WO2005075632A2 - Treatment of neurodegenerative diseases by the use of atp7a-modulators - Google Patents

Treatment of neurodegenerative diseases by the use of atp7a-modulators Download PDF

Info

Publication number
WO2005075632A2
WO2005075632A2 PCT/EP2004/013538 EP2004013538W WO2005075632A2 WO 2005075632 A2 WO2005075632 A2 WO 2005075632A2 EP 2004013538 W EP2004013538 W EP 2004013538W WO 2005075632 A2 WO2005075632 A2 WO 2005075632A2
Authority
WO
WIPO (PCT)
Prior art keywords
atp7a
secretase
beta
protein
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2004/013538
Other languages
English (en)
French (fr)
Other versions
WO2005075632A3 (en
Inventor
Carsten Hopf
Gerard Drewes
Heinz Ruffner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cellzome GmbH
Original Assignee
Cellzome GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cellzome GmbH filed Critical Cellzome GmbH
Priority to AU2004315399A priority Critical patent/AU2004315399B2/en
Priority to JP2006549894A priority patent/JP2007523893A/ja
Priority to CA002554362A priority patent/CA2554362A1/en
Priority to US10/587,426 priority patent/US20070280927A1/en
Priority to EP04803344A priority patent/EP1718741A2/en
Publication of WO2005075632A2 publication Critical patent/WO2005075632A2/en
Publication of WO2005075632A3 publication Critical patent/WO2005075632A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2814Dementia; Cognitive disorders
    • G01N2800/2821Alzheimer

