WO2005084711A1

WO2005084711A1 - A pegylated recombinant erythropoietin that has in vivo activity

Info

Publication number: WO2005084711A1
Application number: PCT/CN2005/000254
Authority: WO
Inventors: Yonghong Ge; Zhiyong Chen; Xianwu Zeng; Lanjun Liu
Original assignee: Chengdu Institute Of Biological Products
Priority date: 2004-03-02
Filing date: 2005-03-02
Publication date: 2005-09-15

Abstract

The invention involves a kind of PEG conjugates of erythropoietin (PEG-EPOP). The recombinant erythropoietin, which has no in vivo activity so as not to be used as the medicament to treat anemia, is chemically modified with polyethylene glycol (PEG) to form the product having in vivo erythropoietic activity. In particular, the invention discloses that prokaryotic expression system expresses EPOP and produces PEG-EPOP with low cost to produce the medicament for treating anemia disease and stimulating red blood cells.

Description

Recombinant erythropoietin with physiological activity in vivo modified by polyethylene glycol

The present invention relates to a recombinant erythropoietin protein having no physiological activity in vivo by polyethylene glycol

(EPOP) Modification, and a physiology-active conjugate (PEG-EPOP) having an erythropoiesis-producing action was obtained. Background technique

Human Erythropoietin (hEPO) is a glycoprotein hormone synthesized and secreted mainly by the kidney. EPO is produced in the liver during embryonic period and is produced by the kidney 4 months after birth. Its physiological role is to stimulate the differentiation and proliferation of bone marrow erythrocyte precursor cells, play an important role in the process of red blood cell development and maturation, and is an endogenous regulator of red blood cell growth.

In the early years, more hEPO was obtained from the urinary and fetal kidney cell cultures of patients with aplastic anemia, but it did not meet the clinical needs. In 1985, the use of genetic recombination technology to obtain recombinant human EPO (rhEPO) began the history of industrial production of EPO, making it possible to widely use EPO in clinical practice. In June 1989, the rhEPO produced by Amgen in the United States was officially registered with the US FDA under the trade name "EPOGEN® EPOETIN ALFA" for the treatment of chronic renal failure (CRF) with anemia, which was a great success. At present, many companies in the world have developed and produced rhEPO. The results of clinical application for more than ten years show that ΛΕΡΟ has remarkable curative effect and small side effects. It is a special treatment for various types of anemia, and it is also the most successful genetic engineering treatment. As people's research on EPO is deepening, their clinical indications will be further expanded. Currently applicable to: (1) Treatment of chronic renal failure with anemia: One of the main causes of such anemia is the lack of EPO production, and EP0 can be described as an alternative treatment method. The curative effect is over 95%, the hemoglobin content (Hb) and hematocrit (Hct) are increased, the anemia is improved, the bleeding time is shortened, the quality of life is improved, the number of blood transfusions is reduced, and the patient who is performing kidney transplantation is also beneficial; (2) AIDS patients with anemia, especially patients treated with AZT are often associated with anemia, EPO treatment is effective; (3) cancer patients with anemia caused by chemotherapy, especially with cisplatin often with obvious anemia, EPO treatment is effective; (4) Chronic anemia, such as rheumatoid arthritis, cancer patients, when accompanied by anemia and need to transfusion to maintain treatment, EPO can reduce the number of blood transfusions in some patients; (5) anemia of hematopoietic stem cell diseases, such as myelodysplastic syndrome ( MDS;), patients with aplastic anemia, etc., if it is difficult to maintain blood transfusion, try EPO, about 25%~30% of patients can improve anemia and reduce the number of blood transfusions; (6) Autologous blood supply infusion: The American Association of Blood Banks stipulates that patients undergoing elective surgery, such as orthopedic surgeons, should be stored from blood for infusion during surgery. EPO was started 3 weeks before the operation. When the increase in Hb was obvious, 400 ml of blood was collected and collected for 3 times to meet the needs of the patient. Use EPO to improve the quality of blood storage and reduce the amount of blood storage; (7) Prevention and treatment of anemia in premature infants: 50~100IU / kg, 3 times a week, starting after birth, for 4 weeks. It can be expected that EPO will be the first line of anemia treatment for a long period of time.

