WO2005090568A2

WO2005090568A2 - Promoter chain reaction

Info

Publication number: WO2005090568A2
Application number: PCT/GB2005/001113
Authority: WO
Inventors: Stephen Dower; Eva Qwarnstrom; Endre Kiss-Toth
Original assignee: University Of Sheffield
Priority date: 2004-03-20
Filing date: 2005-03-17
Publication date: 2005-09-29
Also published as: WO2005090568A3; GB0406330D0

Abstract

We describe a method for the identification of genes that critically enhance or repress transcription from promoters that regulate typically but not exclusively, pro-inflammatory genes and including vectors used in said method.

Description

Promoter Chain Reaction

The invention relates to a method for the identification of genes that enhance or repress, either directly or indirectly, transcription from promoters that regulate typically but not exclusively, pro-inflammatory genes.

Intracellular signalling via receptor mediated activation is a fundamental process for regulating cellular and/or tissue homeostasis. Typically, ligands that interact with receptors to bring about a suitable biochemical response are known as agonists and those that prevent, or hinder, a biochemical response are known as antagonists. For example, cell specific growth factors are ligands that act as agonists and bind receptors located at the cell surface. Activation of the receptors by ligand-specific binding promotes cell proliferation via activation of intracellular signalling cascades that result in the expression of, amongst other things, cell-cycle specific genes and the activation of quiescent cells to proliferate. Growth factors may also activate cellular differentiation.

A large group of ligands, referred to as cytokines, are involved in a number of diverse cellular functions. These include modulation of the immune system, regulation of energy metabolism and control of growth and development. Cytokines that are secreted by lymphocytes are termed lymphokines (also known as interleukins). Those secreted by monocytes and macrophages are termed monokines.

The disregulation of expression of cytokines is a major contributing factor to the aetiology of inflammatory and autoimmune diseases. T -lymphocytes which respond in part to pro-inflammatory cytokines are responsible for cell mediated immune responses to intracellular pathogens, delayed hypersensitivity reactions and graft versus host organ transplantation rejection. There are vast arrays of diseases which exhibit an inflammatory component. The following list is not exhaustive. Inflammatory joint diseases including rheumatoid arthritis, osteoarthritis, polyarthritis and gout. Chronic inflammatory connective tissue diseases include lupus erythematosus, scleroderma, Sjorgen's syndrome, poly- and dermatomyositis, vasculitis, mixed connective tissue disease (MCTD), tendonitis, synovitis, bacterial endocarditis, osteomyelitis and psoriasis. Chronic inflammatory lung diseases include chronic respiratory disease, pneumonia, fibrosing alveolitis, chronic bronchitis, bronchiectasis, emphysema, silicosis and other pneumoconiosis and tuberculosis. Chronic inflammatory bowel and gastro-intestinal tract inflammatory diseases include ulcerative colitis and Crohn's disease. Chronic neural inflammatory diseases which include chronic inflammatory demyelinating polyradiculoneuropathy, chronic inflammatory demyelinating polyneuropathy, multiple sclerosis, Guillan-Barre Syndrome and myasthenia gravis. Other diseases include mastitis, laminitis, laryngitis, chronic cholecystitis, Hashimoto's thyroiditis, and inflammatory breast disease.

Moreover, chronic over expression of interleukin-1 and the tumour necrosis factors have been associated with the pathogenesis of inflammatory diseases such as rheumatoid arthritis, psoriasis and atherosclerosis. Furthermore, a large component of the innate response to bacteria and their products is mediated by receptors (TLRs), TLRs signal through a cytoplasmic domain (the toll-IL-1 receptor or TIR domain) that is homologous to that of I -1 receptors (3,4). Hence tolls and IL-ls activate similar intracellular signalling systems. Tolls have also been implicated in sterile injury responses, for example myocardial infarction (5) and in infectious diseases with long term inflammatory consequences, for example lyme disease (6).

Thus, there is an emerging consensus that TIR family receptors are primarily responsible for the immediate-early response to injury and infection, with other cytokines acting as downstream effector and amplification systems; TNFs being a major element of this effector phase. For these reasons, much attention has been focused on TLRs, ILls and TNFs, with a view to developing effective methods for treating inflammatory diseases. Thus, the natural antagonist form of IL-1 (IL-lra), soluble IL-1 and TNF receptors (e.g. Enbrel¹¹") and antibodies to TNF (e.g. Infliximab^tm) are in use the clinic or in clinical development. These agents block formation of ligand-receptor complexes at the cell surface. A novel class of potential anti-inflammatory drugs, CSAIDs (Cytokine Suppressive Anti-inflammatory Drugs) has been described (7), which inhibit inflammatory signalling pathways. In addition a major mechanism of action of the anti-inflammatory steroid dexamethasone is induction of expression of I-κBG thereby attenuating NF-κB activity (8, 9). This transcription factor has been shown to play a central role in regulation of genes activated during immune and inflammatory responses and Lps, IL-1 and T?NF are potent activators of ?NF-κB (10). Thus analysis of the mechanisms of cytokine action, in addition to providing new insights into their biology, can lead to the development of new anti-inflammatory drugs.

