WO2005063980A1 - Procede de construction enzymatique d'une bibliotheque d'arni - Google Patents

Procede de construction enzymatique d'une bibliotheque d'arni Download PDF

Info

Publication number
WO2005063980A1
WO2005063980A1 PCT/JP2004/019612 JP2004019612W WO2005063980A1 WO 2005063980 A1 WO2005063980 A1 WO 2005063980A1 JP 2004019612 W JP2004019612 W JP 2004019612W WO 2005063980 A1 WO2005063980 A1 WO 2005063980A1
Authority
WO
WIPO (PCT)
Prior art keywords
rnai
dna
library
adapter
gene
Prior art date
Application number
PCT/JP2004/019612
Other languages
English (en)
Japanese (ja)
Other versions
WO2005063980A8 (fr
Inventor
Kenzo Hirose
Daisuke Shirane
Kohtaroh Sugao
Shigeyuki Namiki
Masamitsu Iino
Original Assignee
Toudai Tlo, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Toudai Tlo, Ltd. filed Critical Toudai Tlo, Ltd.
Priority to JP2005516704A priority Critical patent/JP4747245B2/ja
Publication of WO2005063980A1 publication Critical patent/WO2005063980A1/fr
Publication of WO2005063980A8 publication Critical patent/WO2005063980A8/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised

Definitions

  • the present invention relates to a method for constructing an RNAi library based on a DNA expression vector, and particularly to a method for enzymatically constructing a systematic library for a target sequence.
  • the present invention relates to a screening method for selecting an appropriate iRNA expression construct capable of silencing a target gene or the like using the above-described RNAi library constructed enzymatically.
  • Non-Patent Documents 1-5 A reverse genetics approach that determines the function of each gene by functional loss using the large amount of genome data currently available (Non-Patent Documents 1-5) has It has become an important technique to fully elucidate the relationship. Techniques for implementing the reverse genetics approach include the creation of knockout animals by gene targeting or antisense techniques.
  • Non-Patent Document 6 Gene targeting technology by homologous recombination (Non-Patent Document 6) is widely used to determine the functions of various genes. However, the process is labor intensive and cannot be applied simply and widely. Also, antisense oligonucleotides can be used more conveniently, but their introduction often results in toxicity, instability, and non-specific effects (Non-Patent Document 7).
  • RNA interference a gene suppression phenomenon induced by double-stranded RNA
  • Non-Patent Document 8 RNA interference
  • Non-Patent Document 8 RNA interference
  • Non-Patent Document 10 RNA interference has also been applied to genome-wide reverse genetics in C. elegans (Non-Patent Document 10).
  • the use of RNAi was initially limited to invertebrates because long (> 30 nucleotides) double-stranded RNAs in higher vertebrates induced harmful interferon responses!
  • RNAi short interfering RNA
  • Strand RNA force was overcome by the finding that RNAi is induced in mammals without causing adverse events (Non-Patent Document 11).
  • Transient oligo siRNA effects are overcome by the development of DNA vectors that express siRNAs or short-chain, hairpin-shaped double-stranded RNAs (shRNAs) in cells that mimic siRNAs. (Non-Patent Documents 12-17).
  • Non-Patent Document 2 Adams, M.D. et al. The genome sequence of Drosophila
  • Patent Document 3 Waterston, R.H. et al. Initial sequencing and comparative analysis of the mouse genome.Nature 420, 520-562 (2002).
  • Patent Document 4 Lander, E.S. et al. Initial sequencing and analysis of the human genome.Nature 409, 860—921 (2001).
  • Non-Patent Document 5 Venter, J.C. et al. The sequence of the human genome.Science 291, 1304-1351 (2001).
  • Non-Patent Document 6 Capecchi, M.R.The new mouse genetics: altering the genome by gene targeting.Trends Genet. 5, 70-76 (1989).
  • Patent Document 7 Opalinska, J.B. & Gewirtz, A.M.Nucleic-acid therapeutics: basic principles and recent applications.Nat. Rev. Drug Discov. 1, 503-514 (2002).
  • Non-Patent Document 8 Fire, A. et al. Potent and specific genetic interference by
  • Patent Document 10 Kamath, R.S. & Ahringer, J. Genome-wide RNAi screening in Caenorhabditis elegans.Methods 30, 313-321 (2003).
  • Non-patent literature ll Elbashir, SM et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.Nature 411, 494-498 (2001).
  • Patent Document 12 Brummelkamp, TR, Bernards, R. & Agami, R.A system for stable expression of short interfering RNAs in mammalian cells.Science 296, 550-553 (2002).
  • Patent Document 13 Miyagishi, M. & Taira, K. U6 promoter-driven siRNAs with four uridine 3 overhangs efficiently suppress targeted gene expression in mammalian cells.Nat. Biotechnol. 20, 497-500 (2002).
  • Non-Patent Document 14 Yu, JY, DeRuiter, SL & Turner, DL RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells.Proc.Natl.Acad.Sci. USA 99, 6047-6052 (2002).
  • Non-Patent Document 15 Sui, G. et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells.Proc. Natl. Acad. Sci. USA 99, 5515—5520 (2002).
  • Non-Patent Document 16 Lee, NS et al. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.Nat.Biotechnol. 20, 500-505 (2002) .
  • Non-Patent Document 17 Paul, CP., Good, PD, Winer, I. & Engelke, DR Effective expression of small interfering RNA in human cells.Nat. Biotechnol. 20, 505—508 (2002).
  • RNAi is also considered to be specific. Depending on the designed sequence, a phenomenon called “off-target effect” that suppresses specific genes other than the target has also been detected. Therefore, in order to avoid off-target effects, it has become important to design siRNA or shRNA for which sequence in the target gene.
  • the present invention relates to a library of shRNA expression constructs capable of systematic screening.
  • An object of the present invention is to provide a production method and a screening method capable of selecting an expression construct having a desired silencing activity using the library.
  • EPRIL enzyme production of RNAi libraries. That is, a target gene or the like is randomly cut, and adapters are connected to both ends of the random fragment. When one of the adapters has a hairpin structure, a fragment having a hairpin structure with a random fragment at the center is obtained. By extending the fragment converted into the hairpin structure with a polymerase having strand displacing activity, an iRNA expression construct capable of mainly expressing a hairpin double-stranded RNA is produced.
  • the present inventors fused a target gene with a reporter gene to select a target gene for silencing using the reporter gene silencing as an index. Further, the present inventors also provided a thymidine kinase gene which is a negative selection marker. Using this technique, a technology was developed that enables selection of an shRNA expression construct having the most effective silencing activity from the RNAi library. Furthermore, the present inventors have also shown that the library production method of the present invention can be applied to directly producing an RNAi library from a cDNA library. That is, the present invention is as described below.
  • a method for producing a desired target DNA polymerase RNAi library comprising the following steps (1) and (3).
  • a method for producing an RNAi library comprising the step of: causing a hairpin-type DNA fragment to undergo primer extension using a polymerase having Strand-displacing activity to generate an iRNA expression construct encoding interference RNA.
  • step (2) a step of connecting a double-stranded stump type adapter to the other end of the DAN fragment
  • Either the double-stranded stump type adapter or the hairpin type adapter is provided with a restriction enzyme recognition site of an outside cutter,
  • the adapter having the restriction enzyme recognition site is connected to the DNA fragment first, and the other adapter is connected to the end formed by adjusting the length of the DNA fragment by the restriction enzyme of the outside cutter.
  • RNAi library 8. The method for producing an RNAi library according to any one of the above items 17, wherein the target DNA is any one of a cDNA of a specific gene, a cDNA library, and a cDNA after subtraction.
  • RNAi library is any one of a polymerase polymerase having a strand—displacing activity and a Vent polymerase.
  • RNAi library produced by the method according to any one of 1 to 12 above.
  • RNAi library produced by the method described in any of 1 to 12 above
  • a method for screening an siRNA expression construct having a desired RNAi activity comprising introducing the RNAi library into a cell expressing a target DNA,
  • a screening method wherein in the step of measuring the expression of the target DNA, the expression of the target DNA is measured using the activity of the reporter protein as an index.
  • any of the adapters is provided with a restriction enzyme recognition site for an outside cutter.
  • FIG. 1 is a diagram showing an outline of EPRIL.
  • A Illustrated protocol for enzymatic induction of cDNA into an shRNA expression library.
  • B PAGE of DNAs during enzymatic induction.
  • M 25 bp ladder-shaped DNA marker.
  • Lanes 1, 2, and 3 show the ligation of the first adapter and the product after Mmel digestion, the adapter 2-ligation fragment, and the fragment after the polymerase reaction. For each lane, the product is indicated by the arrowhead.
  • FIG. 2 is a diagram showing silencing of GFP expression by an RNAi library prepared from cDNA encoding GFP.
  • A Histogram showing the distribution of RNAi efficiency. Bars represent the number of shRNA expression constructs. Circles indicate the normalized cumulative frequency.
  • B Depending on the value of the fold reduction The fractional amounts of shRNA expression constructs with greater efficiency indicated are plotted against fold reduction.
  • C Location and efficiency of individual shRNA expression constructs. The vertical axis represents the relative decrease and the horizontal axis represents the position of the GFP sequence. Each short horizontal bar represents the location and its RNAi efficiency.
  • the orientation of the shRNA expression constructs is likewise indicated by the color of the bars, and the gray and black bars indicate shRNA expression constructs in which the guide sequence is 5 'and 3' to the inverted repeat sequence, respectively.
  • (d) Plot the mean of the relative reduction for each position of the GFP sequence (mean value SD). The numbers in parentheses indicate the number of data for each group.
  • FIG. 3 shows RNAi efficiency profiles obtained by various transduction operations.
  • FIG. (A) Estimated RNAi efficiency based on GFP fluorescence intensity. The relative decrease in GFP fluorescence intensity is shown. Square boxes represent the IPR coding regions, and dots represent the respective shRNA expression
  • shRNA expression constructs Indicates the location of the target of the construct. Data on shRNA expression constructs, SI2A5 and SI3G6, are provided.
  • No shRNA expression construct control
  • GFP-silencing shRNA expression vector shGFP
  • shRNA expression constructs targeting IPR SI2A5 and SI3G6
  • Figure 4 shows the intracellular calcium response of A7r5 cells induced by nosopletsusin without transduction of the construct and with the introduction of SI2A5 or SI3G6. Bar indicates application of AVP.
  • FIG. 5 shows a thymidine kinase-based system for efficient RNAi construct selection.
  • A Selection strategy scheme. The upper figure shows the selectable marker gene construct. TK-puro indicates mRNA encoding a fusion protein of thymidine kinase and puromycin N-acetyltransferase. GCV is converted to a toxic derivative of GCV (GCV-ppp), which leads to cell death.
  • GCV-ppp toxic derivative of GCV
  • the dashed curve represents the GFP fluorescence distribution without transduction of the shRNA expression construct.
  • (c) Analysis of individual RNAi library clones with or without GCV selection! Individual clones were classified into four categories according to their RNAi efficiency; weak (fold reduction value of 1.5), moderate (1.5-2.5), strong (2.5-4.5) and very strong (> 4.5). The normalized population represents the number of clones in each classification normalized to the total number of clones (n 121 and 101 for clones with and without GCV selection, respectively).
  • RNAi library produced by the present invention is a library applicable to the genetics of mammals, plants, insects, yeasts and the like. Therefore, in the present specification, "iRNA” is applied to mammalian cells and the like, and is referred to as “short, double-stranded RNA (generally referred to as” siRNA "). ), Short hairpin-type double-stranded RNA (generally referred to as “shRNA” and this term is used synonymously in this document) and siRNA applied to gene suppression of nematodes, insects, plants, yeasts, etc. Compared to the above, it is used to include double-stranded RNA.
  • the method for producing an RNAi library of the present invention firstly includes a step of randomly cutting target DNA into fragments.
