WO2021149714A1 - Agent for treating bone tumor, and method for evaluating ion channel agonist for treatment of bone tumor, etc. - Google Patents

Abstract

Provided are: an agent for preventing or treating a bone tumor; and a method for evaluating an ion channel agonist for prevention or treatment of a bone tumor, etc. The agent for preventing or treating a bone tumor comprises, as an active ingredient, an inhibitor that inhibits the activity of a K_Ca3.1 ion channel.

Description

Evaluation method of therapeutic agents for bone tumors and ion channel agonists for the treatment of bone tumors, etc.

The present specification relates to a therapeutic agent for bone tumors such as osteosarcoma and a method for evaluating an ion channel agonist for the treatment of bone tumors and the like.
(Cross-reference of related applications)
This application is a related application of Japanese Patent Application No. 2020-7116, which is a Japanese patent application filed on January 20, 2020, and claims priority based on this Japanese application, which is described in this Japanese application. All the contents that have been made are used.

Among bone tumors, osteosarcoma is one of the intractable rare diseases that are difficult to cure due to metastasis and development of drug resistance. Various studies have been conducted on promising target molecules for various cancer treatments. For example, _{the K Ca} 3.1 (also known as medium-conductance calcium-activated potassium, IK channel, gene name KCNN4) channel, which is an ion channel that controls ^{Ca 2+ signals, is a target molecule for the treatment of various epithelial cancers.} It has been reported that (Non-Patent Documents 1 to 3).

In addition, it is said that cancer stem cells may be involved in cancer metastasis and drug resistance. Cancer stem cells have the properties of stem cells among cancer cells, and form cancers with the same phenotype as the original cancers at the time of self-renewal ability, pluripotency, and living body transplantation such as mice. Ability. Cancer stem cells have high drug resistance and oxidative stress resistance. Therefore, targeting cancer stem cells as therapeutic targets is an issue for the realization of fundamental cancer treatment.

However, it has not been reported that _{the K Ca} 3.1 channel is associated with bone tumors, which are mesenchymal tumors. Also, to date, no association of ion channels in cancer stem cells has been reported. Furthermore, the current situation is that the molecular mechanisms that maintain the properties of cancer stem cells and the molecular mechanisms such as treatment resistance to anticancer drugs have not been elucidated.

The present specification provides a prophylactic or therapeutic agent for bone tumors and an evaluation method for ion channel agonists for the prevention or treatment of bone tumors and the like.

In the cancer stem cell model of osteosarcoma, which is one of the bone tumors, the present inventors assumed that ion channels are associated with the differentiation of cancer stem cells into normal cancer cells. Ion channel expression screening revealed that the expression level of a specific ion channel, K _Ca 3.1 (KCNN4) channel, was low in cancer stem cells but became tumorous in cancer stem cells and tumorigenic cells. We obtained the finding that it is increasing in cells. Furthermore, it was found that the enhanced expression of this ion channel is also associated with malignant transformation of tumorigenic cells and cancer metastasis. The present specification provides the following means based on such findings.

[1] A preventive or therapeutic agent for bone tumors
K _Ca 3.1 A therapeutic agent containing an inhibitor that suppresses the activity of ion channels as an active ingredient.
[2] The prophylactic or therapeutic agent according to [1], wherein the inhibitor is a blocker that inhibits the activity of the ion channel.
[3] The prophylactic or therapeutic agent according to [1], wherein the inhibitor is an expression inhibitor that suppresses the expression of the ion channel.
[4] The prophylactic or therapeutic agent according to [1], wherein the inhibitor is an antibody that binds to the ion channel.
[5] The prophylactic or therapeutic agent according to any one of [1] to [4], wherein the bone tumor is osteosarcoma.
[6] An agent for evaluating a preventive or therapeutic agent for a tumor.
Voltage-gated Na ion channels that prolong the duration of action potentials associated with depolarization,
K ion channels that deepen the resting membrane potential in the negative direction,
K _Ca 3.1 ion channel and
An agent comprising cells comprising.
[7] The agent according to [6], wherein the tumor is a bone tumor.
[8] An evaluation method for ion channel agonists.
The ion channel agonist is a drug for preventing or treating mesenchymal tumors such as bone tumors.
The target ion channel is the K _Ca 3.1 ion channel,
Evaluation step of evaluating the inhibitory activity of the target ion channel of the test compound,
A method.
[9] The method according to [8], wherein the evaluation step is a step of evaluating the inhibitory activity using the agent according to [6] or [7].
[10] A method for evaluating an ion channel agonist.
The ion channel agonist is a drug for suppressing the differentiation of cancer stem cells into tumor cells, malignant transformation of tumor cells, and cancer metastasis.
The target ion channel is the K _Ca 3.1 ion channel,
A step of evaluating the inhibitory activity of the target ion channel of the test compound,
A method.
[11] A marker for examining the pathological condition of a bone tumor.
A _{marker comprising a K Ca} 3.1 ion channel, its mRNA or a compound that binds its pre-mRNA.
[12] A method for examining the pathological condition of a bone tumor.
_{A step of measuring K Ca} 3.1 ion channel activity in cells collected from a target site of a subject,
A method.

It is a figure which shows the mRNA expression analysis result _{of the K Ca} 3.1 ion channel about the osteosarcoma cancer stem cell (AO cell) and the progenitor cell-like cell (AX cell). In the figure which shows the comparison result of the current which shows sensitivity to the inhibitor (TRAM-34) of _{K Ca} 3.1 ion channel for osteosarcoma cancer stem cell (AO cell) and progenitor cell-like cell (AX cell). be. _{The results of examination of changes in membrane potential of K Ca} 3.1 ion channel activators (DCEBIO) and inhibitors (TRAM-34) in osteosarcoma cancer stem cells (AO cells) and progenitor cell-like cells (AX cells) are shown. It is a figure. It is a figure which shows the comparison result of ^{the intracellular Ca ion concentration [Ca 2+} ] i at rest with respect to osteosarcoma cancer stem cell (AO cell) and progenitor cell-like cell (AX cell). Osteosarcoma For cancer stem cells (AO cells) and progenitor cell-like cells (AX cells), _{intracellular Ca ion concentration at rest using K Ca} 3.1 ion channel activators and inhibitors [Ca ²⁺ ] It is a figure which shows the evaluation result of the contribution of K _{Ca 3.1 ion channel to i.} It is a figure which shows the comparative result of the contribution of _{K Ca} 3.1 ion channel to cell proliferation of osteosarcoma cancer stem cell (AO cell) and progenitor cell-like cell (AX cell). It is a figure which shows the evaluation result of the contribution of _{K Ca} 3.1 ion channel to the migration ability of a progenitor cell-like cell (AX cell). It is a figure which shows the expression analysis result of _{K Ca} 3.1 ion channel mRNA when osteosarcoma cancer stem cell (AO cell) and progenitor cell-like cell (AX cell) were transplanted into mouse femur.

The disclosure of the present specification relates to an agent for preventing or treating a bone tumor, an agent for evaluating a compound for preventing or treating a tumor, the evaluation method, and the like.

_{Using a cancer stem cell model of osteosarcoma, we use the K Ca} 3.1 ion channel for tumorigenesis of cancer stem cells, malignant transformation of tumor cells, and cancer metastasis, ie, as another name, medium conductance calcium. For the first time, we found that activated potassium, IK channel, and KCNN4 as a gene name (hereinafter, also referred to as this K ion channel) are related. That is, the expression and activity increase of this K ion channel in cancer stem cells are intracellular. For the first time, we found that through an increase in calcium ions (Ca ²⁺ ), it is involved in malignant mechanisms such as decreased ability to differentiate cancer stem cells to non-cancer stem cells, cell proliferation, and metastasis. For the first time, it has been found that the K ion channel can be used as a target molecule for drugs that suppress tumorigenesis of cancer stem cells, malignant transformation of tumor cells, and cancer metastasis. Therefore, according to the specification, a prophylactic or therapeutic agent for tumors. , Agents used for evaluation of agents for the prevention or treatment of tumors, methods for evaluating ion channel agonists for the prevention or treatment of tumors, and the like are provided.

Hereinafter, typical and non-limiting specific examples of the present disclosure will be described in detail with reference to the drawings as appropriate. This detailed description is intended to provide those skilled in the art with details for implementing the preferred examples of the present disclosure and is not intended to limit the scope of the present disclosure. In addition, the additional features and disclosures disclosed below are used to provide further improved therapeutic agents for bone tumors and methods for evaluating ion channel agonists for the treatment of bone tumors and the like. It can be used separately or together with the disclosure.

In addition, the combination of features and processes disclosed in the following detailed description is not essential in carrying out the present disclosure in the broadest sense, and is particularly for explaining typical specific examples of the present disclosure. It is to be described. In addition, the various features of the above and below representative examples, as well as the various features of those described in the independent and dependent claims, are described herein in providing additional and useful embodiments of the present disclosure. It does not have to be combined according to the specific examples given or in the order listed.

All features described herein and / or claims are, separately, as a limitation to the disclosure at the time of filing and the specific matters claimed, apart from the composition of the features described in the examples and / or claims. And it is intended to be disclosed independently of each other. In addition, all numerical ranges and statements relating to groups or groups are made with the intention of disclosing their intermediate composition as a limitation to the disclosure at the time of filing and the specific matters claimed.

Hereinafter, various embodiments based on the newly discovered findings will be described with respect to tumor preventive or therapeutic agents, agents for their evaluation, evaluation methods, and the like.

