001). Tumor formation alters genes involved in cell proliferation, differentiation, migration and apoptosis. Ion channels are important mediators of such functions and recent findings confirmed an altered regulation and expression of chloride, potassium and sodium channels in glioma (Olsen et al, 2003, Ransom et al, 2002, Schrey et al., 2002). [0004] Calcium channels, mostly T-types, are also regulated during cell differentiation and tumor formation (Bertolesi et al._t 2003, Chemiπ etaL, 2002, Hirooka etal, 2002, ariot et al„ 2002, Toyota et at, 1999). To date, three different genes encoding distinct ςι.ι subunits of the T-type channel have been identified (Ca_v3.1, Ca_v3.2 and Ca_v3-3) (Cribbs et al., 199S, Lee etal, 1999, McRory et l., 2001, Perez-Reyes etal., 1 98). Alternative splicing generates additional isoforms of these channels with distinct biophysical properties such as kinetics and voltage-dependence of activation, inactivation and deactivation (Chemiπ et al., 2001a, Monteil et al, 2000). [0005] Ca_v3.1 channels are expressed abundantly in CNS neurons and were recently shown to be present in astrocytes (Klugbauer et al., 1999, Latour et al., 2003). However, their function in astrocytes remains poorly understood. [0006] The function and membrane expression of a number of high voltage-activated calcium channels is regulated by interaction with other cellular proteins. For example, N- and P/Q-type channel function is regulated by synaptie proteins, such as syntaxin, SNAP-25 or cysteine string protein (88,89), (U.SPatNos.5,623,051 and 6,090,631). L-type channels are modulated through interactions with calmodulin (Liang, H., DeMaria, CD., Erickson, M.G., Mori, M.X., Alseikhan, B.A., and Yue, D.T.2003. Unified mechanisms of Ca²* regulation across the Ca²⁺ channel family. Neuron 39, 51-960.) as well as A-Kinase anchoring proteins (Altier, C, Dubel, S.J., Ba-rrere, C, Jarvis, S.E., Stotz, S.C., Spaetgeπs, R.L., Scott, J λ, Comet, V._; De Waard, M. Zamponi, G.W., Nargeot, J., and Bourinet, E.2002 Trafficking of L-type calcium channels mediated by the postsynaptic scaffolding protein AKAP79. . Biol Che . 2773359S-33603). The close association of calmodulin with the channels allows channels to directly activate calcium/calmodulin activated signaling cascades (Dolmetsch, R.E., Pajvani, U., Fife, ., Spotts, J. . and Greenbert, M.E.2001. Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway. Science 294, 333-339.). To date, with the exception of G protein β2 subunit interactions with Ca_v3.2 (Wolfe, J.T., Wang, H., Howard, , Garrison, J.C., and Barrett, P.Q.2003. T-type calcium channel regulation by specific g-protein betagamma subunits. Nature 424, 209-213.), proteins interacting with T-type channels have not been clearly identified.

Disclosure of the Invention [0007] In humans, three isofoππs of the T-Type (Ca_v3.1) calcium channel αi subunit have been reported as a result of alternate splicing of exons 25 and 26 in the IH-IV linker region (Ca_v3. la, Ca_v3.1b or Ca_v3.1bc). According to the invention, human gliomas express Ca_v3.l channels in situ, splicing of these exons is uniquely regulated, and there is expression of a glioma-specific novel T- type variant (Ca_v3.1ac). As discussed below, seven human glioma samples were collected at the time of surgery, RNA was extracted and cDNA was produced for RT-PCR analysis. In addition, three glioma cell lines (U87, U563 and U251N), primary cultures of human fetal astrocytes as well as adult and fetal human brain cDN A were used. Previously described Ca_v3.1 splice variants were present in glioma samples, cultured cells and whole brain. The results revealed that in the normal adult brain, Ca_v3.1a transcripts predominate while Ca_v3.1b is mostly fetal-specific. VRT-PCR results on glioma and glioma cell lines showed that Ca_v3.1 expression in tumor cells resembles fetal brain expression pattern as Ca_v3.1bc is predominantly expressed. In addition, a novel splice variant, Ca_v3.1 ac, was identified, as expressed in three glioma biopsies and one glioma ceil line, but not in normal brain or fetal astroc es. Transient expression of this variant revealed that Ca_v3. lac displays similar current-voltage and steady-state inactivation properties compared to C--v3.1b, but a slower recovery from inactivation. Jan addition, a novel interaction between the Ca_v3,lac splice variant and annexin HI was discovered. Thus, provided is a mechanism which can be targeted for tumor growth inhibition. [0008] It has been discovered that (-X3.1 splice variants are associated with cell proliferative conditions, such as brain cancers, glioma, breast cancers, eye cancers and retinσblastoma- For example, Ca_v3.1 splice variant RNA and protein are present in glioma samples and glioma cell lines. It also has been discovered that gliomas express a splice variant of Ca_v3.1 that is normally mainly found in fetal cells (Ca_v3.1b), a-s well as a novel, glioma-spec-fic Ca_v3-1 splice isoform (Ca_v3.lac). Electrophysiological characterization of Ca_v3. lac indicates similar gating characteristics to other Cav3.1 splice isoforms- In addition, it was discovered that the protein annexin III (ANX III) interacted with a T-type calcium channel. [0009] Thus, provided herein is a method for screening cells in a human for abnormal expression of Ca_v3.1 T-type isoforms, thus determining the tumorigenic potential of the cells. One aspect is a method for detecting a risk of, or the presence of, a cell proliferative disorder in a subject, which comprises determining the presence or absence of an abnormal expression of Ca_v3.1 T-type isoforms, whereby said abnormal expression indicates the risk or presence of this disorder. By "expression" of a Ca_v3.1 splice variant or isoform is meant the presence of mRNA encoding the variant or isoform and/or the presence of the protein itself. The expression levels of these splice variants can be determined in samples comprising cells taken from the subject. The samples may be biopsies, tissues, or circulating cells. The presence of rri NA can be detected by a variety of methods, including prior formation of cDNA and hybridization or RT-PCR. Northern Blot may also be used. The presence f the protein may be d tected in some instances by iratminoreaetion with antibodies specific for the isoform. [0010] At least three indications of abnormal expression may be assessed. In one aspect, the determination is made of the presence or absence of an isoform uniquely associated with abnormally proliferative cells, such as gliomas, i.e., the Ca_v3.1ac form. In another method to determine abnormal expression, the distribution of isoforms is determined whereby the presence of an abnormally high percentage of the Ca_v3.1bc form is indicative of the risk or presence of a cellular proliferative condition. The presence of the Ca_v3.1b form is also an indication. In these embodiments, the cell proliferative disorder sometimes is selected from the group consisting of brain cancer, glioma, breast cancer, eye cancer and retinoblastoma. [0011] The methods described above sometimes further comprise determining whether there is increased cell proliferation within a subject identified as having the presence of a nucleotide sequence that encodes a Ca_v3.1ac calcium channel or the presence of a Ca_v3.1ac calcium channel protein in cells. The presence or absence of increased cell proliferation sometimes is detected in a tissue biopsy from the subject, and sometimes increased cell proliferation is detected in vivo. The previously described methods sometimes further comprise administering a molecule that reduces cell proliferation in a subject identified as having the presence of a nucleotide sequence that encodes a Ca_v3,lac calcium channel, the presence of a Ca_v3. lac calcium channel protein in cells, and/or the presence of increased cell proliferation, in an amount effective to reduce the cell proliferation. The molecule that reduces cell proliferation in the subject sometimes is a Ca_v3.1ac calcium channel antagonist molecule and/or a molecule that inhibits an interaction between a Ca_v3.1ac calcium channel and ANX HI. [0012] Also provided is a method for treating a cell proliferative disorder characterized by expression Ca_v3.1 ac, which comprises administering a T-type calcium channel Mocker to a subject in need thereof in an amount effective to treat the cell proliferative disorder. Specific embodiments are directed to a method for treating a cell proliferative disorder in a subject, which comprises administering a Ca 3.1ac calcium channel antagonist molecule or a molecule that inhibits the interaction of a Ca_v3-lac calcium channel with ANX III to a subject in need thereof in an amount effective to treat the cell proliferative disorder. These substances may be used in the preparation of medicaments for such treatment as well. [0013] Provided also is a composition which comprises a cancer cell in combination with an antibody that Specifically binds to a Ca 3.1ac calcium channel protein, or a synthetic nucleic acid comprising a nucleotide sequence complementary to a polynudeotide sequence in a cancer cell nucleic acid that encodes a Ca_v3.1ac calcium channel. The synthetic nucleic acid sometimes is linked to a solid support, and the nucleic acid sometimes is arranged on the solid support in an array. Also provided is a composition which comprises a cancer cell in combination with a Ca_y3. lac calcium channel antagonist molecule or a molecule that inhibits the interaction of a Ca_v3.1ac calcium channel with ANX 1H. Also featured is a composition which comprises an isolated Cav3.1ac calcium channel-encoding nucleic acid or protein and an isolated ANX Hi-encoding nucleic acid or protein. [0014] Also provided are a variety of methods and compositions related to screening compounds for the ability to inhibit the interaction between Ca_v3.1ac and ANX HI (e.g., by a compound's ability to bind to a selected Ca_v3.1ac-like peptide). One aspect is a method for identifying a molecule that inhibits cell proliferation, which comprises contacting one or oie cells comprising a Ca_v3.1ac calcium channel encoding nucleic acid and/or a Ca_v3 Jac calcium channel polypeptide with a test molecule, and determining whether the test molecule decreases cell proliferation, whereby a test molecule that decreases cell proliferation is identi ied as a molecule that inhibits cell proliferation. Another aspect is a method of screening for a molecule that inhibits cell proliferation, one of which comprises: (a) incubating a Ca_v3.lac polypeptide or substantially identical polypeptide thereof with a test molecule under conditions sufficient to permit binding between the polypeptide and the test molecule in a reaction mixture, (b) contacting ANX III with the reaction mixture under conditions sufficient to permit binding between the polypeptide and ANX HI, and (c) detecting the presence or absence of decreased binding between the polypeptide and ANX III, whereby the presence of decreased binding between the polypeptide and ANX III identifies the test molecule as a molecule that inhibits the interaction between Ca_v3.1ac and ANX HI. Analogous methods are described for detecting compounds that inhibit the interaction of N-type calcium channels with syπtaxin and SNAP-25 in U.S. PatNos. 5,623,051. and 6,090,631. A Ca_v3-lac polypeptide is a polypeptide that is unique to this isoform. The Cav3.1ac polypeptide sometimes comprises 25 or more sequential amino acids selected from a region spanning a ino acid 1546 to a ino acid 1570 of a Ca_v3.Iac T- type calcium channel, and the polypeptide sometimes consists of the amino acid sequence SKEKQMADLM DDVIASGSSASAAS. [0015] Methods and compositions described herein sometimes pertain to a Ca_v3.1b calcium channel instead of, or sometimes in addition to, a Ca_v3.1ac calcium channel. For example, methods for detecting a risk or presence of a cell proliferative condition in a subject sometimes is performed by detecting the presence of a Ca_v3. lb calcium channel encoding nucleotide sequence or Ca_v3.1b calcium channel protein in a sample instead of, or in addition to, detecting the presence of a Ca_v3.f ac calcium channel component. The Ca_v3. lb calcium channel sometimes is targeted in other embodiments, such as in a method for treating a cell proliferative condition by administering a Ca_v3.1b calcium channel antagonist to a subject in need thereof in an amount sufficient to treat the cell proliferative condition instead of, or in addition to, administering a Ca_Ϋ3.1ac calcium channel antagonist. [0016] These and other aspects of the present invention are evident upon reference to the following detailed description and attached drawings.

Brief Description of the Drawings [0017] Figures 1A to IE depict immunofluørescence studies showing Ca_v3.1 calcium channel expression in glioma. Immunocytochemistry of Ca_v3.1 channels on U251N glioma cells is assessed by confoeal microscopy at40X (Figure 1A) and lOOX (Figure IB). A paraffin-embedded section of a malignant astrocytoma showing GFAP expression is in Figure 1C and showing Ca_v3.1 channel expression is in Figure ID. Coexpression of T-type channels on GFAP-staiπed astrocytes is shown in Figure IE. [001S] Figures 2A and 2B shows that specific isoforms of the Ca_v3,l IH-IV linker generated by alternative splicing of exon 25 and 26 are differentially expressed in the human brain at various developmental stages and in glioma. Figure 2A is a schematic representation of alternative splicing mechanisms in the Ca_v3.1 HI-IV linker. Intron-exon boundaries and splice donor and acceptor sites are shown in lower case letters, amino acid sequence is shown in upper case lettering. The sequences at the beginning of exons 27 and 26 are shown. The entire exon 26 contains the amino acid sequence LMI-DDVIASGSSASAAS, such that inclusion of this exon results in a 50 bp increase, as shown in Figure 2B. Exon 25 can either produce a long (Ca_v3.1a) or short isoform (Ca_v3.1b), while exon 26, when present, gives rise to two additional variants (Ca_v3.1ac or Ca_v3.1bc). Figure 2B is an agarose gel showing IH-IV linker RT-PCR results in the normal adult (lane 1), fetal brain (lane 2), u251N glioma cells (lane 3) and a glioma sample (lane 4). The first lane represents the molecular weight marker (MW weight is indicated by arrows). [0019] Figures 3A to 3D show biophysical properties of Ca_v3.1ac (*) and Ca_v3.1b (o). Error bars reflect standard errors. Figure 3A shows cunent-voltage relationships for Ca_v3.1ac (n=13) and Ca_v3.1b (n=10) variants. The data were fitted with the Boltzmann relation (solid line). Figure 3B shows steady-state inactivation relationships, fitted with the Boltzmann relation, for Ca_v3.1ac (n=l 1) and Ca_γ3.1b (n---8). Note that there is no difference in slope or half inactivation potential with these two channel isoforms. Figure 3C shows time constants for inactivation at various test potentials. The time constants were obtained by π-onoexponent-ial fits to the raw data. Only at +20 V is there a statistical difference between the two channel isoforms (asterisk). A total of 13 and 10 experiments are included for the ac and b variants, respectively. Inset: Current records obtained from Ca_v3.1b and Ca_v3.1ac, elicited by a 150 ms step depolarization. The currents were scaled to overlap at peak, the peak current amplitudes of the raw two currents, were, respectively 680 pA and 570 pA. Note the similar inactivation kinetics, Figure 3D depicts a time constant of recovery from inactivation. The data were obtained by using an inactivating prepulse followed by a test depolarization at various recovery intervals. The data normalized and fitted monoexponetially. Note that the ac variant shows an increase in the time constant of recovery from inactivation. Ca_v3.1b: τ---10O.00ms(n= 9), Cav3.1ac; *=154.52-ns (n---9). [0020] Figures 4A an 4B illustrate Ca_v3.1 iπ-IV linker splice isoform distribution in normal brain, glioma cell lines and glioma samples. Figure 4A shows the number of clones for each condition corresponding to the various isoforms. Figure 4B is a schematic representation of the percentage of each isoform in fetal and adult brain, fetal -istrocytes and glioma (glioma cell lines and glioma samples combined). [0021] Figure 5 shows the identification and cot-firmation of annexin in as a binding partner of the Ca_v3.1ac splice isoform -QI-IV linker.