  • the target DNA may be a specific gene, a plurality of genes, a group of genes contained in an individual, a genomic or cDNA library, or the like.
  • the “gene” may be a genomic sequence containing introns, or may be a cDNA or the like.
  • the species from which these genes and libraries are derived are not limited to mammals such as humans, plants, insects, bacteria and the like as described above.
  • a desired target DNA is prepared and randomly fragmented.
  • Fragment The length may be at least a length encoding an RNA capable of inducing RNAi, for example, ten or more bp or more.
  • the appropriate length depends on the cell type for which silencing is to be induced. For example, in a mammalian cell, it can be 19 to 400 bp, preferably 19 to 200 bp, more preferably 19 to 50 bp.
  • the enzyme that can be used in this step has a length corresponding to the cell type that induced the silencing!
  • enzymes that can be used include, but are not limited to, DNasel and restriction enzymes that can be used for shotgun clawing, such as CvilJI, HaeIII, Rsal, Alul, and Hpal.
  • the above-mentioned DNA fragment force is used to generate a hairpin-type DNA using a hairpin-shaped oligonucleotide adapter (hereinafter referred to as "hairpin-type adapter").
  • the “hairpin-type adapter” functions as a linker connecting at least one end of the double-stranded DNA fragment into a hairpin shape, and finally obtains iRNA expression by this method. It encodes an RNA linker that connects the antisense RNA strand to a hairpin.
  • the hairpin-type adapter can be of any length, for example, 5-50 base, preferably 6-20 base, as long as it is effective for inducing RNA interference.
  • a hairpin type adapter having the length shown here or more.
  • the length can be adjusted to the appropriate length when the iRNA expression construct is generated.
  • the design should be such that the long hairpin RNA portion can be trimmed in cells to produce siRNAs of appropriate length.
  • the sequence of the hairpin-type adapter may be any of artificial sequences and microRNA-derived sequences.
  • the hairpin type adapter is preferably made of DNA, but may be made of RNA.
  • the hairpin-type adapter When a hairpin-type adapter is added to the random DNA fragment, the hairpin-type adapter generally binds to both ends of the DNA fragment unless the terminal structure of the DNA fragment is controlled. If the adapter binds to both ends of the DNA fragment, the operation of the primer extension described later will be hindered. Therefore, only one end of the double-stranded DNA In order to form a hairpin-type DNA to which the adapter is bound, a hairpin-type adapter is bound to both ends of the DNA fragment to cut the double-stranded portion of the circularly ligated DNA fragment to generate two hairpin-type DNAs. It is possible to do.
  • such a DNA fragment having a circular shape can be cut by using a restriction enzyme that randomly cuts a double-stranded region derived from a DNA fragment.
  • a restriction enzyme recognition site for an outside cutter is provided inside the hairpin adapter, and the double-stranded DNA region is ligated with this restriction enzyme. It is preferable to use a cutting method.
  • the restriction enzyme of the outside cutter is preferably an enzyme that cuts a site at least 19 bp or more away from the recognition site.
  • An example of such an enzyme is Mmel.
  • Mmel breaks the double strand 20 or 21 bases away from the recognition site. Therefore, by providing an Mmel recognition site at the end of the hairpin-type adapter, the DNA fragment to which this hairpin-type adapter is connected is connected to one end of the 20-21 base DNA fragment by Mmel digestion. Hairpin-shaped DNA is generated.
  • Mmel is a preferred restriction enzyme that produces a hairpin-type DNA encoding an effective length of iRNA that silences the target gene in mammalian cells.
  • an enzyme that cuts a position 20 to 21 bases away from the recognition site is effective in this step.
  • the length of the DNA fragment encoding the iRNA can be adjusted by adjusting the position of the restriction enzyme recognition site in the adapter length adapter. Can be adjusted as desired.
  • This trimming method is based on whether the adapter is DNA-based or RNA-based. It depends on whether it is a base. If the adapter is DNA-based, provide an optional restriction enzyme recognition site or cleavage site for trimming within the adapter, digest with this restriction enzyme, and then reconnect by ligation. Thus, the length of the adapter can be adjusted.
  • the restriction enzyme for trimming may be any restriction enzyme capable of shortening the length of the adapter, which is particularly limited. As shown in Examples described later, Bcgl, which performs bidirectional cleavage from a recognition site, can be given as an example of a restriction enzyme.
  • the inside of the adapter can be cut at two places with one restriction enzyme, Bcgl, so that trimming can be performed easily. It is of course possible to adjust the length of the adapter by combining two restriction enzymes.
  • an RNA-based adapter is used, an RNA / DNA hybrididoni heavy chain is formed in the adapter region by the primer extension described below. Trimming of the RNA / DNA hybrid region can be performed by first quenching the RNA chain with RNaseH, and then digesting the ssDNA with an enzyme that digests single-stranded DNA (ssDNA enzyme).
  • an iRNA expression construct is generated using a hairpin-type DNA formed by adding a hairpin-type adapter to the DNA fragment.
  • an iRNA expression construct in which a complementary sequence is head-til-bonded with an adapter interposed is generated.
  • an iRNA expression construct may be generated by the above-mentioned primer extension while the hairpin-type DNA generated in the above step is left as it is, but preferably, the adapter of the hairpin-type DNA is connected before performing the primer extension. It is preferable to protect the other end with another adapter.
  • an adapter to be connected for end protection is a DNA adapter having a truncated structure at both ends (hereinafter referred to as a “double-stranded truncated adapter” for convenience).
  • “Or” Stump type adapter” ".
  • the sequence of this adapter is not particularly limited.
  • the length is, for example, 5 to 100 bases, preferably 20 to 40 bases in consideration of the cost of synthesizing the adapter. However, even if the length is longer than this, naturally the protection of the DNA end can be achieved. Therefore, there is basically no upper limit of the length as long as it does not hinder the experimental operation.
  • the stump-type adapter 1 is added for the purpose of protecting a DNA fragment, it is preferable that the adapter be removed after the primer extension is completed. Ply to be described in detail
  • the stump-type adapter is provided with a restriction enzyme site for excision or a cleavage site. There are no particular restrictions on the restriction enzymes that can excise the stump-shaped adapter V. It is preferable to use it. For example, Bpml cuts a position at a certain distance from a recognition site, as shown in an example described later.
  • the stump-shaped adapter is almost removed from the iRNA expression construct,
  • the adapter sequence is completely removed by further digesting the remaining sticky ends with an enzyme having ssDNA digestion activity.
  • the truncated adapter sequence is added to both ends of the iRNA expression construct. By cutting both ends with different restriction enzymes, it is possible to control the direction of connection to a vector described later. As shown in the examples below, one truncated adapter is excised with B pml and the other with Bbsl to remove the truncated adapters at both ends and to control the structure of both ends of the iRNA expression construct. It is possible to design a stump type adapter to obtain.
  • the hairpin DNA to which the stump-type adapter is connected is subjected to primer extension using a primer capable of aligning with the end of the adapter and a polymerase having a strand-displacing activity.
  • the polymerase used here should have at least a strand displacing activity, but it is preferable that the polymerase be heat-resistant in order to perform this operation using a PCR device.
  • Klenow Fragment and phi29 are examples of polymerases having a strand-displacing activity
  • Bst polymerase and Vent polymerase are examples of those having a thermophilic property.
  • the extension conditions can be appropriately determined depending on the polymerase used. For example, the conditions when Bst polymerase is used are described in an example described later.
  • the hairpin-type adapter is RNA-based, it is necessary to use an enzyme having a reverse transcription activity in addition to the above strand-displacing activity.
  • a truncated adapter is provided at both ends.
  • a double-stranded DNA having a structure in which DNA fragments derived from the target DNA are head-tilled with a hairpin-shaped adapter is formed between the sequences.
  • An unnecessary truncated adapter sequence at the end is removed from this structure to generate an iRNA expression construct.
  • Unnecessary truncated adapter sequences can be removed by cutting with a restriction enzyme that recognizes the site provided on the truncated adapter. When the truncated adapter is trimmed by the restriction enzyme, a huge iRNA expression construct is generated.
  • the desired fragment may be purified in the process until the iRNA expression construct is produced, each time an adapter is added or digested with a restriction enzyme, or at the final stage of purification of the iRNA expression construct. It is preferable to remove excess adapters and fragments to be removed with a restriction enzyme from the reaction system.
  • a method of extracting a fragment having a desired or expected length from the gel after electrophoresis, or a method of purifying the fragment using a tag or the like can be mentioned.
  • the iRNA expression construct thus produced is connected to a vector to construct an RNAi library.
  • the vector can be selected depending on the cell type to which the present library is to be applied, but preferably an expression vector having a plasmid backbone that can be amplified in a bacterium such as Escherichia coli can be suitably used.
  • a plasmid backbone that can be amplified in Escherichia coli and the like include M13-based vectors, pUC-based vectors, pBR322, pBluescript, and pCR-Script.
  • a bacterial plasmid can be amplified in a large amount, it is easy to prepare a large amount of a library, and it is convenient when performing a treatment such as trimming of a hairpin type adapter sequence. It is preferable to carry a drug selection marker such as Amp, an auxotrophic gene, and the like, as necessary, on the bacterial plasmid.
  • RNA polymerase III driven promo examples include a mouse U6 gene-derived promoter, a tRNA promoter, an adenovirus VA1 promoter, a 5S rRNA promoter, a 7SK RNA promoter, a 7SL RNA promoter, and an HI RNA promoter.
  • a retrovirus expression cassette To integrate the iRNA expression construct into the chromosome and stably express iRNA, it is preferable to use a retrovirus expression cassette and incorporate the iRNA expression construct into this cassette.
  • An example using a retrovirus expression cassette will be described in Examples described later.
  • a vector depending on the host cell may be selected.
  • expression vectors derived from insect cells such as mammalian-derived expression vectors, for example, pcDNA3 (manufactured by Invitrogen), pEGF-BOS (Nucleic Acids. Res.
  • RNAi libraries Bac-to-BAC baculovairus expression system (manufactured by Gibco BRL), plant-derived expression vectors such as pBacPAK8, and animal virus-derived expression vectors such as ⁇ 1 and pMH2, for example, pHSV, pMV, pAdexLcw
  • a retrovirus-derived expression vector for example, pZIPneo, etc.
  • yeast-derived expression vector for example, ⁇ Pichia Expression KitJ (manufactured by Invitrogen), pNVll, SP-Q01, etc.