(Preventive or therapeutic agent for tumor) The prophylactic or therapeutic agent for tumor disclosed in the present specification (hereinafter, also simply referred to as this agent) is effective as an inhibitor that suppresses the activity of _{K Ca 3.1 ion channel.} It can be an ingredient. As described above, it is known that this K ion channel is associated with tumorigenesis of cancer stem cells, malignant transformation of tumor cells, and metastasis of tumor cells.

Here, this K ion channel is a K ion channel activated by ^{Ca 2+.}
It is a potassium channel that is activated depending on the intracellular calcium ion concentration. This ion channel is an ion channel that promotes the phenomenon of increasing intracellular calcium ions in osteosarcoma.

For example, the nucleotide sequence of the cDNA of this K ion channel gene (KCNN4 gene) and the amino acid sequence of the ion channel protein in humans are represented by SEQ ID NOs: 1 and 2, respectively. The accession numbers for NCBI (https://www.ncbi.nlm.nih.gov/) (GenBank and GenPept) of SEQ ID NOs: 1 and 2 are NM_002250 and NP_002241, respectively. In addition, both the nucleotide sequence encoding the K ion channel protein in other animals and the amino acid sequence of the protein are searched in a known database such as NCBI. For example, the accession numbers of the cDNA base sequence of this mouse K ion channel protein and the amino acid sequence of the ion channel protein are NM_008433 and NP_032459 (SEQ ID NOs: 3 and 4, respectively).

The K ion channel can include the following various aspects in addition to the protein encoded by the above gene. Examples of the homolog of this K ion channel include KCNN1, KCNN2, and KCNN3. In addition, KCNM1, KCNM4, and KCNM5 are also included as ^{the same Ca 2+} activated K ^{+ channel.} The following is an example of a part of the accession number of the base sequence of the DNA encoding these proteins and the amino acid sequence of the protein.

Human KCNN1 (Nucleotide Sequence, Amino Acid Sequence): NM_002248, NP_002239 (Nucleotide Sequence, SEQ ID NO: 5 and 6) Human KCNN2 (Nucleotide Sequence, Amino Acid Sequence): NM_021614, NP_067627 (Nucleotide Sequence No. 7, 8) Human KCNN3 (Nucleotide Sequence, Amino Acid Sequence): NM_002249, NP_002240 (SEQ ID NO: 9, 10) Human KCNMA1 (nucleic acid sequence, amino acid sequence): NM_002247, NP_002238 (SEQ ID NO: 11, 12) Mouse KCNN1 (nucleic acid sequence, amino acid sequence): NM_032397, NP_115773 (SEQ ID NO: 13, 14) Mouse KCNN2 (nucleic acid sequence, amino acid sequence): NM_080465, NP_536713 (SEQ ID NO: 15, 16) Mouse KCNN3 (nucleic acid sequence, amino acid sequence): NM_080466, NP_536714 (SEQ ID NO: 17, 18) Mouse KCNMA1 (nucleic acid sequence, amino acid sequence): NM_010610, NP_034740 (SEQ ID NOs: 19, 20)

Regarding the base sequence and amino acid sequence disclosed in the present specification, when the base sequence or amino acid sequence is specified by the SEQ ID NO: or accession number, the sequence having a certain degree of identity with the sequence is equivalent to the sequence. As long as it has a function or activity, it can be used in place of the sequence. The identity above a certain level includes, for example, 80% or more, for example, 85% or more, and for example, 90% or more, and for example, 95% or more, or, for example, 96, with the specified base sequence or amino acid sequence. % Or more, for example 97% or more, for example 98% or more, for example 99% or more, and for example 99.5% or more.

Further, in the present specification, the identity or similarity of a base sequence or an amino acid sequence is determined by comparing sequences as known in the art, and is determined by comparing two or more proteins or two or more polys. The relationship between nucleotides. In the art, "identity" means between protein or polynucleotide sequences, as determined by the alignment between protein or polynucleotide sequences, or, in some cases, by the alignment between a series of such sequences. Means the degree of sequence invariance of. Similarity is also the correlation between protein or polynucleotide sequences, as determined by the alignment between protein or polynucleotide sequences, or, in some cases, by the alignment between a series of partial sequences. Means the degree of. More specifically, it is determined by sequence identity and conservativeness (substitutions that maintain physicochemical properties at a particular amino acid or sequence in the sequence). In addition, the similarity is referred to as Similarity in the sequence homology search result of BLAST described later. The method of determining identity and similarity is preferably the method designed to have the longest alignment between contrasting sequences. Methods for determining identity and similarity are provided as publicly available programs.
For example, the BLAST (Basic Local Alignment Search Tool) program by Altschul et al. (For example, Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: p403-410 (1990), Altschul. It can be determined using SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: p3389-3402 (1997)). The conditions for using software such as BLAST are not particularly limited, but it is preferable to use default values.

The inhibitor that suppresses the activity of the K ion channel is not particularly limited, and any mode thereof may be used as long as it suppresses the activity of the K ion channel. One embodiment includes a blocker for the K ion channel. As used herein, a blocker is a low molecular weight organic compound having a molecular weight of 500 or less, and generally does not have a peptide bond or a polynucleotide skeleton.

Examples of the blocker include polycyclic compounds including tricyclic compounds such as TRAM-34 and ICA-17043 shown below, which are known inhibitors for the K ion channel. More specifically, the following compounds can be mentioned. All of these are commercially available or organically synthetic.

As another blocker, in addition to the evaluation method described later, screening can be performed based on a known method for evaluating a blocker for an ion channel (screening method).

As another aspect, an inhibitor that suppresses the expression of the gene encoding this K ion channel can be mentioned. Examples of such an inhibitor include nucleic acid drugs that suppress the expression of the K ion channel gene. Nucleic acid drugs can take various forms depending on whether DNA and / or RNA is used as the target, or the drug itself can be provided with natural nucleotides such as DNA and RNA or chemically modified nucleotides as a basic skeleton. can. The skeleton itself that can be obtained by a nucleic acid drug is known to those skilled in the art, and those skilled in the art can use the known skeleton as it is or by appropriately modifying it as an expression inhibitor disclosed in the present specification. can.

Examples of nucleic acid drugs include antisense oligonucleotides. Examples of the antisense oligonucleotide include mRNA, pre-mRNA, and the like as target molecules. Antisense oligonucleotides generally have DNA or a modification thereof as the basic skeleton. In relation to hybridization ability, the sugar chain portion may be RNA or a modified product thereof. The mechanism of action by antisense oligonucleotides is diverse: RNaseH-dependent mRNA degradation, exon skip that binds to splicing regulatory sites to induce alternative splicing, and translational inhibition that binds tightly to mRNA and inhibits translation. And so on.

Also, for example, RNA interfering agents can be mentioned. RNA interference is a method of suppressing gene expression by degrading a target RNA such as mRNA in a sequence-specific manner by using double-stranded RNA. Examples of target molecules for RNA interference (RNAi) include mRNA, pre-mRNA, and the like.
The RNA interfering agent is typically siRNA. The design of siRNA is known to those skilled in the art, and those skilled in the art can design siRNA having an appropriate structure and sequence by appropriately considering target selection, terminal structure, and the like.

As RNA interfering agents, siRNA and other double-stranded RNA that is a single-stranded RNA and becomes siRNA by cleavage, and each strand of siRNA or RNA single strand that is a siRNA precursor can be transcribed from DNA. It can also take the form of a formable DNA construct.

Various nucleic acid drugs can be screened based on the evaluation method described later.

Further, for example, as another aspect, an antibody that specifically binds to the present K ion channel can be mentioned. The antibody may be a polyclonal antibody or a monoclonal antibody as long as it specifically binds to the present K ion channel.

In the present specification, the antibody also includes an intact antibody that recognizes at least a part of the K ion channel as an antigen and has a binding ability, or a portion containing an antigen-binding portion having the binding ability.

The "antigen-binding portion" of an antibody means one or more fragments of an intact antibody that retains the ability to specifically bind to any antigen. Thus, for example, "antigen-binding portion" is not particularly limited, Fab _fragments, V _L, V H, a monovalent fragment consisting of _{C L} and CH1 domains; F _{(ab) 2} fragments, disulfide bridge at the hinge region A bivalent fragment containing two Fab fragments linked by (generally one from a heavy chain and a light chain); _{an Fd fragment consisting of VH} and CH1 domains; a single arm _VL and _VH domain of an antibody. Fv fragments consisting of; _{single domain antibody (dAb) fragments consisting of VH} domains; and fragments of various forms such as isolated complementarity determining regions (CDRs) or combinations thereof can be included. In addition, the antigen-binding moiety can be linked by an artificial peptide linker that can be prepared as a single protein chain _{in which the VL} and _{VE regions are paired to form a monovalent molecule using a recombination method.} can.

In addition, the antigen-binding moiety may be incorporated into a single domain antibody, maxibody, minibody, intrabody, diabody, triabody, tetrabody, v-NAR and bis-scFv.

The species from which the antibody is derived is not particularly limited, but can be human antibody, mouse antibody, goat antibody, etc., although it depends on the organism to which it is applied and the purpose. The term human antibody means that both the framework of the antibody and the CDR regions include an antibody having a variable region derived from a sequence of human origin. Furthermore, when an antibody comprises a constant region, the constant region is also meant to be derived from such a human sequence, eg, a human germline sequence or a mutant human germline sequence. Further, an antibody based on a fragment derived from two or more species can be called a chimeric antibody.