Definitions

  • the copper transporter is required for the activation of copper-containing enzymes such as lysyl oxidase, tyrosinase, cytochrome C oxidase and Cu/Zn superoxide dismutase (Petris et al., 2000).
  • copper-containing enzymes such as lysyl oxidase, tyrosinase, cytochrome C oxidase and Cu/Zn superoxide dismutase (Petris et al., 2000).
  • Defects in ATP7A are associated with Menkes disease (MD) and occipital horn syndrome (OHS) in humans and are found in the 'mottled' mouse, a model for human MD.
  • fragment refers to a polypeptide of at least 10, 20, 30, 40 or 50 amino acids of the component protein according to the embodiment. In specific embodiments, such fragments are not larger than 35, 100 or 200 amino acids.
  • the term "inhibitor” refers to a biochemical or chemical compound which preferably inhibits or reduces the activity of ATP7A. This can e.g. occur via suppression of the expression of the corresponding gene. The expression of the gene can be measured by RT-PCR or Western blot analysis. Furthermore, this can occur via inhibition of the activity, e.g. by binding to ATP7A.
  • nucleic acids can be directly administered to a cell, or which can be produced intracelmlarly by transcription of exogenous, introduced sequences.
  • Modified internucleotide phosphate radicals and/or non- phosphorus bridges in a nucleic acid which can be employed in one of the uses according to the invention contain, for example, methyl phosphonate, phosphorothioate, phosphoramidate, phosphorodithioate and/or phosphate esters, whereas non-phosphorus internucleotide analogues contain, for example, siloxane bridges, carbonate bridges, carboxymethyl esters, acetamidate bridges and/or thioether bridges. It is also the intention that this modification should improve the durability of a pharmaceutical composition which can be employed in one of the uses according to the invention.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone.
  • the antisense oligonucleotides may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine,
  • the longer the hybridizing nucleic acid the more base mismatches with a component protein RNA it may contain and still form a stable duplex (or triplex, as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • binding protein or "binding peptide” refers to a class of proteins or peptides which bind and inhibit ATP7A, and includes, without limitation, polyclonal or monoclonal antibodies, antibody fragments and protein scaffolds directed against ATP7A.
  • polyclonal antibodies which are formed in the animal as a result of an immunological reaction can subsequently be isolated from the blood using well known methods and, for example, purified by means of column chromatography.
  • Monoclonal antibodies can, for example, be prepared in accordance with the known method of Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293-299).
  • the antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide.
  • ELISA enzyme linked immunosorbent assay
  • the antibody molecules can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG fraction.
  • antibodies specific for a protein or polypeptide of the invention can be selected for (e.g., partially purified) or purified by, e.g., affinity chromatography.
  • a substantially purified antibody composition is meant, in this context, that the antibody sample contains at most only 30% (by dry weight) of contaminating antibodies directed against epitopes other than those on the desired protein, or polypeptide of the invention, and preferably at most 20%, yet more preferably at most 10%, and most preferably at most 5% (by dry weight) of the sample is contaminating antibodies.
  • a purified antibody composition means that at least 99% of the antibodies in the composition are directed against the desired protein or polypeptide of the invention.
  • a monoclonal antibody directed against a polypeptide of the invention can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with the polypeptide of interest.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAP Phage Display Kit, Catalog No. 240612).
  • examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Patent No. 5,223,409; PCT Publication No.
  • recombinant antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region.
  • Fully human antibodies are particularly desirable for therapeutic treatment of human patients.
  • Such antibodies can be produced, for example, using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chains genes, but which can express human heavy and light chain genes.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
  • Monoclonal antibodies directed against the antigen can be obtained using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA and IgE antibodies.
  • Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection.”
  • a selected non-human monoclonal antibody e.g., a murine antibody
  • a completely human antibody recognizing the same epitope is used to guide the selection of a completely human antibody recognizing the same epitope.
  • ATP7A is part of the protein complexes regulating the proteolytic processing of APP, in particular by beta-secretase and/or gamma-secretase activity. Therefore, in a preferred embodiment, the inhibitor or interacting molecule modulates the activity of gamma secretase and/or beta-secretase.
  • the term "modulating the activity of gamma secretase and/or beta secretase” includes that the activity of the enzyme is modulated directly or indirectly. That means that the ATP7A modulator may either bind also directly to either of these enzymes or, more preferred, may exert an influence on ATP7A which in turn, e.g. by protein-protein interactions or by signal transduction or via small metabolites, modulates the activity of either of these enzymes.
  • beta secretase modulator inhibits the activity of beta secretase either completely or partially.
  • the most preferred functional consequence of a ATP7A modulator is a reduction in Abeta-42 generation.
  • Gamma secretase activity can e.g. measured by determining APP processing, e.g. by determining levels of Abeta peptide species produced, most importantly levels of Abeta-42 (see Example-section, infra).
  • Presenilins are involved in the proteolytical processing of Amyloid precursor protein (APP) (De Strooper et al, Nature 391, 387) and the Notch receptor (De Strooper et al, Nature 398, 518). In addition, Presenilins are associated with the cell-adhesion proteins alpha and beta-catenin, N- cadherin, and E-cadherin (Georgakopoulos et al, Mol Cell 4, 893) and other members of the armadillo family (Yu et al, J Biol Chem 273, 16470).
  • APP Amyloid precursor protein
  • Notch receptor De Strooper et al, Nature 398, 518.
  • Presenilins are associated with the cell-adhesion proteins alpha and beta-catenin, N- cadherin, and E-cadherin (Georgakopoulos et al, Mol Cell 4, 893) and other members of the armadillo family (Yu e
  • the gamma secretase activity could comprise a multimeric complex of these proteins (Yu et al, Nature 407, 48) but it is not known how the relationship between these proteins affects secretase activity.
  • the beta-secretase (BACE) activity cleaves APP in the ectodomain, resulting in shedding of secreted, soluble APPb, and in a 99-residue C-terminal transmembrane fragment (APP- C99).