  • pPL608, pKTH50 etc.
  • the huge iRNA expression constructs described above are inserted into individual vectors to generate an RNAi library.
  • RNAi library generated here can be directly used for forward and reverse genetics.
  • an oligo-RNAi library is synthesized from the RNAi library of the present invention using an in vitro transcription system, and this oligo-RNAi library is generated and then used for research on forward and reverse genetics. Is also good.
  • the present invention provides a screening method for selecting a clone having an iRNA expression construct capable of suppressing the expression of a target gene as described above in the RNAi library.
  • the screening method of the present invention comprises a step of introducing an RNAi library prepared from a target DNA by the above method into cells expressing the target DNA, and a step of measuring the expression of the target DNA. included.
  • the method for introducing an RNAi library into cells expressing the target DNA is as follows.
  • One can be appropriately selected depending on the vector used when constructing one.
  • an RNAi library is introduced into cells due to the infectivity of the virus.
  • a method using catonic ribosome DOTAP manufactured by Boehringer Mannheim
  • electoral poration lipofection
  • lipofection gene gun
  • calcium phosphate DEAE dextran, etc. ! / You can.
  • Expression of the target DNA may be measured based on the expression level of the protein using an antibody against the target DNA. If the activity of a specific gene has been identified, the measurement may be performed. You may measure based on activity. For example, if it is known that the downstream gene is regulated as the activity of the target DNA, the expression of the target DNA is indirectly measured by measuring the expression of the downstream gene. Is also good.
  • a transformant in which a fusion gene in which a reporter gene is connected to the target DNA is prepared is prepared. It is preferable to conduct screening.
  • an enzyme such as a fluorescent protein (luciferase, GFP, CFP, YFP, RFP, etc.), aminoglycoside transferase (APH), thymidine kinase (TK), dihydrofolate reductase (dhfr) is used.
  • a fluorescent protein luciferase, GFP, CFP, YFP, RFP, etc.
  • APH aminoglycoside transferase
  • TK thymidine kinase
  • dhfr dihydrofolate reductase
  • a fusion gene in which the target DNA is fused with a reporter gene, it is possible to easily measure the silencing activity of each clone of the RNAi library with respect to the target DNA using the reporter activity as an index.
  • the silencing activity of each clone in the RNAi library can be measured based on the decrease in the expression of the fluorescent protein.
  • a negative selection marker such as TK
  • the clones having no silencing activity in the RNAi library cannot suppress the TK activity, and the cells are killed by the addition of ganciclovir.
  • TK activity is suppressed and The cells can survive even with the luster.
  • a negative selection marker is used as a reporter in this manner, only the cells into which the clones having silencing activity have been introduced selectively survive, so that clones having the iRNA expression constructs having silencing activity efficiently can be obtained. can get.
  • the present invention provides an RNAi library kit for performing the above-described method for enzymatically constructing an RNAi library.
  • the kit can include the above-described hairpin-type adapter, stump-type adapter 1, primers and enzymes for primer extension, enzymes used for trimming if necessary, enzymes for purifying random DNA fragments, and the like.
  • a vector for inserting the iRNA expression construct can be included.
  • a protocol for performing the above-described method for enzymatically constructing an RNAi library may be attached.
  • EPRIL involves several steps of enzymatic treatment to create a target cDNAs shrimp expression vector library (Figure la).
  • double-stranded DNAs are fragmented almost randomly with DNasel (Anderson, S. Nucleic Acids Res. 9, 3015-3027 (1981)).
  • a hairpin-shaped adapter containing the recognition sequence of Mmel is ligated to the fragment.
  • Mmel has been reported to cleave the upper and lower strands at sites 20 and 18 bases away from the recognition sequence, respectively (Boyd, AC et al. Nucleic Acids Res. 14, 5255-5274 (1986)). ), The inventors have found that Mmel also cleaves DNA at bases 21 and 19.
  • Mmel digestion yields short 3'-overhanging DNA fragments with sequences 20 or 21 bases in length from the target cDNAs.
  • Polyacrylamide gel electrophoresis Shows Mmel digested DNA as a -40 bp band (FIG. Lb).
  • a second adapter is ligated to the resulting fragment. This adapter has two degenerate bases at the 3 'end of one strand so that the 3' overhang of the Mmel digest is plugged.
  • a primer extension reaction is performed to convert the single-stranded hairpin DNA into a double-stranded DNA with inverted repeats connected via a loop sequence ( Figure 1). .
  • the primer extension product is digested with an appropriate restriction endonuclease to remove extra sequences outside the inverted repeat sequence and inserted into the plasmid vector described below. Recircularization is performed after removing extraneous sequences in the long loop flanked by inverted repeats with an appropriate restriction end nuclease.
  • RNAid For library construction and shRNA expression, we used a plasmid with a retroviral vector containing a mouse U6 gene capella RNA polymerase III driven promoter. Using a retroviral vector to introduce the shRNA expression cassette ensures a stable RNAi effect (Paddison, P.J. & Hannon, G.J. Cancer Cell 2, 17-23 (2002)).
  • the first adapter can be ligated to both ends of the DNasel digested fragment, so that shRNAs with two different orientations should be obtained.
  • Guide sequences that are complementary to the mRNA sequence are about the same frequency on the 5 'or 3' side of the shRNA (54.6% vs. 45.4%, p> 0.1).
  • Analysis of the target sequence indicated that different shRNA expression constructs were generated with different partial forces of the target gene; the complete 720 For the entire bp GFP coding sequence, 96.3% of the total was covered by 157 non-overlapping shRNA expression constructs from 251 independent clones.
  • EPRIL enables high-throughput production of vast arrays of shRNA expression constructs from cDNA of interest.
  • Retroviruses with shRNA expression constructs are produced from individual plasmids in a 96-well plate format, allowing the present inventors to simultaneously obtain a vast array of independent viruses.
  • Jurkat T cells expressing GFP were also infected with the virus in the same format.
  • GFP expression levels in infected cells were determined by flow cytometry to quantify RNAi efficiency.
  • RNAi efficiency There was considerable variation in RNAi efficiency depending on the shRNA expression construct.
  • the present inventors analyzed the distribution of RNAi efficiency in the measurement results of 262 non-overlapping constructs (FIG. 2a). Approximately 56% of the constructs had low RNAi activity (less than 1.5-fold reduction).
  • RNAi efficiency was such that 10 representative constructs examined showed that HEK293 or HeLa Since the cells showed a similar efficiency profile in some cases (data are shown,,,), they were independent of the cell type.
  • Direct transfection of the minimal plasmid or PCR amplified shRNA expression cassette yielded a profile similar to retroviral transduction (FIG. 3a), excluding the effects of differences in viral titers.
  • the RNAi profile of the in vitro transcribed shRNA by direct transfection correlated well with the DNA-based expression profile (FIG. 3b). Similar results were obtained when shRNAs transcribed in vitro were previously digested with Dicer. These results indicate that the factors that determine the RNAi efficiency profile are downstream of the transcription and Dicer 1-processing steps.
  • the present inventors encode inositol type 1,4,5-triphosphate receptor type 1 (Mignery, GA et al. J. Biol. Chem. 265, 12679-12685 (1990)) (IPR) as a target. DNA was used. GFP
  • T cells were generated. Degradation of the target mRNA by the shRNA expression construct can be assessed by monitoring the decrease in GFP fluorescence (Kumar, R et al. Genome Res. 13, 2333-2340 (2003)). ShRNA expression constructs targeting IPR also have altered RNAi efficiency.
  • FIG. 4 We selected two shRNA expression constructs, SI2A5 and SI3G6, among the most effective constructs and these clones were expressed endogenously in the vascular smooth muscle cell line A7r5. We examined whether IPR can induce effective RNAi for IPR (De
  • the present inventors have developed a novel intracellular selection scheme based on a special selectable marker gene for efficient positive selection of shRNA expression constructs (Figure 5a).
  • the marker gene is also a component of the two head-til junctions; the first encodes a fusion protein consisting of thymidine kinase and puromycin N-acetyltransferase (Chen, YT & Bradley, A. Genesis 28). , 31-35 (2000)), the latter encoding the target mRNA.
  • GCV ganciclovir
  • thymidine kinase Chen, YT & Bradley, A. Genesis 28, 31-35 (2000). Cells are killed. When cells are transduced with shRNAs having effective RNAi activity for the target gene, the cells will escape cell death by silencing thymidine kinase expression.
  • the present inventors constructed such a marker-gene using GFP as a target, introduced this into Jurkat T cells, and performed puromycin selection.
  • the inventors generated shRNA-expressing retroviruses as a mixture from a shRNAi library targeting GFP, and infected marker gene expressing cells with these retroviruses.
  • the infected cells were treated with GCV for 48 hours to cultivate GCV-resistant cells.
  • We recovered the shRNA expression constructs by PCR amplification of viable cells and reconstructed them into retroviral expression vectors to obtain the selected library.
  • To determine whether GCV selection actually enriched the effective shRNA expression constructs Jurkat T cells expressing GFP were infected with a virus mixture prepared from the reconstructed library.
  • RNAi library 1 RNAi library 1
  • EPRIL offers the opportunity to construct shRNAi libraries from complex mixtures of cDNAs, such as cDNA libraries, rather than from a single cDNA source. Such shRNAi libraries should be extremely valuable for comprehensively searching for genes involved in specific cellular functions. Therefore, the present inventors have investigated whether or not the present technology can be realized for such a purpose.
  • EPRIL was performed on a cDNA library prepared from mouse bone marrow progenitor cells FL5.12 cells and the mRNA level of which was also expressed to prepare a shRNAi library. Sequencing of randomly selected clones revealed that 215 of the 240 obtained sequences contained inverted repeats (Table 1).
  • inverted repeats from 35 clones contained sequences with more than 10 bases of poly A or T, probably from the poly A tail of mRNAs. Therefore, a BLAST search was performed on the remaining 180 clones.
  • the sequence of 165 clones matched the cDNA sequence and / or ESTs (Table 2).
  • the present inventors classified these clones derived from gene transcripts according to the gene cluster (Build 126) and found that 146 out of 165 clones belonged to at least one of the gene clusters. . Among these, some clones corresponded to the same cluster, suggesting that these clones were derived from the same gene.
  • RNAi library exhibits an initial expression profile.
  • 53% corresponded to the coding region
  • 44% corresponded to the 3'-untranslated region
  • 3% corresponded to the 5'-untranslated region.
  • Reverse repeat sequence containing a sequence of 10 or more bases of adenine or thymine b Sequence that matches genomic DNA sequence but does not match cDNA / ESTs sequence
