WO2005080562A1 - Procédé consistant à se prononcer sur un cancer de la prostate - Google Patents

Procédé consistant à se prononcer sur un cancer de la prostate Download PDF

Info

Publication number
WO2005080562A1
WO2005080562A1 PCT/JP2004/012446 JP2004012446W WO2005080562A1 WO 2005080562 A1 WO2005080562 A1 WO 2005080562A1 JP 2004012446 W JP2004012446 W JP 2004012446W WO 2005080562 A1 WO2005080562 A1 WO 2005080562A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutation
thymine
pca
adenine
substitution
Prior art date
Application number
PCT/JP2004/012446
Other languages
English (en)
Japanese (ja)
Inventor
Hiroshi Yamamoto
Noboru Konishi
Kazutake Tsujikawa
Original Assignee
Hiroshi Yamamoto
Noboru Konishi
Kazutake Tsujikawa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hiroshi Yamamoto, Noboru Konishi, Kazutake Tsujikawa filed Critical Hiroshi Yamamoto
Priority to JP2006510150A priority Critical patent/JPWO2005080562A1/ja
Priority to US10/590,146 priority patent/US20080020375A1/en
Publication of WO2005080562A1 publication Critical patent/WO2005080562A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a method for determining prostate cancer. More specifically, the present invention is a method for determining a subject at risk of developing or at risk of developing prostate cancer, comprising the following steps:
  • Prostate cancer is a malignant tumor that ranks highest in male cancer morbidity and mortality in Europe and the United States. In Japan, the morbidity and mortality of prostate cancer have been increasing rapidly in recent years with the westernization and aging of eating habits.
  • prostate cancer relies on histopathological judgments such as tumor grade and stage, and biochemical parameters such as PSA levels.
  • PSA prostatic specific antigen
  • the measurement of prostatic specific antigen (PSA) concentration in blood has rapidly spread in mass screenings and health check-ups, and prostate cancer can be detected relatively early.
  • an increase in blood PSA levels is observed after the onset of prostate cancer, and a diagnosis based on blood PSA levels may be associated with benign prostatic hyperplasia or prostatitis.
  • differentiation is difficult and there is a need for the development of new, more specific and sensitive markers for the detection, diagnosis, and follow-up of prostate cancer.
  • the present inventors separated prostate tissue removed from a prostate cancer patient into a tumor part and a non-tumor part pathologically for the purpose of searching for a therapeutic target molecule for prostate cancer, Genes whose expression levels differed between the non-tumor part and the tumor part were analyzed.
  • a gene called PCA-1 also called human AlkB homolog 3 (hABH3)
  • hABH3 human AlkB homolog 3
  • He succeeded in clawing a denko The 123rd Annual Meeting of the Pharmaceutical Society of Japan 4, p 15, 2003.
  • PCA-1 has been confirmed to be a DNA and RNA alkylation damage repair enzyme, and its function has attracted attention (Nature, Vol. 421, p859-863, 2003).
  • an object of the present invention is to provide a new method for determining a subject at risk of developing or at risk of developing prostate cancer.
  • PCA-1 gene was increased in prostate cancer tissue, and the enhanced function of PCA-1 was associated with the onset or progression of prostate cancer and some consequences.
  • PCA-1 gene mutations that could cause PCA-1 dysfunction were found to occur frequently in prostate cancer patients.
  • the present invention has been completed.
  • the present invention relates to the following (1) to (19).
  • a method for determining a subject at risk of developing or at risk of developing prostate cancer comprising the following steps:
  • the missense mutations are mutations of the 7th arginine to leucine, 8th alanine to valine, 30th alanine to threonine, and 41st mutation of the PCA-1 polypeptide. Mutation of threonine to isoloicin, mutation of aspartic acid at position 73 to asparagine, mutation of glycine at position 137 to arginine, mutation of serine at position 144 to proline, position 228 of aspartic acid Of glutamic acid at position 233 to glutamic acid.
  • the missense mutations are mutations of the 228th aspartic acid to glutamic acid, 233rd glutamic acid to aspartic acid, and 261st lysine to asparagine for the PCA-1 polypeptide.
  • missense mutation is a mutation that causes a mutation of 228th aspartic acid to glutamic acid in the PCA-1 polypeptide.
  • the missense mutation is caused by mutation of 426th guanine to thymine, 429th cytosine to thymine, 494th guanine to adenine, 528th of PCA-1 gene. Mutation of cytosine to thymine, mutation of 623th guanine to adenine, mutation of 815th guanine to adenine, 836th thymine to cytosine, 1090th cytosine to guanine
  • the method according to (3) which is a mutation selected from the group consisting of a mutation, a mutation of adenine at position 1105 to thymine, and a mutation of adenine at position 1189 to thymine.
  • Missense mutations consist of mutations of cytosine at position 1090 to guanine, mutation of adenine at position 1105 to thymine, and mutation of adenine at position 1189 to thymine in PCA-1 gene
  • the method according to (6) which is a mutation selected from the group.
  • missense mutation is a mutation of the 1090th cytosine of the PCA-1 gene to guanine.
  • the silent mutation is a mutation selected from the group consisting of a mutation of 568th thymine to cytosine and a 1132th mutation of guanine to thymine in the PCA-1 gene, ). (12) The method according to the above (11), wherein the silent mutation is a mutation of the PCA-1 gene at the 1st to 2nd guanine to thymine.
  • substitution of guanine at position 426 with thymine, substitution of cytosine at position 429 with thymine, substitution of guanine at position 494 with adenine, Substitution of cytosine at position 528 with thymine, substitution of guanine at position 623 with adenine, substitution of guanine at position 815 with adenine, substitution of guanine at position 835 with cytosine Substitution of the 1st 90th cytosine with guanine, 1st 105th adenine with thymine, 1st 189th substitution of the 9th adenine with thymine, 1st 18 Substitution of the 7th adenine with thymine, substitution of the 5th and 8th thymine with cytosine, substitution of the 1st and 32nd guanine with thymine, and 775th adenine to 8th 6 Includes a base sequence with
  • a kit for determining a subject at risk of developing or at risk of developing prostate cancer comprising a reagent for analyzing PCA-1 gene mutation.
  • the PCA-1 gene mutation analysis reagent can or should be used to determine a subject at risk of developing or at risk of developing prostate cancer.
  • prostate cancer of the present invention By using the method for determining prostate cancer of the present invention, it is possible to easily and highly sensitively determine a subject who is at risk of, or at risk of developing, prostate cancer. It is effective for diagnosis, follow-up, prediction of prognosis, pre-symptom diagnosis, carrier diagnosis, etc.
  • FIG. 1 is a graph showing the relationship between the MMS concentration and the number of adherent cells.
  • the vertical axis indicates the number of adherent cells as a relative value when the control group is taken as 100%.
  • the horizontal axis indicates the MMS concentration (mM).
  • the black column indicates the control group, the hatched column indicates the PCA-1WT transfusion group, and the white column indicates the PCA- ⁇ 777-865 transfection group.
  • prostate cancer is a concept that broadly encompasses cancers that have occurred in the prostate. Not only adenocarcinoma that has occurred in the prostate but also squamous cell carcinoma, transitional cell carcinoma, neuroendocrine cancer, undifferentiated cancer And the like.
  • the prostate cancer is an adenocarcinoma arising in the prostate.
  • PCA-1 is a molecule also called human AlkB homolog 3 (hABH3) or DEPC-1.
  • the nucleotide sequence (cDNA nucleotide sequence) of the normal human PCA-1 gene includes, for example, SEQ ID NO: 1, among which the 407th to 1267th residues (SEQ ID NO: 3) are included in the protein coding region.
  • SEQ ID NO: 3 the 407th to 1267th residues
  • PCA-11 polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.
  • the PC A-1 gene base sequence and The positions of the residues in the amino acid sequence are based on the sequences of SEQ ID NOS: 1 and 2, respectively.
  • the residues 923 to 1243 in SEQ ID NO: 1 and the amino acids 172 to 279 in SEQ ID NO: 2 correspond to the dealkynoleic acid active site of PCA-1.
  • the human PCA-1 gene is encoded by the locus of p11 on chromosome 1 and the nucleotide sequence of the PCA-1 gene and the chromosomal DNA around it is, for example, Gene Bank Accession No. NT_009237. (NCB I homepage).
  • the human PC A-1 gene contains 10 exons.
  • exon 1 is the 1st to 334th residue
  • exon 2 is the 335th to 485th residue
  • Exon 3 is the 486th residue and 592th residue
  • Exon 4 is the 593th and 624th residue
  • Exon 5 is the 625th and 670th residue
  • Exon 6 is the Exon 7 is the 776th residue
  • Exon 7 is the 865th residue
  • Exon 8 is the 866th residue
  • Exon 9 is the 1076th residue.
  • the 1172th residue, exon 10 corresponds to the 1173th—the 1520th residue, respectively.
  • the method for determining prostate cancer of the present invention comprises at least the following steps:
  • the PC A-1 gene derived from the subject is compared with a normal PC A-1 gene.
  • the comparison between the PCA-1 gene derived from the subject and the normal PCA_1 gene is not particularly limited, but is, for example, a comparison with the nucleotide sequence of mRNA, cDNA, chromosomal DNA, etc. of the normal PCA-1 gene.
  • “comparison with the base sequence of the normal PCA-1 gene” refers to not only the comparison with the full-length base sequence of the normal PCA-1 gene, but also the complementary sequence of the sequence, the partial sequence, and the complementary sequence of the partial sequence. It may be a comparison with the sequence of a specific residue.
  • the length of the partial sequence is at least 10 bases or more, preferably 30 bases or more.
  • Preferred embodiments of the partial sequence include the nucleotide sequence of the protein coding region of PCA-1 and the nucleotide sequence of the exon region of the PCA-1 gene.
  • Any method known per se can be used to analyze the presence or absence or the degree of mutation of the PCA-1 gene derived from the subject.
  • the nucleotide sequence of the PCA-1 gene in the polynucleotide derived from the subject may be determined.
  • any method currently used to detect base changes in the art such as the RFLP method, TaqMan test, oligonucleotide ligase method, single-stranded conformational polymorphism, nucleic acid oligonucleotides Test methods based on hybridization to an array, denaturing daradiant gel electrophoresis, PCR_SSPC, Southern blotting, Northern blotting, ASO, ARMS using mismatched primers, and the like can also be used.
  • the nucleotide sequence of the PCA_1 gene in the polynucleotide derived from the subject is determined.
  • the polynucleotide is first isolated or purified from the subject.
  • the polynucleotide preferably contains a PCA-1 gene from the subject.
  • the polynucleotide is isolated or purified from a sample derived from the subject, for example, a tissue, a cell, a liquid component, or the like.
  • the tissue is not particularly limited, but includes, for example, prostate, hair, skin and the like, and is preferably prostate.
  • the cells include both cells that have been separated from the subject and have not been cultured, and cells that have been separated and cultured from the living body. Examples include blood cells, prostate-derived cells and the like, and preferably prostate-derived cells.
  • liquid component examples include blood, semen, saliva, urine, and sweat.
  • polynucleotide examples include DNA (chromosomal DNA, cDNA, etc.) and RNA (total RNA, mRNA, cRNA, etc.), and are preferably chromosomal DNA, total RNA or mRNA.
  • the polynucleotide can be isolated or purified by a method known per se.
  • a method known per se for isolation or purification of the chromosomal DNA, for example, proteinase K / phenol extraction method, proteinase ⁇ phenol / clonal form extraction method, alkali dissolution method, boiling method, and the like can be used.
  • guanidine cesium monochloride ultracentrifugation method for example, guanidine cesium monochloride ultracentrifugation method, AGPC method (Acid guanidinium-Phenol-Chloroform method) and the like can be used.
  • AGPC method Acid guanidinium-Phenol-Chloroform method
  • commercially available kits such as TRIzol (manufactured by Life Technologies, Inc.) and Isogen (tsubonone: t) can also be used.
  • Isolation or purification of mRNA can be achieved by subjecting the purified tota1 RNA to an oligo dT column or the like.
  • the polynucleotide is RNA, particularly tota1 RNA or mRNA, it is preferable to synthesize cDNA by a method known per se utilizing reverse transcriptase or the like.
  • the PCA-1 gene in the polynucleotide is preferably amplified using the polynucleotide as a type III.
  • the type III polynucleotide is not particularly limited, but is preferably chromosomal DNA or cDNA.
  • the method of gene amplification is not particularly limited, but includes polymerase chain reaction (PCR), LAMP (Loop-mediated isothermal amplification) (see, for example, WO 00/28082), and ICAN (Isothermal and Chimeric primer-initiat).
  • PCR polymerase chain reaction
  • LAMP Loop-mediated isothermal amplification
  • ICAN Isothermal and Chimeric primer-initiat
  • ed Amplification of Nucleic acids see, for example, WO 00/56877
  • self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. Natl. Acad. Sci. USA 86: 1173-1177), Q- ⁇ replicase (Lizardi et al.
  • any of Taq polymerase and the like commonly used by those skilled in the art can be used.
  • a polymerase having relatively high fidelity for example, K0D Plus (T0Y0B 0 ⁇ ⁇ ⁇ ) etc. are used.
  • a pair of oligonucleotide primers capable of amplifying the gene is used.
  • the primer pair may be, for example, the information described in the present specification such as the nucleotide sequence of SEQ ID NO: 1 or the ⁇ 11 of human chromosome 11 disclosed in Genebank Accession No. NT_009237 (NCBI website).
  • a person skilled in the art can appropriately design based on the nucleotide sequence of the region described above, using an appropriate program such as Oligo 4.0.6 (Plymouth MN, manufactured by National Bioscience) or the like.
  • the region in which the primer pair is set is not particularly limited, but the primer pair is preferably a 426th guanine or a 429th nucleotide in SEQ ID NO: 1.
  • the region where the primer pair is set is not particularly limited, but the primer pair is preferably set so as to amplify the exonex region.
  • the staining corresponding to the above residues It is set so that at least one, more preferably two or more, and most preferably all residues on the body DNA can be amplified.
  • a plurality of primer pairs may be set.
  • the size of the oligonucleotide used as a primer can be appropriately selected, it is usually 10 to 1 OO bp, preferably 12 to 50 bp, more preferably 15 to 30 bp.
  • the GC content of the oligonucleotide used as a primer can be appropriately set, but is usually in the range of 20 to 80%, preferably 30 to 70%, and more preferably 40 to 60%.
  • the Tm value of the oligonucleotide used as a primer is usually set in the range of 60 ⁇ 20 ° C.
  • the Tm value varies depending on the salt concentration in the buffer and the like, but can be calculated by a method known per se, for example, the nearest neighbor method (for example, see “Biochemistry, 35, 3555-3562, 1996”).
  • Oligonucleotides may be either naturally occurring or synthesized, but can be synthesized by a phosphotriethyl method, a phosphodiester method, or the like, using a commonly used automatic nucleic acid synthesizer.
  • the primer is set so that the size of the amplification product is usually about 50 to 30,000 bp.
  • the size of the amplification product is preferably set to about 50 to 3000 bp, more preferably about 100 to 2000 bp.
  • Preferred primer pairs include, for example,
  • Primer 1 CTGAAAGCTCGGAGCAGMGC (SEQ ID NO: 4)
  • Primer 2 GGTCTACTGTGGGAACAG (SEQ ID NO: 5)
  • the nucleotide sequence of the amplified PCA-1 gene is determined by a well-known method. Preferred methods include those based on the incorporation of the terminal nucleotide into type II polymerase-generated copies using the method of Sanger et al. Alternative methods include, for example, adapter sequencing (PCTZUS95Z 12678), ligation-based sequencing (PCTZUS95Z). 96/05245), and sequencing by hybridization (AD Mirzabekov, TIBTechl 2: 27-32, 1994).
  • the presence or absence or the degree of mutation of the PCA-1 gene derived from the subject is analyzed.
  • the type ⁇ used in the above amplification is a chromosomal DNA
  • the nucleotide sequence contained in the exon region of the PCA-1 gene in the determined nucleotide sequence is replaced with the cDNA of the normal PCA-1 gene. Compare with the corresponding base sequence in the base sequence.
  • the type II used in the above amplification is cDNA
  • the determined nucleotide sequence is compared with the corresponding nucleotide sequence in the cDNA nucleotide sequence of the normal PCA-1 gene.
  • the subject When a mutation is detected in the PCA-1 gene derived from the subject, that is, one or more residues in the analyzed PCA-1 gene derived from the subject differ from the normal PCA-1 gene. If detected, the subject is considered at risk (or high) of developing prostate cancer or at risk (or high) of developing prostate cancer. Conversely, if no mutation is detected in the PCA-1 gene from the subject, the subject is not at risk (or low) of developing prostate cancer or at risk (or low) of developing prostate cancer. to decide. Further, in the method of the present invention, it can be determined that the greater the degree of mutation, the higher the risk that the subject has or has a higher risk of developing prostate cancer.
  • the “degree of mutation” refers to, for example, the number of mutation sites, the length of the base involved in the mutation, and the like.
  • the subject is at risk of developing or developing prostate cancer. Although it is judged that there is a risk, when both alleles have mutations, it can be judged that the risk is higher (or higher) than when only one mutation is present.
  • the method of the present invention can improve the accuracy of determination by using the method in combination with other methods for diagnosing prostate cancer.
  • Another prostate cancer diagnosis method is palpation ⁇ , methods using prostate-specific antigen (PSA) concentration in serum, etc., pathological examination using a prostate needle biopsy sample, ultrasonography, MRI, CT, bone scintigraphy, etc.
  • the method of the present invention can be used in combination with a test method using an index indicating that the expression of the PC A-1 gene is increased in prostate cancer tissue (see Non-Patent Document 1).
  • the site of mutation of the PCA-1 gene is not particularly limited.
  • the chromosomal DNA may be any of the regions encoding the PCA-1 gene (eg, an enhancer region, a promoter region, an exon region, an intron region, etc.), but is preferably an exon region or an intron region. Preferably, it is an exon region.
  • the site of mutation of the PCA-1 gene is preferably a protein coding region.
  • the type of mutation of the PCA-1 gene is not particularly limited, and examples thereof include a mutation S by substitution such as a missense mutation, a nonsense mutation or a silent mutation, a frame shift mutation caused by deletion, insertion, and the like.
  • the mutation is selected from the group consisting of a missense mutation, a nonsense mutation, a silent mutation, and a frameshift caused by deletion.
  • the mode of amino acid mutation in the missense mutation of the PC A-1 gene is not particularly limited.
  • the missense mutation is a 7th arginine, an 8th alanine, a 30th alanine, a 41st threonine, a 73rd aspartic acid, a 1st arginine of the PCA_1 polypeptide.
  • the type of amino acid after the substitution is not particularly limited.
  • the missense mutation is a mutation of the seventh arginine of PCA_1 polypeptide to leucine, a mutation of the eighth arayun to palin, a mutation of the thirtieth alanine to threonine, 4 Mutation of 1st threonine to isoleucine, 7th mutation of asparagine to asparagine, 13th mutation of glycine to arginine, 144th mutation of serine to proline 2nd and 8th aspartic acid glue
  • the mutation results in a mutation of amino acid selected from the group consisting of mutation to tamic acid, mutation of 233rd glutamic acid to aspartic acid, and mutation of 261st lysine to asparagine.
  • the missense mutation is an amino acid mutation in the dealkylating enzyme active site of PCA-1 polypeptide (corresponding to the 17th to 279th amino acid residues of PCA_l polypeptide), , 228th mutation of aspartic acid to glutamic acid, 233rd mutation of glutamic acid to aspartic acid, and 26th mutation of lysine to asparagine This is a mutation that causes a mutation in the amino acid to be changed.
  • the missense mutation is a mutation that causes a mutation of the 228th aspartic acid to glutamic acid in the PCA-1 polypeptide.
  • the nucleotide sequence encoding the amino acid after the mutation is not particularly limited.
  • the missense mutation is a mutation of the PCA-1 gene at the 426th guanine to a thymine, at the 429th mutation of a cytosine to a thymine, or at the 494th guanine to an adenine.
  • Mutation of the 5th and 8th cytosines to thymine, 6th and 23rd mutations of guanine to adenine, 8th and 15th mutations of guanine to adenine, 8th and 6th thymine A group consisting of a mutation to cytosine, a mutation of the 1900th cytosine to guanine, a mutation of the 1105th adenine to thymine, and a mutation of the 1189th adenine to thymine It is a mutation selected from
  • the mode of amino acid mutation in the nonsense mutation of the PCA-1 gene is not particularly limited, and the nonsense mutation may be a mutation that causes a mutation to the stop codon of the 26th lysine of the PCA-1 polypeptide. preferable.
  • the nucleotide sequence encoding the stop codon after the mutation is not particularly limited.
  • the nonsense mutation is a mutation of the 1187th adenine to thymine in the nucleotide sequence of the PCA-1 gene.
  • the mutation site in the silent mutation of the PCA_1 gene is not particularly limited, but the silent mutation is preferably the 568 th thymine of the PCA-1 gene, It is a mutation in a residue selected from the group consisting of the 113rd guanine, and more preferably a mutation in the 113rd guanine.
  • the base after the mutation is not particularly limited.
  • the silent mutation is a mutation selected from the group consisting of a mutation of the 568th thymine to cytosine and a mutation of the 113th guanine to thymine in the PCA-1 gene. is there.
  • the number, position, and the like of the deleted bases are not particularly limited.
  • the deletion is a deletion of one or more exon regions, more preferably, the deletion is a deletion of one exon region.
  • the exon region to be deleted is not particularly limited, but in the case of the human PCA-1 gene, preferably, it is exon 7 (residues 7777 to 1865 in SEQ ID NO: 1).
  • the present invention provides a method for substituting 426th guanine for thymine, 429th cytosine for thymine, and 494th guanine as compared to SEQ ID NO: 1.
  • the polynucleotide is a polynucleotide consisting of a nucleotide sequence having one or more substitutions selected from the above group as compared to SEQ ID NO: 1.
  • a polynucleotide which is a part of the above-mentioned polynucleotide and has one or more substitutions or deletions selected from the above-mentioned group as compared with SEQ ID NO: 1 is also included in the present invention.
  • the length of a part of the polynucleotide is at least 10 bp or more, preferably 30 bp or more.
  • the polynucleotide of the present invention can be used for analysis of mutations in the human PCA-1 gene.
  • the polynucleotide contains a PCA-1 gene having a mutation as a reagent such as a mismatch primer or a mismatch probe, or the like. Useful as a control.
  • an appropriate expression vector into which the polynucleotide of the present invention is functionally inserted is introduced into a host cell such as a prostate cancer cell, and after expressing the mutated PCA-1 polypeptide, the host By analyzing cells, etc., it is possible to study the association between PCA-1 gene mutation and prostate cancer. Therefore, the polynucleotide of the present invention is useful as a reagent for prostate cancer research.
  • the polynucleotide of the present invention is preferably isolated or purified.
  • the present invention relates to a method for substituting 426th guanine for thymine, 429th cytosine for thymine, and 494th guanyun adenine as compared to SEQ ID NO: 1.
  • Substitution of 528th cytosine with thymine, 623th guanine with adenine, 815th guanine with adenine, 836th Substitution of the thymine for cytosine, substitution of the 190th cytosine for guanine, substitution of the 110th adenine for thymine, substitution of the 1189th adenine for thymine,
  • substitutions or deletions selected from the group consisting of the substitution of adenine at position 187 to thymine and the deletion of the sequence from position 7 of adenine to position of position 865 of cytosine;
  • the present invention relates to a polypeptide comprising an amino acid sequence encoded by a nucleotide sequence
  • the present invention also includes a polypeptide which is a part of the above-mentioned polypeptide and which contains at least one amino acid substituted by the above-mentioned substitution or deletion.
  • the relevant part The length of the peptide is at least 6 amino acids or more, preferably 8 amino acids or more.
  • the polypeptides of the present invention are preferably isolated or purified.
  • the polypeptide of the present invention is useful as an immunogen for producing an antibody that immunospecifically recognizes the human PCA-1 polypeptide having the above mutation.
  • the present invention also relates to the antibody.
  • Immunospecific means that the antibody exhibits a substantially higher affinity for a particular polypeptide than its affinity for other polypeptides, under conditions where one of ordinary skill in the art would normally use the antibody. Means that.
  • the “other polypeptide” includes, for example, a normal human PCA-1 polypeptide.
  • Antibodies include natural antibodies such as polyclonal antibodies and monoclonal antibodies (mAbs), chimeric antibodies that can be produced using gene recombination techniques, humanized antibodies, single-chain antibodies, and transgenic animals that produce human antibodies.
  • the antibody is a polyclonal antibody, a monoclonal antibody or a binding fragment thereof.
  • the binding fragment means a partial region of the aforementioned antibody, specifically, for example, F (ab ') 2 , Fab, Fab, Fv variable fragment of antibody), sFv, dsFv (di sulphide s tabilised Fv) And dAb (single domain antibody) (Exp. Op in. Ther. Patents, Vol. 6, No. 5, p. 441-456, 1996).
  • the class of the antibody is not particularly limited, and includes antibodies having any isotype such as IgG, IgM, IgA, IgD or IgE. Preferably, it is IgG or IgM, and IgG is more preferable in consideration of ease of purification and the like.
  • the antibody of the present invention can be obtained, for example, by administering the polypeptide or the like to mammals such as mice and egrets (preferably mammals other than humans) using a conventional protocol.
  • the monoclonal antibody can be prepared according to the method of Koehler and Milstein et al. ( Nature , Vol. 256, p. 495-497, 1975) and modification methods analogous thereto.
  • a hybridoma producing an antibody that specifically reacts with the polypeptide of the present invention.
  • the corresponding control peptide substituted by the amino acid of the normal pCA-1 and the mutant site contained in the polypeptide of the present invention was used, and the reaction with the polypeptide of the present invention was performed.
  • a clone that does not react with the peptide can be selected.
  • the preparation of the polyclonal antibody is preferably performed by purifying the serum of an animal immunized with the polypeptide of the present invention using a column or the like to which the polypeptide of the present invention is bound. More preferably, in order to further increase the specificity, a fraction that can react with normal human PCA-1 is removed using a column to which the corresponding control peptide is bound.
  • the antibody of the present invention is preferably a saturated ammonium sulfate, a euglobulin precipitation method, a caproic acid method, a caprylic acid method, ion exchange chromatography (DEAE or DE52 or the like), an anti-immunoglobulin column or a protein A column, It is isolated or purified by affinity column chromatography using a column or the like cross-linked with an immunogen.
  • the antibody of the present invention immunospecifically recognizes a human PCA-1 polypeptide having a mutation, it can be subjected to, for example, Western blotting, immunohistochemical staining, ELISA, RIA, surface plasmon resonance, protein chip, etc. It is possible to analyze whether or not the examiner-derived PCA-1 gene has a mutation.
  • the method of the present invention for determining a subject at risk of developing or at risk of developing prostate cancer also includes a method using the above antibody.
  • the present invention also relates to a kit for determining a subject at risk of developing or at risk of developing prostate cancer, which kit includes a reagent for analyzing PCA-1 gene mutation.
  • the PCA-1 gene mutation analysis reagent can be used or used to determine a subject at risk of developing or at risk of developing prostate cancer. Further, a statement stating that it should be included is further included.
  • the reagent for PCA-1 gene mutation analysis may be any of the reagents used in the method of the present invention.
  • oligonucleotide primer pairs used to amplify the PCA-1 gene have been shown to contain the normal PCA-1 gene.
  • Immunizing isolated or purified polynucleotides, mutated human PCA-1 polypeptides already known to contain a mutated PCA-1 gene Specific examples include antibodies that bind specifically.
  • Tissue samples were collected from four postoperative specimens of prostate cancer patients who had never received chemotherapy or hormonal therapy.
  • a human prostate cancer cell line (PC-3, DU145, LN-CaP) was also used.
  • the collected tissues and cells were frozen and subjected to total RNA extraction.
  • the frozen sample was homogenized in TRIzol reagent (Life Technologies, Inc., Rockville, MD, USA), and total RNA was isolated according to the protocol provided by the manufacturer. DNA that might have been contaminated was removed by RNase-free DNasel (manufactured by Wako Pure Chemical Industries, Ltd.).
  • a reverse transcription reaction was performed using total RNA (5 ⁇ g), oligo dT primer and AMV reverse transcriptase (manufactured by Life Technologies, Inc.).
  • a part of the obtained cDNA was used to amplify the PCA-1 gene by PCR.
  • the composition of the PCR reaction mixture used was such that the above cDNA (20 ng), K0D dash (manufactured by T0Y0B0), dNTP (each 0.2 M), 10x K0D dash buffer ( 2.5 ⁇ 1), Primer 1 (SEQ ID NO: 4: 0.2 ⁇ ), and Primer 2 (SEQ ID NO: 5: 0.2 ⁇ ).
  • the reaction was performed using a DNA thermal cycler (DNA Thermal 1 Cycler 460, manufactured by PerkinElmer Inc.) for 35 cycles at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 1 minute and 30 seconds. Finally, it was performed under the condition of 72 ° C. for 10 minutes.
  • the reaction mixture was subjected to agarose gel electrophoresis to separate amplification products.
  • the band containing the amplification product was isolated, and the amplification product was purified by Concert (Life Technologies, Inc.
  • the amplification product was subcloned into pT7-vector (Novagen), and the nucleotide sequence was determined using PRISM 310 DNA sequencer (PerinElmer).
  • the determined nucleotide sequence was compared with the nucleotide sequence of SEQ ID NO: 1, and the amino acid sequence predicted from the determined nucleotide sequence was compared with the sequence of SEQ ID NO: 2, and the presence or absence of mutation was analyzed. Table 1 shows the results.
  • Primer 1 (SEQ ID NO: 4): CTGAAAGCTCGGAGCAGAAGC (corresponding to residues 373 to 393 in SEQ ID NO: 1)
  • Primer 2 (SEQ ID NO: 5): GGTCTACTGTGGGAACAG (corresponding to residues 1442 to 14459 in SEQ ID NO: 1)
  • Al30Thr means “mutation of the 30th alanine to threonine”.
  • Lys261 * means “mutation of 261st lysine to stop codon”
  • T568C means “mutation of 568th thymine to cytosine”.
  • Del (777-865) j means“ deletion of the 777th residue to the 865th residue ”.
  • Specimen Nos. 1 to 4 indicate cancerous parts of prostate cancer patients
  • Specimen No. 5 indicates LN-CaP cells
  • Specimen No. 6 indicates PC-3 cells
  • Specimen No. 7 indicates DU145 cells.
  • PCA-1WT The normal PCA-1 (PCA-1WT) gene and the PCA-1 (PCA- ⁇ 777-865) gene lacking the 777th to 865th bases were inserted into mammalian expression vector (pEGFP).
  • pEGFP mammalian expression vector
  • COS-7 cells lxlO 6
  • control group cells were transfected with an empty expression vector.
  • 0.25 mM methyl methanesulfonic acid (MMS) was added to induce alkylation damage of nucleic acids, and 24 hours later, the number of adherent cells was measured. The results are shown in Figure 1.
  • SEQ ID NO: 4 Oligonucleotide designed to act as a PCR primer to detect PCA-1 gene
  • SEQ ID NO: 5 Oligonucleotide designed to act as PCR primer for detecting PCA_1 gene

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Procédé consistant à évaluer un sujet testé courant le danger d'avoir développé un cancer de la prostate ou courant le danger d'être prêt à développer un cancer de la prostate, comprenant les étapes consistant à : (a) analyser la présence d'une quelconque mutation dans le gène PCA-1 dérivé du sujet testé ou le degré d'une telle mutation ; et (b) se prononcer vis-à-vis du sujet testé sur la présence du danger d'avoir développé un cancer de la prostate ou du danger d'être prêt à développer un cancer de la prostate ou sur le degré de ceux-ci sur la base de la présence d'une quelconque mutation dans le gène PCA-1 ou du degré de celle-ci. Ce procédé consistant à se prononcer sur un cancer de la prostate permet de façon simple et avec une grande sensibilité de se prononcer vis-à-vis de sujets testés courant le danger d'avoir développé un cancer de la prostate ou courant le danger d'être prêts à développer un cancer de la prostate. Par conséquent, le procédé est efficace dans le diagnostic du cancer de la prostate, l'observation de suivi, la prédiction d'un pronostique, le diagnostic avant que la maladie ne se déclare, le diagnostic de porteur, etc.
PCT/JP2004/012446 2004-02-23 2004-08-24 Procédé consistant à se prononcer sur un cancer de la prostate WO2005080562A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2006510150A JPWO2005080562A1 (ja) 2004-02-23 2004-08-24 前立腺癌の判定方法
US10/590,146 US20080020375A1 (en) 2004-08-24 2004-08-24 Method Of Adjudicating On Prostate Cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2004047036 2004-02-23
JP2004-047036 2004-02-23

Publications (1)

Publication Number Publication Date
WO2005080562A1 true WO2005080562A1 (fr) 2005-09-01

Family

ID=34879463

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/012446 WO2005080562A1 (fr) 2004-02-23 2004-08-24 Procédé consistant à se prononcer sur un cancer de la prostate

Country Status (2)

Country Link
JP (1) JPWO2005080562A1 (fr)
WO (1) WO2005080562A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014528693A (ja) * 2011-06-15 2014-10-30 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ 抗ヒトｅｐｏ受容体抗体及び使用方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002055700A2 (fr) * 2000-12-07 2002-07-18 Chiron Corp Genes humains et produits d'expression genetique isoles de la prostate humaine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002055700A2 (fr) * 2000-12-07 2002-07-18 Chiron Corp Genes humains et produits d'expression genetique isoles de la prostate humaine

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AAS P.A. ET AL.: "Human and bacterial oxidative demethylases repair alkylation damage in both RNA and DNA", NATURE, vol. 421, no. 6925, 20 February 2003 (2003-02-20), pages 859 - 863, XP002904183 *
DUNCAN T. ET AL.: "Reversal of DNA alkylation damage by two human dioxygenases", PROC. NATL. ACAD. SCI. USA, vol. 99, no. 26, 2002, pages 16660 - 16665, XP002277808 *
TSUJIKAWA K. ET AL.: "Expression and functional analysis of PCA-1 (hABH3), a new DNA and RNA alkylation damage repair enzyme", PROGRAM OF THE 26TH ANNUAL MEETING OF THE MOLECULAR BIOLOGY SOCIETY OF JAPAN, 25 November 2003 (2003-11-25) - 2003, KOBE, JAPAN, pages 525, XP002904181 *
TSUJIKAWA K. ET AL.: "Molecular cloning and expression analysis of DNA and RNA demethylase PCA-1 (hABH3)", PROCEEDINGS SIXTY-SECOND ANNUAL MEETING OF THE JAPANESE CANCER ASSOCIATION, 25 September 2003 (2003-09-25) - 27 September 2003 (2003-09-27), NAGOYA, pages 387 - 388, XP002904182 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014528693A (ja) * 2011-06-15 2014-10-30 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ 抗ヒトｅｐｏ受容体抗体及び使用方法
US9187563B2 (en) 2011-06-15 2015-11-17 Hoffmann-La Roche Inc. Anti-human EPO receptor antibodies and methods of use

Also Published As

Publication number Publication date
JPWO2005080562A1 (ja) 2007-08-02

Similar Documents

Publication Publication Date Title
KR101828290B1 (ko) 자궁내막암 마커
US20030027178A1 (en) Methods and kits for determining a cancer diagnosis and prognosis
US20040175744A1 (en) Polynucleotide sequences and corresponding encoded polypeptides of particular secreted and membrane-bound proteins overexpressed in certain cancers
WO2006014999A2 (fr) Compositions et methodes d'utilisation de modulateurs de nectine 4, de semaphorine 4b, d'igsf9 et de kiaa0152 dans le traitement de maladies
EP0756488B1 (fr) Detection d'alterations de genes antitumoraux pour le diagnostic du cancer
US6221621B1 (en) Methods of screening for colorectal cancers in which a complement Factor I or related protein is associated
TW201128190A (en) Identification of a novel gastric cancer biomarker and uses thereof
WO2006014903A2 (fr) Compositions et techniques d'utilisation d'antagonistes adam12 dans le traitement de maladie
WO2005080562A1 (fr) Procédé consistant à se prononcer sur un cancer de la prostate
JP2007119359A (ja) 癌抑制剤
Hung et al. Neurofibromatosis 2 phenotypes and germ-line NF2 mutations determined by an RNA mismatch method and loss of heterozygosity analysis in NF2 schwannomas
US7226731B1 (en) PB 39, a gene dysregulated in prostate cancer, and uses thereof
US8323916B2 (en) Method of detecting endometrial cancer comprising measuring levels of fibrocystin-L
JP4576168B2 (ja) 膀胱尿管逆流症または間質性膀胱炎の検査方法
EP1164190A1 (fr) Gene de la polyarthrite rhumatoide et procede permettant de diagnostiquer la polyarthrite rhumatoide
US20080020375A1 (en) Method Of Adjudicating On Prostate Cancer
WO1998039659A1 (fr) Criblage et traitement au moyen d'un regulateur du complement ou de proteines receptrices du complement
WO1998039659A9 (fr) Criblage et traitement au moyen d'un regulateur du complement ou de proteines receptrices du complement
US20090098544A1 (en) Marker molecules associated with lung tumors
JP4923252B2 (ja) 癌の判定方法および癌診断キット
JP5002749B2 (ja) 癌抑制剤
US20060292627A1 (en) PB39, a gene dysregulated in prostate cancer, and uses thereof
JP5354484B2 (ja) がん検出方法
WO2004061103A1 (fr) Nouvelle proteine et son gene
MXPA01012717A (es) Expresion genica modulada en inflamacion gastrointestinal.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006510150

Country of ref document: JP

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 10590146

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10590146

Country of ref document: US