  • BACEl transmembrane aspartic protease that had the characteristics of the postulated beta-secretase of APP, which they termed BACEl.
  • Brain and primary cortical cultures from BACEl knockout mice showed no detectable beta-secretase activity, and primary cortical cultures from BACE knockout mice produced much less amyloid-beta from APP. This suggests that BACEl, rather than its paralogue BACE2, is the main beta-secretase for APP.
  • BACEl is a protein of 501 amino acids containing a 21-aa signal peptide followed by a proprotein domain spanning aa 22 to 45.
  • BACE-I-457 and BACE-I-476 There are alternatively spliced forms, BACE-I-457 and BACE-I-476.
  • the lumenal domain of the mature protein is followed by one predicted transmembrane domain and a short cytosolic C-terminal tail of 24 aa.
  • BACEl is predicted to be a type 1 transmembrane protein with the active site on the lumenal side of the membrane, where beta-secretase cleaves APP and possible other yet unidentified substrates.
  • BACEl is clearly a key enzyme required for the processing of APP into A-beta, recent evidence suggests additional potential substrates and functions of BACEl (J. Biol. Chem. 279, 10542-10550).
  • no BACEl interacting proteins with regulatory or modulatory functions have been described. The elucidation of these protein interactors provides novel intervention points for therapy.
  • ATP7A is part of the protein complexes regulating beta-secretase and/or gamma secretase activity. Therefore, in a preferred embodiment, the inhibitor or interacting molecule modulates the activity of beta- secretase and/or gamma secretase.
  • beta secretase modulator inhibits the activity of beta secretase either completely or partially. With respect to the modulator of gamma secretase activity, it is preferred that this modulator inhibits gamma secretase activity. However, it is also preferred that the activity of gamma secretase is shifted in a way that more Abeta-40 is produced instead of Abeta- 42.
  • BACEl activity assays include but are not limited to: use of a cyclized enzyme donor peptide containing a BACEl cleavage site to reconstitute and measure beta-galactosidase reporter activity (Naqvi et al., J Biomol Screen.
  • the neurodegenerative disease is Alzheimer's disease.
  • the ATP7A interacting molecule is used to prepare a pharmaceutical composition.
  • the invention provides pharmaceutical compositions, which may be administered to a subject in an effective amount.
  • the therapeutic is substantially purified.
  • the subject is preferably an animal including, but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably human.
  • a non-human mammal is the subject.
  • compositions of the invention may be desirable to administer locally to the area in need of treatment.
  • This may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • administration can be by direct injection at the site (or former site) of a malignant tumor or neoplastic or pre-neoplastic tissue.
  • the therapeutic can be delivered in a vesicle, in particular a liposome (Langer, 1990, Science 249:1527-1533; Treat et al., 1989, In: Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler, eds., Liss, New York, pp. 353-365; Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)
  • the therapeutic can be delivered via a controlled release system.
  • a pump may be used (Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201-240; Buchwald et al., 1980, Surgery 88:507-516; Saudek et al., 1989, N. Engl. J. Med. 321:574-579).
  • the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (U.S. Patent No.
  • Water is a preferred carrier when the pharmaceutical composition is administered orally.
  • Saline and aqueous dextrose are preferred carriers when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions are preferably employed as liquid carriers for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • the amount of the therapeutic of the invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.
  • in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances.
  • suitable dosage ranges for intravenous administration are generally about 20-500 micrograms of active compound per kilogram body weight.
  • Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight.
  • Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • kits of the present invention can also contain expression vectors encoding the essential components of the complex machinery, which components after being expressed can be reconstituted in order to form a biologically active complex.
  • a kit preferably also contains the required buffers and reagents.
  • Optionally associated with such container(s) can be instructions for use of the kit and/or a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the invention further relates to a method for identifying a gamma secretase modulator and/or beta-secretase modulator, comprising the following steps: a. identifying a ATP7 A-interacting molecule by determining whether a given test compound is a ATP7A-interacting molecule, b. determining whether the ATP7A-interacting molecule of step a) is capable of modulating gamma secretase activity or beta-secretase activity.
  • step a) the test compound is brought into contact with ATP7A and the interaction of ATP7A with the test compound is determined. Preferably, it is measured whether the candidate molecule is bound to ATP7A.
  • Test or candidate molecules to be screened can be provided as mixtures of a limited number of specified compounds, or as compound libraries, peptide libraries and the like. Agents/molecules to be screened may also include all forms of antisera, antisense nucleic acids, etc., that can modulate complex activity or formation. Exemplary candidate molecules and libraries for screening are set forth below.
  • screening can be carried out by contacting the library members with a ATP7A immobilized on a solid phase, and harvesting those library members that bind to the protein (or encoding nucleic acid or derivative).
  • panning techniques
  • ATP7A-fragments and/or analogs are screened for activity as competitive or non-competitive inhibitors of the formation of a complex of ATP7A with other proteins, such as Psen2 (amount of complex or composition of complex) or ATP7A activity in the cell, which thereby inhibit complex activity or formation in the cell.
  • agents that modulate i.e., antagonize or agonize
  • ATP7A-activity or ATP7A-protein complex formation can be screened for using a binding inhibition assay, wherein agents are screened for their ability to modulate formation of a complex under aqueous, or physiological, binding conditions in which complex formation occurs in the absence of the agent to be tested.
  • Agents that interfere with the formation of complexes of the invention are identified as antagonists of complex formation.
  • Agents that promote the formation of complexes are identified as agonists of complex formation.
  • Agents that completely block the formation of complexes are identified as inhibitors of complex formation.
  • Methods for screening may involve labeling the component proteins of the complex with radioligands (e.g., 125 I or 3 H), magnetic ligands (e.g., paramagnetic beads covalently attached to photobiotin acetate), fluorescent ligands (e.g., fluorescein or rhodamine), or enzyme ligands (e.g., luciferase or ⁇ -galactosidase).