  • Jurkat T cells were cultured in RPMI 1640 medium (Invitrogen) containing 10% fetal calf serum (FCS), penicillin and streptomycin.
  • FCS fetal calf serum
  • GP293, HEK293, A7r5, and HeLa cells were prepared from Dulbecco's modified Eagle's medium containing 10% FCS ( (Sigma or Invitrogen).
  • FL5.12 cells (donated by Dr. Inaba, Hiroshima University) were maintained in RPMI 1640 (Sigma) containing 10% FCS and 1 ng / ml IL-3 (Wako, Japan).
  • All plasmids including the plasmid pNAMA-U6 with the shRNA expression retroviral vector, were constructed using standard molecular biology techniques. Briefly, the U6 promoter and termination signal-encoding DNA obtained by PCR amplification from pSilencerl.O-U6 (Ambion) were transferred from a pMX retrovirus vector (donated by Dr. Kitamura, University of Tokyo). It was inserted into the Nhel site of a plasmid having a 3 'LTR. Primer pair, 5'-CGCGGATCCGAATGCTTTTTTTAATTCCTGCAGCCCG-3 '(SEQ ID NO: 1) and 5'
  • PCR amplification was further performed on the plasmid to form a Bbsl / Bsml site for inserting an shRNA-encoding DNA fragment, thereby obtaining pBsk-U63-3LTR.
  • pNAMA-U6 a Hindlll / Sall fragment having a 3 'LTR containing a U6 promoter at the Nhel site was
  • Plasmid pMS240-PNS was also constructed with a PCR amplified fragment encoding thymidine kinase and puromycin acetyltransferase.
  • a DNA fragment containing the thymidine kinase and puromycin N-acetyltransferase genes was subcloned into a self-inactivating retroviral vector pMS240 to produce pMS240-PNS.
  • pMS240-PNS has a BamHI / Notl site for cloning a DNA fragment encoding the target gene.
  • a pd2EGFP-I (Clontech) GFP coding fragment was inserted at that site.
  • DNA was prepared from pd2EGFP-1 and inserted into pMX. Coding IPR from pBS-IPR
  • the DNA to be loaded was inserted into a site downstream of d3EGFP.
  • a BamHI / Notl DNA fragment encoding GFP was obtained from pEGFP-1 (Clontech).
  • IPR rat 1 type IP
  • a fragment encoding the entire coding region of R was prepared by EcoRI / Notl digestion of pBS-IPR1.
  • a double-stranded cDNA library was prepared from mRNA prepared from FL5.12 cells using the Super SMART PCR cDNA synthesis kit (Clontech), -Used directly for further induction without aging.
  • EPRIL was applied using these DNA fragments according to a six-step protocol as follows:
  • DNA fragments were prepared using 1 mM MgCl, 0.1 mg / ml BSA ⁇ and 50 mM Tris-HCl (pH 7.5).
  • the digests were ligated with T4 DNA ligase (DNA Ligation Kit version 2, Takara, Japan) to hairpin-shaped oligonucleotides, adapters 1, 5, column number: 3).
  • the hairpin-shaped adapter 1 was purified by native PAGE from chemically synthesized oligonucleotides before use.
  • the nick between the 5 'end of Adapter 1 and the 3' end of the digested DNA was 0.1 mM NAD, 1.2 mM EDTA, 10 mM (NH4) after treatment with 1.0 or 1.25 U / 1 T4 polynucleotide kinase. ) SO, 4 mM MgCl
  • Adapter 2 was ligated to the Mmel-cleaved DNA fragment from step 2 using DNA ligase. After purification by PAGE, nicks on the adapter 2-ligation fragment were repaired by treatment with T4 polynucleotide kinase (Takara, Japan) and T4 DNA ligase.
  • step 3 the product from step 3 was subjected to a primer extension reaction, along with the primer oligonucleotide, 5'-GACTCACGGTCTGGAGGGCCGAA-3 '(SEQ ID NO: 6), 0.1% triton X-100, 0.2 mM dNTPs, 10 mM KC1, 10 mM (NH) SO
  • reaction mixture After incubating at 94 ° C for 135 seconds in a reaction buffer containing 20 mM Tris-HCl (pH 8.8), the mixture was cooled to 62 ° C. Next, 0.02 U / ⁇ l Bst DNA polymerase large fragment (NEB) was added to the reaction mixture to initiate the primer extension reaction. The reaction was performed at 65 ° C for 300 seconds and stopped by cooling to 4 ° C. Reaction products were purified by PAGE.
  • NEB Bst DNA polymerase large fragment
  • the product from step 4 was digested with Bpml, blunt-ended with tarenou fragments (Takara, Japan) and then digested with Bbsl.
  • pNAMA-U6 was digested with Bsml, similarly blunt-ended and digested with Bbsl, followed by treatment with bacterial alkaline phosphatase (Takara, Japan).
  • the digested fragments were gel purified and ligated at a molar ratio of about 3: 1. After purification of the ligation mixture, it was introduced into ElectroMAX DH5a-E competent cells (Invitrogen) by electroporation.
  • Transform cells into 100 g / ml The cells were seeded on a 500 cm 2 LB agar plate containing sylin. After overnight incubation, turf-grown bacteria were collected with a spatula, and plasmid DNA was prepared using a plasmid purification kit (plasmid MIDI kit, Qiagen).
  • the plasmid purified from step 5 was digested with Bcgl, blunt-ended with T4 DNA polymerase, and circularized again by self-ligation. This procedure removes most of the sequence from adapter 1 Short linker sequence, 5 '
  • ElectroMAX DH5a-E competent cells were transformed with the recirculated plasmid and selected on LB-agar plates containing 100 ⁇ g / ml carbecillin. After overnight culture on the plate, a plasmid library stock was obtained.
  • shRNA expression constructs were recovered by PCR amplification from 100 ng of genomic DNA also prepared from transduced FL5.12 cells.
  • Vent DNA polymerase NEB
  • PCR amplified DNA was digested with Notl and A11II and subcloned into pBsk-3LTR.
  • the DNA encoding the 3 'LTR containing the recovered shRNA expression construct was excised with Hindlll and Notl and subcloned into pda5LTR-DsRed2-M4.
  • the resulting plasmid is structurally identical to pNAMA-U6 and can be packaged to produce a retrovirus with the recovered shRNA expression construct.
  • shRNAs were synthesized by using in vitro transcription based on the T7 promoter.
  • type I two chemically synthesized oligonucleotides, a T7 promoter-encoding oligonucleotide, 5'-taatacgactcactataG-3 '(SEQ ID NO: 10) And shRNA-encoded oligonucleotide 5, -AAAN GTCGGACAAN '
  • the corresponding sequence is shown, lower case letters indicate nucleotides complementary to the T7-promoter-encoding oligonucleotide) were incubated at 94 ° C for 135 seconds and then annealed at 45 ° C for 30 seconds. Next, the annealed oligonucleotide was converted to double-stranded DNA type II by an extension reaction at 50 ° C. for 600 seconds using a large fragment of Bst DNA polymerase (0.08 U / 1). The shRNA was also purified using the CUGA7 in vitro transcription kit (Futtsubon Gene, Japan) according to the manufacturer's protocol.
  • shRNA was purified using a gel filtration spin column (Microspin G-25, Amersham Bioeciences).
  • a gel filtration spin column Mospin G-25, Amersham Bioeciences.
  • shRNA was treated with recombinant human Dicer (Gene Therapy Systems) according to the manufacturer's protocol.
  • TTGTAGTTGCCGTCGTCCTT (shGFP20) (SEQ ID NO: 22).
  • the N 'sequence was complementary to the N sequence.
  • retrovirus generation and transduction with shRNA expression constructs was performed in a 96-well plate format.
  • the plasmid is QIA ⁇ Prepared in 96-well plate format using the E96 Ultra Plasmid Kit (Qiagen) according to the manufacturer's protocol.
  • E96 Ultra Plasmid Kit Qiagen
  • GP293 packaging cell line Clontech
  • 200 ng of retrowinores setter plasmid and 17 ng of VSG-G encoding plasmid were placed in a 96-well plate using Lipofectamine 2000 (Invitrogen) for each well.
  • Transfetat Two days after transfection, a culture medium containing the retrovirus was obtained.
  • Retroviral transduction was performed by adding 50 ⁇ l of medium containing retrovirus particles to 1 ⁇ 13 ⁇ 41: cell suspension (1.0 10 5 cells / 1 ⁇ 21) 501.
  • DNA is purified by plasmid MIDI kit and propagated in a 10 cm culture dish by transfection with 24 ⁇ g of retrowinoresetter plasmid and 2 ⁇ g of VSG-G encoding plasmid.
  • Retrovirus packaging was performed on GP293. If necessary, the retroviral particles were concentrated by centrifugation at ⁇ , and then resuspended in an appropriate culture medium.
  • Relative GFP expression levels are based on fluorescence intensity analyzed using a FAC Scan Flow Cytometer (BD)! / Estimated.
  • the fold reduction of GFP fluorescence was used as a measure of RNAi efficiency.
  • a series of internal control shRNA expression constructs were included in each 96-well plate to correct for batch-to-batch differences in RNAi efficiency due to variations in retrofilska titer.
  • A7r5 cells were infected with the retrovirus carrying the shRNA expression construct. Four days later, the cells were collected by trypsinization, soluble, and subjected to SDS-PAGE. After transferring the SDS-PAGE product to the PVDF membrane, the protein corresponding to the IPR is transferred to the primary antibody and the secondary antibody.
  • the antibodies were Eg IgG anti-type I IPR (Alomone) and HRP-conjugated antibody, respectively.
  • A7r5 cells seeded on a cover glass were infected with shRNA-expressing retrovirus, and 4 days after infection, the Ca 2+ indicator Fura-2 was loaded. Changes in intracellular Ca 2+ concentration were determined by inversion with a CCD camera (Photometries) as described previously (Hirose, K. et al. Science 284, 1527-1530 (1999)). The evaluation was performed by fluorescence measurement based on ratio measurement in a microscope. Cells were stimulated by caloricizing 1 ⁇ arginine vasopressin (AVP) in the presence of the L-type Ca 2+ channel inhibitor -cardipine (10 ⁇ ).
  • AVP arginine vasopressin
  • EPRIL a technology capable of enzymatically deriving a shRNA expression library from cDNA type I polymerase.
  • the library can provide a vast array of candidate shRNA expression constructs for various regions on the cDNA.
  • Combining EPRIL with a no-throughput screening and intracellular selection scheme provides a generic platform for generating the best shRNA expression construct sizes and collections for any gene. Such collections will generally make a significant contribution to RNAi-based high-throughput reverse genetics in mammals.
  • EPRIL allows large cDNA libraries consisting of complex mixtures of cDNAs
  • an shRNAi library can be created. We estimated that the library contained 3 ⁇ 10 5 —4 ⁇ 10 6 independent cDNA-derived shRNA expression constructs. Therefore, the methods of the present invention provide a measure of absolute phenotype, such as cell morphology, adhesion, cell death, RNAi-based forward genetics could be performed where genes can be identified by selection based on the expression levels of key molecules and other functional indicators.
  • the shRNA sequence can perfectly match 20 and 21-base long tags with random sequences (Saha, S. et al. Nat. Biotechnol. 20, 508-512 (2002)) probability 9.1 X 10 13 Contact and 2.3 X 10- 13 are, since sufficiently small again considering the size one 3 X 10 9 bp of mouse or human genome, can serve as a reliable tags for gene identification.
  • RNAi library of the present invention Forward genetics using the RNAi library of the present invention may be applied at the animal level. Because lentivirus-mediated transduction can generate mice with shRNA expression constructs (Rubinson, DA et al. Nat. Genet. 33, 401-406 (2003)), we target different genes. The shRNA expression construct can efficiently produce a huge array of mutant animals. Systematic screening based on phenotype allows easy identification of genes involved in a particular phenotype. This feature contrasts with that of a large-scale mutagenesis project that is ongoing in mice using ethylnitrosoperrea (ENU) (Kile, BT et al. Nature 425, 81-86 (2003)). .
  • ENU ethylnitrosoperrea
  • ENU-mutagenesis efficiently produces mutant animals, but requires a tedious and tedious process to determine the locus.
  • variations in the RNAi efficiency of shRNA expression constructs can lead to the discovery of unique phenotypes due to varying degrees of gene silencing.
  • EPRIL provides a new style of forward genetics in mammals and, together with its role in RNAi-based reverse genetics, will contribute significantly to elucidating the relationship between genes and functions at the whole genome level. Will.