Detailed Description [0022] The present invention offers several strategies for prognosing, diagnosing and treating cell proliferative conditions. In prognostic and diagnostic methods, Ca_v3.1 splice variant-encoding nucleotide sequences or proteins are detected in a sample from the subject, and such methods sometimes are coupled with further diagnostic information and or procedures, and/or treatment procedures. In methods of treating cell proliferative disorders, T-type calcium channel blockers can be used to prevent entry of calcium into mitogenic cells, thus preventing initiation of cell proliferation. Alternatively, a molecule that inhibits the interaction between Ca_v3-lac and ANX in can be administered to reduce cell proliferation. Ca_v3-1 splice variant antagonists, such as antisense molecules, ribozymes, siRNA molecules, compounds or antibodies directed specifically to Ca_v3.1ac or Ca_v3.1b splice variants, can also be administered to reduce cell proliferation. Alternatively, ANX III antagonists can be administered to reduce cell proliferation and treat cell proliferative disorders. In certain embodiments, the cancer cell is from a brain tumor or glioma, and in other embodiments the cancer cell is from a breast cancer tumor or eye cancer tumor (e.g., retinoblastoma). [0023] A characteristic of the cells of the invention that exhibit undesired proliferation is the presence of abnormal expression of at least one Ca_v3- 1 calcium channel splice variant. This abnormal expression can manifest itself in a number of ways so ----- to meet the definition of "abnormal expression." First, the presence of the splice variant Ca_v3.1ac, either in the form of mRNA or protein or both, is indicative of such cells and of such abnormal expression. Second, the presence of the splice variant Ca_v3.1b also indicates abnormal expression; such expression is represented by either or both the presence of mRNA or protein corresponding to this splice variant. In addition, the proportion of the total Ca_v3.1 expression attributable to Ca_v3.1bc indicates abnormal expression if the cells are non-fetal cells and the percentage measured as a mole percent of mRNA or protein is greater than 20% of the total Ca_v3.1 calcium channel mRNA or protein level. ₍ These percentages are on a mole basis.

Compositions [0024] Given the association of certain Ca_v3.1 splice variants with cell proliferative disorders, provided is a composition which comprises a cancer cell in combination with an antibody that specifically binds to a Ca_v3.1 calcium channel protein splice variant associated with the cancer (e,g,₇ a Ca.v3.l c or Ca_v3.1b calcium channel protein). Examples of antibodies are described hereafter. In some embodiments, the cancer cell is intact, is in association with other cells (e.g., the cancer cell is in a cell culture or in a tissue) or is separated from other cells {e.g., the cancer cell is dispersed in a liquid medium). hi other embodiments, the cancer cell is not intact (e.g., it is a ceil lysate). The cancer cell sometimes is isolated from a subject having a 'cell proliferative condition, sometimes is isolated from a tissue of the subject, and sometimes is isolated from or is part of a cell line established from a subject having a cell proliferative condition. [002-5] Cell proliferative disorders also include but are not limited to cancers of the colorectum, breast, lung, liver, pancreas, lymph node, colon, prostate, brain, head and neck, skin, liver, kidney, and heart. The cell proliferative condition sometimes is a brain cancer such as glioma, sometimes is an eye cancer such as retinoblastoma, and sometimes is breast cancer, A cell proliferative condition sometimes is a hematopoietic πeoplastic disorder, which is a disease involving hyperplastic/neoplastic cells of hematopoietic origin (e.g., arising from yeloid, lymphoid or erythroid lineages, or precursor cells thereof). The disease can arise from poorly differentiated acute leukemias, e.g., erythroblastic leukemia and acute megakaryoblastic leukemia. Additional myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (reviewed in Vaickus, Crit. Rev. in Oncoiy-He otol. 11:267-97 (1991)); lymphoid maligttancies include, but are not limited to acute lymphoblastic leukemia (ALL), which includes B-lineage ALL and T-liπeage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (FIX), hairy cell leukemia (HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of malignant Iymphomas include, but aie not limited to non-Hodgkin lymphoma and variants thereof, peripheral T cell Iymphomas, adult T cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocytic leukemia (I-GF), Hodgkin's disease and eed-Sternberg disease. [0026] In certain embodiments, the composition comprises a cancer cell and a synthetic nucleic acid comprising a nucleotide sequence complementary to a polynucleotide sequence in a cancer cell nucleic acid that encodes a Ca_v3-1 calcium channel splice variant associated with a cancer (e.g., a

Ca_v3. lac or Ca_v3.lb calcium channel). As used herein, the term "nucleic acid" includes DNA molecules (e.g., a complementary DNA (cDNA) and genomic DNA (gDNA)), RNA molecules (e.g., mRNA or siRNA) and analogs of DNA or RNA (e.g„ RNA or DNA comprising or consisting of nucleotide analogs). The nucleic acid molecule sometimes is single-stranded and often is double- stranded. The nucleic acid sometimes is a fragment, which sometimes is 50, 100, or 200 or more base pairs in length, and is sometimes about 300, 400, 500, 600, 700, 800, 00, 1000, 1100, 1200, 1300, or 1400 base pairs in length. An example of a nucleic acid fragment is an oligonucleotide. As used herein, the term "oligonucleotide" refers to a nucleic acid comprising about S to about 50 covalently linked nucleotides, often comprising from about 8 to about 35 nucleotϊdes, and more often from about 10 to about 25 nucleotides. The backbone and nucleotides within an oligonucleotide may be the same as those of naturally occurring nucleic acids, or analogs or derivatives of naturally occurring nucleic acids, provided that oligonucleotides having-such analogs or derivatives retain the ability to hybridize specifically to a nucleic acid comprising a targeted polymorphism. Oligonucleotides described herein may be used as hybridization probes or as components of prognostic or diagnostic assays, for example, as described herein. [0027] Oligonucleotides often are synthesized using standard methods and equipment, such as the ABF^M3900 High Throughput DNA Synthesi-zer and the EXPEDITE™8909 Nucleic Acid Synthesizer, both of which ate available from Applied Biosystems (Foster City, CA), Analogs and derivatives ate exemplified in U.S. Fat. Nos. 4,469,863; 5,536,821; 5,541,306; 5,637,683; 5,637,684; 5,700,922; 5,717,083; 5,719,262; 5,739,308; 5,773,601; 5,886.165; 5,929,226; 5,977,296; 6,140,482; WO 00/56746; WO 01/14398, and related publications. Methods for synthesizing oligonucleotides comprising such analogs or derivatives are disclosed, for example, in the patent publications cited above and in U.S. Pat. Nos. 5,614,622; 5,739,314; 5,955,599; 5,962,674; 6,117,992; in WO 00/75372; and in related publications. Oligonucleotides sometimes are linked to a second moiety. The second moiety may be an additional nucleotide sequence such as a tail sequence (e.g., a polyadenosine tail), an adapter sequence (e.g., phage M13 universal tail sequence), and others. Alternatively, the second moiety may be a noπ-nucleotide moiety such as a moiety which facilitates linkage to a solid support or a label to facilitate detection of the oligonucleotide. The second moiety may be attached to any position of the oligonucleotide, and labels include but are not limited to a radioactive label, a fluorescent label, a chemiluminescent label, a paramagnetic label, and the like. [002S] The synthetic nucleic acid may be linked to a solid support, and the nucleic acid may be arranged on the solid support in an array. An array, sometimes referred to as a "microairay-" sometimes includes an oligonucleotides described herein, and methods for making and using oligonucleotide πricroarrays are disclosed in U.S. Pat. Nos.5,492,806; 5,525,464; 5,589,330; 5,695,940; 5,849,483; 6,018,041; 6,045,996; 6,136,541; 6,142,681; 6,156,501; 6,197,506; .6,223,127; 6,225,625; 6,229,911; 6,239,273; WO 00/52625; WO01/25485; and WO 01/29259. The microarray typically comprises a solid support and the oligonucleotides sometimes are linked to the solid support by covalent or non-covalent interactions. The oligonucleotides sometimes are linked to the solid support directly or by a spacer molecule. [0029] The invention further includes compositions which comprise an isolated Ca_v3.1ac calcium channel-encoding nucleic acid or protein- The term "isolated" refers to substances that are separated from their natural environments or from the materials present in the natural source. For example, with regard to genomic DNA, the term "isolated" includes nucleic acids which are separated from the chromosome with which the genomic DNA is naturally associated- An "isolated" nucleic acid is often free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5* and/or 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of 5' and/or 3" nucleotide sequences which flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. An "isolated" nucleic acid molecule, such as a cDNA molecule, sometimes is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" polypeptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. "Substantially free" means a preparation of a substance having less than about 30%, 20$>, 10% and more preferably 5% (by dry weight), of material from its source of derivation. When the polypeptide or a biologically active portion thereof is produced reco binantly, it often is substantially free of culture medium, specifically, where culture medium represents less than about 20%, sometimes less than about 10%, and often less than about 5% of the volume of the polypeptide preparation. [0030] Also provided is a composition which comprises a cancer cell in combination with a molecule that antagonizes a Ca_v3.1 calcium channel splice variant associated with a cell proliferative disorder (e.g., antagonizes a Ca_v3.1ac or Ca_v3.ib calcium channel) or a molecule that inhibits the interaction of a Ca_v3.1 calcium channel splice variant with ANX in (e.g., Ca_v3.1ac). Examples of such molecules include but are not limited to compounds, antisense nucleic acids, ribozy e nucleic acids, inhibitory RNA, and antibodies, which are described in greater detail hereafter.

Compounds [0031] Compounds can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive (see, e.g., Zuckermann et al, J. Med. Chem-37: 2678-85 (1994)); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring decoπvolution; "one-bead one-compound" library methods; and synthetic library methods using affinity chro atography selection. Biological library and peptoid library approaches are typically limited to peptide libraries, while the other approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des. 12: 145, (1997)). Examples of methods for synthesizing molecular libraries are described, for example, in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A.90: 6909 (1993); Erb et al, Proc. Natl Acad. Sci. USA 91: 11422 (1994); Zuckermann et al, J. Med. Chem. 37: 2678 (1994); Cho etal, Science 261: 1303 (1993); Camell et al, Angew, Chem. Int. Ed. Eng 33: 2059 (1994); Carell et al, Angew, Chem. Int. Ed. Engl, 33: 2061 (1994); and in Gallop et al., J. Med. Chem.37: 1233 (1994). [0032] Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13: 412-421 (1992)), or on beads (Lam, Nature 354: 82-84 (1991)), chips (Fodor, Nature 364: 555-556 (1993)), bacteria or spores (Ladner, United States Patent No, 5,223,409), plas ids (Cull et al, Proc. Natl, Acad. Sci. USA 89: 1865-1869 (1992)) or on phage (Scott and Smith, Science 249: 386-390 (1990); Devlin, Science 249: 404-406 (1 90); Cwirla et at., Proc. Natl. Acad. Sci.87: 6378-6382 (1990); Felici, J. Mol. Biol. 222; 301-310 (1991); adner supra.). [0033] A compound sometimes modulates expression or activity of a polypeptϊdes and often is a small molecule. Small molecules include, but are not limited to, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e„ including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. [0034] Examples of T-type calcium channel small molecule antagonists and methods for determining their effect on calcium channel function are disclosed in U.S. patent application publication no. US-2004-0034035-A1 published February 19, 2004; U.S. patent application publication no, US-2004-0044004-A1 published March 4, 2004; U.$. patent application no. 10/763,974 filed January 22, 2004 afld U.S. patent application no, 60474,864 filed May 30, 2003.

Antisense, Ribozvme RNAi- siRNA and Modified Nucleic Acid Mqlecules [0035] An "a-ntiseinse" nucleic acid refers to a nucleotide sequence complementary to a "sense" nucleic acid encoding a polypeptide, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. The antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof. In another embodiment, the antisense nucleic acid molecule is antisense to a "noncodiπg region" of the coding strand of a nucleotide sequence encoding the calcium channel or ANX M protein, [0036] An antisense nucleic aeid can be designed such that it is complementary to the entire coding region, and often the antisense nucleic acid is an oligonucleotide antisense to only a portion of a coding or noncoding region of RNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of mRNA, e.g., between the -10 and +10 regions of the target gene nucleotide sequence of interest An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 0, 6$, 70, 75, 80, or more nucleotides in length. The antisense nucleic acids, which include the ribozymes described hereafter. can be designed to target calcium channel and ANX III nucleic acids. [0037] An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using standard procedures. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridh-e substituted nucleotides can be used. Antisense nucleic acid also can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e„ RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection). [0038] When utilized as therapeutics, antisense nucleic acids often are administered to a subject e,g., by direct injection at a tissue site) or generated in situ such that they hybridise with or bind to cellular mRNA and or genomic DNA encoding a polypeptide and thereby inhibit expression of the polypeptide, for example, by inhibiting transcription and/or translation. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then are administered systemica-ly. For systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, for example, by linking antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. Antisense nucleic acid molecules can also be delivered to cells using the vectors described herein, Sufficient intracellular concentrations of antisense molecules are achieved by incorporating a strong promoter, such as a pol π or pol IH promoter, in the vector construct. [0039] Antisense nucleic acid molecules sometimes are alpha-anomeric nucleic acid molecules. An alpha-anomeric nucleic acid molecule forms specific double-sfranded hybrids with complementary RNA in which, contrary to the usual beta-units, the strands run parallel to each other (Gaultier et al, Nucleic Acids. Res. 15: 6625-6641 (1987)). Antisense nucleic acid molecules can also comprise a 2'-o-methylribonucleotide (I oue et al, Nucleic Acids Res. 15: 6131-6148 (1987)) or a chimeric RNA-DNA analogue (Iπoue et al., FEBS Lett. 215: 327-330 (1987)). Antisense nucleic acids sometimes are composed of DNA or PNA or any other nucleic acid derivatives described previously. [0040] In another embodiment, an antisense nucleic acid is a ribozyme. A ribozyme having specificity for a calcium channel or ANX Hi-encoding nucleic acid can include one or more sequences complementary to the nucleotide sequence of a calcium channel or ANX III sequence, and a sequence having a known catalytic region responsible for mRNA cleavage (see e.g., U.S. Pat. No. 5,093,246 or Haselhoff and Gerlach, Nature 334: 585-591 (1988)). For example, a derivative of a Tetrahymena L-1 IVS RNA is sometimes utilized in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in the target miRNA (see e.g., Cech et at. U.S. Patent No.4,987,071 ; and Cech et al. U.S. Patent No.5,116,742). Also, target mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see e_:g„ Bartel & S-sostak, Science 261: 1411-1418 (1993)). [0041] Antagonists include in certain embodiments nucleic acids that can form triple helix structures with a calcium channel nucleotide sequence, especially one that includes a regulatory region that controls calcium channel expression. Calcium channel gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the channel (e.g., promoter and or enhancers) to form triple helical structures that prevent transcription of the channel gene in target cells (see e.g., Helene, Anticaπcer Drug Des.6(6): 569-84 (1991); Helens et al, Ann. N.Y. Acad. Sci.660: 27-36 (1992); andMaher, Bioassays 14(12): 807-15 (1992). Potential sequences that can be targeted for triple helix formation can be increased by creating a so-called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3\ 3'-5' manner, such that they base pair with first one strand of a duplex and then tine other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex. [0042] Calcium channel antagonists also include RNAi Mid siRNA nucleic acids. Gene expression may be inhibited by the introduction of double-stranded RNA (dsRNA), which induces potent and specific gene silencing, a phenomenon called RNA interference or RNAi, See, e.g., Fire etal, US Patent Number 6,506,559; Tuschl et al PCT International Publication No. WO 01/75164; Kay et al. PCT International Publication No. WO 03/01018QA1 ; or Bosher JM, Labouesse, Nat Cell Biol 2000 Feb;2(2):E31-6. This process has been improved by decreasing the size of the double- stranded RNA to 20-24 base pairs (to create small-interfering RNAs or siRNAs) that "switched off" genes in mammalian cells without initiating an acute phase response, i.e., a host defense mechanism that often results in cell death (see, e.g., Caplen etal. Proc Natl Acad Sci U S .2001 Aug 14;98(17) 9742-7 and Elbashir et al. Methods 2002 Feb;26(2);199-213). There is increasing evidence of post-transcriptioπal gene silencing by RNA interference (RNAi) for inhibiting targeted expression in mammalian cells at the mRNA level, in human cells. There is additional evidence of effective methods for inhibiting the proliferation and migration of tumor cells in human patients, and for inhibiting etastatic cancer development (see, e.g., U.S. Patent Application No. US2001000993183; Caplen et al. Proc Natl Acad Sci U S A; and Abderrahmani et al. Mol Cell Biol 2001 Nov21(2l):7256-67). [0043] An "siRNA" or "RNAi" refers to a nucleic acid that forms a double stranded RNA and has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is delivered to or expressed in the same cell as the gene or target gene. "siRNA" refers to short double-stranded RNA formed by the complementary strands. Complementary portions of the siRNA that hybridize to form the double stranded molecule often have substantial or complete identity to the target molecule sequence. In one embodiment, an siRNA refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA, such as a calcium channel encoding nucleotide sequence, for example. [0044] When designing the siRNA molecules, the targeted region often is selected from a given DNA sequence beginning 50 to 100 nucleotides downstream of the start codon. See, e.g., Elbashir et al,. Methods 26:199-213 (2002). Initially, 5' or 3' UTRs and regions nearby the start codon were avoided assuming that UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNP or RISC endonuclease complex. Sometimes regions of the target 23 nucleotides in length conforming to the sequence motif AA(N19)TT (N, an nucleotide), and regions with approximately 30% to 70% G/C-conteπt (often about 50% G/C-conteπt) often are selected. If no suitable sequences are found, the search often is extended using the motif NA(N21). The sequence of the sense siRNA sometimes corresponds to (N19) TT or N21 (position 3 to 23 of the 23-nt motif), respectively. In the latter case, the 3' end of the sense siRNA often is converted to TT. , The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs. The antisense siRNA is synthesized as the complement to position 1 to 21 of the 23-nt motif. Because position 1 of the 23-nt motif is not recognized sequence-specifically by the antisense siRNA, the 3' -most nucleotide residue of the antisense siRNA can be chosen deliberately. However, the penultimate nucleotide of the antisense siRNA (complementary to position 2 of the 23-nt motif) often is complementary to the targeted sequence. For simplifying chemical synthesis, T often is utilized. siRNAs corresponding to the target motif NAR(N17)YNN, where R is purine (A.G) and Y is pyrimidine (CO), often are selected. Respective 21 nucleotide sense and antisense siRNAs often begin with a purine nucleotide and can also be expressed from pol El expression vectors without a change in targeting site. Expression of RNAs from pol in promoters often is efficient when the first transcribed nucleotide is a purine. [0045] The sequence of the siRNA can correspond to the full length target gene, or a subsequence thereof. Often, the siRNA is about 15 to about 50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, sometimes about 20-30 nucleotides in length or about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 2$, 29, or 30 nucleotides in length. The siRNA sometimes is about 21 nucleotides in length. Methods of using siRNA are well known in the art, and specific siRNA molecules may be purchased from a number of companies including Dharmacon Research, Inc. [0046] Antisense, ribozyme, RNAi and siRNA nucleic acids can be altered to form modified nucleic acid molecules. The nucleic acids can be altered at base moieties, sugar moieties or phosphate backbone moieties to improve stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of nucleic acid molecules can be modified to generate peptide nucleic aόids (see Hyrup et al., Bioorganic & Medicinal Chemistry 4 (1): 5-23 (1996)). AS used herein, the terms "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic such as a DNA mimic, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of a PNA can allow for specific hybridization to DNA and RNA under conditions of low ionic strength. Synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described, for example, in Hyrup et al., (1996) supra and Perry-O'Keefe etal, Proc- Natl. Acad. Sci. 93: 14670-675 (1996), [0047] PNAs of nucleic acids can be used in prognostic, diagnostic, and therapeutic applications. For example, PNAs can be used as antisense or antlgene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation arrest or inhibiting replication. PNAs of nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping); as "artificial restriction enzymes" when used in combination with other enzymes, (e.g., SI nucleases (Hyrup (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup et al, (1996) supra; Perry-O'Keefe supra). [0048] In other embodiments, oligonucleotides may include other appended groups such as peptides (e,g„ for targeting host cell receptors in vivo), or agents facilitating transport across cell membranes (see e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA 86: 6553-6556 (1989); Lemaitre et at, Proc. Natl. Acad. Sci. USA 84: 648-652 (1987); PCT Publication No- W088/09810) or the blood-brain barrier (see, e.g. , PCT Publication No, W089/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (See, e.g., rol et at., Bio-Techniques 6: 958-976 (1988)) or intercalating agents. (See, e,g., Zon, Phar . Res.5: 539-549 (1988) ). To this end, the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).

