WO2005080579A2

WO2005080579A2 - Taxadiene biosynthesis

Info

Publication number: WO2005080579A2
Application number: PCT/GB2005/000578
Authority: WO
Inventors: Rupert Fray
Original assignee: Plant Bioscience Limited
Priority date: 2004-02-20
Filing date: 2005-02-18
Publication date: 2005-09-01
Also published as: WO2005080579A3; GB0403847D0

Abstract

The present invention relates to the finding that plants which are deficient in geranylgeranyl diphosphate (GGDP) metabolism, in particular tomato and other carotenoid synthesising plants, are useful in the biosynthesis of taxa-4, 11-diene (taxadiene) and other paclitaxel intermediates. Methods and means of producing taxadiene and other paclitaxel intermediates using plants deficient in GGDP metabolism are provided.

Description

Taxadiene Biosynthesis

This invention relates to the biosynthesis of taxadiene and other intermediates in the production of paclitaxel.

The first committed step in the biosynthesis of the anti-cancer agent paclitaxel (marketed as taxol™) is the formation of taxa-4, 11- diene ( ^taxadiene' ) from geranylgeranyl diphosphate (GGDP) (Koepp et al J. Biol . Chem. 270 (1995) 8686-8690).

Geranylgeranyl diphosphate (GGDP) is a common precursor for many plant metabolites, including the side chain of chlorophyll and the plant hormone gibberellic acid. In most plant tissues, the synthesis and use of GGDP are tightly regulated. For example, constitutive overexpression of phytoene synthase, a GGDP utilising enzyme, in vegetative tissues results in dwarf, pale plants, due to competition with gibberellic acid and chlorophyll synthesis pathways (Fray. et al . (1995) The Plant Journal 8 693-701) .

In tomato fruit, GGDP is used almost exclusively for the production of the red carotenoid lycopene, which can form 2% of dry weight. Tomato mutants that lack the enzyme phytoene synthase, which converts GGDP to phytoene, the first step in the synthesis of carotenoids, do not produce red fruit (e.g. the yellow flesh mutant; Fray and Grierson 1993 Plant Mol . Biol . 22 (4): 589-602).

The present invention relates to the finding that plants which are deficient in GGDP metabolism, in particular tomato and other carotenoid synthesising plants, may be useful in the production of taxadiene and other paclitaxel intermediates.

One aspect of the invention provides a method of producing taxadiene comprising; expressing a heterologous nucleic acid encoding taxadiene synthase in a plant deficient in GGDP metabolism. The expressed taxadiene synthase converts GGDP in the plant into taxadiene. Taxadiene produced in a plant by heterologous taxadiene synthase may be extracted, isolated and/or purified from the plant.

Taxadiene synthase (EC4.3.2.17) includes any polypeptide which catalyses the cyclization of geranylgeranyl diphosphate into taxa-4, -11-diene. Suitable polypeptides may be obtained from any organism that produces taxoids. Preferably, yew tree taxadiene synthase is employed i.e. taxadiene synthase from a Taxus species, in particular an organism of the Taxaceae family such as Taxus brevifolia (AAC49310), Taxus chinensis (AAG02257), Taxus baccata (AAR02861) Taxus mairei, Taxus sumatrana (Shen YC et al J. Toxicol-Toxin Reviewa 22 (4) : 533-545 2003) , Taxus wallichiana (Veeresham C et al Pharmaceutical Biology 41 (6): 426-430 2003), Taxus cuspidata, Taxus canadensis or Taxus yunnanensis (Chen Y et al Plant Growth Regul 41 (3) : 265-268 (2003) ) .

Suitable nucleic acid sequences include sequences encoding taxadiene synthase from Taxus brevifolia (U48796; U48796.1; GI: 1354138) Taxus chinensis (AY007207; AY007207.1; GI: 9965483), Taxus baccata (AY424738; AY424738.1; GI: 37789215) or any other Taxus species.

Whilst nucleic acid encoding a wild-type taxadiene synthase is preferred, nucleic acid encoding a taxadiene synthase which is a fragment, mutant, derivative, variant or allele of such a wild type sequence may also be used

Suitable fragments, mutants, derivatives, variants and alleles of taxadiene synthase retain the ability to catalyse the conversion of GGDP to taxadiene. A mutant, variant or derivative may have one or more of addition, insertion, deletion or substitution of one or more nucleotides in the encoding nucleic acid, leading to the addition, insertion, deletion or substitution of one or more amino acids in the encoded polypeptide. Of course, changes to the nucleic acid which make no difference to the encoded amino acid sequence are included.

A taxadiene synthase which is a mutant, derivative, variant or allele may comprise an amino acid sequence which shares greater than about 60% sequence identity with the sequence of a Taxus spp taxadiene synthase, for example a T. brevifolia (AAC49310; AAC49310.1; GI:1354139), T. chinensis (AAG02257; AAG02257.1; GI:9965484) or T. baccata (AAR02861; AAR02861.1; GI:37789216) taxadiene synthase, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%. The sequence may share greater than about 60% similarity with the sequence of a Taxus spp taxadiene synthase, for example a T. brevifolia (AAC49310; AAC49310.1; GI:1354139), T. chinensis (AAG02257; AAG02257.1; GI:9965484) or T. baccata (AAR02861; AAR02861.1; GI:37789216) taxadiene synthase, greater than about 70% similarity, greater than about 80% similarity or greater than about 90% similarity, or greater than about 95% similarity.

Sequence similarity and identity are commonly defined with reference to the algorithm GAP (Genetics Computer Group, Madison, WI) . GAP uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps. Generally, default parameters are used, with a gap creation penalty = 12 and gap extension penalty = 4. Use of GAP may be preferred but other algorithms may be used, e.g. BLAST (which uses the method of Altschul et al . (1990) J. Mol . Biol . 215: 405- 410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85: 2444-2448), or the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol Biol . 147: 195-197), or the TBLASTN program, of Altschul et al . (1990) supra, generally employing default parameters. In particular, the psi-Blast algorithm (Nucl. Acids Res. (1997) 25 3389-3402) may be used. Sequence identity and similarity may also be determined using Genomequest™ software (Gene- IT, Worcester MA USA) . Similarity allows for "conservative variation", i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for anothe'r, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine . Particular amino acid sequence variants may differ from a known taxadiene synthase polypeptide sequence as described herein by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30, 30-50, or more than 50 amino acids.

Sequence comparisons are preferably made over the full-length of the relevant sequence described herein.

A plant which is deficient in GGDP metabolism may have reduced or abrogated activity in one or more enzymes which metabolise GGDP, for example for the biosynthesis of chlorophyll, gibberellic acid or carotenoids . In some preferred embodiments, a plant which is deficient in GGDP metabolism may have reduced or abrogated carotenoid biosynthesis activity.

The plant may, for example, have deficient expression of a GGDP metabolising enzyme or may express an enzyme which lacks or has reduced activity.

The plant may be deficient in GGDP metabolism through mutation, polymorphism or allelic variation in a GGDP metabolising enzyme, which reduces or abrogates the activity of the enzyme. For example, the plant may be of a strain or variety which is naturally deficient in GGDP metabolising activity.

In other embodiments, the plant may be deficient in GGDP metabolism through the action or expression of an inhibitor such as a sense, anti-sense or RNAi nucleic acid, which reduces or abrogates expression of one or more GGDP metabolising enzymes. Methods and means for the suppression of plant gene expression are well known in the art.

A plant which is deficient in GGDP metabolism may contain increased levels of GGDP, relative to control plants.

In some preferred embodiments, the plant is deficient in a carotenoid biosynthesis enzyme, in particular phytoene synthetase.

Suitable plants for use in the present methods include any carotenoid producing plant, in particular a fruiting plant. Phytoene synthetase deficient mutants have been reported in Lycopersicon spp, Capsicum spp such as red pepper { Capsicum annuum L . ; Huh J.H. et al Theoretical and Applied Genetics 102 (4) : 524-530) and crop plants such as Zea mays (Buckner B et al Genetics 143 (1): 479-488(1996)).

In some preferred embodiments, the plant is a tomato plant i.e. a plant of a Lycopersicon spp such as L. esculentum, L. chilense_r L . peruvianum, L . pimpinelli folium or L. hirsutum .

A suitable tomato plant is preferably deficient in phytoene synthetase. For example, the tomato plant may be a mutant or allelic or polymorphic variant which has reduced or abrogated phytoene synthetase activity, for example, a yellow flesh mutant (Fray RG and Grierson D (1993) Plant Mol Biol 22 (4) : 589-602) . Alternatively, the tomato plant may comprise a heterologous nucleic acid molecule which expresses a sense, anti-sense or RNAi construct which suppresses the expression of phytoene synthase.

In some embodiments, a phytoene synthetase may have the amino acid sequence of L . esculentum phytoene synthetase (Database Ace No: AAA34153) or may be a variant or allele thereof, and/or may be encoded by a I. esculentum phytoene synthetase coding sequence (Database Ace No: M84744) or a variant or allele thereof. The plant, for example a tomato plant, may have one or more additional mutations that increase fruit plastid number and pigment accumulation and thus are advantageous for the production of taxadiene or taxadiene metabolites in accordance with the present methods. Suitable mutations include high pigment (Cookson PJ et al Planta 217 (6): 896-903 (2003), high pigment∑ (hp2) and mutations which down regulate the auxin response factor homologue DR12 (Mustilli AC et al Plant Cell 11 (2): 145-157 (1999); Levin I et al Theoretical & Applied Genetics 106 (3) : 454-460 (2003) ; Jones B et al Plant Journal 32 (4): 603-613 (2002)).

Additional mutations may be introduced into a plant which is deficient in GGDP metabolism either by conventional cross breeding with other mutant lines or by recombinant methods.

Methods as described herein may also be useful in the biosynthesis of taxadiene metabolites.

A method may, for example, comprise expressing in the plant one or more additional heterologous nucleic acid sequences encoding one or more polypeptides which convert taxadiene into a taxadiene metabolite.

The taxadiene produced by the taxadiene synthase is converted into a metabolite by the additional heterologous polypeptide (s) . The taxadiene metabolite may then be extracted, isolated and/or purified from said plant.

Taxadiene metabolites which may be produced using the present methods include paclitaxel precursors such as taxa-4 (20) , 11 (12) - dien-5α-ol, taxa-4 (20) , 11 (12) -dien-5α-yl acetate, taxa-4 (20) , 11 (12) - dien-5α-acetoxy-10β-ol and taxa-4 (20) , 11 (12) -dien-5α, 13α-diol, 2- debenzoyltaxane, 10-deacetylbaccatin III and baccatin III and paclitaxel itself. Suitable polypeptides include polypeptide active in the paclitaxel biosynthetic pathway which are well known in the art (Jennewin & Croteau (2001) Appl . Microbiol. Biotechnol. 57 13-19).