  • radioligands e.g., 125 I or 3 H
  • magnetic ligands e.g., paramagnetic beads covalently attached to photobiotin acetate
  • fluorescent ligands e.g., fluorescein or rhodamine
  • enzyme ligands e.g., luciferase or ⁇ -galactosidase.
  • the reactants that bind in solution can then be isolated by one of many techniques known in the art, including but not restricted to, co-immunoprecipitation of the labeled complex moiety using antisera against the unlabeled binding partner (or labeled binding partner with a distinguishable marker from that used on the second labeled complex moiety), immunoaffmity chromatography, size exclusion chromatography, and gradient density centrifugation.
  • the labeled binding partner is a small fragment or peptidomimetic that is not retained by a commercially available filter. Upon binding, the labeled species is then unable to pass through the filter, providing for a simple assay of complex formation.
  • the free species is labeled.
  • each can be labeled with a distinguishable marker such that isolation of both moieties can be followed to provide for more accurate quantification, and to distinguish the formation of homomeric from heteromeric complexes.
  • Typical binding conditions are, for example, but not by way of limitation, in an aqueous salt solution of 10-250 M NaCl, 5-50 mM Tris-HCl, pH 5-8, and 0.5% Triton X-100 or other detergent that improves specificity of interaction.
  • Metal chelators and/or divalent cations may be added to improve binding and/or reduce proteolysis.
  • Reaction temperatures may include 4, 10, 15, 22, 25, 35, or 42 degrees Celsius, and time of incubation is typically at least 15 seconds, but longer times are preferred to allow binding equilibrium to occur.
  • Particular complexes can be assayed using routine protein binding assays to determine optimal binding conditions for reproducible binding.
  • one of the binding species is immobilized on a filter, in a microtiter plate well, in a test tube, to a chromatography matrix, etc., either covalently or non-covalently.
  • Proteins can be covalently immobilized using any method well known in the art, for example, but not limited to the method of Kadonaga and Tjian, 1986, Proc. Natl. Acad. Sci. USA 83:5889-5893, i.e., linkage to a cyanogen-bromide derivatized substrate such as CNBr-Sepharose 4B (Pharmacia). Where needed, the use of spacers can reduce steric hindrance by the substrate.
  • Non-covalent attachment of proteins to a substrate include, but are not limited to, attachment of a protein to a charged surface, binding with specific antibodies, binding to a third unrelated interacting protein, etc.
  • Assays of agents for competition for binding of one member of a complex (or derivatives thereof) with another member of the complex labeled by any means (e.g., those means described above) are provided to screen for competitors or enhancers of complex formation.
  • blocking agents to inhibit non-specific binding of reagents to other protein components, or absorptive losses of reagents to plastics, immobilization matrices, etc. are included in the assay mixture.
  • Blocking agents include, but are not restricted to bovine serum albumin, casein, nonfat dried milk, Denhardfs reagent, Ficoll, polyvinylpyrolidine, nonionic detergents (NP40, Triton X-100, Tween 20, Tween 80, etc.), ionic detergents (e.g., SDS, LDS, etc.), polyethylene glycol, etc. Appropriate blocking agent concentrations allow complex formation.
  • Protein or protein complexes can be attached to an array by different means as will be apparent to a person skilled in the art. Complexes can for example be added to the array via a TAP-tag (as described in WO/0009716 and in Rigaut et al., 1999, Nature Biotechnol. 10:1030-1032) after the purification step or by another suitable purification scheme as will be apparent to a person skilled in the art.
  • TAP-tag as described in WO/0009716 and in Rigaut et al., 1999, Nature Biotechnol. 10:1030-1032
  • a sufficient rate of cross-linking can be checked f.e. by analysing the cross-linked complex vs. a non-cross-linked complex on a denaturating protein gel. If cross-linking has been performed successfully, the proteins of the complex are expected to be found in the same lane, whereas the proteins of the non-cross-linked complex are expected to be separated according to their individual characteristics.
  • the presence of all proteins of the complex can be further checked by peptide-sequencing of proteins in the respective bands using methods well known in the art such as mass spectrometry and/or Edman degradation.
  • proteins or the protein can be expressed as a single fusion protein and coupled to the matrix as will be apparent to a person skilled in the art.
  • Exemplary assays useful for measuring the production of Abeta-40 and Abeta-42 peptides by ELISA include but are not limited to those described in Vassar R et al., 1999, Science, 286:735-41.
  • Exemplary assays useful for measuring the production of C-terminal APP fragments in cell lines or transgenic animals by western blot include but are not limited to those described in Yan R et al, 1999, Nature, 402:533-7.
  • Exemplary assays useful for measuring the proteolytic activity of beta- or gamma secretases towards bacterially expressed APP fragments in vitro e.g. by modifying the expression of one or several interacting proteins in cells by means of RNAi (siRNA) and/or plasmids encoding the interacting protein(s)) of the Presinilin 2-complex (Psen2) and of the BACEl -complex include but are not limited to those described in Tian G et al., 2002, J Biol Chem, 277:31499-505.
  • Exemplary assays useful for measuring transactivation of a Gal4-driven reporter gene e.g. by modifying the expression of one or several interacting proteins in cells by means of RNAi (siRNA) and/or plasmids encoding the interacting protein(s)) of the Presinilin 2- complex (Psen2) and of the BACEl -complex include but are not limited to those described in Cao X et al, 2001, Science, 293:115-20.
  • Candidate molecules can be directly provided to a cell expressing the ATP7A-complex machinery, or, in the case of candidate proteins, can be provided by providing their encoding nucleic acids under conditions in which the nucleic acids are recombinantly expressed to produce the candidate protein.
  • Exemplary libraries are commercially available from several sources (ArQule, Tripos/PanLabs, ChemDesign, Pharmacopoeia). In some cases, these chemical libraries are generated using combinatorial strategies that encode the identity of each member of the library on a substrate to which the member compound is attached, thus allowing direct and immediate identification of a molecule that is an effective modulator. Thus, in many combinatorial approaches, the position on a plate of a compound specifies that compound's composition. Also, in one example, a single plate position may have from 1-20 chemicals that can be screened by administration to a well containing the interactions of interest. Thus, if modulation is detected, smaller and smaller pools of interacting pairs can be assayed for the modulation activity. By such methods, many candidate molecules can be screened.
  • libraries can be constructed using standard methods. Chemical (synthetic) libraries, recombinant expression libraries, or polysome-based libraries are exemplary types of libraries that can be used.
  • the libraries can be constrained or semirigid (having some degree of structural rigidity), or linear or nonconstrained.
  • the library can be a cDNA or genomic expression library, random peptide expression library or a chemically synthesized random peptide library, or non-peptide library.
  • Expression libraries are introduced into the cells in which the assay occurs, where the nucleic acids of the library are expressed to produce their encoded proteins.
  • the library screened is a biological expression library that is a random peptide phage display library, where the random peptides are constrained (e.g., by virtue of having disulfide bonding).
  • benzodiazepine library see e.g., Bunin et al, 1994, Proc. Natl. Acad. Sci. USA 91:4708-4712 may be used.
  • Confomiationally constrained libraries that can be used include but are not limited to those containing invariant cysteine residues which, in an oxidizing environment, cross-link by disulfide bonds to fomi cystines, modified peptides (e.g., incorporating fluorine, metals, isotopic labels, are phosphorylated, etc.), peptides containing one or more non-naturally occurring amino acids, non-peptide structures, and peptides containing a significant fraction of -carboxyglutamic acid.
  • the members of the peptide libraries that can be screened according to the invention are not limited to containing the 20 naturally occurring amino acids.
  • chemically synthesized libraries and polysome based libraries allow the use of amino acids in addition to the 20 naturally occurring amino acids (by their inclusion in the precursor pool of amino acids used in library production).
  • the library members contain one or more non-natural or non-classical amino acids or cyclic peptides.
  • Non-classical amino acids include but are not limited to the D-isomers of the common amino acids ⁇ - amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid; .
  • amino acid can be D (dextrorotary) or L (levorotary).
  • combinatorial chemistry can be used to identify modulators of a the complexes.
  • Combinatorial chemistry is capable of creating libraries containing hundreds of thousands of compounds, many of which may be structurally similar. While high throughput screening programs are capable of screening these vast libraries for affinity for known targets, new approaches have been developed that achieve libraries of smaller dimension but which provide maximum chemical diversity. (See e.g., Matter, 1997, J. Med. Chem. 40:1219-1229).
  • affinity fingerprinting has previously been used to test a discrete library of small molecules for binding affinities for a defined panel of proteins.
  • the fingerprints obtained by the screen are used to predict the affinity of the individual library members for other proteins or receptors of interest (in the instant invention, the protein complexes of the present invention and protein components thereof.)
  • the fingerprints are compared with fingerprints obtained from other compounds known to react with the protein of interest to predict whether the library compound might similarly react. For example, rather than testing every ligand in a large library for interaction with a complex or protein component, only those ligands having a fingerprint similar to other compounds known to have that activity could be tested. (See, e.g., Kauvar et al., 1995, Chem. Biol.
  • Kay et al. (1993, Gene 128:59-65) disclosed a method of constructing peptide libraries that encode peptides of totally random sequence that are longer than those of any prior conventional libraries.
  • the libraries disclosed in Kay et al. encode totally synthetic random peptides of greater than about 20 amino acids in length. Such libraries can be advantageously screened to identify complex modulators. (See also U.S. Patent No. 5,498,538 dated March 12, 1996; and PCT Publication No. WO 94/18318 dated August 18, 1994).
  • the interaction of the test compound with ATP7A results in an inhibition of ATP7A-activity.
  • step b) the ability of the gamma-secretase to cleave APP is measured. This can be measured as indicated above.
  • the invention also relates to a method for preparing a pharmaceutical composition for the treatment of neurodegenerative diseases, preferably Alzheimer's disease, comprising the following steps: a) identifying a gamma-secretase modulator and/or beta-secretase modulator, preferably inhibitor, according to the method of the invention, and b) formulating the gamma-secretase and/or beta-secretase modulator, preferably inhibitor, to a pharmaceutical composition.
  • this method of the invention further comprises the step of mixing the identified molecule with a pharmaceutically acceptable carrier as explained above.
  • the invention also relates to a pharmaceutical composition comprising a ATP7A-inhibitor as defined above.
  • the invention is also directed to a method for treating or preventing a neurodegenerative disease, preferably Alzheimer's disease, comprising administering to a subject in need of such treatment or prevention a therapeutically effective amount of a pharmaceutical composition of the invention.
  • a neurodegenerative disease preferably Alzheimer's disease
  • TAP-technology which is more fully described in EP 1 105 508 Bl and in Rigaut, et al, 1999, Nature Biotechnol. 17:1030-1032 respectively, was used and further adapted as described below for protein purification. Proteins were identified using mass spectrometry as described further below.
  • ATP7A was identified as a member of a protein complexes with the TAP technology entry points Psen2. Part 1: Construction of TAP-tagged bait
  • N-terminal tagging was chosen for the following baits/entry points: Presenilin 1, Presenilin 2, Aph-la, Aph-lb, Pen-2, APP, Tau, Fe65, Calsenilin.
  • Clones were analyzed by restriction digest, DNA sequencing and by in vitro translation using the TNT T7 Quick Coupled Transcription/Translation System (Promega inc.). The presence of the proteins was proven by Western blotting using the protein A part of the TAP-tag for detection. Briefly, separation of proteins by standard SDS-PAGE was followed by semi-dry transfer onto a nitrocellulose membrane (PROTRAN, Schleicher&Schuell) using the Multiphorll blotting apparatus from Pharmacia Biotech. The transfer buffer consisted of 48 mM Tris, 39 mM glycine, 10%> methanol and 0,0375% sodium dodecylsulfate.
  • Part 2 Preparation of Virus and infection
  • a MoMLV-based recombinant virus was used as a vector. The preparation has been carried out as follows:
  • Virus 293 gp cells were grown to 100% confluency. They were split 1:5 on poly-L-Lysine plates (1 :5 diluted poly-L-Lysine [0.01% stock solution, Sigma P-4832] in PBS, left on plates for at least 10 min.). On Day 2, 63 microgram of retroviral Vector DNA together with 13 microgram of DNA of plasmid encoding an appropriate envelope protein were transfected into 293 gp cells (Somia, et al., 1999, Proc. Natl. Acad. Sci. USA 96:12667-12672; Somia, et al. 2000, J. Virol. 74:4420-4424).
  • the filtered supernatant was ultracentrifuged at 19400 rpm in the SW 28 rotor, for 2 hours at 21 degree Celsius. The supernatant was discarded.
  • the pellet containing viruses was resuspended in a small volume (for example 300 microliter) of Hank's Balanced Salt Solution [Gibco BRL sure 14025-092], by pipetting up and down 100-times, using an aerosol-safe tip. The viruses were used for transfection as described below.
  • the expression pattern of the TAP-tagged protein was checked by immunoblot analysis and/or by immunofluorescence. Immunofluorescence analysis was either carried out according to No. 1 or to No. 2 depending on the type of the TAP-tagged protein. Immunoblot analysis was carried out according to No. 3.
  • Incubation of the primary antibodies was performed in the blocking solution overnight at +4°C. The proper dilution of the antibodies was determined in a case to case basis. Cells were washed in PBS containing 0.3% Saponin for 2x 20 minutes at room temperature. Incubation of the secondary antibodies is performed in the blocking solution. Alexa 594 coupled goat anti-rabbit is diluted 1:1000 (Molecular Probes). Alexa 488 coupled goat anti-mouse is diluted 1:1000 (Molecular Probes). DAPI was used to label DNA. If Phalloidin was used to label F-actin, the drug is diluted 1 :500 and incubated with the secondary antibodies. Cells were then washed again 2x 20 minutes at room temperature in PBS. The excess of buffer was removed and cells were mounted in a media containing an anti-bleaching agent (Vectashield, Vector Laboratories).
  • an anti-bleaching agent Vectashield, Vector Laboratories
  • Blocking was then done in 1% Bovine Serum Albumin (BSA) in 0.3% Saponin + PBS for at least 1 hour at RT (Blocking solution). Incubation of the primary antibodies was performed in the blocking solution, overnight at +4°C. The proper dilution of the antibodies has to be determined in a case to case basis. Cells were washed in PBS containing 0.3%> Saponin, for 2x 20 minutes at RT. Incubation of the secondary antibodies was performed in the blocking solution. Alexa 594 coupled goat anti-rabbit is diluted 1:1000 (Molecular Probes), Alexa 488 coupled goat anti-mouse is diluted 1:1000 (Molecular Probes). DAPI was used to label DNA.
  • BSA Bovine Serum Albumin
  • Phalloidin is used to label F-actin
  • the drug is diluted 1:500 and incubated with the secondary antibodies. Cells were washed 2x 20 minutes at RT in PBS. The excess of buffer was removed and cells were mounted in a media containing an anti- bleaching agent (Vectashield, Vector Laboratories).
  • a cell pellet (from a 6-well dish) was lyzed in 60 ⁇ l DNAse I buffer (5% Glycerol, 100 mM NaCl, 0.8 % NP-40 (IGEPAL), 5 mM magnesium sulfate, 100 ⁇ g/ml DNAse I (Roche Diagnostics), 50 mM Tris, pH 7.5, protease inhibitor cocktail) for 15 min on ice. Each sample was split into two aliquots. The first half was centrifuged at 13,000 rpm for 5 min. to yield the NP-40-extractable material in the supernatant; the second half (total material) was carefully triturated.
  • DNAse I buffer 5% Glycerol, 100 mM NaCl, 0.8 % NP-40 (IGEPAL), 5 mM magnesium sulfate, 100 ⁇ g/ml DNAse I (Roche Diagnostics), 50 mM Tris, pH 7.5, protease inhibitor cocktail
  • Electrotransfer of two gels at once was performed at 600 mA for 25 min. Transferred proteins were visualized with Ponceau S solution for one min to control transfer efficiency and then destained in water.
  • the membrane was blocked in 5%> non-fat milk powder in TBST (TBS containing 0.05% Tween-20) for 30 min at room temperature. It was subsequently incubated with HRP-coupled PAP antibody (1:5000 diluted in 5% milk/TBST) for 1 h at room temperature, washed three times for 10 min in TBST. The blot membrane was finally soaked in chemiluminescent substrate (ECL, Roche Diagnostics) for 2 min. and either exposed to X-ray film or analyzed on an imaging station.
  • chemiluminescent substrate ECL, Roche Diagnostics
  • Protein complex purification was adapted to the sub-cellular localization of the TAP- tagged protein and was performed as described below.
  • CZ lysis buffer 50 mM Tris-Cl, pH 7.4; 5 % Glycerol; 0,2 % IGEPAL; 1.5 mM MgCl 2 ; 100 mM NaCl; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT; containing 1 tablet of EDTA- free Protease inhibitor cocktail (CompleteTM, Roche) per 25 ml of buffer) and homogenized by 10 strokes of a tight-fitted pestle in a dounce homogenizer.
  • CZ lysis buffer 50 mM Tris-Cl, pH 7.4; 5 % Glycerol; 0,2 % IGEPAL; 1.5 mM MgCl 2 ; 100 mM NaCl; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT; containing 1 tablet of EDTA- free Protease inhibitor cocktail (CompleteTM, Roche) per 25 ml of buffer
  • the lysate was incubated for 30 min on ice and spun for 10 min at 20,000g.
  • the supernatant was subjected to an additional ultracentrifugation step for 1 h at 100,000g.
  • the supernatant was recovered and rapidly frozen in liquid nitrogen or immediately processed further.
  • the membrane pellet was resuspended in 7,5 ml of Membrane-Lysis buffer containing 0.8% n-Dodecyl- ⁇ -D-maltoside and incubated for 1 h at 4°C with constant agitation.
  • the sample was subjected to another ultracentifugation step for lh at 100,000g and the solubilized material was quickly frozen in liquid nitrogen or immediately processed further.
  • the lysate was spun for 10 min at 2,000g and the resulting supernatant (SI) saved on ice.
  • the nuclear pellet (PI) was resuspended in 5 ml Nuclear- Lysis buffer (50 mM Tris, pH 7.4; 1.5 mM MgCl 2 ; 20 % Glycerol; 420 mM NaCl; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT; containing 1 tablet of EDTA-free Protease inhibitor cocktail (CompleteTM, Roche) per 25 ml of buffer) and incubated for 30 min on ice.
  • Nuclear- Lysis buffer 50 mM Tris, pH 7.4; 1.5 mM MgCl 2 ; 20 % Glycerol; 420 mM NaCl; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT; containing 1 tablet of EDTA-free Protease inhibitor cocktail (CompleteTM
  • the sample was combined with SI, further diluted with 7 ml of Dilution buffer (110 mM Tris, pH 7.4; 0.7 % NP40; 1.5 mM MgCl 2 ; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT), incubated on ice for 10 min and centrifuged at 100,000g for lh. The final supernatant (S2) was frozen quickly in liquid nitrogen.
  • Dilution buffer 110 mM Tris, pH 7.4; 0.7 % NP40; 1.5 mM MgCl 2 ; 25 mM NaF; 1 mM Na 3 VO 4 ; 1 mM DTT
  • Immobilized protein complexes were washed with 10 ml of CBP wash buffer (10 mM Tris, pH 7.4; 100 mM NaCl; 0,1 % IGEPAL; ImM MgAc; ImM Imidazole; ImM DTT; 2 mM CaCl 2 ) and eluted by addition of 600 ⁇ l CBP elution buffer (10 mM Tris, pH 8.0; 5 mM EGTA) for 5 min at 37°C. The eluate was recovered in a siliconzed tube and lyophilized. The remaining Calmodulin resin was boiled for 5 min in 50 ⁇ l 4x Laemmli sample buffer. The sample buffer was isolated, combined with the lyophilised fraction and loaded on aNuPAGE gradient gel (Invitrogen, 4-12%, 1.5 mm, 10 well).
  • CBP wash buffer 10 mM Tris, pH 7.4; 100 mM NaCl; 0,1 % IGEPAL; ImM MgAc; ImM Imidazo
  • Gel-separated proteins were reduced, alkylated and digested in gel essentially following the procedure described by Shevchenko et al., 1996, Anal. Chem. 68:850-858. Briefly, gel- separated proteins were excised from the gel using a clean scalpel, reduced using 10 mM DTT (in 5mM ammonium bicarbonate, 54°C, 45 min) and subsequently alkylated with 55 mM iodoacetamid (in 5 mM ammonium bicarbonate) at room temperature in the dark (30 min).
  • Reduced and alkylated proteins were digested in gel with porcine trypsin (Promega) at a protease concentration of 12.5 ng/ ⁇ l in 5mM ammonium bicarbonate. Digestion was allowed to proceed for 4 hours at 37°C and the reaction was subsequently stopped using 5 ⁇ l 5% formic acid.
  • Peptide samples were injected into a nano LC system (CapLC, Waters or Ultimate, Dionex) which was directly coupled either to a quadrupole TOF (QTOF2, QTOF Ultima, QTOF Micro, Micromass or QSTAR Pulsar, Sciex) or ion trap (LCQ Deca XP) mass spectrometer.
  • Peptides were separated on the LC system using a gradient of aqueous and organic solvents (see below).
  • Solvent A was 5% acetonitrile in 0.5% formic acid and solvent B was 70% acetonitrile in 0.5% formic acid.
  • Table 1 Peptides eluting off the LC system were partially sequenced within the mass spectrometer.
  • Protein identification The peptide mass and fragmentation data generated in the LC-MS/MS experiments were used to query fasta formatted protein and nucleotide sequence databases maintained and updated regularly at the NCBI (for the NCBInr, dbEST and the human and mouse genomes) and European Bioinformatics Institute (EBI, for the human, mouse, D. melanogaster and C. elegans proteome databases). Proteins were identified by correlating the measured peptide mass and fragmentation data with the same data computed from the entries in the database using the software tool Mascot (Matrix Science; Perkins et al., 1999, Electrophoresis 20:3551-3567). Search criteria varied depending on which mass spectrometer was used for the analysis.
  • NCBI for the NCBInr, dbEST and the human and mouse genomes
  • EBI European Bioinformatics Institute
  • siRNAs A and B directed against ATP7A or siRNAs directed against known effectors of APP processing, BACEl or nicastrin, or against unrelated Luc3 was transfected into SK-N-BE2 neuroblastoma cells expressing human APP695.
  • SiRNAs for human ATP7A were synthesized by Dharmacon Research Inc..
  • sequences of the siRNAs used for ATP7A are: AAAGCAGATTGAAGCTATGGG (A) and AACACAGAGGGATCCTATACT (B).
  • Transfection of SK-N-BE2 cells was performed using LipofectAMINE 2000 (Invitrogen) following the manufacturer's instructions. Briefly, the cells were seeded at a density of 1.0 x 10 cells in a final volume of 85 ⁇ l per 96-well 12-16 hrs prior to transfection. 25 nM of siRNAs were mixed with 8 ⁇ l Opti-MEM buffer (Gibco) and 60 ng carrier DNA, and the mixture was incubated for 20 minutes at room temperature before addition to the cells. 16 and 48 hrs post-transfection medium was replaced with 100 ⁇ l or 200 ⁇ l growth medium with or without serum, respectively. 72 hrs post-transfection 100 ⁇ l supematants were harvested for A ⁇ l -42 ELISA (Innogenetics). The assay was performed following the manufacturer's instructions.
  • Knockdown efficiency of selected siRNAs was assessed by quantitative RT-PCR. Briefly, 5x 10°5 SKNBE2 cells were plated per 6-well and transfected with 25 nM siRNA the following day. 36 h after transfection, cells were harvested and total RNA was prepared and reverse-transcribed using standard procedures. Equal amounts of cDNAs and ATP7A- specific primers were utilized for determination of relative expression levels of ATP7A following manufacturer's instructions. All values were normalized to a human reference RNA (Stratagene).
  • ferroxidase FetSp is dysfunctional resulting in an iron-deficient phenotype.
  • a human copper- transporting ATPase such as ATP7B (His et al., 2004) or ATP7A, complements this phenotype. Consequently, the activity of ATP7A can be quantified by measuring the extent of functional complementation of the iron-deficient phenotype, i.e. by the quantifying the ability of the yeast cells to grow in iron-limited medium.
  • inhibitors of ATP7A may be identified by their ability to counter-act said functional complementation, i.e. by their ability to cessation of growth in iron-limited medium.
  • ferroxidase activity can also be measured in ccc2p-deficient yeast strains as a more sensitive indicator of copper transport function (Hsi et al., 2004) in order to quantify ATP7A activity.
  • metal ion-dependent ATPase activity of ATP7A (for example, as obtained by purification of TAP-ATP7A) is assayed at 37 °C either by the pyruvate kinase/lactate dehydrogenase-coupled assay or by a colorimetric method that measures phosphate release at fixed time intervals (Hou et al., 2001 and references therein).
  • the activity of ATP7A can also be determined by measuring the intracellular copper (preferably 64 Cu) accumulation (Bellingham et al, 2004).
  • Inhibitors of ATP7A may be identified as agents that cause intracellular copper (preferably 64 Cu) accumulation (Bellingham et al., 2004).
  • Example 4 Modulation of A ⁇ l-42 generation/secretion by ATP7A modulators
  • SKNBE2 cells (or another suitable cell line) stably over-expressing human APP695 (SKNBE2/APP695) or a suitable mutant with enhanced beta-/gamma-secretase cleavage kinetics are plated in growth medium and serum-starved for 4 h the next morning.
  • a ATP7A modulator preferably inhibitor, diluted in serum-free medium, is then added and incubated for suitable periods of time.
  • Cell supematants are collected and levels of A ⁇ l -42 determined by ELISA (Innotest ⁇ -amyloid (1-42) from INNOGENETICS N.V., Belgium Innogenetics).
  • FIG. 1 siRNA-mediated knock-down of ATP7A expression attenuates secretion ofABl-42.
  • Fig. 1A SiRNAs directed against BACEl, nicastrin, ATP7A (siRNA A or siRNA B) or Luc3 were transfected into SK-N-BE2 neuroblastoma cells over-expressing APP695. 48h after transfection growth medium was removed and cells were incubated over night in serum- free medium. Supematants were collected and levels of A ⁇ l -42 determined by ELISA (Innogenetics). At least three independent experiments were performed in duplicate. A representative example is shown.
  • Fig.lB SiRNAs directed against ATP7A (siRNA A and siRNA B), but not a siRNA directed against unrelated Luc3 specifically reduce ATP7A- mRNA as assessed by quantitative RT-PCR analysis. Two bars shown for each siRNA represent two independent experiments.
  • Figure 2 Amino acid sequence of human ATP7A (Copper-transporting ATPase 1), depicted in the one-letter-code.
  • Figure 3 Multiple sequence alignment of human ATP7A and ATP7B.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Virology (AREA)
PCT/EP2004/013538 2004-01-29 2004-11-29 Treatment of neurodegenerative diseases by the use of atp7a-modulators Ceased WO2005075632A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2004315399A AU2004315399B2 (en) 2004-01-29 2004-11-29 Treatment of neurodegenerative diseases by the use of ATP7A-modulators
JP2006549894A JP2007523893A (ja) 2004-01-29 2004-11-29 Atp7aの使用による、神経変性疾患の治療
CA002554362A CA2554362A1 (en) 2004-01-29 2004-11-29 Treatment of neurodegenerative diseases by the use of atp7a inhibitors
US10/587,426 US20070280927A1 (en) 2004-01-29 2004-11-29 Treatment Of Neurodegenerative Diseases By The Use Of Atp7a
EP04803344A EP1718741A2 (en) 2004-01-29 2004-11-29 Treatment of neurodegenerative diseases by the use of atp7a

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP04001895.4 2004-01-29
EP04001895 2004-01-29
EP2004004891 2004-05-07
EPPCT/EP2004/004891 2004-05-07

Publications (2)

Publication Number Publication Date
WO2005075632A2 true WO2005075632A2 (en) 2005-08-18
WO2005075632A3 WO2005075632A3 (en) 2005-11-10

Family

ID=37818137

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/013538 Ceased WO2005075632A2 (en) 2004-01-29 2004-11-29 Treatment of neurodegenerative diseases by the use of atp7a-modulators

Country Status (7)

Country Link
US (1) US20070280927A1 (cg-RX-API-DMAC7.html)
EP (1) EP1718741A2 (cg-RX-API-DMAC7.html)
JP (1) JP2007523893A (cg-RX-API-DMAC7.html)
CN (2) CN1925869A (cg-RX-API-DMAC7.html)
AU (1) AU2004315399B2 (cg-RX-API-DMAC7.html)
CA (1) CA2554362A1 (cg-RX-API-DMAC7.html)
WO (1) WO2005075632A2 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9833420B2 (en) 2003-02-27 2017-12-05 JoAnne McLaurin Methods of preventing, treating, and diagnosing disorders of protein aggregation

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0700645D0 (en) * 2007-01-12 2007-02-21 Eisai London Res Lab Ltd Targets for disease therapy
EP2022848A1 (en) * 2007-08-10 2009-02-11 Hubrecht Institut A method for identifying, expanding, and removing adult stem cells and cancer stem cells
KR101076612B1 (ko) 2009-01-14 2011-10-26 재단법인 아산사회복지재단 윌슨병 진단용 조성물
PH12020551219A1 (en) * 2018-02-14 2021-04-19 Deep Genomics Incorporated Oligonucleotide therapy for wilson disease
US11471497B1 (en) 2019-03-13 2022-10-18 David Gordon Bermudes Copper chelation therapeutics
CN119979502B (zh) * 2025-03-13 2025-09-26 华中科技大学 一种防治tau疾病的多肽及其应用

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8308235D0 (en) * 1983-03-25 1983-05-05 Celltech Ltd Polypeptides
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4980286A (en) * 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
US5225539A (en) * 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5198346A (en) * 1989-01-06 1993-03-30 Protein Engineering Corp. Generation and selection of novel DNA-binding proteins and polypeptides
US5096815A (en) * 1989-01-06 1992-03-17 Protein Engineering Corporation Generation and selection of novel dna-binding proteins and polypeptides
US5498538A (en) * 1990-02-15 1996-03-12 The University Of North Carolina At Chapel Hill Totally synthetic affinity reagents
US5633425A (en) * 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5545806A (en) * 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
ATE158021T1 (de) * 1990-08-29 1997-09-15 Genpharm Int Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper
US5661016A (en) * 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5625126A (en) * 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5582981A (en) * 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target
WO1998015828A1 (en) * 1996-10-07 1998-04-16 Scios Inc. Method to identify direct inhibitors of the beta-amyloid forming enzyme gamma-secretase
DE19941039A1 (de) * 1999-08-28 2001-03-01 Boehringer Ingelheim Pharma gamma-Sekretase in vitro Testsystem

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9833420B2 (en) 2003-02-27 2017-12-05 JoAnne McLaurin Methods of preventing, treating, and diagnosing disorders of protein aggregation

Also Published As

Publication number Publication date
AU2004315399A1 (en) 2005-08-18
WO2005075632A3 (en) 2005-11-10
CN1925869A (zh) 2007-03-07
AU2004315399B2 (en) 2009-08-06
EP1718741A2 (en) 2006-11-08
JP2007523893A (ja) 2007-08-23
CA2554362A1 (en) 2005-08-18
US20070280927A1 (en) 2007-12-06
CN1934251A (zh) 2007-03-21

Similar Documents

Publication Publication Date Title
EP1670903B1 (en) Treatment of neurodegenerative diseases
WO2006056467A1 (en) Use of eph receptor inhibitors for the treatment of neurodegenerative diseases
EP1786442B1 (en) Treatment of neurodegenerative diseases by the use of degs inhibitors
AU2004315111B2 (en) Treatment of neurodegenerative diseases by the use of GPR49
WO2005023858A1 (en) Protein complexes associated with app-processing
AU2004315399B2 (en) Treatment of neurodegenerative diseases by the use of ATP7A-modulators
EP1732649B1 (en) Treatment of neurodegenerative diseases by the use of laptm4b
US20080038249A1 (en) Treatment Of Neurodegenerative Diseases By The Use Of Laptm4a
US20060264610A1 (en) Protein complexes of the tip60 transcriptional activator protein
HK1100867A (en) Treatment of neurodegenerative diseases by the use of atp7a
HK1100746A (en) Treatment of neurodegenerative diseases by the use of gpr49

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004315399

Country of ref document: AU

Ref document number: 2554362

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2006549894

Country of ref document: JP

Ref document number: 2799/CHENP/2006

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: DE

ENP Entry into the national phase

Ref document number: 2004315399

Country of ref document: AU

Date of ref document: 20041129

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004315399

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004803344

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200480042299.1

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2004803344

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10587426

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10587426

Country of ref document: US