Anti-Calcium Channel and ANX HI Antibodies [0049] The term "antibody" as used herein refers to an im-munoglobulin molecule or immunologically active portion thereof, -^".--., an antigen-binding portion. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab')2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. An antibody sometimes is a polyclonal, monoclonal, recombinant (e.g., a chimeric or humanized), fully human, non-human (e.g., murine), or a single chain antibody. An antibody may have effector function and can fix complement, and is sometimes coupled to a toxin or imaging agent. [00SO] A full-length calcium channel or ANX in polypeptide or antigenic peptide fragment can be used as an immunogeo or can be used to identify anti-calcium channel or ANX in antibodies made with other immunogens, e.g., cells, membrane preparations, and the like. An antigenic peptide often includes at least 8 amino acid residues of the target protein and encompasses an epϊtope of the protein. Antigenic peptides sometimes include 10 or more amino acids, 15 or more amino acids, 20 or more amino acids, or 30 or more amino acids. Hydrophilic and hydrophobic fragments of target polypeptides sometimes are used as immunogens. Epitopes encompassed by the, antigenic peptide often are regions located on the surface of the polypeptide (e.g., hydrophilic regions) and regions with high antigeπicity. For example, an Emini surface probability analysis of human polypeptide sequences can be used to indicate the regions that have a particularly high probability of being localized to the surface of calcium channel and ANX HI polypeptide and are thus likely to constitute surface residues useful for targeting antibody production. The antibody may bind an epitope on any domain or region of calcium channel or ANX IH polypeptides. An antibody can be made by immunizing with a purified calcium channel or ANX III antigen, or a fragment thereof, a membrane associated antigen, tissues, e.g., crude tissue preparations, whole cells (e.g., living cells), lysed cells, or cell fractions. [0051] Chimeric, humanized, and completely human antibodies are useful for applications which include repeated administration to subjects. Chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, can be made using standard recombinant DNA techniques. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al International Application No. PCT/US86/02269; Akira, et al European Patent Application 184,1.87; Taniguchi, M., European Patent Application 171,496; Morrison et al European Patent Application 173,494; Neuberger et al PCT International Publication No. WO 86/01533; Cabilly et al U.S. Patent No.4,816,567; Cabilly et al European Patent Application 125,023; Better et al, Science 240: 1041- 1043 (1988); Liu et al, Proc. Natl. Acad. Sci. USA 84: 3439-3443 (1987); Liu et al, J. Immunol. 139: 3521-3526 (1987); Sun et al, Proc. Natl. Acad. Sci. USA 84: 214-218 (1987); Nishitnura et al, Cane. Res.47: 999-1005 (1987); Wood et al, Nature 314: 446-449 (1985); and Shaw et o „ J. Natl. Cancer Inst. SO: 1553-1559 (1988); Morrison, S. L., Science 229: 1202-1207 (1985); Oi etal, BioTechniques 4: 214 (1986); Winter U.S. Patent 5,225,539; Jones et at, Nature 321: 552-525 (1986); Verhoeyan et al, Science 239: 1534; and Beidler et al., J. Immunol. 141: 4053-4060 (1988). [0052] Completely human antibodies are desirable for therapeutic treatment of human patients. Such antibodies can be produced using transgenic mice that are incapable of expressing endogenous immuπoglobulin heavy and light chains genes, but which can express human heavy and light chain genes. See, for example, Lonberg and Huszar, Int Rev. Immunol. 13: 5-93 (1995); and U.S. Patent Nos.5,625,126; 5,633,425; 5,569,825; 5,661,016; and 5,545,806, In addition, companies such as Abgenix, Inc. (Fremont, CA) and Medarex, Inc. (Princeton, NJ), can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above. Completely human antibodies that recognize a selected epitope also can be generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody (e.g„ a urine antibody) is used to guide the selection of a completely human antibody recognizing the same epitope. This technology is described for example by Jespers et al., Bio/Technology 12: 899-903 (1994). [0053] An anti-calcium channel or ANX III antibody can be a single chain antibody. A single chain antibody (scFV) can be engineered (see, e.g., Colcher et al., Ann. N Y Acad. Sci.880: 263-80 (1999); and Reiter, Gin. Cancer Res.2: 45-52 (1996)). Single chain antibodies can be dimerized or multimerized to generate multivalent antibodies having specificities for different epitopes of the same target polypeptide. [0054] Antibodies also may be selected or modified so that they exhibit reduced or no ability to bind an Fc receptor. For example, an antibody may be an isotype or subtype, fragment or other mutant, which does not support binding to an Fc receptor (e.g., it has a mutagenized or deleted Fc receptor binding region). [0055] Also, an antibody (or fragment thereof) may be conjugated to a therapeutic moiety such as a c^totoxin, a therapeutic agent or a radioactive metal ion. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomyc , etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, raitoxantroπe, mithramycin, actinomycin D, 1 dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaiπe, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g„ mechlorethamme, thiotepa chlorambucil, melphalan, carmustine (BCNU) an lomust e (CCNU), cyclophosphamide, busuliSaπ, dibromo annitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDF) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomyciπ, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine). [0056] Antibody conjugates can be used for modifying a given biological response. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a polypeptide such as tumor necrosis factor, γ-interferon, α-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; or, biological response modifiers such as, for example, lyrophokines, interleukin-1 ("IL-1"), interIeukin-2 ("D -2"), iπlerieukin-6 ("3L-6"), granulocyte macrophage colony stimulating factor ("GM-CSF'), granulocyte colony stimulating factor ("G-CSF , or other growth factors. Also, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, for example. [0057] An anti-calcium channel or ANX III antibody (e.g., monoclonal antibody) can be used to isolate calcium channel or ANX IH polypeptides by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-ealcium channel or ANX in antibody can be used to detect a calcium channel or ANX in polypeptide (e.g. , in a cellular ly sate or cell supernatant) to evaluate the abundance and pattern of expression of the polypeptide. Anti-calcium channel or ANX HI antibodies can be used diagnostically to monitor polypeptide levels in tissue as part of a clinical testing procedure, e.g., to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e„ physically linking) the antibody to a detectable substance (i.e„ antibody labeling). Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, biolu inescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β- galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin bϊotin; examples of suitable fluorescent materials include umbeliiferone, fluoresceiπ, fluoresceiin isothiocyanate, rhodamine, dichlorotriazinylamine fluoresceiπ, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ^l2Sl, ^t311, ³⁵S or ³H or any radioactive molecule suitable for and/or used in in vivo nuclear medicine procedures. Also, an anti-calcium channel or ANX πi antibody can be utilized as a test molecule for determining whether it can treat a cell proliferative disorder, and as a therapeutic for administration to a subject for treating a cell proliferative disorder. [0058] Included are antibodies that bind only a native calcium channel splice variant or ANX III polypeptide, only denatured or otherwise non-native calcium channel or ANX m polypeptide, or which bind both, as well as those having linear or conformational epitopes. Conformational epitopes sometimes can be identified by selecting antibodies that bind to native but not denatured polypeptide. Methods For Determining a Risk of or Presence of a Cell Proliferative Disorder [0059] Provided herein are methods for detecting a risk of, or the presence of, a cell proliferative disorder in a subject, which methods comprise determining whether an abnormal pattern of expression of Ca_v3.1 calcium channel mRNA or protein exists. Expression of a particular splice variant can be determined by detecting the presence of mRNA encoding the splice variant and/or by detecting the protein splice variant itself. As demonstrated below, cells that undergo abnormal proliferation uniquely produce the splice variant Ca_v3.1ac, and thus the presence or absence of expression of this splice variant is indicative of the propensity of the cell for proliferation. The presence of this splice variant expression when found in the cells in a sample from a subject indicates that the subject is at risk for, or is afflicted with, a cell proliferative disorder. Similarly, the presence of Ca_v3.1 b splice variant is characteristic of hyperproliferative cells and the presence of ,this splice variant expression in cells of a sample derived from a subject indicates that the subject is at risk f r or is afflicted with a cell proliferative disorder. Also diagnostic is the proportion of the splice variant Ca_v3.1bc, where the presence of mote than about %, especially more than about 30%, in particular more than about 40%, 50%, or 60% of Ca_v3.1bc as a percentage of the total Ca_v3.1 expression in the cells indicates the presence of a cell proliferative disorder. As noted, expression levels may be measured either at the mRNA level or the protein level. [0060] The mRNA or protein is detected in a biological sample from the subject. For example, the biological sample may be blood, saliva, sputum, urine, cell scrapings, and/or biopsy tissue. The term "subject" as used herein refers primarily to a human but also refers to other mammals such as dogs, cats, and ungulates (e.g., cattle, sheep, and swine). Subjects also include avϊans (e.g., chickens and turksys), reptiles, and fish (e.g._t salmon), as embodiments described herein can be adapted to nucleic acid samples isolated from any of these organisms. A nucleic acid, protein or biological sample may be isolated from the subject and then directly utilized in a method for detetm-niπg the presence of a calcium channel splice variant associated with a cell proliferative condition, or alternatively, the sample may be isolated and then stored (e.g., frozen) for a period of time before being subjected to analysis. [0061] The nucleotide sequence or polypeptide sequence detected sometimes is substantially identical to the nucleotide sequence or amino acid sequence of the calcium channel associated with a cell proliferative condition. In some embodiments, the nucleotide sequence or polypeptide sequence detected is substantially identical to a Ca_v3.1ac calcium channel or Ca_v3.1b calcium channel encoding nucleotide sequence or polypeptide sequence, as allelic variants may occur. The sequence detected at times is 80% or more, 81% or more...85% or more...89% or more, or 90% or more identical to a Ca_v3.1ac calcium channel or Ca_v3.1b calcium channel encoding nucleotide sequence or polypeptide sequence, and often is 91% or more, 92% or more...95% or more. , .97% or more, 98% or more, or 99% or more identical to a Ca_v3.1ac calcium channel or Ca_v3,lb calcium channel encoding nucleotide sequence or polypeptide sequence. Also, an ϊntraceilular loop region between conserved transmembrane regions, such as an intracellular loop between region I and n, between H and HI or between HI and IV in a detected nucleotide sequence or polypeptide sequence sometimes bears less sequence identity to a corresponding loop in a Ca_v3.1ac calcium channel or Ca_v3. lb calcium channel as compared to the rest of the sequence. In such loop regions, the detected nucleotide sequence or polypeptide sequence sometimes bears 50% or more, 51% or more.. ,,60% or more...70% or more...80% or more...90% or more...95% or more- ..97% or more, 98% or more or 99% or more sequence identity to a corresponding loop sequence in a Ca_v3.1 c calcium channel or Ca 3.Ib calcium channel. [0062] Any suitable method for detecting the Ca_v3.1 calcium channel splice variant nucleotide Sequence or amino acid sequence is utilized. For example, in a process for detecting a specific Ca_v3.l calcium channel splice variant protein, a biological sample from a subject sometimes is processed (e.g„ processed to disrupt cell membranes) and then contacted with an antibody that specifically binds to the particular Ca_v3.1 calcium channel splice variant being detected (e.g., a Cav3.1ac or Ca_v3. lb calcium channel splice variant). A variety of methods are known for detecting the presence or absence of a particular Ca_v3.1 calcium channel splice variant nucleotide sequence associated with a cell proliferative condition, which include the RT-PCR techniques described hereafter. [0063] If it is determined that a subject is at risk of a particular cell proliferative disorder, such as one described previously, the risk may be expressed in any known and usefijl manner. For example, risk of a cell proliferative disorder sometimes is expressed as a probability, such as an odds ratio, percentage, or risk factor. The risk assessment is based upon the presence or absence of a Ca_v3.1 calcium channel nucleotide sequence or polypeptide associated with the cell proliferative condition -?,#., a Ca_v3.1ac or Ca_v3,lb calcium channel splice variant), and also may be based in part upon phenotypic traits of the individual being tested. Methods for calculating risks based upon patient data are known (see, e,g., Agresti, Categorical Data Analysis, 2nd Ed.2002. Wiley). [0064] Processes for identifying a nucleotide sequence encoding a Ca_v3.1 calcium channel splice variant associated with a cell proliferative disorder or the encoded protein in a sample from the subject sometimes is combined with other information or processes. Combining with other information or processes often enhances the ability of a health care provider to diagnose or treat the cell proliferative disorder. Other information sometimes is the presence or absence of another calcium channel splice variant nucleotide sequence or polypeptide in a sample from the subject; phenotypic information pertaining to the subject -.-g., family history of a cell proliferative disorder and personal history of a cell proliferative disorders); and/or information from a further process for diagnosing a cell proliferative disorder. For example, another process for diagnosing a cell proliferative disorder sometimes is detecting the presence or absence of increased cell proliferation within a subject identified as aving the presence of a nucleotide sequence that encodes a Ca_v3-1 calcium channel or the presence of a Ca_v3.1 calcium channel protein associated with a cell proliferative disorder. The presence or absence of increased cell proliferation sometime-- is detected in a tissue biopsy from the subject. Iti other embodiments, the presence or absence of increased cell proliferation is detected in vivo, such as by nuclear medicine procedures, for example. [0065] In other embodiments, the processes described above sometimes are combined with a further process for treating the cell proliferative disorder. Any treatment of the cell proliferative disorder can be administered to the subject. A general method for treating a celt proliferative disorder sometimes is prescribed, such as administering a chemotherapy or radiation therapy regimen to the subject that reduces cell proliferation. Methods that specifically target the cell proliferative condition also may be prescribed, such as removing one or more tumors from the subject in surgery, and or treatment with an antagonist of a specific molecule that causes the cell proliferative disorder. Compositions and methods for treating cell proliferative disorders by antagonizing a T-type calcium channel (e.g„ a Ca_v3.1 calcium channel splice variant associated with a cell proliferative disorder) are described in greater detail hereafter.

Methods to Inhibit Cellular Proliferation [0066] Cellular proliferation may be inhibited in cells that express abnormal patterns of Ca_v3.1 calcium channel splice variants using a number of techniques. As noted above, the abnormal pattern may reflect itself in the ratio of the various splice variants or the presence of Ca_v3.ib or the presence ofCa_v3.1ac, [0067] to one approach, blockers of T-type calcium channels may be used; however, a more nuanced approach focuses on the T-type channels that are abnormally expressed - e.g., Ca 3.1 b, Ca_v3. lac, and Ca_v3. Ibc. Inhibition of either expression or activity of these channels or both may be effective. Expression of these splice variants may be negatively affected using, for example, antisense oligonucleotides, inhibitory RNA, or ribozymes, all of which are designed to be Specific for these splice variants to be targeted. Alternatively, specific antagonists, such as antibodies that are directed toward the splice variant in question ate useful. In the case of Ca_v3.1ac, inhibitors of its interaction with the ANX in protein or substances that bind specifically to ANX -31 protein may also be used. [0068] As demonstrated below, the splice variants differ in the linker sequence between regions III and IV of the «i protein characteristic of Ca_v3.1 calcium channels (see Fig. 2). Thus, ribozymes, inhibitory RNA, and antisense sequences targeted to the miRNA region specific for the sequences characteristic of the undesired splice variant in this region may be used, as well as antibodies specifically immunoreactive with the protein encoded in this region, [0069] As further described below, these approaches to inhibiting the proliferation of abnormally proliferating cells exhibiting abnormal Ca_v3.1 splice variant expression can be applied to cells that exist in a subject as well as cells in culture or biopsy. I. Cell Proliferative Treatment Compositions and Methods [0070] Provided are methods for treating a cell proliferative disorder characterized by expression of a Ca_v3.1 calcium channel splice variant associated with the cell proliferative disorder (e.g., Ca_v3.lac and/or Ca_v3.1b and/or Ca_v3,lbc), which comprise administering a T-type calcium channel blocker to a subject in need thereof in an amount effective to treat the cell proliferative disorder. An antagonist molecule specific for a Ca_v3.1 calcium channel splice variant associated with the cell proliferative disorder (e.g., Ca_v3.1ac and/or Ca_v3,lb and/or Ca_v3.1bc) is preferred, or a molecule that inhibits the interaction between ANX HI with a C v3.1 calcium channel associated with the cell proliferative disorder (e.g., Ca_v3.1ac), to a subject in need thereof in an amount effective to treat the cell proliferative disorder, [0071] In addition, expression of undesired splice variants may be inhibited by an antisense, ribozyme, RNAi, siRNA, or triple helix-forming nucleic acid. Activity may be inhibited by an antibody or compound small molecule type. The antagonist sometimes blocks the calcium channel and sometimes interferes with and inhibits an interaction between a Ca_v3.1 calcium channel splice variant and ANX IH (e.g., inhibiting binding between a Ca_v3.1 calcium channel splice variant and ANX in). Inhibition of binding between a Ca_v3.1 calcium channel splice variant and ANX ffl sometimes is effected by binding of the antagonist to the calcium channel, to ANX HI or to a complex formed by the calcium channel and ANX ffl. In some embodiments, a molecule administered is a compound described in U.S. patent application publication no. US-2004-0034035- Al published Februar Λ9, 2004; U.S. patent application publication no. US-2Q04-0044004--A1 published March 4, 2004; U.S. patent application no. 10/763,974 filed January 22, 2004 and U.S. patent application no.60/474,864 filed May 30, 2003. In other embodiments, a molecule administered is an antibody that specifically binds to a Ca_v3, 1 calcium channel associated with a cell proliferative disorder (e.g., Ca_v3.1ac and/or Ca_v3.1b), or an antibody that specifically binds to ANX HI. An antibody that binds to a calcium channel often inhibits or blocks the function of the molecule and or inhibits the interaction between the calcium channel and ANX m. An antibody that binds to ANX HI often inhibits the interaction between the calcium channel and ANX HI. [0072] The antagonist often is formulated as a pharmaceutical composition with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes solvents, dispci-ύuu iπed-a, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds sometimes are incorporated into the compositions, [0073] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), traπsdexmal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradeπn-ι-1, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl para-bens; aπtioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenedi minetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. [0074] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g. , gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a outhwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalliπe cellulose, gum tragacan h or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. [0075] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for fl-e extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. la many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. [0076 J Sterile injectable solutions can be prepared by incoiporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients described above, as required, followed by filtered sterilization- Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those described. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation often utilized are vacuum drying and frees-e- drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. [0077] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a. gas such as carbon dioxide, or a nebulizer. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and ftisidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams (e.g., sunscreen) as generally known in the art. Molecules can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery. [0078] In one embodiment, active molecules are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethytene vinyl acetate, polyaπhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811, [0079] It is advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated, where each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier, [0080] Toxicity and therapeutic efficacy of molecules and formulations can be determined by Standard pharmaceutical procedures in cell cultures or experimental animals in which LD_∞ values (the dose lethal to 50% of the population) and EDsα values (the dose therapeutically effective in 50% of the population) sometimes are determined. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅otED₅o. Molecules which exhibit high therapeutic indices often are utilized. While molecules that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue for minimizing potential damage to v-niπfected cells and reducing side effects, [0081] Data obtained from cell culture assays and animal studies can be used informulating a range of dosages for use in humans, A dosage of such molecules lies preferably within a range of circulating concentrations that include the ED_S0 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any molecules used in the method, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (--<--, the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography- [0082] A therapeutically effective amount of protein or polypeptide (--<?„ an effective dosage) ranges from about 0.001 to 30 rag/kg body weight, sometimes about 0.01 to 25 mg kg body weight, often about 0.1 to 20 mg/kg body weight, and more often about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg kg body weight. The protein or polypeptide can be administered one time per week for between about 1 to 10 weeks, sometimes between 2 to 8 weeks, often between about 3 to 7 weeks, and more often for about 4, 5, or 6 weeks. The skilled artisan will appreciate that certain factors may influence the dosage and timing requited to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or can include a series of treatments. [0083] In formulation embodiments comprising an antibody, a dosage of O.t mg/kg of body weight (generally 10 mg/k-g to 20 mg kg) is often utilized. If the antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg kg often is appropriate. Generally, partially human antibodies and fully human antibodies have a longer half-life within the human body than other antibodies. Accordingly, lower dosages and less frequent administration is often possible. Modifications such as Hpidation can be used to stabilize antibodies and to enhance uptake and tissue penetration (e.g., into the brain). A method for lipidatioπ of antibodies is described by Cruikshank eτ al., J. Acquired Immune Deficiency Syndromes and Human Retrøvirology 14: 193 (1997). f0084] Antibody conjugates can be used for modifying a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a polypeptide such as tumor necrosis factor, .alpha.-interferøn, .bεta.-interferoπ, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; or, biological response modifiers such as, for example, lymphokin.es, interieukin-1 ("IL-F'), interleukin-2 ("IL-2"), inter-eukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF⁵), or other growth factors. Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described in U.S. Patent No.4,676,980. [0085] For compounds, exemplary doses include milligram or microgram amounts of the compound per kilogram of subject or sample weight, for example, about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about ϊ microgram per kilogram to about 50 micrograms per kilogram. It is understood that appropriate doses of a small molecule depend upon the potency of the small molecule with respect to the expression or activity to be modulated. When one or more of these small molecules is to be administered to an animal (e.g., a human) in order to modulate expression or activity of a polypeptide or nucleic acid, a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. In addition, it is understood that the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated. [0086] Pharmaceutical compositions of active ingredients can be administered by any of the paths described herein for therapeutic and prophylactic methods for treating a cell proliferative disorder. With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from pharmacogenomic analyses. As used herein, the term "treatment" is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic molecule to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward the disease.

Screening Methods [0087] Provided herein are methods for identifying a molecule that inhibits cell proliferation, which comprise contacting one or more cells comprising a Ca_v3.1 calcium channel encoding nucleic acid and/or a Ca_v3.1 calcium channel polypeptide with a test molecule, and determining whether the test molecule decreases cell proliferation, whereby a test molecule that decreases cell proliferation is identified as a molecule that inhibits cell proliferation. The Ca_v3.1 calcium channel utilized in the process is associated with a cell proliferative disorder, and sometimes is a Ca_v3.1ac and/or Ca_v3.1b and/or an excess of Ca_v3.1bc calcium channel splice variant. Thus, in one form of these assays, compounds may be evaluated by their effects on expression of splice variants characteristic of abnormal cellular proliferation or by their ability to inhibit the activity of these splice variants in transport of calcium ion. Also provided are methods of screening for a molecule that inhibits the interaction between Ca_v3.1ac and ANX III. In one embodiment, this method comprises detecting the level of interaction of the calcium channel splice variant (lac) and ANX ffl protein the presence and absence of the substance to be tested. A decrease in the interaction in the resence as compared to the absence of the test substance indicates that the test substance is a successful candidate molecule for treatment of cell proliferative disorders -aid for inhibiting cell proliferation generally. In lieu of using the splice variant per se, a polypeptide representative of the splice variant, i.e., that encoded by the differentiating portion of the mR A encoding the HI-IV linker, can be used. As noted in Figure 2, the sequence SKEKQMAD per se is unique to Ca_v3. lac and the extended form of this segment into exon 26 includes sequences shared with the abnormally highly expressed Ca-Albc. -- L one specific embodiment, the method comprises: (a) incubating a Ca_v3. lac polypeptide or substantially identical polypeptide thereof with a test molec le under conditions sufficient to permit binding between the polypeptide and the test molecule in a reaction mixture, (b) contacting ANX ffl with the reaction mixture under conditions sufficient to permit binding between the polypeptide and ANX m, and (c) detecting the presence or absence of decreased binding between the polypeptide and ANX TO., whereby the presence of decreased binding between the polypeptide and ANX m identifies the test molecule as a molecule that inhibits the interaction between Ca_v3.1ac and ANX HI. In such methods, the Cay .lac polypeptide sometimes comprises 25 or more sequential amino acids selected from a region spanning amino acid 1546 to amino acid 1570 of a Ca_v3.1ac T-type calcium channel, and in certain embodiments, the polypeptide consists of the amino acid sequence, S1-^Q ADI--^DD\?IASG5S-^AAS. [00SS] A reaction mixture or system sometimes is a cell-free in vitro environment and sometimes is a cell-based environment such s a collection of cells, a tissue, n organ, or an organism. A system is "contacted" with a test molecule in a variety of manners, including adding molecules in solution and allowing them to interact with one another by diffusion, cell injection, and any administration routes in an animal. As used herein, the term "interaction" refers to an effect of a test molecule on a calcium channel nucleic acid or polypeptide, ANX ffl nucleic acid or polypeptide, or complex between a calcium channel and ANX III, where the effect is sometimes binding between the test molecule and the nucleic acid or polypeptide, and sometimes is an observable change in cells, tissue, or an organism. [00S9] Any method for determining whether a calcium channel is inhibited or blocked can be utilized, and examples of such processes are described in U.S. patent application publication no, US- 2004-0034035-At published February 19, 004; U.S. patent application publication no. US-2004- 0044004-A1 published March 4, 2004; U.S. patent application no. 10/763,974 filed January 22, 2004 and U.S. patent application no. 60/474,864 filed May 30, 2003. In an embodiment, a standard patch clamp technique is employed to identify Mockers of T-type calcium channel currents. Briefly, HE cell lines stably expressing a human olG T-type channel are used for recordings (passage #: 4 20, 37°C, 5% CO₂ . To obtain T type currents, plastic dishes containing semi confluent cells are positioned on the stage of a ZEISS AXIOVERT S100 microscope after replacing the culture medium with external solution. Whole cell patches are obtained using pipettes (borosilicate glass with filament, OJD.: 1.5 mm, I.D.: 0.86 mm, 10 cm length), fabricated on a SUITER P 97 puller with resistance values of ~5 MΩ. Increases or decreased in currents are detected to determine whether a test molecule modulates the signal of a T-type calcium channel. Examples of other assays ate described in Example 4 hereafter. [0090] Any other method for determining whether the test molecule interacts with a calcium channel or for determining whether an interaction between a calcium channel splice variant and ANX in is inhibited can be utilized. Examples of such methods include, for example, titrametric, acidimetric, radiometric, NMR, monolayer, polarographic, spectrophotoraetric, fluorescent, and ESR assays. Specific embodiments include fluorescence resonance energy transfer (FRET) assays, surface plas on resonance assays, and certain heterogeneous assays, [0091] hi FRET assay embodiments, a fluorophore label on a first, "donor" molecule (e.g., the calcium channel) is selected such that its emitted fluorescent energy is absorbed by a fluorescent label on a second, "acceptor" molecule (e.g., ANX III), which in turn is able to fluoresce due to the absorbed energy from the donor (e.g., Lakowicz et al. , U.S. Patent No.5,631 , 169; Stavrianopøulos et al. U.S. Patent No.4,86S, 103). Alternately, a donor of a non-derivatized polypeptide may be natural fluorescence energy of tryptophan residues. When labels are utilized, they are chosen to emit a different wavelength of light, such that the acceptor label may be differentiated from that of the donor. Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed, to a situation in which binding occurs between the molecules, the fluorescence emission of the "acceptor" molecule label in the assay should be maximal. A FRET binding event can be conveniently measured by standard fluorometric detectors. [0092] hi surface plasmon resonance assay embodiments, biospecific interactions are detected in real time without labeling any of the interactants with detectable chemicals (e.g., Sjolander & Urbaniczk, Anal. Chem.63: 2338-2345 (1991) and S-tabo etal.. Curr. Opin. Struct. Biol, 5: 699-705 (1995)). Changes in mass at the binding surface, which are indicative of binding events, result in alterations of the refractive index of light near the surface (the optical phenomenon of surface plasmon resonance (SPR)), which is a detectable signal used to monitor real-time interactions between biological molecules. This type of assay sometimes is referred to as biomolecular interaction analysis (BIA). In such assays, the calcium channel splice variant protein or ANX HI protein sometimes is linked to a solid support surface and the effect of a test molecule on the binding of the other added binding partner (e.g., the added binding partner is ANX III where the calcium channel is linked to the solid support) is determined by detecting changes in SPR. [0093] In other embodiments, the calcium channel, ANX III or test molecule is anchored to a solid surface in a heterogeneous assay. The target calcium channel or ANX III molecule often is anchored to a solid surface, and the non-anchored molecule sometimes is directly labeled and sometimes is indirectly labeled. The anchored molecule may be linked to any suitable solid surface, examples of which include a surface of a microtiter plate, test tube, micro-centrifuge tube or silicon chip. In certain embodiments, the molecule to be anchored may be produced by recombinant processes as a product that includes a contiguous and heterologous polypeptide region, where the heterologous region is capable of binding to a molecule linked to a solid surface. For example, a calcium channel splice variant polypeptide or ANX III polypeptide may be fused to glutathione-S- transferase and then adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or g αtathione-derivatized microtiter plates. The molecule to be conjugated to the solid surface (e.g., a calcium channel splice variant) may be linked before, during or after the other molecules (e.g., ANX III and/or a test molecule) are added to the system, which are combined under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Other techniques for immobilizing a calcium channel or ANX III molecule on a solid support include using biotin and streptavidin. For example, a biotinylated calcium channel or ANX III polypeptide can be prepared from biotin-NHS (N-hydroxy-succinimide) using known techniques (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in wells of a streptavidin-coated microtiter plate (Pierce Chemical). [0094] In heterogeneous assay embodiments, one or more non-immobilized components are added to the coated surface containing the anchored component or components under conditions conducive to binding. After the reaction is complete, unreacted components are removed (e.g. , by washing) under conditions allowing for any molecules bound to the anchored molecule or molecules to remain immobilized on the solid surface. The detection of molecules anchored on the solid surface can be accomplished in a number of ways. Where the non-immobilized component is pre- labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where a previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface. In certain embodiments, an indirect label is a labeled antibody that specifically binds to the immobilized, non-anchored component, or an antibody that specifically binds to the immobilized, non-anchored component, which in turn is labeled directly, or is labeled indirectly with a labeled anti-Ig antibody, for example. In the latter embodiments, the label sometimes is an enzyme utilized in an enzyme-linked format. In embodiments incorporating an antibody, the antibody often specifically binds to a calcium channel splice variant or ANX III molecule without significantly interfering with binding of the calcium channel to ANX HI polypeptide or binding of the test molecule. Such antibodies can be anchored to the solid support, [0095] In alternative embodiments, a homogeneous assay conducted in a liquid phase without a solid support can be utilized. In such an assay, the reaction products are separated from unreacted components by standard techniques that include but are not limited to differential ceπtrifugation (see, for example, Rivas, G., and Minton, A. P., Trends Biochem Sci Aug;18(S): 284-7 (1993)); chromatography (e.g., gel filtration chromatography, ion-exchange chromatography); electrøphoresis (e.g„ Ausubel et at, eds. Current Protocols in Molecular Biology , J. Wiley: New York (1999)); immunoprecipitation e.g., Ausubel, F. et at, eds. Current Protocols in Molecular Biology , J. Wiley: New York (1999)) and mass spectrometry (e.g., U.S. Pat. Nos. 5,547,835; 5,605,798; 5,691,141; 5,849,542; 5,869,242; 5,928,906; 6,043,031 and 6,194,144). [0096] The assay embodiments described above sometimes are conducted in a direct format or a competitive format. In the latter format, an interaction between, a calcium channel splice variant, ANX HI and/or a test molecule is determined by detecting an interaction of one component with a target component in the presence of another component that interacts with the target component, In an embodiment, a competitive assay sometimes is conducted by monitoring the amount of an antibody bound to a calcium channel splice variant in the presence of ANX -HI and/or a test molecule, where the antibody and ANX III compete for binding to the calcium channel splice variant. In. the assay embodiments described herein, a convenient measure of binding affinity can be calculated from signals generated by the assays usiηg known methods. For example, a K^, Kj, _ra, pre-steady state kinetic constant, IC50, LD₅₀ or ED5₀ parameter can be utilized to rank test molecules in. the assays. [0097} In certain embodiments, modulators of calcium channel splice variant or ANX III expression ate identified. For example, a cell or cell-free mixture is contacted with a test molecule and the expression of the calcium channel splice variant or ANX in mRNA or polypeptide is evaluated relative to the level of such products in the absence of the candidate compound. When expression of the calcium channel splice variant or ANX III mRNA or polypeptide is less in the presence of the test molecule than in its absence, the candidate compound is identified as a stimulator of calcium channel or ANX DI expression, for example. Calcium channel splice variant or ANX III mRNA or polypeptide expression levels can be determined by standard methods, such as those described herein. [0098] Where membrane-bound forms of a calcium channel are used, it may be desirable to utilize a solubilizing agent. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, α-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methyiglucamide, decanoyl-N-methylglucamide, Triton^® X-100, Triton^® X-114, Thesit^®, ϊsotridecyρoly(ethylene glycol ether)n, 3-[(3-cholamidoproρyl)dimethylamminio]-l-ρrθpane sulfonate (CHAPS), 3-[(3- cholamidoρrøpyl)d--methylammjπio]-2-hydroxy-l -propane sulfonate (CHAPSO), or -dodecyl- N,N-dimethyI-3-ammonio-l -propane sulfonate. [0099] The following examples are intended to illustrate but not to limit the invention.

Example 1 Tissue samples [0100] Glioma samples were obtained with informed consent from seven patients who underwent craniotomy for brain tumor resection. The extent of the resection and standard neurosurgical methods were not modified for the purpose of this study. Part of the specimen was removed, quickly frozen in liquid nitrogen and stored at-80°C until RNA preparation. Another part was sent for routine neuropathological evaluation. The clinicopathological data of the patients are presented in Table 1. Six of the tumors were categorized as astirocytoπia and one was oligodendroglioma (case 01), The astrocytomas ranged in World Health Organization (WHO) grade (Kleibues et al 1994) from II (increased cellularity and mild atypia without mitoses, endothelial proliferation and necrosis) to IV (marked cellular heterogenity, cytoplasmic and nuclear pleomorphism, mitotic figures including atypical forms, endothelial proliferation and necrosis) Grade III tumors were differentiated from Grade IV by the absence by endothelial proliferation and necroses. The oligodendroglioma was anaplastic WHO Grade III (high cellularity, widespread nuclear atypia and pleomorphism, high mytotic index, endothelial proliferation and necrosis). Table 1. Clinicopathological data of patients undergoing resection of a glioma

* World Hea th rganiza on e hues et a , 1 .

Example 2 Cell culture and transient tratisfecttoπ [0101] Primary cultures of human fetal astrocytes (>99% purity) are prepared and maintained as described iit Corley et at. (2000). The glioma cell lines US7, U251 N and U563 are prepared and used as previously reported (Besson and Yong, 2000). These cells were cultured in Dulbεcco's modified Eagle's medium (-DMEM) containing 10% (v/v) fetal calf serum with L-glutamine (2mM), sodium pyruvate (tmM) and 1% (v/v) non-essential amino acids. They were maintained at 37°C in a humidified atmosphere with 95% air and 5% COj and grown until confluency. The medium was changed every two days. Tissue culture and wansfection of tsA-201 cells is described in detail in Beedle et al. (2002). Briefly, HEK cells were grown to 85% confluency at 37^βC (5% C0₂) in DMEM (+10% fetal bovine serum, 200U/mI penicillin aπd .2mg/ml streptomycin, Life Technologies, Inc.). Cells were dissociated with trypsin (0,25%)-EDTA and plated on glass coverslips. All of the above solutions used for cell culture were purchased from Gibco-BRL. The Ca_v3.lac and Ca_v3.1b variants (6μg) and green fluorescent protein (Iμg) DNA were transfected into cells using the calcium phosphate method. Cells were transferred to 28^PC 24 hours after transfection and recordings were performed two days later.

Example 3 RNA isolation and RT-PCR [0102] Total RNA from glioma samples and cell lines a_j well as from primary cultures of fetal astrocytes was extracted following a Trizol protocol (Life Technologies), DNase treated, extracted using phenol/chloroform extraction and resuspended in DEPC-treatsd water. The RT-PCR forward (5'CAGTTACCGGTGGGTCC 3CACAA3') and reverse

(5^,G- ATCTGGGGC CTG G GCT CAT3^,) primers were directed to the DI-IV linker and were based on the human CACN1G sequence (Geπbank accession number AF126965). The detailed protocol for RT-PCR is described in Latour et at (2003). [01,03] As illustrated in Figure 2A, splicing of exon 25 to exon 27 results in Ca_v3.1--. or the Cay3.1b variant. Splicing of exon 25 to exon 26 results in the Ca_v3.1ac or Ca_v3.1bc variant. To determine Ca 3.1 gene expression inhuman whole brain, glioma samples and glioma cell lines, RT- PCR analysis was performed using primers directed to the III-IV linker region of Ca_v3.i which contains these exons. Agarose gel analysis of RT-PCR results on human adult brain (Figure 2B lane 1) reveals the expression of two different Ca_v3.1 mRNA transcripts. The lower molecular weight product likely corresponds to Ca_v3.1a while the higher weight product probably corresponds to the Ca_v3,lbc isoform. Results obtained with RT-PCR of fetal brain (Figure 2B lane 2) suggest expression of Ca_v3. lbc (top band), but not of Ca_v3.la. The faint lower band indicates mRNA expression of Ca_v3.1b in fetal tissue. These results are consistent with previous findings by (i) showing mRNA expression of Ca_v3.1 , b and be in the brain and (ii) showing differential expression of exon 25 variants, with Ca_v3.1b being strongly fetal-specific and Ca_v3.1a being more abundant in the adult brain (Monteil et l, 2000). To determine C v3.1 expression in glio ---, RT-PCR analysis was performed on U251N glioma cells (Figure 2B lane 3) and glioma biopsies (Figure 2B lane 4) using the same primer pairs. Agarose gel analysis revealed the presence of a higher molecular weight product in lanes 3 and 4, suggesting the presence of a novel, longer isoform of the πi-rv linker expressed in glioma. Sequencing of the RT-PCR product confirmed the presence of a novel variant, Ca_v3. lac. These results are evidence of tumor specific expression of a Ca_v3, 1 channel splice variant in human brain. [0104] To further investigate the differentia! Ca_v3.1 gene expression in adult and fetal normal brain and glioma, ten clones were sequenced from each RT-PCR reaction and the relative abundance of Ca_v3.1 a, b, be and ac were determined for each condition. Distribution of the variants is shown in Figure 4A. Consistent with the literature (Monteil et al, 2000), sequencing revealed the exclusive expression of Ca_v3.1bc in fetal brain and a predominant expression of Ca_v3. l in adult brain. Since glioma frequently arises from astrocytes, RT-PCR analysis was performed on human fetal astrocyte cultures to evaluate Ca_v3.1 gene expression in normal astrocytes. As illustrated in Figure 4,

Ca_v3.1bc is predominantly expressed in fetal astrocytes, consistent with fetal whole brain RT-PCR. results. Sequencing analysis of the U563, U87 and U251N glioma cell lines demonstrated that these cells mostly express Ca_v3,lb and Ca_v3.1bc. Since these cells are derived from adult brain tissue, a predominant expression of Ca_v3.la was expected. The presence of the Ca 3.ϊac variant in the U251N cell line and in three glioma samples was identified-. This variant was observed only in glioma and not in normal tissue, suggesting a glioma-specific expression of Ca_v3.1ac, which is evidence of a differential gene expression of Ca_v3.1 in glioma, as gliomas mostly express fetal isoforms and the Ca_v3.1ac splice variant.

Example 4 -SlectroDhvsiology [0105] Glass coverslips carrying transfected cells were transferred to a 3 cm culture dish containing the recording solution (20mM BaCl₂, ImM MgCI , lOraM HEPES, 40mM tetraethylammontu chloride, lOmM glucose, 65mM CsCI, pH 7.2 with TEA-OH). Calcium channel activity in transfected tsA-201 cells was characterized via whole-cell patch clamp recordings using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA) linked to a personal computer equipped with pCLAMF v8.0. Patch pipettes (Sutler borosilicate glass, BF150- S6-15) were pulled (Sutter P-87 micrσelecirode puller), fire polished (Narishige) and showed typical resistances of 3 to 4 MΩ when illed with pipette solution (in mM: 108 CsMeSθ₄, 4 MgClj, 9 EGTA, pH 7.2). All data figures, fits and statistics were completed using Sig aPiot 2000 (SPSS Inc), [0106] Splicing of the πi-ΪV linker has previously been shown to alter the biophysical properties of T-type channels (Cheπώ- et al., 2001a). The HHV linker region of Ca_v3-lac was subcloned into a full-length Ca_v3.1 channel, and transiently expressed the variant in tsA-201 cells for electrophysiological characterization. Both clones expressed well in HEK cells and produced typical T-type current densities and waveforms. Figure 3 compares the biophysical properties of Ca_v3.lac to the Ca_v3,lb variant (Beedle et al., 2002). As shown in Figure 3, there was no statistical difference in the position of the current voltage-relations (Figure 3A), the voltage-dependences of inactivation (Figure 3B), nor the majority of time constants of inactivation (Figure 3C). Current densities also were similar for both variants. There was, however, a statistically significant slowing in the time course of recovery from inactivation for the Ca_v3.1ac variant (Figure 3D). These observations suggest that the glioma-specific Ca_v3.1ac variant displays electrophysiological cha-røcteristics that are similar to those observed with Ca_v3.Ib. [0107] These results provide evidence for low voltage-activated calcium channels in human glioma. Given that a range of different calcium-mediated intracellular cascades are involved in cancers, this suggests that the activation of these channels and subsequent calcium iftflux likely contribute to calcium signaling in glioma cells. Since Ca 3.tac is likely to contribute to tumor growth, it is interesting that the biophysical properties of this channel are virtually indistinguishable from Ca_v3.1b expressed in tsA-201 cells. However, it has been shown that Ca_v3.3 T-type calcium channels expressed in a neuronal cellular background can show different electrophysiological characteristics compared to channels expressed in tsA-201 cells (Chemin et at, 2001b). This difference can be due to the presence of neuron-specific interacting proteins. The Ca_v3. lac variant contains the longest amino acid sequence of all domain JH-IV linker splice variants, thus it is possible that splicing of this region could lead to the creation of an interaction site for neuron/glial specific regulatory proteins which may affect channel function, or be involved in intracellular signaling events mediated by channel activity. It is shown in Example 6 that a Ca_v3.1ac variant interacts with annexin HI while other Ca_v3.1 isoforms do not. Example 5 Immunofluorescence [0108] To determine if glioma cells express T-type calcium channels, immunostaining was performed on glioma samples and on a glioma ceil line using a rabbit polyclonal Ca_v3.1 antibody directed to the ΪI-HI linker region of the oh subunit (Latour et al., 2003). The presence of T-type channels on U251N glioraa cells w s assessed using Cy^m3-conjugated anti-rabbit secondary antibody. As shown in representative 40X (Figure 1A) and lOQX (Figure IB) confoeal images, most of the U251N cells display abundant expression of the Ca_v3.1 channel. Double-irnmunos ining was performed on paraifm-embedded glioma sections using the glial fibrillary acidic protein (GFAP) mouse monoclonal antibody in addition to the T-type channel antibody. The fluorescent anti-mouse Cy™2-conjugated secondary antibody was used against the mouse primary (GFAP) antibody. This dual staining confirmed the expression of Ca_v3.1 channels oα astrocytes in situ. A confoeal image of T-type channel immunofluorescence in a malignant astrocytoma is shown in Figure IC. The staining reveals clear expression of Ca_v3.1 channels in the tumor. The presence of astrocytes in the tissue was confirmed by GFAP immunolabeling (Figure ID). The co-expression of GFAP and T-type channels is assessed in Figure IE. Cells were pre-incubated with the Ca_v3.1 control peptide and Stained following the same protocol to confirm antibody specificity. This procedure significantly decreased the brightness of the immunofluorescence signal in glioma. As an additional control, glioma cells and sections also were incubated in the presence of the fluorescent secondary antibody alone and no signal was detected. This evidence shows expression of a voltage-gated calcium channel in human glioma cells and demonstrates that glioma and cultured glioma cells abundantly express Ca_v3,l channels. [0109] The U251N glioma cells were grown until confluency in a culture dish and detached from the dish with a 3-5 min.37^βC incubation with trypsin. Culture medium was added to the resuspension solution and cells were plated directly onto glass coverslips in 24-well plates. Cells were grown for an additional 24h, fixed with a 15 min. incubation period in 4% parafor aldehyde at 4° C and stained using a protocol described in Latour et al, (2003). Paraffin-embedded glioma sections obtained from the Foothills Hospital pathology services were deparaffinized in xylene and rehydrated in a descending ethanol series (100%, 95%, 80% and 70%). Tumor sections were then washed twice in PBS and incubated for lh at room temperature in a fresh PBS solution containing 5% normal donkey serum (Jackson ImmunoResearch). Slides were then transferred to a fresh PBS solution containing 0.01% BSA (Sigma), mouse anti-glial fibrillary acidic protein (GFAP) (1:3000) and rabbit anti-αio (1:5000) overnight at 4°C. The next day. the sections were washed three t-mss in PBS and were incubated at 4°C overnight in a fresh PBS solution containing Cy™3-conjugated donkey anti-rabbit IgG (1:2000, Jackson ImmunoResearch) and Cy™2-conjugated donkey anti- mouse IgG (1:2000, Jackson ImmunoResearch). The next day, the sections were washed again three times with cold PBS and mounted with Fluorsave (Calbiochem).

Example 6 Interaction of Cav3.1ac with Annexin HI [0110] RT-PCR was used to examine the presence of Ca_v3.1 T-type channels in human glioma. Using this approach, a splice variant of Ca_v3,l (Ca_v3.1ac) was identified that contains both exons 25 and 26 in the intracellular loop connecting domains IH and IV (Figure 2). This variant was seen in surgery samples from glioma patients, and in the U251N human glioma cell line. Moreover, the variant was detected in the human retinoblastoma cell line Y-79. In contrast, this variant was not present in normal human brain or cultured human astrocytes, which expressed predominantly the previously identified Ca_v3,la and Ca_v3.1bc variants. The full length cDNA of Ca_v3.lac was assembled and functionally characteri-jed in tsA-201 cells. In a pull down assay using GST-fusion proteins of various domain III-IV linker splice variants, the ac variant was selectively able to pull down a protein band in the 30-40 fcDa range (Figure 5). This band was excised, digested and subjected to fingerprinting via mass spectromet-ry, with a positive identification of the band as annexin III (ANX K). The identification and specificity for Ca_v3. lac was subsequently cot-firmed via additional pull downs and Western blotting with an ANX -QI antibody (Figure 5), Hence, a Ca_v3.1 splice variant that appears to be selectively expressed in mitogenic cells can form a complex with ANX ΠL [0111] Human annexiπs are a family of 13 different calcium-binding proteins with wide distribution across different tissues (Gerke, V. and Moss, S.E.2002. Annexins: From structure to function. Physiol Rev. 82, 331-371), They appear to share aα ability to bind phospholipids (Raynal, P., and Pollard, H.B. 1994. Annexins: the problem of assessing the biological role for a gene family of multifunctional calcium- and phospholipids-biπding proteins. Biochim. Biophys. Acta 1197, 63-93. Swairjo, M.A., and Seaton, B-A. 1994. Annexin structure and membrane interactions; a molecular perspective. Ann . Rev. Biophys. Biomol. Struct. 23, 193-213. Perron, B„ Lewi-Bentley, A., Geny, B„ and Russo-Marie, F. 1997. Can enzymatic activity, or otherwise, be inferred from structural studies of annexin III? . -0ι<?7. Chetn. 272, 11321-11326. Sopkova, J., Raguenes-Nicol., C, Vincent, M., Chevalier, A„ Lewit-Bentley, A., Russo-Marie, F., and Gallay, J. 2002. Ca(2+) and membrane binding to annexin 3 modulate the structure and dynamics of its N terminus and domain HI. Protein Set 11, 1613-1625.), and some members of the annexin family have been shown to form calcium permeable pores in bilayers, while others have been linked to cell signaling in tumors (Nygaard, S J„ Haugland, H. ., Kristoffersen, E.K., Lund-Johansen, M„ Laerum, O.D., and Tysnes, O.B. 1998. Expression of annexin π in glioma cell lines and in brain tumor biopsies. J. NeuwoncoU 38, 11-18.). ANX-I, IV and VI have been shown to modulate calcium, potassium and/or chloride channel activity (Naciff, J.M., Behbehani, .M., Kaetzel, M.A.. and Dedman, J-R. 1996. Annexin VI modulates Ca²⁺ and K⁺ conductances of spinal cord and dorsal root ganglion neurons. Am. J. Physiol Cell Physiol 271, C2004-C2015. Kaetzel, M.A., Chang Chan, H., Dubinsky, W.P., Ded an, J.R., and Nelson, DJ. 1994. A role for annexin IV in epithelial cell function. Inhibition of calcium-activated chloride conductance. J. Biol Chem. 269, 5297-5305.). Although not neuron specific, ANX HI is expressed in DRG neurons and in astrocytes (Naciff, J.M., Kaetzle, M.A., Behbehani, M.M. and Ded an, J.R. 1996. Differential expression of annexins I-IV in rat dorsal root ganglia and spinal cord. , Comp, NeuroL 368, 356-370.), and has been linked to a host of intracellular signaling events, such as inhibition of phospholipase A2 activity (Raynal, P., and Pollard, H.B. 1994. Annexins: the problem of assessing the biological role for a gene family of multifunctional calcium- and phospholipids-binding proteins. Biσchim. Biophys. Acta 1197, 63-93.). ANX in is comprised of four homologous domains and has a predicted molecular weight of about 36 fcDa (Favier-Pem , B-, Lewit-Bentley, A., and Russo- Marie, F. 1996. The high-resolution crystal structure of human annexin III shows subtle differences with annexin V. Biochemistry 35, 1740-1744.). ANX III may regulate calcium channel activity, and calcium influx through Ca_v3,lac channels may stimulate cell proliferation via ANX EL [0112] Calcium entry via L-type channels mediates the dissociation of preassociated calmodulin from the channel, which results in a downstream activation of CREB mediated gene transcription. Considering that ANX-III is also a calcium binding protein, its association with Ca_v3 , 1 channels is similar to this mechanism. As the expression of Ca_v3.1 ac channel isoform is specific to mitogenic cells, it is possible that Ca_v3.1ac is required for proliferation, and that the ANX-iπ/Ca_v3,lac interaction plays a role in proliferation. It has been shown that T-type channel blockers and knockdown of T-type channels can inhibit proliferation of Y-79 cells (Bertolesi, G.E., Shi, C, Elbaum, L., Jolli ore, C, Rozenberg, G-, Barnes, 5., Kelly, M.E.2002. The Ca(2+) channel antagonists mibefradil and pππoz-de inhibit cell growth via different cytoxic mechanisms. Mol Pharmacol 62, 210-219.). Cited Documents

Beedle AM, Ha id J, Zan-poni GW.2002. Inhibition of transiently expressed low- and high- voltage-activated calcium channels by trivaleπt metal cations. J e br Biol 187:225-38. Bertolesi GE, Jollimore CA, Shi C, Elbau L, Denovan-Wright EM, Barnes S, Kelly ME.2003. Regulation of alphalG T-type calcium channel gene (CACNAIG) expression during neuronal differentiation. Eur J Neurosci 17:1802-10. Besson A, Yong VW (2000) Involvement of 2i^{Wafl αP!} in protein kinase C ^-induced cell cycle progression. Mol Cell Biol 20: 4580-4590. Chemin J, Monteil A, Bourinet E, Nargeot J, Lory P. 2001a. Alternatively spliced alpha(lG) (Ca(V)3.1) intracellular loops promote specific T-type Ca(2+) channel gating properties. Biophys J 80:1238-50. Chemin J, Monteil A, Dubel S, Nargeot J, Lory P.2001b. The alphal I T-type calcium channel exhibits faster gating properties when ovenexpressed in neuroblastoma glioma NG 108-15 cells. Eur J Neurosci 14:1678-86. Chemin J, Nargeot J, Lory P.2002, Neuronal T-type alpha 1H calcium channels induce neuritogenesis and expression of high-voltage-activated calcium channels in the NG108-15 cell line, J Neurosci 22:6856-62. Corley SM, Ladiwala ϋ, Besson A and Yong VW, 2001. Astrocytes attenuate oϋgodendrocyte death in vitro through an α(6) aitegrin-laminin-dependent mechanism. Glia 36: 281-294. Cribbs LL, Lee JH, Yang J, Satin J, Zhang Y, Daud A, Barclay J, Williamson MOP, Fox M, Rees M, Perez-Reyes E. 1998. Cloning and characterization of alphalH from human heart, a member of the T-type Ca²⁺ channel gene family. Circ Res 83:103-9. D'Ascenzo M, Vairano M, Aπdreassi C, Navarra P, Azzena GB, Grassi C.2004, Electrophysiological and molecular evidence of L-(<-Xl), N- (Cav2.2), and R- (Ca_v2,3) type Ca^2÷ channels in rat cortical astrocytes. Glia 45:354-63. Hirooka K, Bertolesi GE, Kelly ME, ---tenov-ui- Wright EM, Sun X, Hamid J, Zamponi GW, Juhasz AE, Haynes LW, Barnes S.2002. T-Type calcium channel alphalG and alphalH subunit-s in human retinoblastoma cells and their loss after differentiation. J Neurophysiol 88:196-205. Kleihues P, Burger PC, Scheithauer BW 1993. The new WHO classification of brain tumors. Brain Pathol-3:255-6S. Klugbauer N, Marais E, Lacinova L, Hofmaπn F. 1999. A T-type calcium channel from mouse brain. Pflugers Arch 437:710-5. Kunert-Radek J, Stepien H, Radek A, Lyson K, Pawlikowski M. 1989, Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro. Acta Neural Scand 79:166-9. Latour L Hamid J, Beedle AM, Zamponi GW, Macvicar BA.2003, Expression of voltage-gated Ca²⁺ channel subtypes in cultured astrocytes, Glia 41:347-53.

Lee JH, Daud AN, Cribbs LL, Lacerda AE, Ferεverzev A, Klockner U, Schneider T, Perez-Reyes E. 1999. Cloning and expression of a novel member of the low voltage-activated T-type calcium channel family. J Neurosci 19:1912-21. Mariot P, Vanoverberghe K, Lalevee N, Rossier MF, Prevarskaya N. 2002. Overexprεssion of an alpha IH (Ca_v3.2) T-type calcium channel during neuroeπdocrine differentiation of human prostate cancer cells. J Biol Chera 277:10824-33. McRory JE, Santi CM, Hamming KS, Mezeyova J, Sutton KG, Baillie DL, Stea A, Snutch TP. 2001. Molecular and functional characterization of a family of rat brain T-type calcium channels. J Biol Chem 276:3999-40 U. Monteil A, Chemin J, Bourinet E, Mennessier G, Lory P, Nargeot J. 2000. Molecular and functional properties of the human alpha (1G) subunit that forms T-type calcium channels. J Biol Chem 275:6090-100. Olsen ML, Schade S, Lyons SA, A aral MD, Sonthei er H. 2003. Expression of voltage-gated chloride channels in human glioma cells. J Neurosci 23:5572-82. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, Lee JH. 1998, Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature 391:896-900. Ransom CB, Liu X, Sontheimer H.2002. BK channels in human glioma cells have enhanced calcium sensitivity. Glia 38:281-91. Schrey M, Codina C, Kraft R, Beetz C, Kalff R, Wolfl S, Patt S. 2002. Molecular characterization of voltage-gated sodium channels in human glioma. Neuroreport 13:2493-8. Sontheimer, H. 2003. Malignant glioma: perverting glutamate and ion homeostasis for selective advantage. Trends Neurosci 26:543-9. Sutherland GR, Florell R, Louw D, Choi NW, Si a AAF. 1987, Epidemiology of primacy intracranial neoplasms in Manitoba, Canada. Can J Neural Sci 14:586-92, Toyota M, Ho C, Ohe-Toyota M, Baylin SB, Issa JP. 1999. Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5' CpG island in human tumors. Cancer Res 59:4535-41. Walker DG, Kaye AH.2001. Diagnosis and management of astrocytomas, oligodendroglioma and mixed glioma: a review. Australas Radiol 45:472-82. Jarvis, S.E, and -Zamponi, G-W. 2001- Interactions between presynaptic Ca2+ channels, cytoplasmic messengers and proteins of the synaptic vesicle release complex. Trends Pharmacol Sci 22, 519-525. Magga, J tø. Jarvis, S.E., Aπrøt, M.I., Zamponi, G.W, and Braun, J.E. 2000. Cysteine string protein regulates G protein modulation of N-type calcium channels. Neuron 28, 1 5-204-

Nucleotide Sequence and Amino Acid Sequence Embodiments

Human alpha-US ac splice variant (SEQ ID NO: 1 )

Λ£gGACe*gGAGGAGGATG<--A-KGGGCGCCGAG^

GTCWGGGCCGGGGGCCGGCCGGGGCCG--ffiGTCAGCAGflAAAGGACCCGGGCA- ;GGGGACTCCGAGGCGGAGG

GGCTGCCGTACCCGGCGCTGGCCCCGGTGGO^TCTTCTACM^

CTCCGCACGGTCTGT---ACCCCTGGTtøGAGCGCAT^

CATGTTCCGGCCATGCGAGGACATCGCCTGTGACTCCCAGC-3CTGCCGGATCCTGCAGGCCTTTGATGACT CA

TCTTTGCCTTCTOTGCCGTGGAGATGGTGGT<i-^GATGGTGGCCTΪS-ffiGCATC

GGAGACACTTGG CCGGCTTGACTTTT CATCGTCATCGCAGGGATGCϊG^GTACTCGt-ITΩGACCTGCAG-^

CG CAGCTW;TCAeCTGTGAGGACAGTCCGTGTGCTGCGACCGCTGAGGGCCATTAACCGGGTGCCCAGCATGC

GCATCCTTGTCACGTTGCT-MTGGATACGCTGCCCAΪGCα-HSGGC-^CGTCCTGCTGCTCTGCTTCTTCGTCTTC

TTCATCT C-KSCATCGTCGGCGTCCAGCTG GGGCAGGGCTGCTTCGGAACCGATOCTTCCϊACC GAGAAT r

CAGCCTCCCCCTGAGCGTK- 3ACCTGQAGCGCTATTACCAGAqAGAG-?^CGAGGAT--aGA- CCCTTCATCTGCT

CCCAGCCACGCGAGAACGGCATGCGGTCCTGCAGAAGCGTGCCCACGCTGCGCGGGGACGGGGGCGG GGCCCA

CCTTGCGG CTGGACTATGAGGCCTACAACAGCTCCAGCAAC---CCACCTGTGTCAACTGGAACCAGTACTACAC

CAACTGCTCAC-C-- -X--&GCACAACCCCTTCAAG^

GCATCT CCAGGTCA CACGCTGGAGGGCTGGGTCGACATCATGTACTTTGTGATGGATCGTCAT CCTTCTAC

AATTTCATCTACTTCATCCTCCTCATCATCGTGCMCTCCT CT CATGATC-^CCTGTGCCTGGTGGTGATTGC

CACGCAGTTCAGTGAGAGOAAGCAGCGGGA-^GCCAGCTGATGCGGGAGCAGCGTGTGCGGTTCCTGTCCAACG

CCAGCACCCTGGCTAGCT CTCTGAGCCCGGCAGCTGCTATGAGGAGCTGCΪCAAGTACCTGGTGTACATCCTT

CGTAAGGCAGCCCGCAGGCTC-GCTCAGGTCTCTCGGGCAGCAGG GTGCGGG TGGGCTGCTCAGCAGCCCAGC

ACCCCTCGGGGt-CCAGGAGACCCAGCCCAGCAGCAGCTΩCTCTCGC'TCCCACCGCCGCCTATCCGTCCACCACC

TGGTCCACC-^CACGACCACCATCACCACCACTACCACC GGGC-^TGGGACGCrCAGGGCCCCCCGGGCCAGC

CCGGAGATCCAGGACAGGGATGCC-^TGGGTCCCGCAGGCTCATΘCTGCCACCACCC'--^,CGACGCC^,-.GCCC CTC

CGGGGCCCCCCCTGGTGGCGCAGAGTCTGTGCACAGCTTCTACCATGCCGACTGCCACTTAGAGCCAGTCCGCT

GCCAGGCGCCCCCTCCCAGGTCCCCATCTGAGGCATCCGGCAGGACt'G ?GGGCAGCGGGAAGGTGTATCCCACC

GTCCACACCAGCCCTCCACCGGAGACGC GA- ^AGAAGGCACTAGTAGAGGTGGCTGCCAGCTCTGGGCCCCC

-^CCCTCACCAGCCTC--ACATCCCACCCGG--x:CCTACAGCTCCATGCACAAGCTGCTGGAGACACAGAGTACAG

GTGCCTGCC-W-AGCTC TGCAAGATCTGGAG CCTTGCTWGAAAGCAGACAGTGGAC^CTGTGGTCCAGACAGC

TGCCCCTACTGTGCCCGGGCC-KGGCAGGGGAGGTGGAGCTCGCCGACCGTGAAATGCCTGACTCAGACAGCGA

GGCAGTTTATGAGTTCACACAGGATGCCCAGCACAGCGACCTCCGGGACCCCCACAGCCGGCGGCAACGGAGCC

TGGGCCCAGATGCAGAGCCCAGCTC GTGCTGGCCTTCTGGAGGCTAATCTGTGAC-^CTTCCGAAAGATTGTG

GACAGC-V-GTACTTT-^C--K3GG-^TCATGATCGCCAT∞^

CGAGCAGCCCGAGGAGCTTACCAACGCCCTAGAAATCAGC-^CA CGTCTTCAGCAGCCTCTTTGCCCTGGAGA

TGCTGCTGAAGCTGCTTGTGTATGGTCCCT TCGCTACA^

GTGGTCATCAGCGTGTGGGAGA CGTGGGCCAGCAG--GGGGCGGCC .GTCGGTGCT-OCGGACCTTCCGCCTGAT

GCGTGTGCTCAAGCTGGTGCGCTTCCTGCCGGCGCTGCAGCGG^ CGTGGCCACCTTC GCATGCTGCTTATGCTCTTCATC TCATCTTCAGQATCCTGGGCATGCATCΪCTTCGGC

TGC-^GTTTGCCTCTGAGCO-- ATXrøGGACACCCTGCCAGACCG^

CGTCACTGTCTTTCAGATCCTGACCCAGGA-^ACTCG-^^

CCTCGGCGGCCCTT OTTCATα

CT?GGTGG- 3---GC-?ΦCCAGaCGGAGGGAGATGCC-^^

GGA GGTCATGGGGACAGG-^G- iGTGC TOGCCTTGGTGTCCCTGGGAGAGCACCCGGAGCTGCGGAAGAGCC

TGCTGCCGCCTCTCATCATCCACACGGCCGCCACACCCATGTCGCTGCCCAAGAGCACCAGCACGGGCCTGGGC

GAGGCGCTGGGCCCTGCGTCGCGCCGCACCAGCAGCAGCGGGTCGGCAGAGCCTGGGGCGGCCCACGAGATGAA

CTCACCGCCCAGCGCCCGCAGCTCTCCGCACAGCCCCTGGAGCGC GCAAGCAGCTGGACCAGCAGGCGCTCCA GCCGG-^CAGCCTCGG_CC_GTGCA_CCCAG_CCTGAAGCGGAGAAGCCCAAGTGGAGAGCGGCGGTCCCTGTTGTCG

GGAGAAGGCCAGGAGAGCCAGGATGAAGAGGAGAGCTCAGAAGAGGAGCGGGCGAGCCCTGCGGGCAGTGACCA

TCGCCACAGGGGGTCCCTGGAGCGGGAGGCCAAGA---TTCCΪTTGACCTGCCAGACACACTGCAGGW CAG-MC

TGCAL'CGCACTGCCAG.-^CGAGGGTCTGCTTC GAGC-^CAGGACT^

CTGGCCCGGGCCC GCGGCCTGATGACCCCCCACTGGATGGGGATGACGCCGAGACGAGGGCAACCTGAGCAA

AGGGGAACGGGTCCGCGCGTGGATCCGA- CCGACTCCCTGCCTGCTGCCTCGAGCGAGACTCCTGGTCAGCCT

ACATCTTCCCTCCTCAGTCCAGGTTCCGCCTCCTOTGT^^

GTCCTTGTCATCATCOTCCTT- CTGCATCACCATCGCCATGGAGCGCCCC-^AAATTGACCCCCACAGCGCTGA

ACGCATCTTCCTGACCCTCTCCAATTACATCTTCACCGCAGTCT^^

CACTGGGCTGGTGCTTCGGGG-^AGGCCTACCT--K-GGAGCAGTT^

ATCTCCG CATCGACAO^CTGGTGTCCATCGTCTCTGACAGCGGCACC-^GATCCTGGGCATGCTGAGGG'rGCT

GCGGC'TGCTGCGGACCCTGCGCCCGCTCAGGGTGATCAGCCGGGCGCAGGGGCTGAAGCTGGTGGTGGAGACGC

TGATCTCCTCACTGA-W-CCATCGGC-V-CATTGTAGTCATC

GGGGTGCAGGTKZTTCAAAGGG-^GTTTTTCGTGTGCCAGGGCGAGGATACCAGGAACATCACC-^TAAATCGGA

C fGTGCCGAGGCCAGTTACCGGTGGGTCCG--CACAA^^

TG TCGT TTGGCCTCCAAGGATGGCTGGG'--CGACA^,rCATσTACGATGGβCTGGATσCTGTGGGCGTGGACCAG

CAGCCCATCATG-^CC-ACAACCCCTGGATGCTt τGTACτrCATCTCGT CCTGC CATTGTGGCCT CTΪTGT

CCTGAACA^GTTTGTGGGTGTGGTGGTGGAG-^CTTCCACAAG GTCGGCA---CACCAGGAGGAAGAGGAGGCCC

GGCGGCGGGAGGAG.-UIGCGCCTACG- SACTGGAGAAAAAGAGAAG^

ATGCTGGACGATGTAA TGC TCCGGCAGCTGAGCCAGCGCTGCGTCAGAAGCCCAGTGCAAACCTTACTACTC

CGACTACTCCCGCTTCCGGCTCCTCGTCCACCACtTGTGCACCAGCCACI.ACCTGGACCTCTTCATCACAGGTG

TTCATCG-- 5CTGAACG GGTCACCATGGCCATGGAGCACTACCAGCAGCCCCAGA TCTGGATGAGGCTCTGAAG

ATCTCCAACTACATCTTCACTGTCATCTTTGTCTTG^

GTTCCTCCAGGACAGGTGG-AACCAGCTGGACCTGGCCATTGT^

AAATCGAGGTCA-^GCCTCGCWK-CCATC-W-CCCCACCATC^^

GTGCTGAAGCTGCTGAAGATGGCTGTGGGCATGC-- -K3^^

GGGGAACCTGGGAC rCTCTTCATCTTGTTGTTT TCATCOT^

^TCGAGTGTGACGAGACACACCCCTGTGA aGCC GGGCCGTCATGCCACCTTTCGGAACTTTGGCATGGCCTTC

CTAaCCCTCTTCCGAGTCTCCACAGGTCAC^TTGGAATGGC^^

GGAGTCC-^CTGCTACAACACGGTCATCTCGCCTATCTACTa^GTG CCTTCGTGCTGACGGCCCAG'TTCG GC

TAGTCAACGTGGTGATCGCCGTGCTGATG-^GCACCTCGAGGAGAG

CTAGAGGCTGAGCTGGAGCTGGAGATGAAGACCCTCAGCCCCCAGCCCCACTCGCCACTGGGCAGCCCCT GCT

CTGGCCTGGGGTCGAGGGCCCCGACAGCCCCGACAGCCCCAAGCCTGGGGCTCTGCACCCAGCGGCCCACGCGA

GATCAGCCTCCCACΪOT CCCTGGAGCACCCCACGATGCAGCCCCACCCCACGGAGCTGCCAGGACGAGACTTA

CTGACTGTGCGGAAGTCTGGGGTCAGCCGAACGCACTCTCTGCCCAATGACAGCTACATGTGTCGGCATGGGAG

CACTGCC---AGGGGCCCCTGGGACACAGGGGCTGGGGGCTCCCCAAAGCTCAGTCAGGCTCCGTCT--'GTCCGTTC

ACTCCCAGCCAGCAGATACCAGCTACATGCTGCAGCTTCCCAAAGATGCACCTCATCTGCTCCAGCCCCACAGC

GCCCCAACC-TGGGGCACCATCCCCAAACTGCCCCCACCAGGACGCTCCCCTraGGC CAGAGGCCACTCAGGCG

CCAGGCAGC-^TAAGGACTGACTCCTTGGACGTTCAGGGTCTGGGCAGCCGGGAAGACCTGCTGGCAGAGGTGA

GϊGGGCCCTCCCCGCCCCTGGCCCGGGCCTACTCTrrcTGGGGCCAGTC-^GTACCCAGGCACAGCAGCAC'Ϊ.CC

CGCAGCCACAGC-^GATCTCC-^GCACATGACCCCGCCAGCCCCTTGCCCAGGCCCAGAACCCAACTGGGGCAA

GGGCCCTCCAGAGACCAG-^GCAGCTTAGAGrrGQACACGGAGCTGAGCTGGATTTCAGGAGACCTCCTGCCCC

CTGGCGGCCAGGAGGAGCCCCCATCCCC---C---GGACCTG-^GAAGTGCTACAGCGTGGAGGCCCAGAGCTGCCAG

CGCCGGCCTACGTCCTGGCTGGATGAGCAGAGGAGACAC CTATCGCCGTCAGCTGCCTGGACAGCGGCTCCCA

ACCCCACCTGGGGACAGACCCCTCT-^CCTTGGGGGCCAGCCTCTTGGGGGGCC GGGAGCCGGCCCAAGAAAA

AACTCAGCCCGCCTAGTATCACCATAGACCCCCCCGAGAGCCAAGGTCCTCGGACCCCGCCCAGCCCTGGTATC

TCCCTCCGGAGGA-_«GCTCCGTCCAGCGACTCCAAGGATCCCTTGGCCTC GGCCCCCCTGACAGCATGGCTGC

CTCGCCC CCCCAAAG-⁵jyiGATGTGCTGAGTCTCTCCGG TTATCCTCTGACCCAGC-AGACCTGGACCCeJ.GA

Human alphalG ac splice variant with amino acid translation (SΞQ D NO : 2>

atggacgaggaggaggatggagegggegσcgaggagtcgggacagccccggagσtteatg D E B E D G A G A E Ξ S G Q P R S F M cggctcaacgacctgtcgggggccgggggccggc-.ggggc---ggggtcagcagaaaaggac R L K D L S G A G G R -P G P G S A --- K D ccgggcagcgcggactccgaggcggaggggctgccgtacccggcgctggocccggtggtt P G S A D S E A E G L P Y P A k A P V V ttcttetacfctgagceaggacagccgcccgeggagetggt-gtctccgcacggtσfcgtaae F F Y I- S Q --- S R P R S W C I. R T V C N ccctggtttgagcgcat-cagcatgttggtcacocttctcaactgcgtgaccctgggeatg P W F E R X S M L V I L Ii N C V T ri G M ttcσggeαatgegagg&catcgcctgtgectcαcagcgctgecggatqctgcaggccttt P R P C B D I A C D S Q R C R I ti Q A -? gatgacuteatctttgccttctttgccgtggagatggtggtgaagatggtggcctt-gggc D D F I F A F F A V Ξ M V V K M V A Ii G atctttgggaaaaagtgttacctgggagacacttggaaccggcttgactttttcatcgtc X F G K K C Y L G D T W -5. R I. D F F I V atcgcagggatgctggagtactcgctggacctgcagaacgtcagcttctαagctgtcagg Ϊ A G L E Y S I- D L Q N V S F S A V R acagtccgtgtgetgcgaccgctαagggccattaaccgggtgcccagcatgcgcatcctt T V R V --. R P L Ϊ. A Ϊ N R V P S M -S I L gtcacgttgctgctggatacgctgcocatgctgggoaaegtcctgctgctctgcfctcttc V T I- t. --, D T --. -? M Ii G N V Iι ϊ, L C F F gtcttαtteatctfccggcatcgfccggcgtccagctgtgggcagggctgctfccggaaccga V F F I F G I V G V Q --. A G I- R 1I R tgcfctccfcacσtgagaatttc&gcσtecccctgagcgtggacctggagcgctattaccag C F -L P E N F S I- F I- S V D Ξ R Y Y Q acagagaacgaggatgagagcσcσttcatctgctcσcagccac-gcgagaacggcatgcgg T E N S D S S P F I C S Q P R E N G M R tcctgcagaagcgtgcccacgotgcgcggggaeggggg-jggtggcccsccttgcggtctg S C R S V P T L R G D G G G G P P C G lj gactatgaggcctacaacagctecagcaacaccaαctgtgtcaactggaaαcagta--.tac D Y E A Y S. S S S t. T T C- V N W N Q Y Y accaactgctcagcgggggageaσaacccce caagggcgccatcaac1 tgacaacatt T N C S A G E H N P F K G A l N F D N I ggctatgcctggatcgccatcttecaggtαateacgctggagggctgggtcgacatcatg G Y A W I A I F Q V I T L E G W V --- I M tactttgtgatggatgσtcattcettctacaatttcatctaettcatcctcetcatcatc Y F V M D A H S F Y N P I Y F ∑ I- L X I gtgggctccttcttoatgatcaacctgtgcctggtggcgattgcscacgσagttcagtgag V G S F F M I N L C l- V V Ϊ A T Q F S Ξ accaagcagcgggaaagccagctgatgcgggageagcgtgtgeggεt--σtgtcσaacg<--c T K Q R E S Q L M R Ξ Q R V R F I- S N A agcaccetggctagcttctctgagcccggcagctgctatgaggagctgstcaagtacictg S T L A S F S E P G S C Y E E L I- K Y I- gtgtacaeccttcgtaaggcagcccgcaggαtggctcaggtctctegggcagαaggtgtg V Y I Ii R K A A R R L A Q V S R A A G V cgggttgggctgctcagcagcccagσaccαcfccgggggσcaggagacccagσceagαagc R V G L L S S P A P L G G Q E T Q P S S agctgctetcgetcccac--gcegcctatcegtceaccaectggtgcaccaceaccaoca-- S C S R S H R R L S V H H L V H H H H H catcaccaceacfcaccaeetgggoaatgggacgctcagggccecccgggccagccαggag H H H H Y H ---- G N G T Σ. R A P R A S -? --: atccaggaeagggatgceaatgggtcccgcaggetcat-gcεgαcaecaecctσgacgect I Q D R D A N G S R R Ϊ-- M L P P P S T P gccctctccggggccccccctggtggcgσagagtctgtgcacagcttotaocatgccgac A ti S G A P P G G A E S V H S F Y H A D tgecacttagagccagtccgctgccaggegcσccctccαaggtccccatctgaggcatcα C H E P V K C Q A P P P R S P S E A S ggcaggactgtgggcagcgggaaggtgtatcccacegtccacaccagccctccaccggag G R T V G S G K V Y P T V H T S P P P E acgσtgaaggagaaggcactagtagaggtggctgeσagctctgggcccccaaccctαacc T I- K E K A I- V E V A A S S G P P T I- T agcctcaacatCGcacccgggccctacagctccatgcacaagctgctggagacacagagt S I* N I P^' P G P Y S S M H K L --. E T S acaggtgcctgccaaagctcttgcaagatctceagcccttgcttgaaageagaeagtgga T G A C Q S S C K I S S P C L K A D S G gcctgtggtocagacagctgcc--ctactgtgσccgggσcggggcaggggaggtggagctc A C G P D S C P Y C A R A G A G Ξ V E L gcσgacegtga---atgαctgactcagacagcgaggcagtttatgagttcaeacaggatgcc A D R E M P D S D S --- A V Y E F T Q D A cagcacagcgacctccgggacccαcacagccggcggcaaσggagcctgggcccagatgca Q H S D L R D P H S R R Q R S L G P D A gagcceagctctgtgctggccttctggaggctaatctgtgaσaccttcegaaagattgtg E P S S V A F R I C D T F R K . I V gacagcaagtactttggccggggaatcatgatcgecatcctggtcaacacactcagcatg D S K Y P G R G I M Ϊ A I L V -M T L S M ggcatcgaataccacgagcagσccgaggagcttaccaaegccαtagaaatcagcaacate G I E Y H Ξ Q P E Ξ L T N A L E Ϊ S N I gtcttcaccagcctctttgccσtggagatgctgctgaagσtgcttgtgtatggteccttt V F T S L F A L E M L L K L L V Y G P F ggctacatcaagaatccctaoaaoatcttcgatggtgfccattgtggtcatcagcgtgtgg G Y I K N P Y M Ϊ F D G V I V V I S V W gagatcgtgggccagcaggggggcggcctgtcggtgctgcggaccttccgcctgatgcgt E I V G Q Q G G G L S V L R 1. F H L M R gtgctgaagctggtgcgct tcctgc eggcgctgeagcggcagctggtggtgc tcatgaag V L K L V R F L P A L Q R Q L V V L M K aecatggacaaσgtggccacettctgcatgctgcttatgc et tcatc ttcatcttoagc T D H V A T F C M L L M L F I F I F S atectgggcatgcatctcttcggctgcaagtttgcctctgagcgggatggggacaccctg I L G M H L F G C K F A S E R D G D T L ccagaσcggaagaattttgactcettgctctgggccategtcaotgεctttcagatcctg P D R K N F D S L L W A I V T V F Q I L acecaggaggactggaacaaagtectctacaatggtatggcctccaegtogt.ctgggcg T Q E D W H K V L Y N G M A S T S S W A gccctttatttcattgcccfccatgaccttcggcaactacgtgctcttcaatttgctggtc A L Y F I A L M T F G N Y V L F N L L V geeatt--tggtggagggcttccaggcggagggagatgeeaaσaagtccgaatcagagccc A I L V Ξ G F Q A E G D A H K S E S E P gatttcttctcacccagcctggatggtgatggggagaggaagaagtgcttggccttggtg D F F S P S L D G O G D R K K C L A L V tccctgggagagcacecggagctgcggaagagcctgctgccgcς-tctcatσatccacacg S L G E H P E L R K S L L P P L I I H . gcσgccaeacccatgtcgctgcccaagageaccagcacgggcetgggcgaggcgctgggc A A T P M S L P K S T S T G L G E A L G cctgcgtcgcgσcgcaccagcagcagcgggtcggcagagcctggggcggcσeacgagatg P A S R R T S S S G S A E P G A A H E M aagtcaccgcceagcgcccgcagctctcegcacagσccctggagcgctgcaagcagctgg K S F P S A R S S P H S P W S A A S S W accagcaggcg<itccagccggaacag--ctcggccgtgcaccσagcctgaageggagaage T S R R S S R N S L G R A P S L K R R S ccaagtggagagcggcggtccctgttgtcgggagaaggccaggagagccaggatgaagag P -- G E R R S ---- L S G E G Q E S Q D E E gagagc teagaagaggagσgggecagccc tgcgggcagtgaccat cgc cacagggggtcc E S S E E Ξ R A S P A G S D H R H R G S qtggagcgggaggcoaagagttcctttgacctgccagacaαactgcaggtgccagggctg L E R E A K S S F D L P D T L Q V P G --- catσgeactgccagtggccgagggtctgς-ttctgagcaccaggactgcaatggcaagεcg H R T A S G R G S A S Ξ H Q D C ΪT G K S gcttσagggcgcctggcccgggccetgcggcctgatgaccccccactggatggggatgac A S G R L A R A L R -P D D P P L P G D D gσcgatgacgagggcaacctgagcaaaggggaacgggtccgcgcgtggatccgagcccga A D D E G W L S K G E R V R A W I S A R σtσcct-gcσtgctgcctcgagcgagactccεggtcagcctacatcttccctoctcagtoc L P A C C L E R D S W S A I F P P Q S aggttσcgcctectgtgtcaccggatcatcaccσacaagatgttcgaccacgtggtcctt R F R L L C H R I -C T H K M F D H V V L gtcatcatcttcσttaactgcatcaccatcgccatggagcgccccaaaattgacccccac V I I F L N C Ϊ T I A E R P K I D P H agcgqtgaacgcatcttcctgaccGtctcαaattacatcttcaccgcagtctttctggct S A E R I F I- T. L S N Y I F T A V F L A gaaatgacagtgaaggtggtggcactgggctggtgottcggggagcaggcgtacctgagg E M T V K V V A L G W C F G E Q A Y L R agcagttggaacgtgetggacgggctgttggtgctcatctccgtcatcgacaεtctggtg S S W N V L D G L L V L I S V I D I L V tccatggtctctgacagcggeaccaagatcctgggcatgctgagggtgctgcggctgctg S V S D S G T K I L G K- L R V L R L L cggaccctgcgcccgctcagggεgatcagccgggGgcaggggctgaagctggtggtggag R T L R P L R V I Ξ R A Q G It L V V S aegc gatgtσcteac tgaaacccatcggcaacat tgtagtcat ctgctgtgcct- cεtc T L M S S L K P I G N I V V I C C A F F atcattttcggcatcttgggggtgcagctottcaaagggaagttεεtcgtgtgccaggge I I F G X L G V Q L F K G K F F V C Q G gaggataecaggaacatcaαcaataaatcggactgtgccgaggccagtta--'cggεgggte E D T R H I T N S D C A E A S . R W V cggcacaagtacaacεttgacaaccttggccaggccctgatgtccctgttcgttttggcc R H K Y N F D -N r. G Q A L Kt -3 I. F V L A teeaaggatggttgggt cgaσat eatgtacgacgggc tggatgσtgtgggcgtggaccag S K D G W V D I M Y -D G L D A V G V D Q cagcσcatcatgaaccacaaccecftggatgctgctgtacttσatctegttcctgctcatt Q P I W H N P W M L L Y F I S F L L I gtggccttctttgtcotgaacatgtttgtgggtgtggtggtggagaacttccacaagtgt V A F F V L N M F V G V V V E -S- F H K C cggoagcaccaggaggaagaggaggcccggcggcgggaggagaagcgcctacgaagactg R Q H Q Ξ E E Ξ A R R R B E K R L R R L gagaaaaagagaaggagtaaggagaagcagatggctgatctaatgctggacgatgtaatt E K K R R S K E K Q M A P .-i M L t. P V X gcttccggcagcrcagσcagcgctgcgtcagaagcceagtgcaaaeettaαtacfcccgaα A S G --- S A S A A S E A Q C K F Y Y S D tactcccgcttccggctcctcgteeacoacttgtgcaccagccactacctggacctcttc Y S R F R L L V H H L C T S H Y L D L F atcacaggtgtcatcgggσtgaacgtggtcaccatggccatggagcactaccagσagecc I T G V l G L ϊtf V V T M A M Ξ H Y Q Q P cagattctggatgaggctctgaagatctgcaacεacatcttcactgtcatcGttgtcttg Q I L D Ξ A -- K -. C N Y I F T V I F V L gagtoagttttcaaacttgtggectttggtttccgtcggttcttccaggaeaggtggaac E S V F K L V A F G F R R F F Q D R W. N cagαtggacctggccattgtgctgctgεccatcatgggcatcacgctggaggaaaccgag Q L D L A I V L L S X M G I T L E Ξ I E gtcaacgectcgctgcGcatcaaccccaccatcatccgcatcatgagggtgctgcgcatt V K A S L P I N P T X I R I M R V L R I gcccgagtgctgaagotgσtgaagatggctgtgggcatgcgggcgctgctggacacggtg A R V L K L L K M A V G M R A L L D T V atgcaggccct^gccccaggt^ggggaacctgggacεεctottcafcgtcgttgttttεcatc 0 A L P Q V G N L G 1- X- F M L L F F 3; tttgcagefcctg^ggcgtggagctctteggagaαctggagtgtgacgagacacacccetgε F A A I- G V E --. P G D L E C D Ξ T H P C gagggcctgggccgccatgccacσtttcggaactttggcatggccttααtaaccetcttc E ^{G L} G R S A T F R N F G M A F L T L F cgagtetccacaggtgacaattggaacggcattatgaaggacaecctccgggactgtgac R V S T G D N W N G I M K --. T R D C D caggagtccacσtgctacaacacggtcatctcgccεatctactttgtgtσcttώgtgctg Q E S T C Y N T V I S P I Y F V S F V L acggcccagttcgtgctagtcaacgtggtgatcgccgtgotgaεgaageacctggaggag T A Q F V L V H V V I A V L M K H L E E agcaacaag^aggccaaggaggaggccgagcεagaggctgagctggagαtggagatgaag S N E A K E E A E L E A E L Ξ L E M K accctcagcccccagccccactcgccactgggcagccccetcctctggαotggggtcgag T L S P Q P H S P L G S P F L W P G V Ξ ggccccgacagccccgacagccccaagccεggggctctgcacocagcggcccacgcgaga G P D S P D S P K P G A L H P A A H A R tcagcctccoacfctttqeccggagcaccccacgatgcagccccaccccacggagctgcca S A S H F S L Ξ H P T M Q P H P T E L P ggaccagaetεactgactgtgcggaagtcεggggtcagccgaacgcactcεctgcccaat G P D L L T V R K S G V S R T H S L P N gacagctacatgtgtcggcatgggagcactgccgaggggcccσtgggacacaggggctgg D S Y M C R H G S T A E G P L G H R G W gggctαcccaaagcftcagtcaggctccgtctcgtc«gttcact«<;cagccageagataec G L P K A β S G S V L -S V H S Q P A D T agαtacatcctgcagcttcecaaagatgcaccteatctgctccagccccacagcge-ccca S Y I L Q L P K D A P H L L Q P H S A P acctggggcacc--.tccccaaactgcc-cccaccaggacgctcccctttggctcagaggcca T W G T I P K L P P P G R S P L A Q R P cteaggσgc---aggcagcaataaggactgactccttggacgttcagggεctgggcagccgg L R R Q A A 1 R T D S L U V Q G L G S R gaagacctgctggcagaggtgagtgggccctccccgcccctggccegggcctactctttc Ξ Ϊ- L L A E V S G P S P F L A R A Y S F tggggGcagtαaagtaccσaggcaeagcagcactcecgcagccacagcaagatctccaag W G O S S T Q A Q Q H S R S H S K I S K cacatgaσcccgccagccccttgcceaggcccagaacασaactggggcaagggccctcca H M T P P A P C P G P Ξ P N G K G P P gagaocagaagcagcttagagttggacacggagctgagctggatttcaggagacctcctg S F R S S L E li D T E L S W I S G D L L ccccctggc gccaggaggagσccecatccccacgggacctgaagaagtgσtacagegtg P P G G Q E B P P S P R D L K K C Y S V gaggeccagagctgecagcgccggcctacgtcσtggσtggatgagcagaggagacactct Ξ A Q S C R R P T S L D E Q R R H S atcgcGgtcagctgeetggacagcggαtcccaaccccacctgggcacagaccocitctaa--- I A V S C L D S G S Q F H L G T D P S -XT cttgggggccagectcttggggggcctgggagccggccσaagaaaaaactcagcccgcct L G G Q P L G G P G S R P K K K L S P P agtaεcaσcatagacαcCGccgagagccaaggtcctcggaccccgcσcagGCcεggcatσ S I T Ϊ D P P E S Q G P R T P P S P G I tgcctccggaggagggetcσgtccagcgactceaaggatcccttggααt-.tggσccc:c<-:t C R A P S S D S K D P --- A S G P P gacagcatggctgcctcgccctccccaaagaaagatgtgctgagεctctceggεttatcc D S M A A S P S P K- K D V L S L S G L S tctgacccageagacctggacccctga S D P A D L D P - [0113] Modifications may be made to the foregoing without departing from the basic aspects of the invention. Although the invention has been described in substantial detail with reference to one or more specific embodiments, those of skill in the art will recognize that changes may be made to the embodiments specifically disclosed in this application, yet these modifications and improvements are within the scope and spirit of the invention, as set forth in the claims which follow. Citation of the above publications and documents is not intended as an admission that any of the foregoing is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents. Each patent, patent application, document and publication referenced herein is hereby incorporated by reference in its entirety.

Claims

Claims What is claimed is:

1. A method for detecting a risk of, or presence of, a cell proliferative disorder in a subject, which comprises determining the presence or absence of abnormal expression of at least one Ca_v3.ϊ calcium channel splice variant in a sample comprising cells of said subject, whereby the presence of abnormal expression of a Ca_v3-1 calcium channel splice variant determines that the subject is at risk of, or has, a cell proliferative disorder.

2. The method of claim 1, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3.1ac calcium channel or of said Ca^.tac calcium channel protein.

3. The method of claim 1, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3-lb calcium chaimel or of said Ca_v3.1ac calcium channel protein.

4. The method of claim 1, wherein said abnormal expression is determined as the presence or absence of a percentage of expression of Ca 3.1bc calcium channel of greater than 20% of the expression of Ca_v3.1 calcium channel on a per mole basis.

5. The method of claim 4, wherein said percentage is measured in terms of mRNA or protein.

6- The method of any of claims 2-5, wherein the presence or absence of protein is determined by contacting said sample with an antibody that specifically binds to the protein.

7. The method of any of claims 1 -6, wherein the cell proliferative disorder is selected from the group consisting of brain cancer, glioma, breast cancer, eye cancer and retinoblastoma.

8. The method of any of claims 1-7, which further comprises determining the presence or absence of increased cell proliferation within a subject identified as having a risk of or presence αf a cell proliferative disorder,

9. A method to inhibit the proliferation of cells that exhibit abnormal Ca_v3- 1 calcium channel splice variant expression, which comprises contacting said cells with a substance that inhibits the expression or activity of at least one Ca_v3.1 calcium channel splice variant.

10. The method of claim 9, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3.1ac calcium channel or of said Ca_v3.1ac calcium channel protein.

11. The method of claim 9, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3.1b calcium channel or of said Ca_v3.1ac calcium channel protein.

12. The method of claim 9, wherein said abnormal expression is determined as the presence or absence of a percentage of expression of Ca_γ3.1bc calcium channel of greater than 20% of the expression of Ca_v3.1 calcium channel on a per mole, basis.

13. The method of any of claims 9-12, wherein the substance is an antisense, ribozyme, RNAi, or triple helix-forming nucleic acid.

( 14. The method of any of claims 9-12, wherein the substance is an antibody.

15. The method of claim 10 wherein the substance is one that inhibits interaction between C v3.1ac calcium channel and ANX HI.

16. A method for identifying a substance that inhibits cell proliferation, which comprises contacting one or more cells that exhibit abnormal Ca_v3.1 calcium channel expression with a test substance, and determining whether the test substance decreases cell proliferation, whereby a test substance that decreases cell proliferation is identified as a substance that inhibits cell proliferation.

17. The method of claim 16, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3. lac calcium channel or of said Ca_v3.1 ac calcium channel protein. 1 S. The method of claim 16, wherein said abnormal expression is determined as the presence or absence of mRNA encoding Ca_v3. lb calcium channel or of said Ca_v3.1 ac calcium channel protein.

19. The method of claim 16, wherein said abnormal expression is determined as the presence or absence of a percentage of expression of Ca_v3.1bc calcium channel of greater than 20% of the expression of Ca-v3.1 calcium channel on a per mole basis.

20. A method of identifying a substance that inhibits cellular proliferation, which method comprises incubating a Cav3,l-ιc calcium channel polypeptide or substantially identical polypeptide and ANX III thereof with a test substance and determining whether the presence of said substance decreases the binding of polypeptide to ANX m, whereby a substance that decreases said binding is identified as a substance that inhibits cell proliferation, or incubating a Ca_v3.1ac calcium channel polypeptide with said substance and determining whether said substance binds to the.polypeptide, whereby a substance that binds said polypeptide is identified as a substance that inhibits cellular proliferation.

21. The method of claim 20, wherein the Ca_v34ac calcium channel polypeptide comprises 25 or more sequential amino acids selected from a region spanning amino acid 1546 to amino acid 1370 of a Ca_v3.1ac T-type calcium channel-

22. The method of claim 21, wherein the polypeptide consists of the amino acid sequence SKEKQMADX-MLDDV--ASGSSASAAS.

23. An isolated mRNA or protein that encodes or has the amino acid sequence of Ca_v3.1ac calcium channel splice variant.

24. A cell that exhibits abnormal expression of at least one Ca_v3.1 calcium channel splice variant in contact with or containing a substance that inhibits the expression or activity of said Ca_v3.1 calcium channel splice variant.

5. The cell of claim 24 wherein the splice variant is Ca_v3.1ac or Ca_v3,lb or Ca_v3.1bc.