If the antibody is a monoclonal antibody, it can exhibit stable binding performance to the antigen. Acquisition of monoclonal antibodies is well known to those of skill in the art. In addition to the methods described below, for example, human monoclonal antibodies are obtained from transgenic non-human animals fused to immortalized cells (eg, transgenic mice having a genome containing a human heavy chain transgene and a light chain transgene). It is produced by a hybridoma containing B cells.

Further, the antibody may be a recombinant antibody such as a recombinant human antibody. Recombinant human corps is, for example, an antibody isolated from an animal (eg, mouse) into which a human immunoglobulin gene has been gene-transfected or chromosome-introduced or a hybridoma produced from it; transformed to express a human antibody. Antibodies isolated from host cells such as transfectomas; antibodies isolated from recombinant combinatorial human antibody libraries; and splicing of all or part of the human immunoglobulin gene sequence to other DNA sequences. Includes antibodies produced, expressed, prepared or isolated by other means, including. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.

The antibody may be a mutant thereof as long as the antibody obtained by a known method has a binding ability to the present K ion channel. For example, by modifying at least a portion of the antibody as a starting material, eg, _{by introducing a mutation into a full-length heavy chain and / or light chain sequence, a VN} and / or _VL sequence or a constant region bound thereto. It is also possible to obtain a new antibody. It is also possible to introduce a so-called peg chain into the obtained antibody. The method of modifying such an antibody itself is well known to those skilled in the art.

The production of the antibody is well known to those skilled in the art, and the K ion channel protein, an epitope obtained from the protein, or a conjugate with a hapten compatible with these is used to appropriately immunize an animal from its spleen. A suitable polyclonal antibody can be obtained by obtaining a polyclonal antibody and purifying the obtained polyclonal antibody. In addition, a monoclonal antibody can also be obtained by a well-known method. Further, various antibodies can be screened based on the evaluation method or the like described later.

A polynucleotide such as DNA encoding the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody thus obtained is also one aspect of the present disclosure. A host cell carrying such an expression vector is also an aspect of the present disclosure. As the expression vector, in addition to an appropriate form well known to those skilled in the art according to the type of host, a control region such as a promoter or a terminator can be appropriately selected. The polynucleotide is, for example, DNA and, for example, cDNA.

Yet another embodiment of the inhibitor that suppresses the activity of the K ion channel is an aptamer. The aptamer is a nucleic acid aptamer or peptiaptamer that can specifically bind to a specific molecule. Nucleic acid aptamers are composed of DNA and / or RNA, and peptide aptamers are composed of peptides. Nucleic acid aptamers can be screened, for example, by the SELEX method, peptide aptamers can be screened by the yeast Two-Hybrid method, or by using the evaluation method described below.

As yet another embodiment of the inhibitor that suppresses the activity of the K ion channel, miRNA and the like that are considered to suppress the activity of the K ion channel can be mentioned. For example, examples of miRNA that reduce the expression of this K ion channel mRNAi include miR-497 and miR407 (References 5, 6 and 2).

The inhibitor, which has a binding property to the present K ion channel protein or the DNA encoding the same or mRNA which is a translation product, can be provided with a labeling element, if necessary. The labeling element is not particularly limited, but conventionally known labeling substances can be appropriately selected and used. The labeling substance is not particularly limited, and typically, a labeling substance using fluorescence, radioactivity, an enzyme (for example, peroxidase, alkaline phosphatase, etc.), phosphorescence, chemiluminescence, coloring, or the like can be mentioned.

As the labeling element, a substance that can be combined with the labeling element may be provided. It may be provided with a molecule or substance capable of binding these so that it can be finally identified by the labeling substance. As such substances, protein-protein interaction, low molecular weight compound-protein interaction and the like can be used. For example, antibodies in an antigen-antibody reaction, biotin in an avidin (streptavidin) -biotin system, digoxigenin in an anti-digoxigenin (DIG) -digoxigenin (DIG) system, or haptens represented by FITC in an anti-FITC-FITC system, etc. Can be mentioned. In this case, the labeling substance ultimately used for detection is the other molecule or substance (eg, antigen, i.e., streptavidin, anti-FITC, etc.) that interacts with the substance that binds to such labeling substance. Labeling Substances are modified to provide as a site for binding to a binding substance.

The labeling elements of these various aspects are commercially available, and methods of modifying the antibody with the labeling elements are well known to those skilled in the art. Therefore, those skilled in the art can obtain various labeling elements and appropriately use functional groups such as amino groups and carboxyl groups for proteins such as antibodies and nucleic acids such as DNA and RNA.

This drug itself has the original differentiation potential and tumorigenicity of cancer stem cells, which are latent cancer cells with low tumorigenicity, that is, the differentiation potential has decreased and the tumorigenicity has increased. The active ingredient is an inhibitor of this K ion channel whose expression or expression increases upon conversion to progenitor cell-like cells. Therefore, it is effective for the prevention or treatment of all tumors associated with cancer stem cells. It is also effective in improving or treating tumors caused by tumor cells that have reached or already have high tumorigenicity.

Although not particularly limited, this drug is useful for the prevention or treatment of mesenchymal cell tumors such as bone tumors. Bone tumors include benign bone tumors and malignant bone tumors. Benign bone tumors include osteochondroma, endochondroma, chondromyxoid tumor, chondromyxoid tumor, osteoid osteoma, and giant cell tumor. Examples of malignant bone tumors include multiple myeloma, osteosarcoma, fibrosarcoma, chondrosarcoma, Ewing's sarcoma, lymphoma, malignant giant cell tumor, and chondrosarcoma. This drug is useful, for example, for the prevention or treatment of osteosarcoma.

(Agent for Evaluation of Tumor Prevention or Therapeutic Agent) The agent for evaluation of tumor prevention or therapeutic agent disclosed in the present specification (hereinafter, also simply referred to as the present evaluation agent) is depolarized. A potential-dependent Na ion channel that prolongs the duration of the active potential associated with the tumor, a K ion channel that deepens the resting membrane potential in the negative direction (hereinafter referred to as another K ion channel), and a K _Ca 3.1 ion channel. Can include cells comprising (the present K ion channel). When the present evaluation agent is provided with the above Na ion channel, K ion channel, and this K ion channel to induce depolarization that originally induces cell death, the presence of the test compound causes the present evaluation agent. When this K ion channel suppresses the deepening of the resting membrane potential in the negative direction, the cell death tendency is enhanced (the cell survival rate is lowered). At this time, the test compound can be said to be an inhibitor of the K ion channel.

The present inventors have already disclosed such cells in WO2012 / 00260 and WO2018 / 084221. All of these are incorporated herein by reference.

The cells used in this evaluation agent are not particularly limited as long as they can be used for screening ion channels, and various animal cells can be used. The type of animal cell is not particularly limited, such as mammals and insects. If the cells are human, as well as cells of cattle, pigs, horses, sheep, goats, birds, dogs, cats, rabbits, etc., obtain a drug evaluation agent for the prevention or treatment of diseases in these animals. can. Animal cells typically include human fetal kidney-derived cells (HEK cells), African green monkey kidney-derived cells (COS cells), Chinese hamster ovary cells (CHO cells), baby hamster kidney cells (BHK cells), and African turkeys. Egg mother cells are used. In addition, cultured cells derived from various tissues can also be used.

The evaluation agent may functionally have the K ion channel. Preferably, the present evaluation agent specifically expresses or highly expresses the present K ion channel in the cell membrane or the like. As the parent strain of the present evaluation agent, cells highly expressing the present K ion channel can be selected in advance. Further, in order to express the target ion channel in the present evaluation agent, it is preferable that the DNA encoding the present K ion channel is retained and expressed. This DNA is preferably ligated under the control of a constitutively active promoter (constitutive promoter) so that the K ion channel is constantly expressed. As described above for this K ion channel, a person skilled in the art constructs an expression vector containing DNA based on a well-known genetic engineering technique and a technique for producing a transformant, and introduces the expression vector into a host cell. By transforming, desired constantly expressed or transiently expressed cells can be appropriately obtained. In addition, the expression level of the suppressive target ion channel can be adjusted in the same manner as other ion channels.

By providing the Na ion channel, the K ion channel, and the K ion channel, the present evaluation agent is a cell death-inducing system (cells) under the stimulus that induces depolarization or in the presence of an inhibitor against other K ion channels. It is possible to construct a viable state of cells waiting in an inducible state of death). This cell death-inducing system itself constitutes an evaluation system for agents and inhibitors for this K ion channel. That is, the presence of an inhibitor on other K ion channels inhibits the deepening of the resting membrane potential in the negative direction, but the K ion channel, which is an inhibitory target ion channel, suppresses the induction of depolarization. It is in a state of being. From such a state, the inhibitory action and promoting action of the test compound on the K ion channel can be easily and efficiently evaluated.

The Na ion channel provided by this evaluator is a voltage-gated Na ion channel that prolongs the duration of action potential associated with depolarization. In other words, such a Na ion channel can be said to be a Na ion channel in which inactivation is suppressed.

Here, the voltage-gated Na ion channel is a protein on the cell membrane that opens depending on the membrane potential of the cell membrane and mediates the passive diffusion of Na ions. As the voltage-gated Na ion channel used in the present specification, various known voltage-gated Na ion channels can be used without particular limitation, but Nav1.5 channel is preferable. Nav1.5 channels are distributed in cardiomyocytes and are thought to be involved in the generation of action potentials and excitatory conduction.
For example, the nucleotide sequence and amino acid sequence of the human Nav1.5 channel (NCBI Accession Number: NM_198056.2, NP_932173.1) are represented by SEQ ID NOs: 21 and 22.