The identification of genes which control signal transduction is desirable since it allows the identification of new target genes to which agents may be designed which either enhance or inhibit the activity of the protein encoded by the gene. This provides the basis for drug screens to identify potentially new therapeutic agents. An example of this is described in WO02/053743.

This patent application describes a method to screen for genes that are involved in mediating inflammatory responses. The method involves the transfection of a cDNA library into a donor cell, the expression of which is under the control of a strong constitutive promoter, for example a viral promoter. The donor cell also includes a reporter construct comprising a promoter operably linked to a nucleic acid molecule encoding a reporter molecule. The promoter is one that controls the expression of a pro-inflammatory cytokine, for example IL-1 or IL-8. The detection of expression of the reporter in a cell transfected with the cDNA library suggests that the cDNA library includes a sequence that encodes a protein that is able to modulate the activity of the promoter, either directly or indirectly. The method was successfully used to isolate genes that encode proteins that are part of the "Tribbles" signal transduction pathway. In the present invention cDNAs are incorporated into the reporter itself. We have discovered that steps incorporating positive feedback loops leading to hypersensitivity are critical to the functioning of signal transduction networks and that such steps are most readily detected by methods that incorporate an externally imposed positive feedback loop. We describe the development and exploitation of such a technique that we call the "promoter chain reaction".

The notion of the importance of hypersensitivity in biological control systems is not new, it was first suggested by Wyman (Reviewed by Bray 24) who showed in principle that a feedback "circuit" composed of two allosteric enzymes (Hill coefficent >1) is bistable. In general feedback loops that operate on any element with a sigmoid input-output response curve will lead to hypersensitivity and at the limit therefore to binary/switch like behaviour. Bray and collaborators have provided experimental examples of such hypersensitivity, drawn from bacterial chemotaxis (25). A recent example from eukaryotic signalling systems is found in the high in vivo Hill coefficient of MAP kinase cascades, its source being a feedback loop (26). Furthermore, the central cell cycle control engine incorporates a feedback loop involving wee-1 that controls the hypersensitive cyclin degradation step which triggers exit from mitosis (27). We have therefore developed a refined version of the transcription expression cloning technique disclosed in WO02/053743 in which an external positive feedback loop is imposed on the endogenous signal transduction network, hence skewing detection towards intrinsically hypersensitive steps.

According to an aspect of the invention there is provided a screening method to identify genes that encode polypeptides that modulate the activity of a nucleic acid molecule comprising a nucleic acid sequence wherein said sequence is a promoter, comprising the steps of: i) providing a preparation comprising a cell transfected with a vector wherein said vector includes an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter; and ii) detecting the presence of said detectable reporter molecule.

"Promoter" is an art recognised term and, for the sake of clarity, includes the following features which are provided by example only. Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors that have been shown to bind specifically to enhancer elements. The binding/activity of transcription factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of physiological/environmental cues that include, by example and not by way of limitation, intermediary metabolites, environmental effectors. Promoter elements also include so called TATA box and RNA polymerase initiation selection sequences that function to select a site of transcription initiation. These sequences also bind polypeptides that function, inter alia, to facilitate transcription initiation selection by RNA polymerase.

In a preferred method of the invention said heterologous polypeptide is an agonist.

In an alternative preferred method of the invention said heterologous polypeptide is an antagonist.

In a preferred method of the invention said promoter is a promoter that regulates the expression of at least one gene that controls cell division.

In a further preferred method of the invention said promoter is a promoter that regulates the expression of at least one gene that controls cell differentiation. In an alternative preferred embodiment of the invention said promoter is a promoter that regulates the expression of at least one gene that controls cell apoptosis.

In a further preferred method of the invention said promoter is a promoter that regulates the expression of at least one cytokine gene.

Preferably said cytokine is selected from the group consisting of: IL-lα, ILlβ, ELlra, IL-2 through IL-30, TNFSF1A, TNFSF1B, TNFSF2 through TNFSF22, GMCSF, GCSF, erythropoetin, LIF, oncostatin M, CNTF, TGFα, TGFβ, EGF, PDGF, Interferon-α , Interferon-β, Interferon-γ, CCL-1 through 28, CXCL-1 through 15, IL- 1F1 through IL-1F10.

More preferably, said cytokine is a pro-inflammatory cytokine. Preferably said pro- inflammatory cytokine is selected from the group consisting of: IL-lα, ILlβ, ILlra, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL11, IL12, IL13, IL15, IL17, TNFSFIA(TNF) , TNFSFlB(Lymphotoxin-α) TNFSF2 (Lymphotoxin-β), TNFSF3 through 22, CCL-1 through 28, CXCL-1 through 15, IL-1F1 through IL-1F10.

In a preferred method of the invention said pro-inflammatory cytokine is IL-8.

In a further preferred method of the invention said pro-inflammatory cytokine is IL8 and said vector comprises an IL8 promoter comprising a nucleic acid sequence as shown in Figure 5, or a variant sequence wherein said sequence has been modified by addition, deletion or substitution of at least one nucleotide base and which variant substantially retains the transcriptional activity of the promoter sequence shown in Figure 5 or has enhanced activity when compared to the unmodified promoter sequence.

In a preferred method of the invention said vector is a eukaryotic expression vector adapted for expression in a mammalian cell. Adaptations include the provision of selectable markers and autonomous replication sequences that facilitate the maintenance of said vector in either the eukaryotic cell or prokaryotic host. Vectors that are maintained autonomously are referred to as episomal vectors. Episomal vectors are desirable since these molecules can incorporate large DNA fragments (30-50kb DNA). Episomal vectors of this type are described in WO98/07876.

Adaptations which facilitate the expression of vector encoded genes include the provision of transcription termination/polyadenylation sequences. This also includes the provision of internal ribosome entry sites (IRES) that function to maximise expression of vector encoded genes arranged in bi-cistronic or multi-cistronic expression cassettes. These adaptations are well known in the art. There is a significant amount of published literature with respect to expression vector construction and recombinant DNA techniques in general. Please see, Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory, Cold Spring Harbour, NY and references therein; Marston, F (1987) DNA Cloning Techniques: A Practical Approach Nol HI IRL Press, Oxford UK; DΝA Cloning: F M Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

In a preferred method of the invention said mammalian cell is a human cell.

In a further preferred method of the invention said human cell is an immune cell.

In an alternative preferred method of the invention said cell is a HeLa cell.

The transfection of cells is an established technique known to those skilled in the art. Many methods have been developed over the last 30 years to facilitate the introduction of DNA into cells that have greatly assisted, inter alia, our understanding of the control of gene expression.

Conventional methods to introduce DNA into cells are well known in the art and typically involve the use of chemical reagents, cationic lipids or physical methods. Chemical methods which facilitate the uptake of DNA by cells include the use of DEAE -Dextran (Vaheri and Pagano Science 175: p434). DEAE-dextran is a negatively charged cation which associates and introduces the DNA into cells but which can result in loss of cell viability. Calcium phosphate is also a commonly used chemical agent which when co-precipitated with DNA introduces the DNA into cells (Graham et al Virology (1973) 52: p456).

The use of cationic lipids (e.g. liposomes ( Feigner (1987) Proc.Natl.Acad.Sci USA, 84:p7413) has become a common method since it does not have the degree of toxicity shown by the above described chemical methods. The cationic head of the lipid associates with the negatively charged nucleic acid backbone of the DNA to be introduced. The lipid/DNA complex associates with the cell membrane and fuses with the cell to introduce the associated DNA into the cell. Liposome mediated DNA transfer has several advantages over existing methods. For example, cells that are recalcitrant to traditional chemical methods are more easily transfected using liposome mediated transfer.

More recently still, physical methods to introduce DNA have become effective means to reproducibly transfect cells. Direct microinjection is one such method that can deliver DNA directly to the nucleus of a cell (Capecchi (1980) Cell, 22:p479). This allows the analysis of single cell transfectants. So called "biolistic" methods physically shoot DNA into cells and/or organelles using a particle gun (Neumann (1982) EMBO J, l: p841).

Elecfroporation is arguably the most popular method to transfect DNA. The method involves the use of a high voltage electrical charge to momentarily permeabilise cell membranes making them permeable to macromolecular complexes. However physical methods to introduce DNA do result in considerable loss of cell viability due to intracellular damage. These methods therefore require extensive optimisation and also require expensive equipment.

More recently still a method termed immunoporation has become a recognised techinque for the introduction of nucleic acid into cells. The technique involves the use of beads coated with an antibody to a specific receptor. The transfection mixture includes nucleic acid, typically vector DNA, antibody coated beads and cells expressing a specific cell surface receptor. The coated beads bind the cell surface receptor and when a shear force is applied to the cells the beads are stripped from the cell surface. During bead removal a transient hole is created through which nucleic acid and/or other biological molecules can enter. Transfection efficiency of between 40-50% is achievable depending on the nucleic acid used.

It is apparent that there are many methods available that facilitate the transfection of nucleic acid into a cell; even cells that are difficult to transfect.

In a further preferred method of the invention said reporter molecule is a polypeptide. "Reporter molecule" is a nucleic acid that encodes a polypeptide that facilitates the detection of expression from the vector. For example green fluorescent protein (GFP). Fluorescent proteins can be used to measure promoter activity in a cell without the need for lysing the cell. Fluorescence emission spectrum shifted derivatives of GFP may include blue fluorescent protein (BFP) and yellow fluorescent protein (YFP). Other derivatives include enhanced cyan yellow protein (ECYP), EYFP, EGFP. An advantage of using GFP or derivatives thereof is that two or more reporter proteins expressed in the same cell can be assayed using the same assay technique e.g. assaying for a particular fluorescence emission. Alternatively, the detectable marker is an enzyme, for example, glucuronidase, luciferase. Other reporter proteins may include lac Z, and CAT. In a preferred method of the invention said reporter molecule is luciferase.

According to a further aspect of the invention there is provided a screening method for the isolation of a gene(s) comprising the steps of: i) providing a culture of cells transfected/transformed with a vector cDNA library wherein said vector includes an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter and a nucleic acid molecule which encodes a selectable marker; ii) growing said culture in the presence of an agent which selects for cells which contain said vector; iii) selecting cloned transfected/transformed cells; iv) extracting from said cloned cells vector DNA; v) transfecting said vector DNA into a mammalian cell; and vi) detecting the presence of said detectable reporter molecule.

In a preferred embodiment of the invention said cell culture is a bacterial or yeast cell culture.

In a further preferred method of the invention said preparation or population of cells is exposed to at least one pro-inflammatory agent.

In a preferred method of the invention said agent is: lipopolysaccharide, IL-lα, ILlβ, TNF, lymphotoxin, and interferon-γ.

A number of methods are known that image fluorescent cells and extract information concerning the spatial and temporal changes occuring in cells expressing fluorescent proteins, (see Taylor et al Am. Scientist 80: 322-335, 1992), which is incorporated by reference. Moreover, US5989835 and US09/031,271, both of which are incorporated by reference, disclose optical systems for determining the distribution or activity of fluorescent reporter molecules in cells for screening large numbers of agents for biological activity. The systems disclosed in the above patents also describe a computerised method for processing, storing and displaying the data generated.

According to a further aspect of the invention there is provided at least one gene obtained by the method according to the invention.

According to a further aspect of the invention there is provided a vector comprising a an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter.

In a preferred embodiment of the invention said inducible promoter is a cytokine promoter.

In a preferred embodiment of the invention said cytokine promoter is the IL-8 promoter.

In a preferred embodiment of the invention said IL-8 promoter comprises a nucleic acid sequence as shown in Figure 5, or a variant sequence wherein said sequence has been modified by addition, deletion or substitution of at least one nucleotide base and which variant substantially retains the transcriptional activity of the promoter sequence shown in Figure 5 or has enhanced activity when compared to the unmodified promoter sequence.

An embodiment of the invention will now be described by example only and with reference to the following figures: Fig. 1. Effect of co-transfection of ILl/TNF signal pathway components on the activity of a pE 8-d2EGFP reporter. HeLa cells cultured in 96 well plates were transfected with a pIL8-d2EGFP reporter and the indicated doses of the plasmid constructs, at a constant dose of DNA of lOOOng maintained with empty vector. At 24 h lOx EGFP confocal fluorescent images were collected from three fields per well (ca 500 cell per field) and image analysed to extract area and average fluorescence per pixel for each cell (particle). Each point on the plots represents a single cell. The plots show the cells in all three fields for each condition. The shape difference in the plots is a consequence of apoptosis - thus for example most FADD transfected cells in which the reporter is activated are small and bright, whereas most relA transfected cells are large and dim. This was confirmed by annexin V staining. After K ss-Toth et al (2000), J. Immunol. Meth. 239, 125;

Figure 2 Detection of inhibitors and activators in cDNA library pools. HeLa cells were transfected with cDNA pools and the indicated luc reporters. Each point is the data from an individual well (pool) in the dual assay (x- firefly luc activity, y- renilla luc activity), 30 pools are shown in each panel. Pools with decreased (A) and increased (B) IL-8 promoter activity relative to TK promoter activity were detected. Pool breakdown and insert sequencing identified the clones responsible for the activity. (Kiss -Toth, Qwamstrom and Dower, unpublished data);

Figure 3. Single cell analysis of the anti-apoptotic function of EGFP-RELA. Fibroblasts were transfected with EGFP, or EGFP-RelA and treated with TNFD (10 ng/ml) plus cycloheximide (10 μg/ml). The number of viable cells in each field was counted at time zero and the same fields were examined at 12 hours. Data are plotted as a function of initial nuclear fluorescence; non-apoptotic cells remaining as a percent of cell number at time zero were determined. After Carlo tti et al (1999) J. Biol Chem 274 , 37941; Figure 4. Vector family: indicating parent -daughter relationships in the derivation - starting from pIRES-CMV_pIL8 is as described in Kiss -Toth et al 2000, but also contains an additional sequence , the 5' enhancer from the bovine leukaemia virus LTR which increases transcription of reporters in Hela cells 10-20 fold without altering fold inducibility. (Kiss-Toth et al , unpublished). The luciferase cDNA used in all vectors is firefly;

Figure 5 is the nucleic acid sequence of the IL-8 promoter;

Table 1: Testing the promoter chain reaction principle. Vector dose responses are done as in Figure 1 (21). Measurements are taken at 12, 24, 48 and 72 and 96 hours, to assess whether the exogenous and autoinduction kinetics differ, i.e. comparing 3 with 6 and 4 with 7;

Table 2: Optimisation of the bicistronic reporter system by comparison with the basic transcription expression method and the fusion protein autoinduction system MCSA and MCSB are the promoter proximal and distal cloning sites in the IRES vectors. Vector doses and times will be based on those estimated from the experiment(s) in table 1 ; and

Table 3: Vector /Inducer combinations used to optimise the luciferase version of the promoter chain reaction.

Materials and Methods

Reporters and expression plasmids

A portion of the 5' noncoding region of the human IL8 gene (accession no.: M28130) including part of the first exon was cloned by PCR amplification. The PCR primers were: 5' GAAGATCTAACTTTCGTCATACTCCG3' (sense primer, from 1308 to 1325 of the EL8 gene genomic sequence) and 5' CCGGTACCCTTCACACAGAGCTCGAG 3' (antisense, from 1647 to 1629). Underlined residues indicate engineered sites. A 220-bp Bgin-HindlH fragment containing the 5' noncoding region and the transcription start site was subcloned into pEGFPl and pd2EGFPl vectors (Clontech, Pao Alto, USA), yielding plasmids pIL8/ EGFP1 and pIL8/ d2EGFPl, respectively. . -174 to +45 region of the human E 8 gene promoter was amplified by genomic PCR and subcloned into the firefly- luciferase vector pGL3-Basic (Promega) ) as a Hind m - Bgl II fragment, creating pIL-8 luc. IRAKI, IRAK2, MyD 88 (kind gifts of Dr F Volpe Glaxo-Wellcome), TRAF6 (a kind gift from Dr D. Goeddell, Tularik), NIK (a kind gift of Dr A Kaptein, Glaxo-Wellcome), IkBα (a kind gift of Professor R. Hay, St. Andrews University), RelA (obtained from ?NIH Aids Reagent Program) and FADD (a kind gift of Professor MK Whyte) expression vectors all contained CMV promoters. For testing the assay under working conditions, pools of a previously described (Hamann et al., 1993), human activated PBMC cDNA library were used (a kind gift of Dr J. Hamann, CLB, the Netherlands).

Transfection procedures and luciferase assays

For GFP assays HeLa cells (ECACC, 85060701) (1.5xl0⁴ per well) were seeded into 96-well tissue culture plates 24 h prior to transfection. Transfections were performed using SuperFect (Qiagen, Crawley, UK); a total amount of 1000 ng of DNA was used, consisting of 500 ng of reporter construct, the stated amount of the expression vector under investigation, and the appropriate amount of empty pcDNA3.1 to keep the DNA concentration constant. DNA was diluted in a total of 30 μl of serum free DMEM, 2.5 μl of SuperFect were added and the sample was vigorously mixed. The mixture was incubated for 7-10 min at room temperature, supplemented with 150 μl of DMEM containing 10% FBS and added to the cells. Cultures were incubated at

37°C for 3 hr and the medium was replaced by 150 μl of DMEM containing 10%

FBS. Twenty-four hours after transfection, three confocal images were taken from each well(see below).

For Luciferase assays HeLa cells (1.5x 10⁴ per well) were seeded into 96-well tissue culture plates 24h prior to transfection. Transfections were performed using SuperFect according to the manufacturer's advice; each well received 500ng of inducible reporter construct (pIL-8 luciferase), lOOng of pTK-?RLuc (Promega) for normalization of transfection efficiency, and 400 ng of expression vector. Sufficient pCDNA3.1 (Invitrogen) ("empty vector") was added to keep the total DNA dose constant. 2 hrs after transfection, cells were washed and 100 μl of fresh medium added. Triplicate wells were transfected for each treatment: 36 hours following transfection, reporter levels were measured using the Dual-Luciferase system (Promega) as recommended by the manufacturer.

Data acquisition and analysis for GFP detection

Using a Molecular Dynamics CLSM 2010 coupled to a Nikon Diaphot microscope and interfaced with a Silicon Graphics workstation, confocal micrographs were taken of the transfected cells. Excitation was with the 488-nm line of the Kr/Ar laser running at 10 or 15 mW, attenuated to 10% with a neutral density filter. Emitted green fluorescence was collected with a xlO air lens, passed through a 530-nm bandpass (+15 nm) filter, amplified with a photomultiplier at 700-750 V, and digitised to 8 bits (256 gray levels). The digital images obtained are from a sample section composed of 1024x1024 voxels of dimensions 1.3(X), 1.3(Y), 5.3(Z) μm. The signal per voxel from this configuration is directly proportional to the concentration of GFP (data not shown). Digital images were transferred to a Power Macintosh by ftp. Analysis was done with software written in Microsoft Foxpro, Excel, and in the ?NIH Image macro language. To examine individual cells, the Analyse Particles algorithm of ?NIH Image vl.62 was used. A particle was defined as >50 pixels in area. The threshold used varied between experiments, within the range 4-8. The algorithm returns the mean pixel intensity of the particle (B), which represents the brightness of the cell, the particle area (A), and a parameter related to cell shape (S). For further analysis of data after conversion to numerical values, MLAB (Civilised Software, Silver Spring, MD, USA) was used to program models and perform non-linear least-squares fitting. To discriminate between transfected and untransfected wells, the observed particle numbers (n), and the means ( m) and standard deviations ( s) of the three properties A, B, and S of the particles in each well were calculated. These seven properties are all approximately normally distributed. Using a linear discriminant function, variables were selected in a stepwise manner to minimize Wilks' λ (Wilks, 1932). Wilk's λ is computed from the eigenvalues of the covariance matrix and tests which variable serves to best discriminate two multivariate data sets.

cDNA Synthesis and Library construction

poly A+ RNA was prepared from PHA+PMA stimulated human peripheral blood mononuclear cells using the Fastrack 2 kit (Invitrogen) according to the manufacturers instructions. Subsequently double stranded cDNA was prepared using random primers (Invitrogen), using the Superscript kit (Invitrogen) according to the manufacturers instructions. The cDNA was size selected (>2 Kb) linker adapted or blunt ended and cloned into a mammalian expression vector, e.g. pCDNA3.1 or pCDM8. For gridded library construction E Coli were transformed and then plated on selection Q-trays for picking in a Megapix.

EXAMPLE 1

Validation of the promoter chain reaction using EGFP reporters. A set of 12 vectors based on pIRES-CMV, which contains an insert with two multiple cloning sites flanking the ECMV internal ribosome entry site (Figure 4) is used. In the parent, vector expression is driven by the CMV promoter. Each of the pCMV vectors is the positive control for its pIL8 counterpart. The host cell line/inducible promoter combination will be HeLa/ pIL-8. (Fig, 1, 21 ,23). We have shown that N- EGFPRelA-C and N-EGFPTRAF6-C fusions have wild type activity in transcription reporter assays, as in figure 2. The basic system is optimised using semi-quantitative confocal microscopy (Figure 1 and 21). The experiment is outlined in Table 1.

Subsequently we will test the bicistronic vectors as in table 2. We have presented the bicistronic design in a "reporter last" configuration as the second O?RF is less efficiently translated than the first (as we have found experimentally with a hTLTRl/EGFP IRES vector , Kiss-Toth and Wyllie , unpublished) and our current system gives >100 fold signal to noise with either pIL8-EGFP +pCMV-relA or pILδluc +pCMV-relA (Figure 1) These experiments will allow us to optimise the promoter chain reaction system by bench marking it against our current validated methodology.

EXAMPLE 2

Validation of the luciferase system and library screening. As we have done for the basic transcription expression cloning method we will develop a dual luciferase system (firefly, renilla) for the purpose of prospectively screening for signal pathway components regulating pEL8 in HeLa cells (figure 2). The pIRES-luc series (Figure 4) is used as the basis of a prospective expression cloning system analogous to the transcription reporter method currently in use by us and others (21,22, 23). We will optimise using the experimental design shown in table 3: time points are taken from those estimated to be optimal from Aim I. In 6-17. The pTK renluc is used as the internal positive control since, as figure 2 shows, the internal renilla luc control serves only to correct for transfection efficiency.

In the transfections , pTK renilla luciferase will be included as an internal transfection control (see figure 2 ).

For library construction, random 6-mer primed cDNAs are used. This will decrease the average insert size by eliminating 3 'UTR sequences from many inserts. The possibility of read through is eliminated by having stop codons in all 3 reading frames immediately 3' of MCSA in the vector pIRES-IL8-luc, into which the library is cloned. Therefore as long as first strand synthesis is primed near the end of the ORF or 3' of the stop codon and RT runs past translation start, the insert in MCSA will produce protein, even if truncated. The library will also not be directional, since in our current screen we have detected several activating clones which are AS, and encode repressors such as IDBOIn producing the library (PHA activated PBMC) we will aim for 3xl0⁶ independent transformants with an average insert size of > 2.5 KB, as based on our current experience this is well within the range where large numbers of positive clones are found.

The methods described here can be used as a genome wide promoter trap, by using e.g. EGFPRELA and cloning a library of genomic fragments into the promoter site instead of pCMV or plL8. In addition transcriptional inhibitors can be detected by performing screens in the presence of for example InM IL-1, or any other agonist to which the host cell is responsive. Thus these functional cloning methods can form the basis of a general mapping strategy for signalling networks, assayed by their impact on the transcription of a genome such as that of H. Sapiens.

REFERENCES

1. Dower, S.K. (2000), Cytokines, virokines and the evolution of immunity , Nature Immunol., 5, 367-368 2. Poltorak A, et al 1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085-2088. 3. Mitcham JL; Parnet P; Bonnert TP; Garka KE; Gerhart MJ; Slack JL; Gayle MA; Dower SK & Sims JE (1996). T1/ST2 Signalling establishes it as a Member of an Expanding Interleukin-1 Receptor Family. J. Biol .Chem. 271: 5777-5783. 4. Slack JL; Schooley K; Bonnert TP; Mitcham JL; Qwarnstrom EE; Sims JE & Dower SK (2000). Site Directed Mutagenesis of Regions in the IL-1RI Cytoplasmic Domain Conserved Between Members of the IL-1RI Family Identifies Novel Sites Critical for Signal Transduction. J. Biol .Chem. 275, 4670-4678. 5. Frantz.S., Kobzik,L., Kim,Y-D., Fukazawa,R., Medzhitov,R., Richard T. Lee,R.T., and Kelly R.A. (1999). Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium. J. Clin. Invest. 104:271-280 6. Alexopolou, L., et al (2002) Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice. Nature Immunol. 8:878-84.

7. Lee, J.C et al (1994). A Protein-Kinase Involved In the Regulation Of Inflammatory Cytokine Biosynthesis. Nature. 372:739-746.

8. Auphan, N., J. A. Didonato, C. Rosette, A. Helmberg, & M. Karin.(1995) - munosuppression By Glucocorticoids - Inhibition Of ?NF-Kappa-B Activity Through Induction Of I-Kappa-B Synthesis. Science 270: 286-290.

9. Scheinman, R. I., P. C. Cogswell, A. K. Lofquist, and A. S. Baldwin. (1995) Role Of Transcriptional Activation Of I-Kappa-B- Alpha In Mediation Of -mmunosuppression By Glucocorticoids. Science 270: 283-286.

10. Beg, A. A., T. S. Finco, P. V. Nantermet, & A. J. Baldwin(1993). Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for ?NF-kappa B activation. Mol Cell Biol 13: 3301-10. 11. Okayama, H., & P. Berg. A (1983) cDNA cloning vector that permits expression of cDNA inserts in mammalian cells. Mol Cell Biol 3: 280-289.

12. Lee, F., et al .( 1986) Isolation and Characterization Of a Mouse Interleukin cDNA Clone That Expresses B-Cell Stimulatory Factor-I Activities and T-Cell- Stimulating and Mast-Cell-Stimulating Activities. Proc. Natl. Acad. Sci. USA 83: 2061-2065.

13. Yang, Y.-C, et al .(1986) Human IL-3 (multi-CSF): identification by expression cloning of a novel hematopoietic growth factor related to murine IL-3. Cell 47: 3-10.

14. Aruffo, A.,& B. Seed. Molecular cloning of a CD28 cDNA by a high-efficiency COS cell expression system.(1987) Proc Natl Acad Sci 84: 8573-8577.

15. Sims, J. E., et al (1988) cDNA expression cloning of the IL-1 receptor, a member of the Immunoglobulin Superfamily. Science 241: 585-589.

16. Stark, G.R. & Gudkov, AN. (1999) Forward genetics in mammalian cells: functional approaches to gene discovery. Human Molecular Genetics, 8: 1925-1938. 17. Stark, G. R., I. M. Kerr, B. R. G. Williams, R. H. Silverman, & Schreiber. R. D. (1998) How cells respond to interferons. Annual Review of Biochemistry 67:227- 264.

18. Muzio, M., J. Ni, P. Feng, & V. M. Dixit. (1997). IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278:1612- 1615.

19. Deng, T. L., & Karin. M. (1994) C-Fos Transcriptional Activity Stimulated By H-Ras- Activated Protein- Kinase Distinct From J k and Erk. Nature 371:171-175.

20. Tojima, Y., et al (2000) NAK is an I-kB kinase-activating kinase. Nature 404:778-782.

21. Kiss-Toth E; Guesdon FMJ; Wyllie D; Qwarnstrom EE & Dower SK (2000). Detection, Cloning and Pathway Assignment of Signal Transduction Components with a High Sensitivity Single Cell Transcription Detection Assay. J. Immunol. Meth. 239, 125-135. 22. Chanda SK, et al (2003). Genome-scale functional profiling of the mammalian AP-1 signaling pathway. Proc Natl Acad Sci U S A. 100:12153-12158. 23. Iourgenko V, Z et al (2003) Identification of a family of cAMP response element-binding protein coactivators by genome-scale functional analysis in mammalian cells. Proc Natl Acad Sci U S A. 100: 12147-12152. 24. Bray, D. (1995). Protein Molecules As Computational Elements In Living Cells. Nature. 376:307-312.

25. Duke, T.A.J., and D. Bray. (1999.) Heightened sensitivity of a lattice of membrane receptors. Proc Natl Acad Sci U S A. 96 : 10104- 10108.

26. Ferrell, J.E., and E.M. Machleder. (1998). The biochemical basis of an all-or- none cell fate switch in Xenopus oocytes. Science. 280: 895-898.

27. Sveiczer, A., Csikasz-Nagy,A., Gyorffy, B., Tyson, J.J. , & Novak, B.(2002) Modeling the fission yeast cell cycle: Quantized cycle times in wee-l(-)- cdc25D mutant cells. Proc Natl Acad Sci U S A. 97: 7865-7870.

28. Dower, S.K., S.M. Call, S. Gillis, and D.L. Urdal. 1986. Similarity between the interleukin-1 receptors on a murine T-lymphoma cell line and on a murine fibroblast cell line. Proc Natl Acad. Sci USA 83: 1060-1065.

Claims

1. A screening method to identify genes that encode polypeptides that modulate the activity of a nucleic acid molecule comprising a nucleic acid sequence wherein said sequence is a promoter, comprising the steps of: i) providing a preparation comprising a cell transfected with a vector wherein said vector includes an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter; and ii) detecting the presence of said detectable reporter molecule.

2. A method according to Claim 1 wherein said heterologous polypeptide is an agonist.

3. A method according to Claim 1 wherein said heterologous polypeptide is an antagonist.

4. A method according to any of Claims 1-3 wherein said promoter is a promoter that regulates the expression of at least one gene that controls cell division.

5. A method according to any of Claims 1-4 wherein said promoter is a promoter that regulates the expression of at least one gene that controls cell differentiation.

6. A method according to any of Claims 1-4 wherein said promoter is a promoter that regulates the expression of at least one gene that controls cell apoptosis.

7. A method according to any of Claims 1-6 wherein said promoter is a promoter that regulates the expression of at least one cytokine gene.

8. A method according to Claim 7 wherein said cytokine is selected from the group consisting of: IL-lα, ILlβ, ILlra, IL-2 through IL-30, TNFSF1A, TNFSF1B, TNFSF2 through TNFSF22, GMCSF, GCSF, erythropoetin, LIF, oncostatin M, CNTF, TGFa, TGFb, EGF, PDGF, Interferon-α , Interferon-β, friterferon-γ, CCL-1 through 28, CXCL-1 through 15, IL-1F1 through IL-1F10.

9. A method according to Claim 7 wherein said cytokine is a pro-inflammatory cytokine.

10. A method according to Claim 9 wherein said pro-inflammatory cytokine is selected from the group consisting of: IL-lα, ILlβ, ILlra, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL11, IL12, IL13, IL15, IL17, TNFSFIA(TNF) , TNFSFlB(Lymphotoxin- α) TNFSF2 (Lymphotoxin-β), TNFSF3 through 22, CCL-1 through 28, CXCL-1 through 15, IL-1F1 through IL-1 F10.

11. A method according to Claim 10 wherein said pro-inflammatory cytokine is IL 8.

12. A method according to Claim 11 wherein said pro-inflammatory cytokine is IL8 and said vector comprises an IL8 promoter comprising a nucleic acid sequence as shown in Figure 5, or a variant sequence wherein said sequence has been modified by addition, deletion or substitution of at least one nucleotide base and which variant substantially retains the transcriptional activity of the promoter sequence shown in Figure 5, or has enhanced activity when compared to the unmodified promoter sequence.

13. A method according to any of Claims 1-13 wherein said vector is a eukaryotic expression vector adapted for expression in a mammalian cell.

14. A method according to Claim 13 wherein said mammalian cell is a human cell.

15. A method according to Claim 14 wherein said human cell is an immune cell.

16. A method according to Claim 13 wherein said cell is a HeLa cell.

17. A method according to any of Claims 1-16 wherein said reporter molecule is a polypeptide.

18. A method according to Claim 17 wherein said reporter molecule is luciferase.

19. A screening method for the isolation of a gene(s) comprising the steps of: i) providing a culture of cells transfected/transformed with a vector cDNA library wherein said vector includes an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter and a nucleic acid molecule which encodes a selectable marker; ii) growing said culture in the presence of an agent which selects for cells which contain said vector; iii) selecting cloned transfected/transformed cells; iv) extracting from said cloned cells vector DNA; v) transfecting said vector DNA into a mammalian cell; and vi) detecting the presence of said detectable reporter molecule.

20. A method according to Claim 19 wherein said cell culture is a bacterial or yeast cell culture.

21. A method according to any of Claims 1-20 wherein said preparation cells or mammalian cell is exposed to at least one pro-inflammatory agent.

22. A method according to Claim 21 wherein invention said agent is selected from the group consisting of: lipopolysaccharide, IL-lα, IL-lβ, TNF, lymphotoxin, and interferon-γ.

23. A gene obtained by the method according to any of Claims 19-22.

24. A vector comprising an inducible promoter operably linked to a first nucleic acid molecule which encodes a detectable reporter molecule and a second nucleic acid molecule which encodes at least one heterologous polypeptide wherein said polypeptide is a polypeptide that modulates, either directly or indirectly, the transcriptional activity of said inducible promoter.

25. A vector according to Claim 24 wherein said inducible promoter is a cytokine promoter.

26. A vector according to Claim 25 wherein said cytokine promoter is the IL-8 promoter.

27. A vector according to Claim 26 wherein said IL-8 promoter comprises a nucleic acid sequence as shown in Figure 5, or a variant sequence wherein said sequence has been modified by addition, deletion or substitution of at least one nucleotide base and which variant substantially retains the transcriptional activity of the promoter sequence shown in Figure 5 or has enhanced activity when compared to the unmodified promoter sequence.