Polypeptides active in the paclitaxel biosynthetic pathway include cytochrome p450 taxadiene 5α hydroxylase (E.C.1.14.99.37; Hefner et al. Chem. Biol. 3:479-489, 1996), taxa-4 (20) , 11 (12) -dien-5α-0-acetyl transferase (AF190130: Walker K. et al Arch. Biochem. Biophys . 374 (2) :371-380 (2000)), 10-deacetylbaccatin III-10-O-acetyl transferase (AF193765; Walker K. et al Proc. Natl. Acad. Sci. U.S.A. 97(2) :583-587 (2000)); 5-alpha-taxadienol-10-beta-hydroxylase (AF318211; Schoendorf A. et al Proc. Natl. Acad. Sci. U.S.A. 98 (4) : 1501-1506 (2001)); 3 ' -N-debenzoyltaxol N-benzoyltransferase (AF466397; Walker K. et al Proc. Natl. Acad. Sci. U.S.A. 99(14) : 9166-9171 (2002)), 2-debenzoyl-7, 13-diacetylbaccatin III-2-0- benzoyl transferase, (AF297618; Walker K. et al Proc. Natl. Acad. Sci. U.S.A. 97 (25) : 13591-13596 (2000)), taxane 13-alpha-hydroxylase (AY056019; Jennewein S., Rithner CD., Williams R.M., Croteau R. Proc. Natl. Acad. Sci. U.S.A. 98 (24) : 13595-13600 (2001) ) , phenylpropanoyltransferase, (AY0828041; Walker K. et al Proc. Natl. Acad. Sci. U.S.A. 99 (20) : 12715-12720 (2002) ) and taxane 14-beta- hydroxylase (AY188177; Jennewein S. et al Arch. Biochem. Biophys. 413(2) :262-270 (2003) ) .

For example, a cytochrome p450 taxadiene 5α hydroxylase polypeptide may be expressed in the plant to convert taxadiene to taxa- 4(20) , 11(12) -dien-5α-ol.

Optionally, a taxa-4 (20) , 11 (12) -dien-5α-0-acetyl transferase polypeptide (e.g. database accession number AF190130) may also be expressed to convert the taxa-4 (20) , 11 (12) -dien-5 -ol thus produced to taxa-4 (20) , 11 (12) ~dien-5α-yl acetate. Optionally, a cytochrome P450 taxane-lOβ-hydroxylase polypeptide may also be expressed to convert the taxa-4 (20) , 11 (12) -dien-5 -yl acetate thus produced to taxa-4 (20) , 11 (12) -dien-5α-acetoxy-10β-ol .

Additional polypeptides active in the paclitaxel biosynthetic pathway may also be expressed to produce other taxadiene metabolites in the plant.

Taxadiene metabolites may be extracted, isolated and/or purified from said plant.

A method of producing of taxadiene or a metabolite thereof may comprise;

(i) providing material from a plant which is deficient in a GGDP metabolism and which comprises a heterologous nucleic acid encoding taxadiene synthase and optionally, one or more additional heterologous nucleic acid sequences encoding one or more polypeptides which convert taxadiene into a taxadiene metabolite; and, (ii) extracting, isolating and/or purifying taxadiene or a metabolite thereof from the material.

Material from a plant which is deficient in a GGDP metabolism may be provided, for example, by growing plants as described above, and harvesting material from said plants.

Taxadiene and metabolites thereof may be extracted, isolated and/or purified from plants or plant material by any convenient method. For example, the plant material may be homogenised, solvent extracted and subjected to chromatographic separation methods such as HPLC and column chromatography, for example using a silica column. Taxadiene extraction is described, for example, in Koepp (1995) J Biol Chem. 270(15): 8686-90. Preferably, taxadiene is extracted, isolated and/or purified from the fruit of said plant. A method may thus comprise harvesting the fruit from said plant, prior to taxadiene extraction.

Harvesting may comprise separating and/or isolating fruit from the other plant material. This may be performed manually or by automated harvesting devices.

Taxadiene and taxadiene metabolites produced in accordance with the present methods may be used for the synthesis or production of paclitaxel .

Nucleic acid suitable for use in taxadiene production as described herein may include an isolated nucleic acid which comprises a nucleotide sequence encoding taxadiene synthase and a heterologous regulatory sequence.

In some embodiments, nucleic acid may further comprise a nucleotide sequence encoding one or more polypeptides which convert taxadiene into a taxadiene metabolite and a heterologous regulatory sequence.

The regulatory sequence or element may be plant specific i.e. it may preferentially direct the expression (i.e. transcription) of a nucleic acid within a plant cell relative to other cell types. For example, expression from such a sequence may be reduced or abolished in non-plant cells, such as bacterial or mammalian cells.

In some preferred embodiments, the heterologous plant specific regulatory sequence is a tomato specific regulatory sequence, in particular a tomato fruit or fruit ripening specific regulatory sequence. Suitable sequences include the 2A11 or polygalacturonase 5' and 3' regulatory sequences (Vanhaaren MJJ, Houck CM, Plant Molecular Biology 21 (4): 625-640 (1993), Vanhaaren MJJ, Houck CM, Plant Molecular Biology 17 (4): 615-630 (1991), Nicholas FJ et al Plant Molecular Biology 28 (3) : 423-435 (1995) . In other embodiments, the heterologous regulatory sequence may be activated by a heterologous transcription factor, such as GAL4 or T7 polymerase. Nucleic acid encoding the heterologous transcription factor may be operably linked to a fruit- specific promoter as described above so that expression of the heterologous transcription factor is fruit specific and drives fruit specific expression of the taxadiene synthase coding sequence by activation of the heterologous regulatory sequence. For example, a GAL4 transcription factor may be expressed using a polygalacturonase promoter and may drive expression of a taxadiene synthase coding sequence which is operably linked to the GAL4 promoter. In other embodiments, T7 polymerase may be expressed using a polygalacturonase promoter and may drive expression of a taxadiene synthase coding sequence which is operably linked to a T7 promoter.

The term "heterologous" is used to indicate that the gene/sequence of nucleotides in question have been introduced into said cells of the plant or an ancestor thereof, using genetic engineering or recombinant means, i.e. by human intervention. A regulatory sequence which is heterologous (i.e. exogenous or foreign) to a coding sequence is not associated with that coding sequence in nature i.e. it does not direct the expression of the coding sequence in natural systems .

A heterologous plant specific regulatory sequence may be an inducible promoter. Such a promoter may induce expression in response to a stimulus. This allows control of expression, for example, to allow optimal plant growth before taxadiene production is induced.

The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus (which may be generated within a cell or provided exogenously) . The nature of the stimulus varies between promoters. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. The preferable situation is where the level of expression increases in the presence of the relevant stimulus by an amount effective to cause production of taxadiene. Thus an inducible (or "switchable" ) promoter may be used which causes a basic level of expression in the absence of the stimulus which causes little or no accumulation of taxadiene. Upon application of the stimulus, which may for example, be an increase in environmental stress, expression of taxadiene synthase is increased (or switched on) to a level which causes the production and accumulation of taxadiene.

Many examples of inducible promoters will be known to those skilled in the art.

Other suitable promoters may include the Cauliflower Mosaic Virus 35S (CaMV 35S) gene promoter that is expressed at a high level in virtually all plant tissues (Benfey et al, (1990) EMBO J 9: 1677- 1684) ; the cauliflower meri 5 promoter that is expressed in the vegetative apical meristem as well as several well localised positions in the plant body, e.g. inner phloem, flower primordia, branching points in root and shoot (Medford, J.I. (1992) Plant Cell 4, 1029-1039; Medford et al, (1991) Plant Cell 3, 359-370) and the Arabidopsis thaliana LEAFY promoter that is expressed very early in flower development (Weigel et al, (1992) Cell 69, 843-859) .

An isolated nucleic acid may further comprise a nucleotide sequence encoding a sense or anti-sense molecule for the suppression of GGDP metabolism as described in more detail below.

Nucleic acid sequences as described above may be comprised within a vector. Those skilled in the art are well able to construct vectors and design protocols for recombinant gene expression, for example in a microbial or plant cell. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a

Laboratory Manual : 3rd edition, Sambrook & Russell, 2001, Cold Spring Harbor Laboratory Press.

Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Protocols in Molecular Biology, Second Edition, Ausubel et al . eds . , John Wiley & Sons, 1992. Specific procedures and vectors previously used with wide success upon plants are described by

Bevan, Nucl . Acids Res. (1984) 12, 8711-8721), and Guerineau and Mullineaux, (1993) Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148.

When introducing a chosen gene construct into a cell, certain considerations must be taken into account, well known to those skilled in the art. The nucleic acid to be inserted should be assembled within a construct which contains effective regulatory elements which will drive transcription. There must be available a method of transporting the construct into the cell. Once the construct is within the cell, integration into the endogenous chromosomal material either will or will not occur. Finally, as far as plants are concerned, the target cell type must be such that cells can be regenerated into whole plants.

Techniques well known to those skilled in the art may be used to introduce nucleic acid constructs and vectors into plant cells to produce transgenic plants which comprise the heterologous taxadiene synthase coding sequence. Agrobacterium transformation is one method widely used by those skilled in the art to transform dicotyledonous species. Production of stable, fertile transgenic plants in almost all economically relevant monocot plants is also now routine: (Toriyama, et al . (1988) Bio/Technology 6, 1072-1074; Zhang, et al . (1988) Plant Cell Rep. 1 , 379-384; Zhang, et al . (1988) Theor Appl Genet 76, 835-840; Shimamoto, et al . (1989) Nature 338, 274-276; Datta, et al . (1990) Bio/Technology 8, 736-740; Christou, et al . (1991) Bio/Technology 9, 957-962; Peng, et al . (1991) International Rice Research Institute, Manila, Philippines 563-574; Cao, et al . (1992) Plant Cell Rep. 11, 585-591; Li, et al . (1993) Plant Cell Rep. 12, 250-255; Rathore, et al. (1993) Plant Molecular Biology 21, 871-884; Fromm, et al . (1990) Bio/Technology 8, 833-839; Gordon-Kamm, et al . (1990) Plant Cell 2, 603-618; D'Halluin, et al . (1992) Plant Cell 4, 1495-1505; Walters, et al. (1992) Plant Molecular Biology 18, 189-200; Koziel, et al. (1993) Biotechnology 11, 194-200; Vasil, I. K. (1994) Plant Molecular Biology 25, 925-937; Weeks, et al . (1993) Plant Physiology 102, 1077-1084; Somers, et al. (1992) Bio/Technology 10, 1589-1594; W092/14828). In particular, Agrobacterium mediated transformation is now a highly efficient alternative transformation method in monocots (Hiei et al. (1994) The Plant Journal 6, 271-282).

The generation of fertile transgenic plants has been achieved in the cereals rice, maize, wheat, oat, and barley (reviewed in Shimamoto, K. (1994) Current Opinion in Biotechnology 5, 158-162.; Vasil, et al. (1992) Bio/Technology 10, 667-674; Vain et al . , 1995, Biotechnology Advances 13 (4) : 653-671; Vasil, 1996, Na ture Biotechnology 14 page 702) . Wan and Lemaux (1994) Plant Physiol . 104: 37-48 describe techniques for generation of large numbers of independently transformed fertile barley plants.

Other methods, such as microprojectile or particle bombardment (US 5100792, EP-A-444882, EP-A-434616) , electroporation (EP 290395, WO 8706614), microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. (1987) Plant Tissue and Cell Culture, Academic Press) direct DNA uptake (DE 4005152, WO 9012096, US 4684611), liposome mediated DNA uptake (e.g. Freeman et al . Plant Cell Physiol . 29: 1353 (1984)), or the vortexing method (e.g. Kindle, PNAS U. S. A. 87: 1228 (1990d)) may be preferred where Agrobacterium transformation is inefficient or ineffective.

Physical methods for the transformation of plant cells are reviewed in Oard, 1991, Biotech . Adv. 9: 1-11.

Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co- cultivation with Agrobacterium (EP-A-486233) .

In some embodiments, the heterologous nucleic acid may be incorporated directly into the plastid genome. For example, the chloroplast may be transformed (Ruf S et al Nature Biotechnology 19 (9) : 870-875 (2001) ) . In such embodiments, the taxadiene synthase may lack a chloroplast targeting sequence. Expression of the heterologous nucleic acid in the plastid genome may be regulated, for example by placing it under a T7 promoter and transcribing a plastid targeted T7 polymerase from a fruit specific promoter, as described above (McBride KE et al PNAS USA 91 (15) : 7301-7305 1994) .

Following transformation, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewed in Vasil et al . , Cell Culture and Somatic Cell Genetics of Plants, Vol I_r II and III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989. The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant cells is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration.

A method of making a plant cell as described herein may include introduction of a nucleic acid or a vector as described herein into a plant cell and causing or allowing recombination between the nucleic acid or vector and the plant cell or chloroplast genome to introduce the nucleic acid sequence into the plant cell genome or chloroplast genome.

The plant cell may be deficient in GGDP metabolism, as described above, for example the cell may be deficient in carotenoid synthesis, and in particular may be deficient in phytoene synthetase activity.

Plant cells which are deficient in GGDP metabolism may be the product of natural selection or conventional selective breeding techniques or they may be generated through the use of anti-sense or RNAi constructs. The use of these approaches to down-regulate plant gene expression is well-established in the art.

Anti-sense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of phytoene synthase polypeptide so that its expression is reduced or completely or substantially prevented. In addition to targeting coding sequence, anti-sense techniques may be used to target control sequences of a gene, e.g. in the 5' flanking sequence, whereby the antisense oligonucleotides can interfere with the sequences which control expression. The construction of antisense sequences and their use is described for example in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990) and Crooke, Ann. Rev. Pharmacol. Toxicol., 32:329-376, (1992).

Oligonucleotides may be generated in vitro ox ex vivo for administration or anti-sense RNA may be generated in vivo within cells in which down-regulation is desired. Thus, double-stranded DNA may be placed under the control of a promoter in a "reverse orientation" such that transcription of the anti-sense strand of the DNA yields RNA which is complementary to normal mRNA transcribed from the sense strand of the target gene. The complementary anti- sense RNA sequence is thought then to bind with mRNA to form a duplex, inhibiting translation of the endogenous mRNA from the target gene into protein. Whether or not this is the actual mode of action is still uncertain. However, it is established fact that the technique works .

The complete sequence corresponding to the coding sequence in reverse orientation need not be used. For example fragments of sufficient length may be used. It is a routine matter for the person skilled in the art to screen fragments of various sizes and from various parts of the coding or flanking sequences of a gene to optimise the level of anti-sense inhibition. It may be advantageous to include the initiating methionine ATG codon, and perhaps one or more nucleotides upstream of the initiating codon. A suitable fragment may have about 14-23 nucleotides, e.g. about 15, 16 or 17.

An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co-suppression; Angell & Baulcombe (1997) The EMBO Journal 16,12:3675-3684; and Voinnet & Baulcombe (1997) Nature 389: pg 553). Double stranded RNA (dsRNA) has been found to be even more effective in gene silencing than both sense or antisense strands alone (Fire A. et al Nature, 391, (1998)). dsRNA mediated silencing is gene specific and is often termed RNA interference (RNAi) . RNA interference is a two-step process. First, dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23 nucleotides length with 5' terminal phosphate and 3' short overhangs (~2nt) . The siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001)

RNAi may be also be efficiently induced using chemically synthesized siRNA duplexes of the same structure with 3 '-overhang ends (Zamore PD et al Cell, 101, 25-33, (2000)). Synthetic siRNA duplexes have been shown to specifically suppress expression of endogenous and heterologeous genes in a wide range of mammalian cell lines (Elbashir SM. et al . Nature, 411, 494-498, (2001)).

Another possibility is that nucleic acid is used which on transcription produces a ribozyme, able to cut nucleic acid at a specific site - thus also useful in influencing gene expression. Background references for ribozymes include Kashani-Sabet and Scanlon, 1995, Cancer Gene Therapy, 2(3): 213-223, and Mercola and Cohen, 1995, Cancer Gene Therapy, 2(1), 47-59.

Thus, a nucleic acid sequence for inhibiting or abrogating GGDP metabolism may comprise a nucleic acid molecule comprising all or part of a GGDP metabolising enzyme coding sequence, for example a phytoene synthase coding sequence, such as the coding sequence of L. esculentum (M84744), or the complement thereof

Such a molecule may suppress the expression of a GGDP metabolising enzyme and may comprise a sense or anti-sense a GGDP metabolising enzyme coding sequence or may be a GGDP metabolising enzyme specific ribozyme, according to the type of suppression to be employed.

The type of suppression will also determine whether the molecule is double or single stranded and whether it is RNA or DNA.

The invention encompasses a plant cell which is deficient in GGDP metabolism and which is transformed with a taxadiene synthase nucleic acid sequence or vector as set forth above, i.e. containing a nucleic acid or vector as described above. Optionally, a cell may be transformed with one or more additional heterologous nucleic acid sequences encoding one or more polypeptides which convert taxadiene into a taxadiene metabolite

The cell may, for example, comprise a sense or anti-sense nucleic acid sequence as described above for suppression of GGDP metabolising activity.

Within the cell, the heterologous nucleotide sequence (s) may be incorporated within the chromosome or may be extra-chromosomal. There may be more than one heterologous nucleotide sequence per haploid genome. This, for example, enables increased expression of the gene product compared with endogenous levels, as discussed below. A nucleic acid sequence comprised within a plant cell may be placed under the control of an externally inducible gene promoter, either to place expression under the control of the user.

A nucleic acid which is stably incorporated into the genome of a plant is passed from generation to generation to descendants of the plant, cells of which descendants may express the encoded taxadiene synthase, and, optionally one or more polypeptides which convert taxadiene into a taxadiene metabolite, and so may produce and/or accumulate taxadiene or a metabolite thereof.

A plant cell may contain a nucleic acid sequence encoding taxadiene synthase and optionally one or more polypeptides which convert taxadiene into a taxadiene metabolite, as a result of the introduction of the nucleic acid sequence into an ancestor cell.

Methods described herein may further include sexually or asexually propagating or growing off-spring or a descendant of the plant regenerated from said plant cell. A plant cell as described herein may be comprised in a plant, a plant part or a plant propagule, or an extract or derivative of a plant as described below.

Plants which include a plant cell as described herein are also provided, along with any part or propagule thereof, seed, selfed or hybrid progeny and descendants. Particularly provided are transgenic higher plants, especially crop plants, which are deficient in GGDP metabolism and which have been engineered to carry genes identified as stated above. Especially preferred are plants and plant cells which synthesise carotenoids, for example Lycopersicon spp (tomato) such as L . esculentum, L . chilense, L . peruvianum, L . pimpinelli folium or L . hirsutum, Capsicum spp such as Capsicum annuum (red pepper) and Zea spp such as Zea mays (maize) .

Plants and plant cells may be deficient in phytoene synthetase, and may for example be yellow flesh mutants of Lycopersicon spp .

A plant or plant cell, in particular a tomato plant or cell, may have one or more additional mutations or polymorphisms relative to the wild type that increase fruit plastid number and pigment accumulation, such as high pigment, high pigment2 or DR12 mutations.

In addition to a plant, the present invention provides any clone of such a plant, seed, selfed or hybrid progeny and descendants, and any part or propagule of any of these, such as cuttings and seed, which may be used in reproduction or propagation, sexual or asexual. Also encompassed by the invention is a plant which is a sexually or asexually propagated off-spring, clone or descendant of such a plant, or any part or propagule of said plant, off-spring, clone or descendant.

The present invention also provides a fruit of a plant described above. A method of producing a plant may comprise incorporating nucleic acid as described above into a plant cell which is deficient in GGDP metabolism and regenerating a plant from said plant cell. In some embodiments, GGDP metabolism deficiency may result from incorporating sense or antisense nucleic acid as described above into a plant cell and regenerating a plant from said plant cell.

Another aspect of the invention provides the use of a nucleic acid, vector, cell or plant as described above in a method of producing taxadiene or a taxadiene metabolite.

Control experiments may be performed as appropriate in the methods described herein. The performance of suitable controls is well within the competence and ability of a skilled person in the field.

Taxadiene and metabolites thereof may also be produced in accordance with the invention in other carotenoid synthesising organisms, including bacteria.

A method of producing taxadiene may comprise; expressing a heterologous nucleic acid encoding taxadiene synthase in a carotenoid synthesising bacterial cell which is deficient in GGDP metabolism.

A method may further comprise extracting, isolating and/or purifying taxadiene from said cell.

Suitable carotenoid synthesising bacteria are well known in the art and may include for example, Erwinia spp such as Erwinia herbicola or Streptomyces spp.

A bacterial cell which is deficient in GGDP metabolism may have reduced or abrogated activity in one or more enzymes which metabolise GGDP, for example for the biosynthesis of carotenoids. In particular a cell may have reduced or abrogated phytoene synthetase activity.

Phytoene synthetase activity may be reduced or abrogated by natural or induced mutation or by conventional recombinant techniques . The sequence encoding the N terminal transit peptide may be removed from the nucleic acid which encodes taxadiene synthase, prior to transformation of the bacterial cell.

Methods and means for the expression of heterologous nucleic acid in bacterial host cells is well known in the art and is described in more detail above.

Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure. All documents mentioned in this specification are incorporated herein by reference in their entirety.

Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the figures described below.

Figure 1 shows the taxadiene synthase coding sequence of European Yew.

Figure 2 shows amino acid sequence of European Yew taxadiene synthase

Figure 3 shows the nucleotide sequence of the pBCTaxK vector construct.

Figure 4 shows the nucleotide sequence of the pBC35 vector construct

Figure 5 shows a GC trace of transgenic and control leaf and ripe fruit samples Figure 6 shows MS analysis of a peak with GC 20.2 min retention time

Figure 7 shows MS analysis of a compound related to Taxadiene (spectral similarity) that elutes earlier than Taxadiene itself

Figure 8 shows a further GC trace of transgenic and control leaf and ripe fruit samples

Experimental Methods

Isolation of a taxadiene cDNA

RNA was obtained from yew tree material by a modification of the method of Walker et al (Walker et al (2000) Archives of Biochemistry and Biophysics 374 371-380) . Young leaf needle tissue was taken from a yew tree growing' in the Nottingham University arboretum and immediately frozen in liquid nitrogen. Plant tissues were ground to a fine powder in a pestle and mortar, added to extraction buffer (4 M guanidine thiocyanate, lOOmM Tris-HCl pH 7.5, 25 mM EDTA, 14 mM β- mercaptoethanol) . The mixture was made 2% for Triton X-100 and left on ice for 15 minutes. An equal volume of 3M sodium acetate (pH 6.0) was added and after mixing and leaving on ice for an additional 15 minutes this was centrifuged at 15,000 g for 30 minutes and the pellet discarded. 0.8 volumes of isopropanol was added to the supernatant and after 5 minutes on ice the precipitated RNA together with large amounts of resinous material was obtained by centrifugation for 30 minutes at 15,000 g. The resinous pellet was dissolved in the minimum volume of warm sterile distilled water and mixed with an equal volume of 2X loading buffer (0.7 M NaCl, lOOmM MOPS buffer pH 7.0). The RNA sample was made 15% for isopropanol immediately before loading onto a purification column.

The RNA was purified using a Quiagen plas id midi prep column according to the manufacturer' s protocol except that the equilibration, wash and elution buffers were modified to favour RNA binding and elution as follows:

Equilibration buffer - NaCl 0.35 M, MOPS pH 7.0 50 mM, Isopropanol 15%, Triton X-100 1.5%.

Wash buffer - NaCl 0.4 M, MOPS pH 7.0 50 mM, Isopropanol 15%.

RNA Elution buffer - NaCl 1.4 M, MOPS pH 7.0 50 mM, Isopropanol 15%.

From this purified total RNA, mRNA was isolated using Promega "poly A tract isolation system" according to the manufacturer' s instructions. 3 μl of this poly A mRNA was incubated at 72 °C for 2 minutes with 1 μl of water and 1 μl the taxadiene specific oligonucleotide lOTaxB (5' TAGGATCCTCATACTTGAATTGGATCAATATAAACTTTTC - 3' ) . After a further 2 minutes on ice 2 μl of MMLV reverse transcriptase buffer, 1 μl of 10 mM dNTPS, 1 μl of water and 1 μl of MMLV reverse transcriptase were added and the reaction incubated under oil at 42 °C for 1 hour. 2 μl of the resulting first strand cDNA were used in a PCR reaction using Bio-X-Act polymerase (a proof reading polymerase with high fidelity) and the oligonucleotides lOTaxB and Taxi (5' -GAAATGGCTCAGCTCTCATTTAATGC -3') on a thermo cycler (95 °C for 30 seconds, 64 °C for 30 seconds, 68 °C for 6 minutes) for 35 cycles. 1 μl of Bioline Taq polymerase (a non-proof reading polymerase) was added and the reaction incubated for 30 minutes at 73 °C for 30 minutes. After purification this PCR product was ligated into pGEMT-Easy (Promega) and cloned into DH5α E. coli cells. The resulting plasmid was named pGEMTaxK.

Construction of binary transformation vectors and plant transformation .

PGEMTaxK was cut with Notl , made blunt with Klenow polymerase and the released taxadiene synthase cDNA sequence gel extracted and purified. This sequence was cloned into pBC35 that had previously been cut with Smal and de-phosphorylated. pBC35 consists of a CaMV 35S promoter and terminator cassette from pDH51 (Pietrzak et al 1986 Nucl . Acids Res . 14 5857-5868) , which are inserted between the EcoRI and HindiII sites of pBIN19 (Bevan (1984) Nucl . Acids Res . 12 8711- 8721) to create the plant binary transformation vector pBCTaxK. This plasmid was transferred to Agrobacterium tumefaciens strain LBA4404 and used to transform tomato cotyledons of the yellowflesh mutant according to published protocols (Bird et al (1988). Plant . Mol . Biol . 13 (3): 303-311). Four transgenic lines were obtained and transferred to compost.

Extraction and identification of taxadiene

Fruit and leaf material from transgenic and control plants was harvested, weighed and ground in a pestle and mortar with analytical grade hexane and a small amount of acid washed sand. The organic phase was removed to a separating funnel and the homogenised plant tissues re-extracted a further four times with hexane, each of these subsequent extractions being pooled with the first. Any remaining aqueous fraction was removed and the organic fraction collected and dried in a rotary evaporator. The dried residue was taken up in a small (typically about 0.5 ml) volume of hexane and stored at -20 °C. One μl samples were subjected to GC-MS analysis.

GC-MS conditions were as follows;

Column DB-5; 25m x 0.22mm ID Carrier gas He, 2 psi

Temp. 80°C start, 1 min delay then 8°C/min ramp to 300 °C hold 5 min

Injector 260°C.

Injections 1 μl in hexane

5 cm needle fitted

A distinctive peak at 27.2 minutes was only seen in the transgenic plant samples (Figures 5 & 8). Additional peaks present in both the transgenic and non-transgenic leaf samples were absent from the fruit samples -indicating greater purity (Figure 5 & 8). The mass spectroscopy data for the peak with a retention time of 27.2 minutes indicated major ions at 122, 121, 123 and 107 characteristic of published data for taxadiene (Wildung MR, Croteau R (1996. The Journal of Biological Chemistry 211 9201-9204.) (Figure 6).

Interestingly, a small additional peak with a retention time of 19.7 minutes is seen only in the transgenic fruit sample. The mass spectroscopy analysis of this peak indicates that it is related to taxadiene (figure 7) .

A C19 alkane standard of known concentration was also run through the GC-MS to provide a very crude estimate of taxadiene levels. By comparing this with the C20 taxadiene, the first fruit analysed was estimated to contain approximately 12.5 μg/g dry weight. The seed set is reduced in the tomato plants constitutively expressing the taxadiene synthase construct and growth rate also appeared to be reduced.

These experiments show that expression of a taxadiene synthase transgene in the fruit of the yellowflesh tomato mutant allows the GGDP normally utilised for the synthesis of carotenoids to be rerouted for the production of taxadiene, providing a cheap and easily extractable source of this important compound.

Claims

Claims :

1. A method of producing taxadiene comprising expressing a heterologous nucleic acid encoding a taxadiene synthase polypeptide in a plant deficient in GGDP metabolism.

2. A method according to claim 1 comprising extracting, isolating and/or purifying taxadiene from said plant.

3. A method according to claim 1 comprising expressing in said plant one or more heterologous nucleic acids which encode one or more polypeptides which convert taxadiene into a metabolite.

4. A method according to claim 3 comprising extracting, isolating and/or purifying said metabolite from said plant.

5. A method according to any one of the preceding claims wherein said plant is a cartenoid synthesising plant.

6. A method according to claim 5 wherein said plant is deficient in phytoene synthetase.

7. A method according to claim 5 or claim 6 wherein said plant is a tomato plant

8. A method according to claim 7 wherein said plant is a yellow flesh mutant.

9. A method according to any one of the preceding claims wherein the taxadiene synthase is a taxadiene synthase from a Taxus spp.

10. A method according to claim 9 wherein the taxadiene synthase is a taxadiene synthase from T. brevifolia , T. chinensis or T. baccata

11. A method according to any one of the preceding claims wherein said taxadiene or taxadiene metabolite is extracted, isolated and/or purified from the fruit of said plant.

12. A method according to any one of the preceding claims wherein said plant has one or more additional mutations that increase fruit plastid number and pigment accumulation

13. An isolated nucleic acid comprising a nucleotide sequence encoding taxadiene synthase operably linked to a tomato-specific regulatory sequence.

14. A nucleic acid according to claim 13 wherein the tomato plant specific promoter is a fruit or fruit ripening specific regulatory sequence.

15. A nucleic acid according to claim 13 or claim 14 wherein the regulatory sequence comprises an inducible promoter.

16. A nucleic acid vector suitable for transformation of a plant cell and comprising nucleic acid according to any one of claims 13 to 15.

17. A host cell containing nucleic acid according to any one of claims 13 to 15, or a vector according to claim 16, wherein said nucleic acid is heterologous to said cell.

18. A host cell according to claim 17 further comprising one or more heterologous nucleic acids which encode one or more polypeptides which convert taxadiene into a metabolite

19. A host cell according to claim 17 or claim 18 wherein which is deficient in GGDP metabolism.

20. A host cell according to claim 19 which is deficient in phytoene synthetase.

21. A host cell according to any one of claims 17 to 20 having said heterologous nucleic acid within its genome.

22. A host cell according to any one of claims 17 to 21 wherein said cell is a plant cell or a bacterial cell

23. A host cell according to any one of claims 13 to 16 wherein said cell is a carotenoid synthesising plant cell.

24. A host cell according to claim 23 wherein said plant cell is a tomato plant cell.

25. A host cell according to any one of claims 23 to 24 which further comprises a heterologous nucleic acid comprising all or part of a nucleotide sequence encoding a GGDP metabolising enzyme, or the complement thereof, said coding sequence being operably linked to a regulatory element.

26. A host cell according to claim 25 wherein the GGDP metabolising enzyme is phytoene synthase.

27. A host cell according to any one of claims 23 to 26 which is comprised in a plant, a plant part or a plant propagule, or extract or derivative of a plant.

28. A method of producing a cell according to any one of claims 23 to 27, the method comprising incorporating said nucleic acid or vector into the cell by means of transformation.

29. A method according to claim 28 which comprises combining the nucleic acid with the cell genome nucleic acid such that it is stably incorporated therein.

30. A method according to claim 22 or claim 23 which comprises regenerating a plant from one or more transformed cells.

31. A method according to claim 30 comprising sexually or asexually propagating or growing off-spring or a descendant of the plant regenerated from said plant cell.

32. A plant comprising a cell according to any one of claims 23 to 27.

33. A plant according to claim 32 which is a tomato plant.

34. A plant according to claim 32 or claim 33 which is deficient in phytoene synthetase activity.

35. A fruit obtained from a plant according to any one of claims 32 to 34.

36. A method of producing a plant according to any one of claims

32 to 34, the method comprising incorporating nucleic acid according to any one of claims 13 to 15 into a plant cell and regenerating a plant from said plant cell.

37. A method according to claim 36 wherein the plant is a tomato plant.

38. Use of a nucleic acid according to any one of claims 13 to 15, a vector according to claim 16, a cell according to any one of claims 17 to 27 or a plant according to any one of claims 32 to 34 in a method of producing taxadiene or a metabolite thereof.