In voltage-gated Na ion channels, after the gate opens depending on the membrane potential and Na ion permeability is exhibited, the inactivation mechanism works to lose Na ion permeability (inactivation). On the other hand, the voltage-gated Na ion channel in which the inactivation is suppressed suppresses (disappears) such an inactivation mechanism. That is, the voltage-gated Na ion channel in which inactivation is suppressed means a Na ion channel in which such inactivation does not occur after the gate opens depending on the membrane potential and exhibits ion permeability. In the potential-dependent Na ion channel whose inactivation is suppressed, when depolarization is induced in the cell membrane and the ion channel itself is activated, the ion channel can be opened to mediate the passive diffusion of Na ions. However, since the inactivation of the ion channel itself is suppressed, the open state of the ion channel is maintained. As a result, in the voltage-gated Na ion channel in which the inactivation is suppressed, once the action potential is generated by the stimulation, the inactivation of the ion channel is delayed, so that the action potential is the original voltage-gated Na ion channel. It lasts longer than the ion channel.

In addition, the Na ion channel in which the inactivity is suppressed is easily activated even at a stationary or relatively deep resting membrane potential (so-called window current is large). Therefore, in cells expressing such Na ion channels, excessive Na ion influx can be prevented only when the resting membrane potential is held at a sufficiently deep negative potential. In cells that fully express such voltage-gated Na ion channels, depolarization easily increases Na ion channel activity for 1 minute or longer, preferably 2 minutes or longer, more preferably 3 minutes or longer, and even more preferably 5 minutes. The action potential or depolarization is maintained for about a minute or more. This causes an excessive influx of Na into the cell, resulting in death of the cell.

The suppression of such inactivation can be appropriately realized by introducing an amino acid mutation into the amino acid sequence of the voltage-gated Na ion channel. Several specific methods have been disclosed for suppressing the inactivation of the Nav1.5 channel. For example, modifying the IFM motif (Grant et al., Biophys. J., 79: 3019-3035, 2000), mutating the 406th asparagine to glutamic acid, arginine, or lysine (McNulty et al., Mol. Pharmacol., 70: 1514-1523, 2006), deletion of the linker site including the IFM portion connecting domains III-IV (Patton et al., Proc. Natl. Acad. Sci. U S A, 89: 10905- 10909, 1992, West et al., Proc. Natl. Acad. Sci. USA, 89 ,: 10910-10914, 1992). That is, in the hNav1.5 amino acid sequence (only the region containing the IFM to be mutated is displayed), the IFM of 1470-IDNFNQQKKKLGGQDIFMTEEQKKYYNAMKK-1500 can be mutated to QQQ.

In addition, it has been reported that the amino acid of segment 4 of domain IV is mutated (Chen et al., J. Gen. Physiol., 108: 549-556, 1996). Those skilled in the art can appropriately introduce mutations into amino acid sequences based on these documents and well-known techniques.

It is preferable that this evaluator retains and expresses DNA encoding such a Na ion channel (natural protein or mutant protein) (hereinafter, also referred to as first DNA). The present evaluation agent may be one that constantly or transiently expresses the mutant, that is, a voltage-gated Na ion channel in which inactivation is suppressed. That is, the DNA may be integrated on the chromosome and transmitted to the daughter cell, or may be integrated into a plasmid that autonomously amplifies extrachromosomally but is not necessarily transmitted to the daughter cell. The DNA is preferably linked under the control of a constitutively active promoter (constitutive promoter). For such an evaluation agent, a person skilled in the art constructs an expression vector containing DNA or the like based on a well-known genetic engineering technique and a technique for producing a transformant, and introduces this into the host of the present assessor. By transforming, constantly expressed or transiently expressed cells can be appropriately obtained.

The expression level of Na ion channels controls the type of control region such as a promoter that controls the first DNA, the number of expression cassettes containing the first DNA to be introduced, and the cell culture conditions after gene transfer. It can be adjusted by.

When the potential-dependent Na ion channel consists of two or more subunits and the subunit containing a mutation effective for inactivation is a part of the whole, only the part of the subunit is concerned. The DNA encoding each of these can be expressed in the present evaluation agent as one or more DNAs, and these subunits are encoded so that other subunits constituting the Na ion channel are also co-expressed at the same time. The DNA may be retained as DNA in an expressible manner. Furthermore, if there are enzymes, other proteins, compounds, etc. necessary for the voltage-gated Na ion channel in which the expressed inactivation is suppressed to function more effectively, these substances are appropriately expressed or supplied. You may try to do so.

The other K ion channel provided by this evaluator is an ion channel having a function (activity) such that the resting membrane potential becomes deeper in the negative direction, in other words, the negative potential becomes larger. That is, according to such other K ion channels, a deep resting membrane potential can be formed by enhancing K ion permeability due to its expression and activity. When the above-mentioned Na ion channel is provided, the Na ion concentration difference between the inside and outside of the cell causes the Na ion to flow excessively into the cell, and finally the intracellular Na ion concentration increases and the cell dies. In order to use cells as this evaluator, the cells must be alive until such a cell death-inducing system is induced. Therefore, in order to deepen (lower) the resting membrane potential, another K ion channel that deepens the resting membrane potential in the negative direction is used.

The resting membrane potential is preferably deeper in the negative direction as long as it does not affect cell survival. The membrane potential is preferably about -50 mV, more preferably about -60 mV, still more preferably about -70 mV, and even more preferably about -80 mV.

Examples of such other K ion channels include a state in which an inwardly rectifying K ion channel (Kir channel), a four-transmembrane type and a two-pore type K ion channel (K2P channel) are activated. There are various types of 4-transmembrane type and 2-pore type K ion channels (K2P channels) having different properties, and they are classified into TWIK, TREK, TASK, TALK, THIK, TRESK and the like. These ion channels function as leak channels because they have little potential and time dependence. Due to the nature of the leaking channel, these other K ion channels act to maintain (fix) the resting membrane potential of the cell.

The inward rectifying K ion channel is not particularly limited, and examples thereof include various Kir2x channels such as Kir2.1, 2.2, 2.3, and 2.4. Kir2.1 is an inwardly rectifying K ion channel (Kir channel) having a transmembrane structure. It does not have voltage dependence and has the property of bringing the membrane potential close to the equilibrium potential of K ions, which is around -80 mV. It is expressed in nerves, heart, skeletal muscle, etc., and forms, stabilizes, and maintains resting membrane potential. Kir2.2 is an inwardly rectifying K ion channel (Kir channel) similar to Kir2.1, but has stronger inwardly rectifying property than Kir2.1. It is expressed together with Kir2.1 in the heart, brain, skeletal muscle, etc., and plays a major role in inwardly rectifying K ion channel (Kir channel) activity in human vascular endothelial cells. Further, Kir2.2 is suitable for this evaluation agent in that it is specifically inhibited by, for example, Ba ions, as will be described later.

Kir. 2. The x ion channel is described in Circ. Res. 94: 1332-1339 (2004), Am. J. Physiol. Cell Physiol. 289: C1134-C1144 (2005), and the like. For example, the nucleotide sequences of genes encoding Kir2.x channels derived from humans are Kir2.1 (GenBank accession No. U12507, NM_000891 (Human KCNJ2)), Kir2.2 (GenBank accession No. AB074970, NM_021012 (Human KCNJ12)). ), Kir2.3 (GenBank accession No. U07364, U24056, NM_152868 (Human KCNJ4)), Kir2.4 (GenBank accession No. AF081466, NM_013348 (Human KCNJ14)) and the like.

Similarly, a G protein-controlled inward rectifying K ion channel (GIRK channel, Kir) can be mentioned. The GIRK channel (Kir3) is an inwardly rectifying K ion channel (Kir channel), but unlike Kir2, it is a K ion channel activated by a G protein. These subunits are tissue-specific and form a heterologous tetramer composed of Kir3.1 / Kir3.4 in the heart and Kir3.1 / Kir3.2 in the central nervous system. Normally, it is not activated, but is activated by agonist stimulation. However, it has been reported in experiments on Xenopus oocytes that the ion channels remain open at all times by mutating the amino acids in the transmembrane helix that forms the ion channel pores (Claydon et. Al., J). . Biol. Chem. 278: 50654-50663, 2003). From this, it is considered that a deep resting membrane potential can be formed by using this mutant as in Kir2.1. For example, the nucleotide sequences encoding the human-derived Kir3.3x channels are Kir3.1 (GenBank accession No. NM_002239 (Human KCNJ3)), Kir3.2 (GenBank accession No. NM_002240 (Human KCNJ6)), and Kir3.3 (GenBank accession No. NM_002239 (Human KCNJ3)). GenBank accession No. NM_004983 (Human KCNJ9)) and Kir3.4 (GenBank accession No. NM_000890 (Human KCNJ5)) can be mentioned.

Further, ATP-sensitive inward rectifying K ion channel (K _ATP channel, Kir6) can be mentioned. The K _ATP channel is an inwardly rectifying K ion channel (Kir channel) that is suppressed by ATP and activated by ADP. K _ATP channels control cell excitability according to the metabolic state of the cell. The K _ATP channel is a _{heterologous octamer composed of four K ATP} channels and four sulfonylurea receptors (SURs). K _ATP channel alone is no function has been reported that will have the function only with K _ATP channel thereby lacking a C-terminal of a K _ATP channel (Tucker et. Al., EMBO J. EMBO J 17: 3290-3296, 1998). In addition, by further mutating this defect, ATP sensitivity can be lowered and always activated. A deep resting membrane potential can also be formed by using this mutant. Human-derived Kir 6. Examples of the base sequence encoding the x-channel include Kir6.1 (GenBank accession No. NM_004982 (Human KCNJ8)) and Kir6.2 (GenBank accession No. NM001166290 (Human KCNJ11)).

As the 4-transmembrane type and 2-pore type K ion channel (K2P channel), for example, the membrane potential becomes deep when expressed in THIK channel (HEK293 cells; Campanucci et al., Neuroscience, 135: 1087- 1094, 2005), TASK-2 channel (Expression in African Tumegael egg matrix cells deepens the resting membrane potential; Kindler et al., J. Pharmacol. Exp. Ther., 306: 84-92, 2003.) , Potential-dependent K-channel (potential-dependent K-channel deepens resting membrane potential in smooth muscle tissue; McDaniel et al., J. Appl. Physiol. (1985) 91: 2322-2333, 2001), etc. Has been done.

The 4-transmembrane type and 2-pore type K ion channels (K2P channels) are classified into each subfamily of TWIK, TREK, TASK, TALK, THIK and TRESK. The TWIK subfamily includes TWIK-1, TWIK-2 channels (Lotshaw, Cell Biochem. Biophys. 47: 209-256, 2007). TWIK channels are present in many tissues in humans. For example, human-derived TWIK ion channels include TWIK-1 (GenBank accession No. NM_002245 (KCNK1)) and TWIK-2 (GenBank accession No. NM_004823 (KCNK6)).

The TREK subfamily includes TREK-1, TREK-2 and TRAAK channels. For example, human-derived TREK ion channels include TREK-1 (GenBank accession No. NM_014217 (KCNK2)), TREK-2 (GenBank accession No. NM_138317 (KCNK10)) and TRAAK (GenBank accession No. NM_033310 (KCNK4)). Can be mentioned.

The TASK subfamily includes TASK-1, TASK-3 and TASK-5 channels. For example, human-derived TASK ion channels include TASK-1 (GenBank accession No. NM_002246 (KCNK3)), TASK-3 (GenBank accession No. NM_016601 (KCNK9)) and TASK-5 (GenBank accession No. NM_022358 (KCNK15)). ).

The TALK subfamily includes TALK-1, TALK-2 and TASK-2 channels. For example, human-derived TALK ion channels include TALK-1 (GenBank accession No. NM_001135106 (KCNK16)), TALK-2 (GenBank accession No. NM_001135111 (KCNK17)) and TASK-2 (GenBank accession No. NM_003740 (KCNK5)). ).

The THIK subfamily includes THIK-1 and THIK-2 channels. For example, examples of human-derived THIK ion channels include THIK-1 (GenBank accession No. NM_022054 (KCNK13)) and THIK-2 (GenBank accession No. NM_022055 (KCNK12)).

The TRESK subfamily includes TRESK (GenBank accession No. NM_181840 (KCNK18)).

For other K ion channels, in addition to these various natural K ion channels, other K ion channel variants modified from these can also be used. This evaluator is preferably used in the presence of an inhibitor of other K ion channels. It is preferred that the inhibitor be capable of inhibiting other K ion channels with as high selectivity as possible and with as high sensitivity as possible (at low concentrations). Therefore, in order to impart more suitable selectivity and sensitivity to the inhibitor to other K ion channels, other K ion channels can be appropriately modified.

A technique for modifying a known protein in order to impart, delete, enhance, or attenuate the intended function is known to those skilled in the art. Since the target protein, especially the ion channel, has been well studied in the transmembrane region and the pore region, it is appropriate to identify an appropriate modifiable site to some extent by using the amino acid sequence alignment of the protein. It is a daily work in a trader. Then, it is a daily task of those skilled in the art to examine the substitution of possible amino acid residues based on the alignment information about the modifiable site, obtain a mutant, and evaluate the function of the mutant.

In this evaluation agent, K ion channels 1 or 2 or more can be appropriately combined and used for the purpose of deepening the resting membrane potential by such other K ion channels.

Like the Na ion channel, this evaluator retains and expresses DNA encoding these other K ion channels (natural protein or mutant protein) (hereinafter, also referred to as second DNA). Is preferable. The present evaluation agent may be one that constantly or transiently expresses the K ion channel, which is a natural product or a mutant thereof. That is, the DNA may be integrated on the chromosome and transmitted to the daughter cell, or may be integrated into a plasmid that autonomously amplifies extrachromosomally but is not necessarily transmitted to the daughter cell. Also, like the first DNA, the second DNA is preferably linked under the control of a constitutively active promoter (constitutive promoter). Furthermore, when the other K ion channel consists of two or more different subunits, the same aspects as in the Na ion channel apply. Moreover, the expression level of other K ion channels can be adjusted in the same manner as in the case of the first DNA.

Even if the present evaluation agent has a mutant potential-dependent Na ion channel in which inactivation is suppressed by providing the Na ion channel and the other K ion channel on the cell membrane or the like, respectively. Until depolarization is induced, the cells are in which cell death due to intracellular influx of Na ions is avoided. That is, although it has a cell death-inducing system, it is in a state of waiting for a cell death-inducing system that operates after waiting for the induction of depolarization.

It can be used as this evaluation agent, a preventive or therapeutic agent for tumors, and can also be used for research purposes on this K ion channel. For tumors to which this evaluator can be applied, the embodiments already described for this drug are provided.

(Evaluation Method of Ion Channel Agent) In the evaluation method of an ion channel agent disclosed in the present specification (hereinafter, also simply referred to as this evaluation method), the ion channel agent is a mesophyll of a bone tumor or the like. It is a drug for preventing or treating a system tumor, and the target ion channel is a K _Ca 3.1 ion channel, and a step of evaluating an inhibitor that suppresses the activity of the target ion channel can be provided. According to this evaluation method, since the present K ion channel inhibitor can suppress the change of mesenchymal tumor from cancer stem cells to tumor cells, it is possible to provide a drug that contributes to the prevention of mesenchymal tumors. In addition, since this K ion channel inhibitor can suppress malignant transformation and metastasis of tumor cells, it is possible to provide a drug that contributes to the treatment and improvement of mesenchymal tumors and the improvement of prognosis.

The present evaluation method is not particularly limited as long as it is a method in which the target ion channel is the present K ion channel and the inhibitory activity of the inhibitor thereof can be evaluated, but the present evaluation agent is used and disclosed in WO2012 / 00246 and WO2018 / 084221. It is preferable to evaluate using the method described above.

For example, the method described in WO2018 / 084221 uses an inhibitory target ion channel as the target ion channel. This K ion channel corresponds to an inhibitory target ion channel. This evaluation method is an inhibitor provided by this evaluation agent that can induce cell death by inducing depolarization in the cell death-inducing system by acting inhibitoryly on other K ion channels that are not target ion channels (hereinafter referred to as , Also referred to as a K ion channel inhibitor) can suppress the induction of depolarization and the induction of cell death. Since this K ion channel acts in the direction of deepening the resting membrane potential, it is possible to suppress the action of the inhibitor, that is, the induction of depolarization and the induction of cell death due to it, independently of the inhibitor. .. By selecting such an ion channel, an efficient evaluation system for the ion channel can be constructed.

The K ion channel inhibitor inhibits the action of other K ion channels and suppresses the deepening of the resting membrane potential in the negative direction. Such inhibitors also vary, for example, depending on the type of other K ion channel. From known information, a K ion channel inhibitor can be obtained, and a cell having a cell death-inducing system containing various other K ion channels is prepared to inhibit other K ion channels that may be possible against this cell. It can be obtained by supplying a drug and evaluating whether or not depolarization is induced or cell death is induced.

For example, Kir2. Ba ion is known as an inhibitor against x. It is preferable that the sensitivity of other elements of this evaluation system to Ba ions, for example, Nav1.5 which is a Na ion channel, the mutant thereof, or K2P channel as a target ion channel described later is low. More specifically, the 50% inhibitory concentration of other ion channels other than the K ion channel of the cell death-inducing system is preferably 5 times or more, more than the 50% inhibitory concentration of the K ion channel of the cell death-inducing system. It is preferably 7 times or more, more preferably 10 times or more, still more preferably 15 times or more, still more preferably 20 times or more. By having such selection inhibitory property, the action of the test compound on the inhibitory target ion channel can be detected and evaluated with high sensitivity. In addition, such an inhibition concentration and the like can also be measured using a cell provided with the cell death induction system disclosed in the present specification.

The screening method disclosed in WO2018 / 084221 is a step of supplying an inhibitor of a K ion channel to the evaluator so as to inhibit the action of the K ion channel, and a suppressive target for the evaluator. A step of supplying a test compound having a possibility of inhibiting an ion channel and a step of evaluating the effect of the supply of the test compound on cell death of the present evaluation agent can be provided. According to this screening method, the action of the test compound on the inhibitory target ion channel can be easily evaluated by supplying an inhibitor of the K ion channel to inhibit the K ion channel. For example, depolarization of this evaluator can be induced without using electrical stimulation. As a result, efficient screening is possible.

In addition, the cell death-inducing system is also controlled by the inhibitory target ion channel that suppresses the cell death-inducing action of the K ion channel inhibitor while suppressing the action of the K ion channel by the K ion channel inhibitor. By adjusting the concentration of the ion channel inhibitor, a suitable screening environment can be constructed depending on the intended properties of the test compound, that is, whether it is an inhibitor or an agent for the inhibitory target ion channel. For example, by supplying the K ion channel inhibitor so that the cell death rate is lower than 50%, a screening environment suitable for the inhibitor against the inhibitory target ion channel can be constructed. Further, for example, by supplying the K ion channel inhibitor so that the cell death rate exceeds 50%, a screening environment suitable for the agent for the inhibitory target ion channel can be constructed.