Abstract

L'invention concerne un procédé de préparation enzymatique d'une bibliothèque d'ARNi systématique à partir d'un ADN cible. Selon ce procédé, un ADN cible peut être préparé non seulement à partir d'un ADNc ou d'une séquence génomique d'un gène spécifique, mais également à partir d'une bibliothèque d'ADNc. Cette invention concerne également un procédé de criblage par le biais duquel un clone transportant une construction d'expression d'ARNi possédant une activité d'extinction souhaitée peut être sélectionnée à partir d'une bibliothèque d'ARNi. Dans ce criblage, une sélection plus efficace peut être réalisée par fusion d'un gène rapporteur ou d'un marqueur de sélection négative avec un ADN cible.
PCT/JP2004/019612 2003-12-31 2004-12-28 Procede de construction enzymatique d'une bibliotheque d'arni WO2005063980A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2005516704A JP4747245B2 (ja) 2003-12-31 2004-12-28 ＲＮＡｉライブラリーの酵素的構築方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US53385403P 2003-12-31 2003-12-31
US60/533,854 2003-12-31

Publications (2)

Publication Number Publication Date
WO2005063980A1 true WO2005063980A1 (fr) 2005-07-14
WO2005063980A8 WO2005063980A8 (fr) 2006-02-09

Family

ID=34738877

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/019612 WO2005063980A1 (fr) 2003-12-31 2004-12-28 Procede de construction enzymatique d'une bibliotheque d'arni

Country Status (2)