In the treatment of sputum protein drugs, their bioavailability is often reduced due to their shorter plasma half-life, which is particularly evident in hormone proteins such as EPO. The body regulates the secretion of EPO through the oxygen partial pressure receptor on the kidney cells, and rapidly releases the EPO released into the plasma through the rapid inactivation of the hepatocytes, thereby establishing a sensitive regulation mechanism for maintaining a relatively constant hematocrit: both in the anemia The release of red blood cells can prevent the excessive release of red blood cells and cause adverse effects such as excessive blood viscosity. In the treatment of anemia diseases with rhEPO, this mechanism greatly reduces the bioavailability of rhEPO, resulting in an increase in the amount of the drug, and the increase in the cost of treatment due to the expensive price of rhEPO; and due to the limitation of the number of EP0 receptors, The mechanism also limits the ability to increase the dose of the drug to achieve higher therapeutic effects.

1

Confirmation In the treatment of the majority, it is necessary to use a three-week treatment plan in the majority of cases, and only in the maintenance treatment after the anemia symptom is corrected, the dosage and the frequency of administration can be reduced to 2 doses per week or 1 dose per week.

The EPO molecule is a sialic acid-containing acidic glycoprotein that is stable to heat (invariance at 80 ° C) and acid-base (stable range between pH 3.5 and 10.0). Two pairs of disulfide bonds are formed between Cys ¹⁶¹ and Cys ⁷ , Cys ²⁹ and Cys ^{33 in the} protein peptide chain, wherein the disulfide bond between Cys ⁷ and Cys ¹⁶¹ is essential for the biological activity of EPO, if disulfide bonds Upon reduction, EPO will lose its biological activity. The four glycosylation sites of the EPO molecule are on Asn ³⁸ , Asn ²⁴ , Asn ⁸³ and Ser ¹²⁶ , respectively, the first three being N-glycans and the latter being 0-sugar chains. Sugar chains have different degrees of branching, with double, three or four tips, of which the four ends are the most common. The results show that the degree of branching of the sugar chain has an effect on the biological activity of EPO in vivo, and the high branching of the N-terminal sugar chain is necessary for maintaining biological activity in vivo. Desialic acid or deglycosylation does not affect the biological activity in vitro, but it greatly shortens the half-life in vivo (mainly by hepatocyte adsorption metabolism), and as a result, completely loses its biological activity in vivo. Only when the EPO molecule is fully glycosylated can it exhibit biological activity in the body. Therefore, the presence of a sugar chain structure is critical for the biological activity of EPO in vivo. That is to say, only EPO expressed by eukaryotic cells is biologically active in vivo. Since the EPO glycosyl moiety accounts for 30 to 40% of the entire molecular weight and has a high degree of heterogeneity, the degree of glycan branching makes the molecular weight of EPO between 30 and 40 KD. OFiw/ey LC, Linderberg G, Fishman L , et al. The importance of N- and O- linked oligosaccharides for the biosynthesis and in vitro and vivo biological activities of erythropoietin. Blood, 1991, 77(3): 419-434. Numerous studies on EPO confirm the above conclusions. Therefore, it is generally accepted that recombinant EPO must be expressed in eukaryotic cells, such as the literature ^. Erythropoietin and its clinical use and market prospects. "Chinese Medical Information", Vol. 5, No. 1, 1999, ΡΠ λ

Based on the above understanding of natural hEPO, rhEPO currently used in drug production uses eukaryotic cell expression systems, and studies on EPO characteristics and drug efficacy have also focused on rhEPO obtained using eukaryotic cell expression systems. In order to increase the efficacy of rhEPO, there are currently two more successful methods. One is to chemically modify the existing rhEPO. For example, in the 00898956 patent application, a conjugate of EPO and PEG is disclosed, which is obtained by EPO sugar. The protein is covalently linked to 1-3 lower decyloxy polyethylene glycol (PEG) groups for modification, which increases the circulating half-life and shelf life of EPO, and reduces EPO clearance and activity in vivo. The other is to genetically engineer a portion of the amino acids in the EPO peptide chain to increase the glycosylation site and thereby increase the degree of glycosylation. See US Patent 5,856,298 and Amgen Inc. One Amgen Center Drive Thousand Oaks, California AranespTM Book.

Although the above improvements have significantly increased the plasma half-life of rhEPO, it is still a eukaryotic cell expression system used in the current rhEPO drug production process, and the production cost should be comparable to current products.

In another earlier patent application of the Applicant (Application No.: 200410021859.7), by redesigning the base sequence of the known hEPO gene, the E. coli rare codon was eliminated and replaced with E. coli preferred codon And appropriate adjustment of GC content, successfully constructed a recombinant gene and vector system that can be highly expressed in prokaryotic systems (such as E. coli). Although the expressed recombinant human erythropoietin protein (EPOP) has no physiological activity in vivo due to lack of glycosylation modification, the production cost of the prokaryotic system is much lower than that of the eukaryotic system, and the thus prepared in vivo-active EPOP can be used, for example, for example. The preparation of EPO peptide protein reagent, can also be used to immunize animal EPO antigen; or prepared into EP0 positive control standard, kit for EPO immunoassay, such as reverse blood coagulation, radioimmunoassay, enzyme-linked immunosorbent assay and the like. Summary of the invention

The present invention provides a PEG-EPOP conjugate, which uses a glycosylation-free and thus in vivo-active erythropoietin (EPO) protein (EPOP), such as: EPO obtained by the prokaryotic expression system without in vivo biological activity provided by the present invention The protein is then chemically modified by PEG to obtain a product having physiological activity of erythropoiesis in vivo (PEG-EPOP).

The present invention also provides the use of a PEG-EPOP conjugate for the preparation of a medicament for treating anemia diseases and for raising red blood cells.

According to an aspect of the invention, a PEG-EPOP conjugate of the formula (I) is provided - mPEG-X-EPOP

(I)

In formula (I), the molecular structural formula of mPEG is

Wherein k is an integer from 100 to 1000, and the molecular weight is from 5,000 to 40,000 Daltons;

X is NH or 0, indicating the covalent attachment of PEG to EPOP chemical modification;

EPOP is a recombinant EPO protein, which is an EPO protein without in vivo biological activity. Compared with recombinant EPO obtained by expression of natural EPO or eukaryotic expression system, it lacks a sugar chain moiety. In vivo, physiological activity of erythropoiesis is not observed in animal experiments. However, it has the in vitro cytological activity unique to EPO.

The invention has no physiological activity in vivo or no biological activity in vivo, and refers to the physiological effect of detecting the growth of red blood cells in the experimental animal by the currently known detection method according to the general therapeutic use dose, that is, EPOP is not It has the value of being used as an anemia correcting drug; of course, it is not excluded that the detection of a weaker in vivo activity can be detected by a larger dose or a higher sensitivity test.

In the present invention, EPOP having no physiological activity in vivo can be of various origins, and a homologous peptide chain having a peptide chain structure similar to that of natural EPO, whether synthetic or expressed by a prokaryotic system or a eukaryotic system, or even Modified, for example, a peptide chain of 166 amino acids or 167 amino acids expressed by a prokaryotic system in Examples 1 and 2 of the present invention can be used as a raw material of the PEG modification of the present invention because it lacks a sugar chain and does not have physiological activity in vivo. Thereby obtaining a product having physiological activity in vivo.

In order to obtain a large amount of EPO protein without in vivo activity at low cost, in one embodiment of the present invention, a recombinant EPO gene and an engineered bacteria which can be efficiently expressed by an Escherichia coli system are first constructed, and the expressed recombinant EPOP has no in vivo activity, and then Based on this EPOP, it was chemically modified with PEG ₂ NHS-20K, and the modified PEG-EPOP conjugate showed significant in vivo physiological activity of erythropoiesis in animals.

The invention adopts a prokaryotic expression system to obtain EPOP without in vivo biological activity, and then chemically modifies EPOP with PEG to obtain a PEG-EPOP conjugate, and observes in vivo activity in animal experiments. If the PEG-EPOP conjugate is used as a medicine for treating anemia diseases, the prokaryotic expression system is significantly reduced in production cost and scale cost, and has a great advantage over the eukaryotic expression system, which can significantly reduce the cost of treatment for patients. . DRAWINGS

Figure 1 is a plasmid construction diagram of the recombinant EPOP prokaryotic expression system.

Figure 2 PEG-EPO in vivo physiological activity test, using R-500 analyzer to determine the percentage of reticulocytes: In the figure: the ordinate is the percentage of reticulocytes, the abscissa is the blood collection time (1, 2, 3, 4 respectively) Represents blood collection on the fourth, fifth, sixth and seventh day after injection of the sample)

0#: Negative control

1#: rhEPO positive control

2#: Recombination EPOP, unmodified control

3#: PEG-EPOP conjugate, modified product

Figure 3 is a comparison of EPO protein expression of two amino acid sequences (167AA and 166AA);

In the figure: 1 : After the password is modified, the expressed sample of 167AA (including 167 Arg)

2: After the password is modified, the expressed 166AA (excluding 167 Arg) sample 3: 1 induces the expression of the pre-control sample.

4: 2 induced expression control sample

The invention is illustrated, but not limited by the detailed description of the preferred embodiments of the invention.

[Example 1] Preparation of recombinant EPOP expressed by prokaryotic expression system

Strain and plasmid

Plasmid PBV _22Q full length 3.66Kb, tandem phage? 1^3⁄4 promoter, downstream of ribosome gene termination signal, ampicillin resistance, construction of prokaryotic expression vector containing PLP _R promoter and its application, Acta Sinica, 1990, 6 (2): 11 , the plasmid consists of Author's gift. The E. coli strain DH ₅ a was purchased from the GIBCO DH ₅ a standard strain.

2. Tool enzymes and reagents

The restriction enzymes BamH I, EcoRI, T4 ligase and Taq DNA polymerase were purchased from Roche, and the CRISPR Plus Minipreps DNA Purification System was purchased from Promega. The protein molecular weight marker was purchased from Huamei Company, and other reagents. All are domestic analytical pure reagents.

3. Synthesis of human erythropoietin gene

The EPO molecule expressed in human body is a glycosylated protein consisting of 166 amino acids. During the post-processing modification, its C-terminal Arg ¹⁶⁶ position is cleaved to become a mature hEPO composed of 165 amino acids. The cDNA sequence of hEPO is shown in SEQ ID NO. 1, and the amino acid sequence of the primary structure of the protein is SEQ ID NO. 2o, wherein the proportion of the rare codon of Escherichia coli accounts for 12%. In order to optimize gene expression, we optimize the use of codons by redesigning and synthesizing genes, eliminating rare codons. Replace most of the rare codons in hEPO with E. coli preference codons, and adjust the GC content in an appropriate amount, and add three restriction sites at both ends of the target gene fragment: EcoR I: GAATTC; Nde l: CATATG; BamH I: GGATCC. The control before and after the substitution of the password is shown in Table 1, and the coding sequence in the sequence synthesized after the substitution is shown in SEQ ID NO. Since the E. coli gene expression is initiated by methionine, the actually obtained peptide chain has one more methionine at the N-terminus of the sequence of SEQ ID NO. 2, and a total of 167 amino acid peptide chains, and the protein primary structure has no other changes. Table 1 Comparison table before and after hEPO gene code substitution

Before replacement

After replacement GAATTCATATG

Before 51 GGA Alternatively ^ GCrAA ^ GA ^ GCrGA ^ AACATCACGACGGGCTGTGCTGAACACTGCA front 1 GCICCGCCGCGICTGATCTGTGArAGCCGIGTICTGGAiCGTTACCTGCT alternatively 51 GGA GCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCA replacement after replacement before replacing 1 GCCCCACCACGCCT £ ATCTGTGACAGCCGAGT £ CTGGA ^ GaTACCTCIT 101 GCCTGAACGA4AACATCACTGTICCGGAIACCAAAGTTAACTTCTATGCI front replacement 101 GCTTGAA1GAQAA1ATCACTGTCCCAGACACCAAAGTTAAITTCTATGCC alternatively 151 after TGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCT alternatively 151 TGGAA ^ CGrATGGA ^ after replacing GTrGGrCAGCAGGCrGTAGAAGT7TGGCAGGGCCT 301 GGCCT1CGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGA before replacement 251 CT ^ GCCAGCCGTGGGA ^ CCCCTGCAGCTGCACGTGGATAAAGCrGTrAGT replaced after replacing former 201 GGCTCTGCTGTCGGAAGCTGTrCTGCGrGGCCAGGCrCTGCTGGTrAACT 251 CT ^ CCAGCCGTGGGAQCCCCTGCAGCTGCAIGTGGATAAAGCCGTCAGT alternative front 201 GGCCCTGCTGTCGGAAGCTGT £ CTGCGaGGCCAGGC £ CTGlTGGTCAACT 351 AGCrATCiGCCCTCC replaced after 301 GGCCTGCGIAGCCTGACCACTCTGCTGCGIGCTCTGGGAGCICAGAA before replacement ^ GA 351 AGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCA replacement Alternatively GGATGCGGCTTCAGCTGCTCCGCTGCGIACCATCA before replacement before 401 CTGCTGA £ ACTTTCCG £ AAACT £ TTCCGAGT £ TACIQCAA1TTCCT £ CGQ front 401 CTGCTGAIACTTTCCGIAAACTGTTCCGIGTrrACiGCAACTTCCTGCGI 451 GGAAA CTGAA CTGTACACAGGGGAQGCCTGCAGQACAGGGGACAGATG alternative replacement after replacing 451 GGAAA4CTGAA CTGTACACCGGIGA4GCrrGC GIACCGGIGA2 GrrG 501 A

501 AGGATCC after replacement

4. Sequence synthesis method:

Method Reference Jelenkovic G, Billings S' Chen Q, et al. Transformation of eggplant with synthetic ccrylllA gene produces a high level of resistance to the Colorado potato beetle. JAmer Soc Hort Sci, 1998.123(1): 19-25, For the method of gene synthesis, firstly, design software is used to design oligo with a length of about 80 nt. These oligos form an overlap of about 18 nt with each other, and then multi-round PCR amplification is performed to obtain a full-length gene, which is electrophoretically recovered, cloned, and sequenced. The correct clone of the sequence.

In order to synthesize a gene sequence expressing 165 amino acids of mature hEPO (lacking the arginine at position 166 from the amino acid sequence shown in SEQ ID NO. 2), the following two primers were designed, and the EPO containing the password substitution was performed by PCR. The EPO gene lacking the arginine code at position 166 (CGT) (such as the 165 amino acid gene sequence shown in SEQ ID N0.4) was re-amplified in the plasmid of the gene, and was also highly expressed as described above. image 3. Similarly, the peptide chain expressed in E. coli is a peptide chain of 166 amino acids with a methionine added to the N-terminus.

Primers: 5, GAG GAA TTC ATA TGG CTC CGC CGC GTC TG 3 '

5, C AG CTG GGA TCC TCA ATC ACC GGT ACG GCA 3 '

5. Recombinant plasmid construction and screening identification

The sequenced correct target gene was digested with restriction endonucleases BamH I and EcoR I to obtain the coding sequence (SEQ ID NO. 4), which was recovered after electrophoresis and doubled with restriction endonucleases BamH I and EcoR I. The digested PBV _22C plasmid was ligated. The ligation product was transformed into E. coli DH ₅ ot, and an LB plate containing ampicillin was applied to obtain a transformant. The transformant was picked, the plasmid was extracted, and the recombinant plasmid transformant containing the hEPO gene fragment was selected by double restriction analysis with restriction endonucleases BamH I and EcoR I.

The construction route of the recombinant plasmid is shown in Figure 1.

6. Expression of EPO gene in Escherichia coli

The recombinant was inoculated into 5 ml of LB medium and cultured at 30 ° C, 180 rpm shaker for about 14 h. Then, it was transferred to LB medium at a ratio of 1:30, and cultured at 30 ° C for about 4 hours (at A ₆ o _Q 0.8). The culture was induced for 4 h at 42 °C. The culture was taken 1 ml, centrifuged, and the expressed protein was identified by SDS-PAGE and Western blot.

7. High-density fermentation culture medium and culture conditions:

7.1. LB seed culture medium: 10 g of peptone per litre, 5 g of yeast powder, 5 g of NaCl, pH 7.0, sterilized by high pressure, and ampicillin was added to 100 ug/ml when used.

7.2. Fermentation medium: K ₂ HP0 ₄ 12g per KL, KH ₂ P0 ₄ - 3H ₂ 0 20g, NaCl 20g,

MgS0 ₄ - 7H ₂ 0 lOg, glucose 500g, yeast powder 480g, peptone 430g, used after autoclaving.

7.3. Fermentation culture: The preserved strains were plated, single colonies were picked, inoculated in LB seed medium, cultured for 14 to 16 hours, and then expanded for 12 hours at a ratio of 1:30. Then inoculated in NBS

The MPP-40 fermenter was cultured, fed once every hour during the culture, and the pH and oxygen solubility (DO) were adjusted according to the growth of the cells.

8. Purification:

The fermentation product is isolated and purified according to methods known to those skilled in the art, such as the literature ^ to ^ mutations at three sites which are N-glycosylated in the mammalian protein decrease the aggregation of Escherichia coli-derived erythropoietin, Protein Engineering , Vol.14 no.2 pp.135-140, 2001, Linda O.Narhi etc. Recombination from prokaryotic expression systems

9. Determination of in vitro cytological activity of EPOP

9.1. Methods: Comparison of in vitro biological activity of rhEPO by ginseng colorimetry and EUSA method [J Cdl Mol Immunol 2000; 16(5)] Han Lei, Han Weiyue, Ultrasound harvesting Centrifuge after sterilizing. The supernatant was directly tested for UT7 cell activity, and the pellet was lysed with 6 volumes of 7M urea for UT7 cell activity assay. The standard product is Li Xuebao (麒麟鲲鹏公司) 3000IU/bottle (2ml)

9.2. Results: UT7 cell activity was not detected in the control vector supernatant and the precipitate lysate. The constructed bacterial suspension supernatant was measured at 8 IU/ml, and the precipitated solution was diluted 400-fold to measure 700 IU/ml. The recombinant EPOP thus obtained has activity for maintaining the growth of UT7 cells, demonstrating that the obtained recombinant EPOP peptide chain has EPO-specific in vitro cytological activity.

[Example 2] Preparation of PEG-EPOP conjugate

The present invention relates to the modification of EPOP with PEG2NHS-20K, and the chemical modification reaction is carried out as follows:

Where X is NH or 0, representing the covalent attachment of PEG to EPOP chemical modification, typically the side chain amino (NH) of lysine in the EPO peptide chain or the N-terminal amino group of EPO, or it may be in the EPO peptide chain Such as the side chain hydroxyl group (OH) of serine.

Where i and j are integers representing the length of the PEG carbon chain;

According to the degree of modification of EPOP by PEG, n is an integer of 1 to 5, preferably 1;

The mPEG moiety has a molecular weight of from 5,000 to 40,000 Daltons, preferably from 10,000 to 20,000 Daltons. The obtained recombinant EPO can be chemically modified by the following methods: 1. Exchange buffer system (ultrafiltration):

The recombinant human erythropoietin semi-finished product was concentrated with an ultrafilter previously treated with 0.5 mol/L NaOH depyrogenation, diafiltered 4 times with PH8.5, 50.0 mmol/L phosphate buffer, and the protein was adjusted with the same buffer. The concentration is 1 mg/ml.

2. Chemical modification of recombinant EPO

Take 20 ml of recombinant EPO sample (lmg/ml), add PEG ₂ NHS-20K 100 mg (PEG ₂ NHS is NEKTAR product, see Nektar Molecule Engingeering CATALOG 2003 for product instructions), react slowly for 30 min at 25 °C, add Gly400 The reaction was stopped in milligrams.

In the chemical modification, the protein concentration of the recombinant EPO sample may be 0.01 to 5 mg/ml, preferably 0.1 to 1 mg/ml, and most preferably 1 mg/ml in the present invention. The molar ratio of the activated PEG ester to the modified protein is 1:1 to 1:10 or higher, and the weight ratio of PEG ₂ NHS-20K is about 2:1 to 1:5, and the preferred weight ratio is 1 in the present invention. : 5.

3. Separation and purification

3.1. Superdex 200 molecular sieve column: Column size (26cmX 100cm)

3.2. Cleaning and equilibration: Wash the column with pyrogen-free water, flow rate 8~10ml/min, wash with 5 times bed volume, then use 5 times bed volume of equilibrium buffer (0.2mol/L NaCl 20mmol/L lemon) Acid buffer pH 7.0) equilibration column.

3.3. Loading and elution: A sample of the erythropoietin modification reaction mixture was injected, and after the injection, it was eluted with a buffer (0.2 mol.dm-3 NaC1 20 mmol.dm-3 citrate buffer pH 7.0). OD280nm detection. The first peak (PEG-EPOP conjugate) and the second peak (unreacted EPOP) were collected separately.

[Example 3] One of the determinations of erythropoiesis activity in PEG-EPOP conjugate animals

1. Experimental method: Refer to "Establishment of Reticulocyte Method for Detection of Biological Activity in EPO" Wang Yuzhou, Cheng Yaqin, Chinese Journal of Biological Products, Vol. 10, No. 1, 1997, which is slightly different from the text, according to the author's recommendation. A method of injecting only one dose of the fourth day of blood stasis was used.

1.1. Recombinant EPOP sample: The purified EPO protein sample was expressed according to the method of Example 1. It contained N-terminal methionine and C-terminal arginine, and a total length of 167 amino acid peptide chain. The cell activity of UT-7 was 44000 IU. /ml;

1.2. PEG-EPOP conjugate sample: PEG-modified PEG-EPOP conjugate sample prepared by the method of Example 2, the specific method in this experiment is: 5ML of the aforementioned recombinant EPOP sample is added with PEG2NHS-20K 50 mg, After the modification reaction was completed, it was not isolated and purified, and stored at 4 degrees for animal experiments.

1.3. Experimental animals: Balb/C pure mice, weighing approximately 20 grams.

1.4. The sample was diluted 50-fold with 20 mM phosphate buffer. Each sample group was subcutaneously injected with 0.2 ml of the back, 3 rats in each group. Blood was collected from the orbital vein on the fourth day after administration. The smear was stained and the percentage of woven red was measured. Results - Restructuring EPOP: 2.6%, 3.4%, 3.7%, mean 3.2%

PEG-EPOP: 9.7%, 7.9%, 7.5%, average 8.4%

Negative controls: 2.3%, 3.9%, 3.4%, mean 3.2% (historical value)

In animal experiments, prokaryotic expression of recombinant EPOP samples failed to detect erythropoietic production, while the same amount of PEG-modified PEG-EPOP conjugate samples had significant erythropoiesis-producing effects. It is indicated that the recombinant EPOP sample can be modified by PEG to obtain the in vivo activity of erythropoietin which is not originally possessed. Sex. Therefore, the results of this experiment indicate that the EPO protein having no in vivo activity and having in vitro cell activity can obtain the in vivo activity of erythropoietin by PEG modification.

[Example 4] Determination of erythropoiesis activity in PEG-EPOP conjugate animals

1. Experimental method: Referring to Example 3, 0.2 ml was subcutaneously injected into each abdomen, and the percentage of reticulocytes was measured by R-500 analyzer instead of smear staining, and the results of the fourth, fifth, sixth, and seventh days after the injection were measured.

1.1. 0#: 4 negative controls, injected with normal saline;

1.2. 1#: rhEPO positive control, using Shanghai Fosun Technology Biological Cloning Company rhEPO product 贻宝, batch number 20040101, 2000 IU / bottle, 2ml physiological saline dissolved, take 200ul, diluted with physiological saline 4.8ml, concentration is 40IU / ml, There are 4 groups of 4 in each group.

1.3. 2#: Recombinant EPOP, unmodified control sample. The purified EPO protein sample was expressed according to the method of Example 1. The N-terminal methionine contained no C-terminal arginine, and the peptide chain of 166 amino acids was long. The cell activity of UT-7 was 30,000 IU/ml, 100 times. Dilution, concentration 300 IU/ml. There are 4 groups of 4 in each group.

1.4. 3#: PEG-EPOP conjugate, the modified product of the above 2# sample, the modification method is the same as that of Example 3, and the same 2# sample dilution group.

2. Experimental results:

As shown in Figure 2, recombinant EPOP detected only weak in vivo activity in this experiment, while significant in vivo activity was measured in the PEG-EPOP conjugate. The above examples show that EPOP having no in vivo activity, which has been modified by the method of the present invention, has a good activity of promoting erythropoiesis in vivo, and has a good application prospect due to low cost.

The peptide chain to which the present invention relates includes a peptide chain having a natural EPO amino acid sequence and a homologous peptide chain which is improved for various purposes, such as: 166 amino acids as proposed in the present invention (if the first methylthioamide from the N-terminus) The acid MET should be 167 amino acids, and the examples of the present invention indicate that the EVP having the methionine still has the theoretically in vitro cytological activity and the in vivo physiological activity of the PEG modified physiological expression sequence and expression. In the post-simulation process, the natural peptide chain of Arg ¹⁶⁶ is cut, or the peptide chain of a part of the amino acid is changed for its purpose, such as: reducing the glycosylation site to increase the stability of the peptide chain, etc., as long as the EPO homologous peptide chain is It is not within the scope of the present invention that the body can not exhibit or can only exhibit weak EPO physiological activity, and PEG modified to obtain strong physiological activity in vivo.

The modification reagent involved in the present invention is an activated PEG ester, and other methods can be used to covalently couple the PEG chain to the peptide chain of EPOP, including other kinds of activating groups, or activate the corresponding sites of the EPOP peptide chain. And mPEG of various structures of single-stranded, double-stranded or multi-stranded, are also within the scope of the present invention.

It is apparent that the above description of the present invention is not intended to limit the invention, and various changes and modifications may be made thereto by those skilled in the art without departing from the spirit of the invention. range.

Claims

Rights request

A polyethylene glycol conjugate of erythropoietin protein, which is characterized in that a recombinant human erythropoietin protein having no in vivo activity is chemically modified by polyethylene glycol to obtain a product having erythropoietic activity in vivo.

The polyethylene glycol conjugate of the erythropoietin protein according to claim 1, which has the structure of the formula (I):

mPEG-X-EPOP (I)

In formula (I), the molecular structural formula of mPEG is CH3 "CH ₂ CH20 -fc"

Wherein k is an integer from 100 to 1000 such that the mPEG portion of the conjugate has a molecular weight of from 5,000 to 40,000 Daltons;

X is NH or 0, which represents the covalent attachment of PEG to EPOP chemical modification;

EPOP represents a recombinant human erythropoietin protein without in vivo activity.

3. The polyethylene glycol conjugate of erythropoietin protein according to claim 2, which has the structure of formula (II):

In the formula (II), n is an integer of 1 to 5, which represents the degree of modification of EPOP by PEG;

The molecular structure of mPEG is CH3"HH ₂ CH ₂ 0

Wherein lc is an integer from 100 to 1000, which is the sum of i and j, such that the molecular weight of the mPEG portion of the conjugate is from 5,000 to 40,000 Daltons;

The polyethylene glycol conjugate of the erythropoietin protein according to claim 2, wherein the EPOP is expressed by a prokaryotic expression system.

The polyethylene glycol conjugate of erythropoietin protein according to claim 4, wherein the EPOP is expressed by an E. coli expression system.

The use of the polyethylene glycol conjugate of the erythropoietin protein according to claim 1 for the treatment of an anemia disease drug.

7. Use of a polyethylene glycol conjugate of an erythropoietin protein according to claim 1 for the preparation of a medicament for raising red blood cells.