Further, for example, by supplying a K ion channel inhibitor so that the cell death rate is close to 50%, qualitatively whether the test compound for the inhibitory target ion channel is an inhibitor or an agent. And it can be evaluated quantitatively.

For example, when Ba ions having a concentration of about 50% in cell death are supplied to this evaluator, the cell death rate is lower than in the vicinity of 50% in the presence of the K2P channel opener, that is, surviving cells. The ratio of is increased from around 50%. On the other hand, in the presence of K2P channel closures, the rate of cell death increases above 50%, that is, the rate of surviving cells decreases below around 50%. By this method, the action (active agent or inhibitor) of the test compound on the inhibitory target ion channel can be detected and evaluated based on the cell death / cell survival of this evaluator, that is, the cell mortality rate (or survival rate). ..

For screening, one or more test compounds can be supplied to this evaluator. A single test compound may be used to detect the action of the compound, or two or more test compounds may be used to detect the combined action, additive action, or synergistic action of these compounds. In detecting the effect on the inhibitory target ion channel by the cell death (rate) of this evaluator, the cell death (rate) of this evaluator when the test compound is not supplied can be used as a control group. In addition, a compound whose action on the inhibitory target ion channel is known may be used as a control group. By comparison with such a control group, the presence or absence of the action of the test compound on the inhibitory target ion channel and the degree of the action can be detected.

The test compound is not particularly limited. In addition to low molecular weight compounds that may be used as inhibitors, proteins such as antibodies, peptides, oligonucleotides, nucleic acids (DNA, RNA) such as polynucleotides, oligosaccharides, polysaccharides, lipids and the like may be used. ..

If necessary, the evaluation agent may be given various stimuli in addition to the test compound. This is because the action may be promoted or suppressed in combination with these stimuli. It is also possible to evaluate the effect on target ion channels that are activated or inactivated in the presence of stimuli. Examples of such stimuli include temperature change (high temperature, low temperature), pH change, O ₂ / CO ₂ concentration change, osmotic pressure change, volume change and the like.

When applying this evaluation agent to this screening method, the following aspects of the evaluation process can be mentioned. That is, in the presence of the test compound and the K ion channel inhibitor, the action of the test compound can be evaluated using the life or death of the present evaluator as an index. In this case, in the absence of the test compound, the K ion channel constantly operates to suppress depolarization or action potential. Therefore, the action potential does not occur or prolong even in the presence of the K ion channel inhibitor. As a result, this evaluator survives. On the other hand, when the test compound and the K ion channel inhibitor are added to this evaluator, cell death of this evaluator is promoted. When such an embodiment is shown, the test compound can be determined as an inhibitor having an inhibitory effect on the present K ion channel.

As described above, according to the screening method disclosed in WO2018 / 084221, by using an inhibitor for K ion channel, an inhibitor for a target ion channel can be easily screened using the life or death of this evaluator as an index.

This evaluation method can also be carried out as an ion channel agonist as a drug evaluation method in order to suppress the differentiation of cancer stem cells into tumor cells and the malignant transformation of tumor cells. This is because, as described above, this K ion channel contributes to the transformation of cancer stem cells into tumor cells, malignant transformation of tumor cells, and cancer metastasis.

(Marker for Examination of Pathological Condition of Tumor) The marker disclosed in the present specification (hereinafter, also simply referred to as this marker) is a marker for examination of pathological condition of bone tumor, and K _Ca 3. It can include one ion channel, its mRNA or a compound that specifically binds to its pre-mRNA. This marker can be used for pathological examination of various tumors including bone tumors such as tumorigenesis of cancer stem cells, malignant transformation of tumor cells and cancer metastasis. As the present marker, in addition to the present inhibitor described above, any marker that specifically binds to the mRNA or protein of the present K ion channel can be used. That is, in addition to those that function as inhibitors for antibodies, aptamers, siRNAs, etc. that specifically bind to the present K ion channel, oligonucleotide probes that are specific for the mRNA of the present K ion channel may be used. Further, as described above for the present inhibitor, a marker having a known labeling element may be preferable as the present marker.

This marker can be applied to, for example, biological fluids such as blood and bone marrow fluid collected from a subject, as well as cell samples in tissues and the like by a known method depending on the type of marker. For example, nucleic acid hybridization, antigen-antibody reaction, protein-nucleic acid interaction, and the like in various embodiments can be used to bind to the K ion channel protein, its mRNA, and pre-mRNA. The detection form can also be appropriately set according to the type of marker, the type of marker, and the like.

(Method for Examining the Pathology of Bone Tumor) The method for examining the pathology of bone tumor disclosed in the present specification (hereinafter, also simply referred to as the present inspection method) is a cell collected from a target site of a subject of a bone tumor patient. The _{step of measuring the K Ca} 3.1 ion channel activity in the above can be provided. According to this test method, by measuring the activity of this K ion channel in cells, the degree of change of cancer stem cells into tumor cells, the possibility and degree of malignant transformation and metastasis of tumor cells, the prognosis of patients, etc. You can get information about.

The target site for collecting cells is not particularly limited, and examples thereof include a primary site of a bone tumor and a metastatic site. The method for measuring activation is not particularly limited, but for example, the mRNA and protein of this K ion channel are specifically detected to measure the expression level, the amount of this K ion channel protein, and the like, using this marker. Can be detected.

Hereinafter, specific examples relating to the disclosure of the present specification will be described, but the disclosure of the present specification is not specifically limited to the following.

_{(Expression of K Ca} ion channels in artificial osteosarcoma cancer cells (AO; potential cancer stem cells / AX; progenitor cell-like cells)) Artificial osteosarcoma cancer cells (AO cells and AX cells, hereinafter collectively referred to as) AO / AX cells) were obtained from Professor Saya of Keio University and Dr. Shimizu (currently an associate professor of Hoshi Pharmaceutical University). All of these cells were established from bone marrow stromal cells of Ink4a / Arf KO mice. Here, AO cells are cells that have the ability to differentiate into adipocytes, osteoocytes and chondrocytes, have a lower tumorigenicity than AX cells, but exhibit high drug tolerance. When the AO cells are transplanted into mice, the expression of PPARγ, which is important for the differentiation into adipocytes, is reduced, and the ability to differentiate from AO cells to adipocytes is reduced to become AX-like cells having the property of becoming a tumor. It has been reported that this causes tumorigenesis (References 10 and 11).

These cancer cells were cultured in Antibiotic-Antimycotic Mixed Stock Solution (Nacalai), GlutaMAX ^TM Supplement (Gibco) and IMDM medium (Nacalai) supplemented with 20% FBS (Nichirei). When used in the experiment, it was sown on a petri dish or a piece of glass 1 to 2 days before use. Osteosarcoma tumor cells obtained from tumor tissue generated by planting AX cells in mice were cultured in Antibiotic-Antimycotic Mixed Stock Solution (Nacalai) and IMDM medium (Nacalai) supplemented with 10% FBS (Nichirei), and mRNA and stained specimens were obtained. Got

RNA extraction and real-time PCR were performed on these cells _{to confirm the expression of K Ca} ion channels (mouse KCNN4). AO / AX cells were petri dish cultured, and after reaching a confluent, total RNA was extracted from the cells by the AGPC (Acid Guanidium Thiocyanate-Phenol Chloroform) method using RNAisoPlus (Takara), and the total RNA concentration was calculated from the OD260 value. CDNA was synthesized by Revertra Ace (TaKaRa) and Ramdom Primers (Invitrogen) using 0.5 μg total RNA, and real-time PCR was performed. Real-time PCR was performed using the PCR detection and quantification system LightCycler® 96 System (Nihon genetics). Using SYBR Premix Ex Taq (TaKaRa), the fluorescence of each cycle was measured by the cyber green assay method, and the GAPDH mRNA expression level was used as an endogenous reference substance based on the calibration curve prepared in advance based on the fluorescence intensity. The expression level of the target ion channel mRNA was calculated as a ratio to GAPDH, and the value was shown. The results are shown in FIG. 1A.

The specific operation of PCR was performed as follows. 1) Preheat denaturation reaction (94 ° C, 10 minutes), 2) Heat denaturation reaction (94 ° C, 30 seconds), 3) Annealing reaction (58 ° C, 30 seconds), 4) Extension reaction (72 ° C, 1 minute) .. 2) to 4) were cycle reactions, which were carried out in 35 cycles. The primers used are as follows.

(Electrophysiological experiment) The whole cell patch clamp method (Hamill et al., 1981) established by Hamill et al. Was used to measure the membrane current of AO / AX cells. A recording electrode is produced from a cored glass tube with an outer diameter of 1.04-1.08 mm using a two-stage electrode manufacturing machine (PB-7; Narishige, Tokyo, Japan), and the tip is smoothed by thermal processing under a microscope. It was prepared and used in the experiment. In the experiment, a recording electrode having a tip diameter of about 1 μm and an electrical resistance of 2-5 MΩ when filled with intracellular fluid was used. A piece of glass with cells colonized was fixed in a chamber fixed on the stage of an inverted microscope (TMD; Nikon, Tokyo, Japan) and perfused with Normal HEPES solution. The recording electrode was pressed against the cells using a hydraulic fine movement manipulator (MHW-3; Narishige), and the membrane current was measured by the voltage fixation method. The measured current was amplified using a microcurrent amplifier CEZ-2400; Nihonkoden, Tokyo) and recorded using an AD generator (Digidata 1440A; Axon Instruments) and Clampex 10.2 (Axon Instruments). Data analysis was performed using Clampfit 10.2 (Axon Instruments). The results are shown in FIG. 1B.

(Membrane potential measurement method using the voltage-sensitive dye Oxonol V) The oxonol-based voltage-sensitive dye Oxonol V is a dye whose fluorescence intensity increases when the cell membrane is depolarized and decreases when the membrane is hyperpolarized. Are known. A piece of glass in which cells were sown was fixed in a chamber, and 1 μM Oxonol V (Sigma) was loaded at room temperature for about 30 minutes, and then the cells were loaded for about 30 minutes while being perfused. A confocal laser scanning microscope (A1R / Ti-E, Nikon) was used as an image measurement / analysis device. Oxonol V was excited at a wavelength of 640 nm and the _{change in fluorescence intensity when a K Ca} ion channel inhibitor (TRAM-34, ICA-17043, see Chemical formula 1) was added was analyzed. The results are shown in FIG. 1C.

Using (intracellular Ca ion concentration ^([Ca _{2+] i)} measurement) ^[Ca _2+] Fast CCD camera for the measurement of _i changes fluorescence image analysis system ARGUS / HiSCA (Hamamatsu ^Photonics), the ^[Ca _{2+] i} changes Image analysis was performed. In this experiment, fura-2 acetoxymethyl ester (fura-2 AM, Invitrogen) was used as a ^{Ca 2+ fluorescence indicator.} A piece of glass to which the cells were attached was fixed in the measurement chamber, 10 μM fura-2 AM was added, and the cells were allowed to stand at room temperature for about 30 minutes to load the cells. Then, the excess fura-2 AM was washed with the HEPES solution for 10 minutes, and then the measurement was started. The change in intracellular Ca ion concentration was measured for about 10 cells existing on the glass piece by one measurement. The measurement conditions are that the intracellular dye is excited by light with excitation wavelengths of 340 nm and 380 nm with a xenon lamp, and the emitted fluorescence of 520 nm or more is acquired by a high-sensitivity camera (F ₃₄₀ and F _380, respectively), and the fluorescence intensity thereof is obtained. The ratio (F ₃₄₀ / F ₃₈₀ ) was acquired as a single image. The results are shown in FIGS. 1D and E.

As shown in FIG. 1A, it was found that the expression of _{K Ca ion channels was remarkably increased in AX cells as compared with AO cells.} Also, as shown in FIG. 1B, the TRAM-34 sensitive currents inhibited by TRAM-34, which is a selective inhibitor of _{K Ca ion channels, were compared.} As a result, it was clarified that the TRAM-34 sensitivity current was remarkably increased in the AX cells as compared with the AO cells.

In addition, FIG. 1C shows the analysis results of the contribution of _{K Ca} ion channels to the membrane potential of AO / AX cells. _{Membrane potential change by DCEBIO, which is a K Ca} ion channel activator, and membrane potential by inhibitor TRAM-34. When the changes were examined, it was found that the K _Ca ion channels in the AX cells shift the membrane potential in the hyperpolarizing direction. Further, FIG. 1D shows the analysis result of the intracellular calcium ion concentration at rest. As shown in FIG. 1D, the intracellular calcium ion concentration at rest in AX cells is higher than that at rest as compared with AO cells. It turned out to be increasing. Further, FIG. 1E shows _{the analysis results of the contribution of K Ca} ion channels to the intracellular calcium ion concentration. As shown in FIG. 1E, in AO cells, in the _{presence and absence of the K Ca} ion channel inhibitor, No _{change occurred when the K Ca} ion channel activator was supplied, whereas in AX cells, when the K _Ca ion channel activator was supplied in the _{absence of the K Ca ion channel inhibitor, the cells were intracellular.} From the increase in calcium ion concentration, it was found that the presence and activation of _{K Ca ion channels contributed to the intracellular calcium ion concentration in AX cells.}

_{(Contribution of K Ca} ion channel to cell proliferation of AO / AX cells) A high content cell analyzer system (Operetta, PerkinElmer) was used to measure cell proliferation. The AO / AX cells used in Example 1 were sown on 96-well plates ^{to 1.5 × 10 3} cells / well and incubated at _{37 ° C, 5% CO 2.} After cell adhesion (about 2 hours later), the drug was replaced with a drug solution suspended in a medium. The time was set to 0 hours, and measurement was performed after culturing for 24 and 48 hours. ^{For the measurement, a 2.2 mM Ca 2 +} HEPES solution containing 10 μg / ml Hoechst33342 (Molecular Probe) was added to the plate after each time, and the plate was allowed to stand at room temperature for 10 minutes. Then, using Operetta, the number of Hoechst-positive cells at an excitation wavelength of 350 nm and a fluorescence wavelength of 461 nm was measured. As an example, the average number of cells of 3 wells in which the experiment was conducted under the same conditions at each measurement time was taken as an example. The results are shown in FIG.

According to FIG. 2, _{it was found that the addition of the K Ca} ion channel inhibitor TRAM-34 suppressed the cell proliferation renewal of AX cells to the same extent as the proliferation rate of AO cells.

_{(Contribution of K Ca} ion channel to the migration ability of AX / AO cells) A cell migration experiment was performed on the AO / AX cells used in Example 1. In the cell migration experiment, a Transwell assay using an 8.0 μm pore size Cell Culture Insert (Corning, hereinafter referred to as chamber) was performed. IMDM medium containing 1% FBS (Nichirei) and drugs (DMSO, TRAM-34, ICA-17043) was prepared on a 24-well plate. The Chamber was placed on a 24-well plate, Serum free IMDM medium was added to the upper and lower parts of the Chamber, and the chamber was shaken several times to bleed air. Then, the upper and lower media were removed. Next, each drug (DMSO, TRAM-34, ICA -17043) suspended by so the AO / AX cells 1.0 × ¹⁰ 5 cells / ml in IMDM medium of added Serum the Free and remove the culture medium 0.5 ml each was added to the upper part of the serum, and immediately placed on a 24-well plate in which IMDM medium containing 1% FBS was immersed. AX cells were incubated at 37 ° C., 5% CO ₂ for 4 hours, and AO cells were incubated for 8 hours because the number of migrating cells was low at 4 hours regardless of the presence or absence of the drug.

After that, the non-migratory cells on the upper part of Chamber were removed with a cotton swab. Using Diff-Quickkit (Sysmex), the migrating cells that passed through Transwell and moved from the top to the bottom were fixed and stained (IMDM medium was removed, the fixative was soaked for 15 minutes, and the stain 1.2 was soaked for 10 minutes. did). The Transwell part of the chamber was hollowed out with a cutter, adhered to a slide glass, and a transmitted image was obtained with a microscope. The number of migrating cells per image was measured, three images were randomly obtained with one chamber, and the average number of cells was taken as the number of migrating cells per chamber. In each trial (n), DMSO, TRAM-34, and ICA-17043 were performed in 3 chambers each, and the number of cells for 3 chambers was further averaged, which was taken as an example. The number of migrating cells in the TRAM-34 and ICA-17043 groups was standardized by the number of migrating cells in the DMSO group, and the change in migration rate due to the drug was calculated. The results are shown in FIG.

As shown in FIG. 3, the addition of the K _Ca ion channel inhibitors TRAM-34 and ICA-17043 markedly suppressed the enhancement of cell migration of AX cells (A and B in FIGS. 3). Moreover, the addition of a similar inhibitor to AO cells had no effect.

_{(Expression of K Ca} ion channels in AO / AX cells and osteosarcoma-collected cells) AX cells [1], AO cells [2] and osteosarcoma tumor cells [3] (tumors formed by transplanting AX cells into mice once The cells were collected from the cells and cultured. The tumorigenicity was higher than that of AX cells.) Was seeded in a cell culture dish by triplicate. The next day, after confirming that the cells had adhered to the culture dish, RNA was extracted and recovered using Nucleospin RNA (Takara).

In the samples [7] and [8] from the tumor, osteosarcoma tumor cells [3] were subcutaneously transplanted into mice, and tumor fragments were formed from the primary tumor (subcutaneous tumor) and lung metastasis formed 26 days later, respectively. Was recovered (n = 3). The tumor pieces were mixed with a tissue lysate of Nucleospin RNA, a solution containing RNA was recovered using Biomasher (Nippi), and then RNA was extracted according to the protocol of Nucleospin RNA.

_{(Expression analysis of K Ca} ion channel by real-time PCR) 0.5 μg of RNA was reverse transcribed using Prime Script (Takara) to prepare cDNA. Real-time PCR was performed using a commonly used protocol. The solution was prepared according to the attachment using 0.4 μg of cDNA, each primer of Kcnn4 and β-Actin, and Thunderbird Premix (TOYOBO) as an enzyme. The solution was prepared in a 48-well real-time PCR dish and PCR was performed using StepOne plus (Thermo Fischer Scientific) (device default setting) to quantify expression. As a result, the expression of Kcnn4 was divided by the expression of β-Actin to calculate the ratio. The sequences of the primers used for each amplification are as follows. The results are shown in FIG.

Kcnn4 (Forward side: CAAGCACACTCGAAGGAAGG (SEQ ID NO: 27), Reverse side: CTTCCGGTGTTTCAGCCGTA) (SEQ ID NO: 28) β-Actin (Forward side: CAACCGTGAAAGATGACCC (SEQ ID NO: 29), Reverse side: TAGACCAGAGGCATACAG) (SEQ ID NO: 30)

_{As shown in A of FIG. 4, the expression level of K Ca} ion channels in AX cells [1], osteosarcoma tumor cells [3], primary lesions [7] and metastatic lesions [8] is AO cells [1]. Was increasing. Among them, the expression level was high in the metastatic lesion [8].

_{(Expression of K Ca} ion channel in primary lesion and metastatic lesion by tissue immunoantibody staining method) Osteosarcoma tumor cells [3] in FIG. 4A were transplanted into the bone marrow of the femur of a mouse, and the primary lesion (subcutaneous tumor). , Liver metastases and lung metastases were formed. The mice were euthanized by intraperitoneal injection of a lethal dose of pentobarbital, the primary lesion (subcutaneous tumor) and metastatic lesion (lung, liver) were removed and fixed in 4% -paraformaldehyde for 2 days. The fixed sample was embedded in paraffin, sliced, and attached to a slide glass. The procedure for immunohistochemical staining was performed using a general method. It is briefly described below. The sample of the slide glass is deparaffinized and dexylene by immersing it in xylene, 100%, 90%, 80%, and 70% ethanol in that order, and heat-treated in a citric acid buffer to activate the antigen. Was done.

Next, endogenous peroxidase was inactivated with methanol containing 3% hydrogen peroxide solution, washed with phosphate buffer (PBS), and blocked with 3% -BSA-PBS. Then, the primary antibody (Anti-Kcnn4 antibody manufactured by GeneTex) was allowed to act at 4 ° C. overnight. After washing with PBS, Nichirei's Histfine was allowed to act as a secondary antibody, and after washing with PBS, color was developed with DAB. After washing with running water, the nuclei were stained with a hematoxylin solution, and the nuclei were soaked in 70%, 80%, 90%, and 100% ethanol and xylene in that order to perform a transparent treatment. Finally, it was sealed in a cover glass with a marinol solution (MUTO). The results are shown in B of FIG.

As shown in B of FIG. 4, it was confirmed that the protein _{of the K Ca} ion channel was expressed in the primary lesion (intrabone marrow) and the metastatic lesion (liver and lung).

_{From the above results, K Ca} ion channels are not expressed in AO cells, which are potential cancer stem cells, but when changing from AO cells to AX cells, which are progenitor cell-like cells, and proliferation as tumor cells, tumor cells _{It was found that K Ca} ion channels were highly expressed during malignant transformation and metastasis.

(List of Related Documents) The documents described below shall be incorporated herein by reference.
1. Bednenko J, Harriman R, Marien L, Nguyen HM, Agrawal A, Papoyan A, Bisharyan Y, Cardarelli J, Cassidy-Hanley D, Clark T, Pedersen D, Abdiche Y, Harriman W, van der Woning B, de Haard H, Collarini E, Wulff H, and Colussi P. A multiplatform strategy for the discovery of conventional monoclonal antibodies that inhibit the voltage-gated potassium channel Kv1.3. MAbs 10: 636-650, 2018.
2. Chen Y, Kuang D, Zhao X, Chen D, Wang X, Yang Q, Wan J, Zhu Y, Wang Y, Zhang S, Tang Q, Masuzawa M, Wang G, and Duan Y. miR-497-5p inhibits cell proliferation and invasion by targeting KCa3.1 in angiosarcoma. Oncotarget 7: 58148-58161, 2016.
3. D'Alessandro G, Catalano M, Sciaccaluga M, Chece G, Cipriani R, Rosito M, Grimaldi A, Lauro C, Cantore G, Santoro A, Fioretti B, Franciolini F, Wulff H, and Limatola C. KCa3.1 channels are involved in the infiltrative behavior of glioblastoma in vivo. Cell Death Dis 4: e773, 2013.
4. Faouzi M, Hague F, Geerts D, Ay AS, Potier-Cartereau M, Ahidouch A, and Ouadid-Ahidouch H. Functional cooperation between KCa3.1 and TRPC1 channels in human breast cancer: Role in cell proliferation and patient prognosis. Oncotarget 7: 36419-36435, 2016.
5. Fujiwara T, Katsuda T, Hagiwara K, Kosaka N, Yoshioka Y, Takahashi RU, Takeshita F, Kubota D, Kondo T, Ichikawa H, Yoshida A, Kobayashi E, Kawai A, Ozaki T, and Ochiya T. Clinical relevance and therapeutic significance of microRNA-133a expression profiles and functions in malignant osteosarcoma-initiating cells. Stem Cells 32: 959-973, 2014.
6. Fujiwara T, Kunisada T, Takeda K, Uotani K, Yoshida A, Ochiya T, and Ozaki T. MicroRNAs in soft tissue sarcomas: overview of the accumulating evidence and importance as novel biomarkers. Biomed Res Int 2014: 592868, 2014.
7. Kito H, Yamazaki D, Ohya S, Yamamura H, Asai K, and Imaizumi Y. Up-regulation of Kir2.1 by ER stress facilitates cell death of brain capillary endothelial cells. Biochem Biophys Res Commun 411: 293-298, 2011.
8. Liu D, Tseng M, Epstein LF, Green L, Chan B, Soriano B, Lim D, Pan O, Murawsky CM, King CT, and Moyer BD. Evaluation of recombinant monoclonal antibody SVmab1 binding to Na V1.7 target sequences and block of human Na V1.7 currents. F1000Res 5: 2764, 2016.
9. Rauer H, Lanigan MD, Pennington MW, Aiyar J, Ghanshani S, Cahalan MD, Norton RS, and Chandy KG. Structure-guided transformation of charybdotoxin yields an analog that selectively targets Ca (2+)-activated over voltage-gated K (+) channels. J Biol Chem 275: 1201-1208, 2000.
10. Shimizu T, Ishikawa T, Sugihara E, Kuninaka S, Miyamoto T, Mabuchi Y, Matsuzaki Y, Tsunoda T, Miya F, Morioka H, Nakayama R, Kobayashi E, Toyama Y, Kawai A, Ichikawa H, Hasegawa T, Okada S, Ito T, Ikeda Y, Suda T, and Saya H. c-MYC overexpression with loss of Ink4a / Arf transforms bone marrow stromal cells into osteosarcoma accompanied by loss of adipogenesis. Oncogene 29: 5687-5699, 2010.
11. Takahashi N, Nobusue H, Shimizu T, Sugihara E, Yamaguchi-Iwai S, Onishi N, Kunitomi H, Kuroda T, and Saya H. ROCK Inhibition Induces Terminal Adipocyte Differentiation and Suppresses Tumorigenesis in Chemoresistant Osteosarcoma Cells. Cancer research 79: 3088-3099, 2019.
12. Williams WA, Linley JE, Jones CA, Shibata Y, Snijder A, Button J, Hatcher JP, Huang L, Taddese B, Thornton P, Schofield DJ, Thom G, Popovic B, Dosanjh B, Wilkinson T, Hughes J, Dobson CL, Groves MA, Webster CI, Billinton A, Vaughan TJ, and Chessell I. Antibodies binding the head domain of P2X4 inhibit channel function and reverse neuropathic pain. Pain 2019.
13. Wulff H, and Castle NA. Therapeutic potential of KCa3.1 blockers: recent advances and promising trends. Expert Rev Clin Pharmacol 3: 385-396, 2010.
14. Yamazaki D, Aoyama M, Ohya S, Muraki K, Asai K, and Imaizumi Y. Novel functions of small conductance Ca ²⁺ -activated K ⁺ channel in brain endothelial cells. J Biol Chem 281: 38430-38439, 2006.

SEQ ID NOs: 23-30: Primers

Claims (12)

1. A prophylactic or therapeutic agent for bone tumors
   K _Ca 3.1 (KCNN4) A therapeutic agent containing an inhibitor that suppresses the activity of ion channels as an active ingredient.
2. The preventive or therapeutic agent according to claim 1, wherein the inhibitor is a blocker that inhibits the activity of the ion channel.
3. The preventive or therapeutic agent according to claim 1, wherein the inhibitor is an expression inhibitor that suppresses the expression of the ion channel.
4. The preventive or therapeutic agent according to claim 1, wherein the inhibitor is an antibody that binds to the ion channel.
5. The prophylactic or therapeutic agent according to any one of claims 1 to 4, wherein the bone tumor is osteosarcoma.
6. An agent for the evaluation of tumor prophylaxis or therapeutic agents,
   Voltage-gated Na ion channels that prolong the duration of action potentials associated with depolarization,
   K ion channels that deepen the resting membrane potential in the negative direction,
   K _Ca 3.1 ion channel and
   An agent comprising cells comprising.
7. The agent according to claim 6, wherein the tumor is a bone tumor.
8. An evaluation method for ion channel agonists
   The ion channel agonist is a drug for preventing or treating mesenchymal tumors such as bone tumors.
   The target ion channel is the K _Ca 3.1 ion channel,
   Evaluation step of evaluating the inhibitory activity of the target ion channel of the test compound,
   A method.
9. The method according to claim 8, wherein the evaluation step is a step of evaluating the inhibitory activity using the agent according to claim 6 or 7.
10. It is an evaluation method for ion channel agonists,
    The ion channel agonist is a drug for suppressing the differentiation of cancer stem cells into tumor cells, malignant transformation of tumor cells, and cancer metastasis.
    The target ion channel is the K _Ca 3.1 ion channel,
    A step of evaluating the inhibitory activity of the target ion channel of the test compound,
    A method.
11. A marker for examining the pathology of bone tumors
    A _{marker comprising a K Ca} 3.1 ion channel, its mRNA or a compound that binds its pre-mRNA.
12. It is a method of examining the pathological condition of bone tumors.
    _{A step of measuring K Ca} 3.1 ion channel activity in cells collected from a target site of a subject,
    A method.
    

Images