Country Link
JP (1) JP4747245B2 (fr)
WO (1) WO2005063980A1 (fr)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007129934A (ja) * 2005-11-09 2007-05-31 Tokyo Metropolitan Univ 遺伝子探索ベクター隣接ゲノム配列の同定方法、及び酸化ストレス感受性変異体
US7704222B2 (en) 1998-09-10 2010-04-27 Jenavalve Technology, Inc. Methods and conduits for flowing blood from a heart chamber to a blood vessel
WO2010071206A1 (fr) * 2008-12-18 2010-06-24 国立大学法人名古屋大学 PRODUIT DE CONSTRUCTION D'ADN POUR LA TRANSCRIPTION/L'EXPRESSION D'ARNsi ET SON UTILISATION
US7896915B2 (en) 2007-04-13 2011-03-01 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
US7896913B2 (en) 2000-02-28 2011-03-01 Jenavalve Technology, Inc. Anchoring system for implantable heart valve prostheses
US8062355B2 (en) 2005-11-04 2011-11-22 Jenavalve Technology, Inc. Self-expandable medical instrument for treating defects in a patient's heart
US8092521B2 (en) 2005-10-28 2012-01-10 Jenavalve Technology, Inc. Device for the implantation and fixation of prosthetic valves
US8206437B2 (en) 2001-08-03 2012-06-26 Philipp Bonhoeffer Implant implantation unit and procedure for implanting the unit
US8398704B2 (en) 2008-02-26 2013-03-19 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US8465540B2 (en) 2008-02-26 2013-06-18 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis
US8679174B2 (en) 2005-01-20 2014-03-25 JenaValve Technology, GmbH Catheter for the transvascular implantation of prosthetic heart valves
JP2015084722A (ja) * 2013-10-31 2015-05-07 独立行政法人産業技術総合研究所 新規なカウンターセレクション法
US9044318B2 (en) 2008-02-26 2015-06-02 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis
US9138315B2 (en) 2007-04-13 2015-09-22 Jenavalve Technology Gmbh Medical device for treating a heart valve insufficiency or stenosis
US9168130B2 (en) 2008-02-26 2015-10-27 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US9295551B2 (en) 2007-04-13 2016-03-29 Jenavalve Technology Gmbh Methods of implanting an endoprosthesis
US9510947B2 (en) 2011-10-21 2016-12-06 Jenavalve Technology, Inc. Catheter system for introducing an expandable heart valve stent into the body of a patient
US9867694B2 (en) 2013-08-30 2018-01-16 Jenavalve Technology Inc. Radially collapsible frame for a prosthetic valve and method for manufacturing such a frame
US9878127B2 (en) 2012-05-16 2018-01-30 Jenavalve Technology, Inc. Catheter delivery system for heart valve prosthesis
US10154901B2 (en) 2008-02-26 2018-12-18 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US10450606B2 (en) 2012-02-17 2019-10-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US10709555B2 (en) 2015-05-01 2020-07-14 Jenavalve Technology, Inc. Device and method with reduced pacemaker rate in heart valve replacement
US11065138B2 (en) 2016-05-13 2021-07-20 Jenavalve Technology, Inc. Heart valve prosthesis delivery system and method for delivery of heart valve prosthesis with introducer sheath and loading system
US11197754B2 (en) 2017-01-27 2021-12-14 Jenavalve Technology, Inc. Heart valve mimicry
US11278406B2 (en) 2010-05-20 2022-03-22 Jenavalve Technology, Inc. Catheter system for introducing an expandable heart valve stent into the body of a patient, insertion system with a catheter system and medical device for treatment of a heart valve defect
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
US11589981B2 (en) 2010-05-25 2023-02-28 Jenavalve Technology, Inc. Prosthetic heart valve and transcatheter delivered endoprosthesis comprising a prosthetic heart valve and a stent

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0706631D0 (en) * 2007-04-04 2007-05-16 King S College London Nucleic acids and libraries

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004101788A2 (fr) * 2003-05-09 2004-11-25 University Of Pittsburgh Of The Commonwealth System Of Higher Education Bibliotheques de petits arn interferants, procedes de synthese et d'utilisation

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003070966A2 (fr) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc Validation et identification de cibles facilitees par interference d'arn au moyen d'acide nucleique interferent court (sina)
WO2004001044A1 (fr) * 2002-06-21 2003-12-31 Sinogenomax Company Ltd. Bibliotheques d'adn et bibliotheques d'arn a double brin preparees au hasard, leur utilisateur et leur procede de production
EP1554386A2 (fr) * 2002-07-24 2005-07-20 Immusol Incorporated Systeme a un seul promoteur pour la production de cassettes d'expression d'arnsi et genotheque d'expression reposant sur l'utilisation d'un lieur en epingle a cheveux d'amorce de polymerase
WO2004072261A2 (fr) * 2003-02-11 2004-08-26 Immusol Incorporated Bibliotheques d'arnsi optimisees pour familles de proteines predeterminees
WO2005042708A2 (fr) * 2003-10-27 2005-05-12 Rosetta Inpharmatics Llc Procede pour designer des arnsi pour l'extinction de genes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004101788A2 (fr) * 2003-05-09 2004-11-25 University Of Pittsburgh Of The Commonwealth System Of Higher Education Bibliotheques de petits arn interferants, procedes de synthese et d'utilisation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BRUMMELKAMP TH.R. ET AL: "A System for Stable Expression of Short Interfering RNAs in Mammalian Cells", SCIENCE, vol. 296, no. 5567, 2002, pages 550 - 553, XP002225638 *
HIROSE K. ET AL: "Enzymatic production of RNAi libraries from cDNAs", NAT.GENET., vol. 36, no. 2, February 2004 (2004-02-01), pages 190 - 196, XP002323762 *
KILE B.T. ET AL: "Functional genetic analysis of mouse chromosome 11", NATURE, vol. 425, no. 6953, 4 September 2003 (2003-09-04), pages 81 - 86, XP002985088 *
MIYAGISHI M. ET AL: "U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells", NAT BIOTECHNOL., vol. 20, no. 5, 2002, pages 497 - 500, XP001153719 *
TRAN N. ET AL: "Expressing functional siRNAs in mammalian cells using convergent transcription", BMC BIOTECHNOL., vol. 3, no. 1, 6 November 2003 (2003-11-06), pages 21 - 30, XP002299175 *

Cited By (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8216174B2 (en) 1998-09-10 2012-07-10 Jenavalve Technology, Inc. Methods and conduits for flowing blood from a heart chamber to a blood vessel
US7736327B2 (en) 1998-09-10 2010-06-15 Jenavalve Technology, Inc. Methods and conduits for flowing blood from a heart chamber to a blood vessel
US7704222B2 (en) 1998-09-10 2010-04-27 Jenavalve Technology, Inc. Methods and conduits for flowing blood from a heart chamber to a blood vessel
US8597226B2 (en) 1998-09-10 2013-12-03 Jenavalve Technology, Inc. Methods and conduits for flowing blood from a heart chamber to a blood vessel
US7896913B2 (en) 2000-02-28 2011-03-01 Jenavalve Technology, Inc. Anchoring system for implantable heart valve prostheses
US9949824B2 (en) 2001-08-03 2018-04-24 Jenavalve Technology, Inc. Devices useful for implantation at a heart valve
US9889002B2 (en) 2001-08-03 2018-02-13 Jenavalve Technology, Inc. Devices useful for implantation at a heart valve
US8585756B2 (en) 2001-08-03 2013-11-19 Jenavalve Technology, Inc. Methods of treating valves
US8206437B2 (en) 2001-08-03 2012-06-26 Philipp Bonhoeffer Implant implantation unit and procedure for implanting the unit
US8216301B2 (en) 2001-08-03 2012-07-10 Philipp Bonhoeffer Implant implantation unit
US8303653B2 (en) 2001-08-03 2012-11-06 Philipp Bonhoeffer Implant implantation unit and procedure for implanting the unit
US8579965B2 (en) 2001-08-03 2013-11-12 Jenavalve Technology, Inc. Methods of implanting an implantation device
US11007052B2 (en) 2001-08-03 2021-05-18 Jenavalve Technology, Inc. Devices useful for implantation at a heart valve
US11517431B2 (en) 2005-01-20 2022-12-06 Jenavalve Technology, Inc. Catheter system for implantation of prosthetic heart valves
US8679174B2 (en) 2005-01-20 2014-03-25 JenaValve Technology, GmbH Catheter for the transvascular implantation of prosthetic heart valves
US9775705B2 (en) 2005-01-20 2017-10-03 Jenavalve Technology, Inc. Methods of implanting an endoprosthesis
US8551160B2 (en) 2005-10-28 2013-10-08 Jenavalve Technology, Inc. Device for the implantation and fixation of prosthetic valves
USRE45790E1 (en) 2005-10-28 2015-11-03 Jenavalve Technology Gmbh Device for the implantation and fixation of prosthetic valves
USRE45962E1 (en) 2005-10-28 2016-04-05 Jenavalve Technology Gmbh Device for the implantation and fixation of prosthetic valves
US8092521B2 (en) 2005-10-28 2012-01-10 Jenavalve Technology, Inc. Device for the implantation and fixation of prosthetic valves
US8062355B2 (en) 2005-11-04 2011-11-22 Jenavalve Technology, Inc. Self-expandable medical instrument for treating defects in a patient's heart
JP2007129934A (ja) * 2005-11-09 2007-05-31 Tokyo Metropolitan Univ 遺伝子探索ベクター隣接ゲノム配列の同定方法、及び酸化ストレス感受性変異体
US8685085B2 (en) 2007-04-13 2014-04-01 JenaValve Technologies GmbH Medical device for treating a heart valve insufficiency
US10543084B2 (en) 2007-04-13 2020-01-28 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
US7914575B2 (en) 2007-04-13 2011-03-29 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
US9138315B2 (en) 2007-04-13 2015-09-22 Jenavalve Technology Gmbh Medical device for treating a heart valve insufficiency or stenosis
US9918835B2 (en) 2007-04-13 2018-03-20 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficency
US9295551B2 (en) 2007-04-13 2016-03-29 Jenavalve Technology Gmbh Methods of implanting an endoprosthesis
US11357624B2 (en) 2007-04-13 2022-06-14 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
US9339386B2 (en) 2007-04-13 2016-05-17 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficency
US9445896B2 (en) 2007-04-13 2016-09-20 Jenavalve Technology, Inc. Methods for treating a heart valve insufficiency or stenosis
US7896915B2 (en) 2007-04-13 2011-03-01 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
US8398704B2 (en) 2008-02-26 2013-03-19 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US10993805B2 (en) 2008-02-26 2021-05-04 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US11564794B2 (en) 2008-02-26 2023-01-31 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US9877828B2 (en) 2008-02-26 2018-01-30 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US11154398B2 (en) 2008-02-26 2021-10-26 JenaValve Technology. Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US8465540B2 (en) 2008-02-26 2013-06-18 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis
US9168130B2 (en) 2008-02-26 2015-10-27 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US9044318B2 (en) 2008-02-26 2015-06-02 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis
US10154901B2 (en) 2008-02-26 2018-12-18 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US9707075B2 (en) 2008-02-26 2017-07-18 Jenavalve Technology, Inc. Endoprosthesis for implantation in the heart of a patient
US10702382B2 (en) 2008-02-26 2020-07-07 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
US10575947B2 (en) 2008-02-26 2020-03-03 Jenavalve Technology, Inc. Stent for the positioning and anchoring of a valvular prosthesis in an implantation site in the heart of a patient
WO2010071206A1 (fr) * 2008-12-18 2010-06-24 国立大学法人名古屋大学 PRODUIT DE CONSTRUCTION D'ADN POUR LA TRANSCRIPTION/L'EXPRESSION D'ARNsi ET SON UTILISATION
JPWO2010071206A1 (ja) * 2008-12-18 2012-05-31 国立大学法人名古屋大学 ｓｉＲＮＡ転写／発現用ＤＮＡコンストラクト及びその利用
US11278406B2 (en) 2010-05-20 2022-03-22 Jenavalve Technology, Inc. Catheter system for introducing an expandable heart valve stent into the body of a patient, insertion system with a catheter system and medical device for treatment of a heart valve defect
US11589981B2 (en) 2010-05-25 2023-02-28 Jenavalve Technology, Inc. Prosthetic heart valve and transcatheter delivered endoprosthesis comprising a prosthetic heart valve and a stent
US9510947B2 (en) 2011-10-21 2016-12-06 Jenavalve Technology, Inc. Catheter system for introducing an expandable heart valve stent into the body of a patient
US11441180B2 (en) 2012-02-17 2022-09-13 Fred Hutchinson Cancer Center Compositions and methods for accurately identifying mutations
US10450606B2 (en) 2012-02-17 2019-10-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US9878127B2 (en) 2012-05-16 2018-01-30 Jenavalve Technology, Inc. Catheter delivery system for heart valve prosthesis
US11185405B2 (en) 2013-08-30 2021-11-30 Jenavalve Technology, Inc. Radially collapsible frame for a prosthetic valve and method for manufacturing such a frame
US10433954B2 (en) 2013-08-30 2019-10-08 Jenavalve Technology, Inc. Radially collapsible frame for a prosthetic valve and method for manufacturing such a frame
US9867694B2 (en) 2013-08-30 2018-01-16 Jenavalve Technology Inc. Radially collapsible frame for a prosthetic valve and method for manufacturing such a frame
JP2015084722A (ja) * 2013-10-31 2015-05-07 独立行政法人産業技術総合研究所 新規なカウンターセレクション法
US11337800B2 (en) 2015-05-01 2022-05-24 Jenavalve Technology, Inc. Device and method with reduced pacemaker rate in heart valve replacement
US10709555B2 (en) 2015-05-01 2020-07-14 Jenavalve Technology, Inc. Device and method with reduced pacemaker rate in heart valve replacement
US11065138B2 (en) 2016-05-13 2021-07-20 Jenavalve Technology, Inc. Heart valve prosthesis delivery system and method for delivery of heart valve prosthesis with introducer sheath and loading system
US11197754B2 (en) 2017-01-27 2021-12-14 Jenavalve Technology, Inc. Heart valve mimicry
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification

Also Published As

Publication number Publication date
JP4747245B2 (ja) 2011-08-17
JPWO2005063980A1 (ja) 2007-12-20
WO2005063980A8 (fr) 2006-02-09

Similar Documents

Publication Publication Date Title
WO2005063980A1 (fr) Procede de construction enzymatique d'une bibliotheque d'arni
Giuliano et al. Generating single cell–derived knockout clones in mammalian cells with CRISPR/Cas9
Ishizu et al. Somatic primary piRNA biogenesis driven by cis-acting RNA elements and trans-acting Yb
JP7412586B2 (ja) ＶＩ－Ｅ型及びＶＩ－Ｆ型ＣＲＩＳＰＲ－Ｃａｓシステム並びにそれらの使用
Yap et al. Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention
EP1853712B1 (fr) Vecteurs d'expression stable et de longue duree de sirna et leurs applications
Haley et al. A simplified miRNA-based gene silencing method for Drosophila melanogaster
EP1462525B1 (fr) Systeme d'expression d'arnsi et procede de production de cellule knockdown a gene fonctionnel ou analogue utilisant ce systeme
JP5258874B2 (ja) Ｒｎａ干渉タグ
Ono et al. Analysis of human small nucleolar RNAs (snoRNA) and the development of snoRNA modulator of gene expression vectors
EP1444346A2 (fr) Dosage biologique de choc a interference arn de courte duree et constructions
CN110343724B (zh) 用于筛选和鉴定功能性lncRNA的方法
Baumgartner et al. The Drosophila ZAD zinc finger protein Kipferl guides Rhino to piRNA clusters
Yang et al. Silencing transposable elements in the Drosophila germline
Zhao et al. MicroRNA-mediated repression of nonsense mRNAs
CN112384620A (zh) 用于筛选和鉴定功能性lncRNA的方法
US7524653B2 (en) Small interfering RNA libraries and methods of synthesis and use
Gaume et al. In vivo study of the histone chaperone activity of nucleolin by FRAP
Munafò et al. Channel nuclear pore complex subunits are required for transposon silencing in Drosophila
Joosten et al. PIWI proteomics identifies Atari and Pasilla as piRNA biogenesis factors in Aedes mosquitoes
Li et al. Chromatin context-dependent regulation and epigenetic manipulation of prime editing
JP2007520221A (ja) 突然変異ｒｎａ分解酵素を用いた短い二重鎖ｒｎａの組成物および製造方法
Du et al. PCR-based generation of shRNA libraries from cDNAs
Joosten et al. Slicing of viral RNA guided by endogenous piRNAs triggers the production of responder and trailer piRNAs in Aedes mosquitoes
US20070231807A1 (en) Method for preparing short hairpin RNA from CDNA

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 28/2005 UNDER (81) ADD "SM"

WWE Wipo information: entry into national phase

Ref document number: 2005516704

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase