WO2005061722A1 - Procedes d'amplification d'acides nucleiques - Google Patents

Procedes d'amplification d'acides nucleiques Download PDF

Info

Publication number
WO2005061722A1
WO2005061722A1 PCT/US2003/037199 US0337199W WO2005061722A1 WO 2005061722 A1 WO2005061722 A1 WO 2005061722A1 US 0337199 W US0337199 W US 0337199W WO 2005061722 A1 WO2005061722 A1 WO 2005061722A1
Authority
WO
WIPO (PCT)
Prior art keywords
primer
sequence
probe
nucleic acid
complementary
Prior art date
Application number
PCT/US2003/037199
Other languages
English (en)
Inventor
David Y. Zhang
Wandi Zhang
Jizu Yi
Original Assignee
Mount Sinai School Of Medicine Of New York University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mount Sinai School Of Medicine Of New York University filed Critical Mount Sinai School Of Medicine Of New York University
Priority to PCT/US2003/037199 priority Critical patent/WO2005061722A1/fr
Priority to AU2003295732A priority patent/AU2003295732A1/en
Publication of WO2005061722A1 publication Critical patent/WO2005061722A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

Definitions

  • Such techniques which generally involve the amplification and detection (and subsequent measurement) of minute amounts of target nucleic acids (either DNA or RNA) in a test sample, include inter alia the polymerase chain reaction (PCR) (Saiki, et aL, Science 230:1350, 1985; Saiki et ah, Science 239:487, 1988; PCR Technology, Henry A. Erlich, ed., Stockton Press, 1989; Patterson et aL, Science 260:976, 1993), ligase chain reaction (LCR) (Barany, Proc. Natl. Acad. Sci. USA 88:189, 1991), strand displacement amplification (SDA) (Walker et ah, Nucl. Acids Res.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • Q ⁇ replicase amplification Q ⁇ RA
  • Q ⁇ RA Q ⁇ replicase amplification
  • 3SR self-sustained replication
  • Circumvention of the aforementioned problems would allow for development of rapid standardized assays, utilizing the various techniques mentioned above, that would be particularly useful in performing epidemiologic investigations, as well as in the clinical laboratory setting for detecting pathogenic microorganisms and viruses in a patient sample. Such microorganisms cause infectious diseases that represent a major threat to human health.
  • the development of standardized and automated analytical techniques and kits therefor, based on rapid and sensitive identification of target nucleic acids specific for an infectious disease agent would provide advantages over techniques involving immunologic or culture detection of bacteria and viruses.
  • Reagents may be designed to be specific for a particular organism or for a range of related organisms. These reagents could be utilized to directly assay microbial genes conferring resistance to various antibiotics and virulence factors resulting in disease. Development of rapid standardized analytical techniques will aid in the selection of the proper treatment.
  • assays having a moderate degree of sensitivity may suffice, e.g., in initial screening tests.
  • great sensitivity is required, e ⁇ g., the detection of the HIV genome in infected blood may require finding the virus nucleic acid sequences present in a sample of one part per 10 to 100,000 human genome equivalents (Harper et aL, Proc. Nat'l. Acad. Sci., USA 83:772, 1986).
  • HIV infectious virus
  • HTLV-I hepatitis B
  • hepatitis C hepatitis C
  • the HIV genome can be detected in a blood sample using PCR techniques, either as an RNA molecule representing the free viral particle or as a DNA molecule representing the integrated provirus (Ou et aL, Science 239:295, 1988; Murakawa et aL, DNA 7:287, 1988).
  • the method provides several advantages over prior art methods.
  • the method simplifies the target nucleic acid isolation procedure, which can be performed in microtubes, microchips or micro-well plates, if desired.
  • the method allows for isolation, amplification and detection of nucleic acid sequences corresponding to the target nucleic acid of interest to be carried out in the same sample receptacle, ej ⁇ , tube or micro-well plate.
  • the techniques described herein may be used for detection of specific genes or markers at the single cell level using a gel matrix or slide format.
  • In situ amplification and detection of nucleic acid sequences in single cells may be carried out using cells embedded in a semi-solid gel matrix. Such methods can be used to detect a mutation in a single cell, such as a tumor cell, or to detect chromosomal abnormalities in single cells such as embryo cells.
  • the method also allows for standardization of conditions, because only a pair of generic amplification probes may be utilized in the present method for detecting a variety of target nucleic acids, thus allowing efficient multiplex amplification.
  • the method also allows the direct detection of RNA by probe amplification without the need for DNA template production.
  • the amplification probes which in the method may be covalently joined end to end, form a contiguous ligated amplification sequence. The assembly of the amplifiable DNA by ligation increases specificity, and makes possible the detection of a single mutation in a target.
  • This ligated amplification sequence rather than the target nucleic acid, is either directly detected or amplified, allowing for substantially the same amplification conditions to be used for a variety of different infectious agents and, thus, leading to more controlled and consistent results being obtained.
  • multiple infectious agents in a single sample may be detected using the multiplex amplification methodology disclosed.
  • Additional advantages of the present invention include the ability to automate the protocol of the method disclosed, which is important in performing routine assays, especially in the clinical laboratory and the ability of the method to utilize various nucleic acid amplification systems, ejj., polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR) and self-sustained sequence replication (3SR).
  • PCR polymerase chain reaction
  • SDA strand displacement amplification
  • LCR ligase chain reaction
  • 3SR self-sustained sequence replication
  • the present method incorporates magnetic separation techniques using paramagnetic particles or beads coated with a ligand binding moiety that recognizes and binds to a ligand on an oligonucleotide capture probe to isolate a target nucleic acid (DNA or RNA) from a sample of a clinical specimen containing e.g., a suspected pathogenic microorganism or gene abnormality, in order to facilitate detection of the underlying disease- causing agent.
  • DNA or RNA target nucleic acid
  • a target nucleic acid is hybridized to a pair of non-overlapping oligonucleotide amplification probes in the presence of paramagnetic beads coated with a ligand binding moiety, gig., streptavidin, to form a complex.
  • a ligand binding moiety gig., streptavidin
  • the capture/amplification probe contains a ligand, e.g., biotin, that is recognized by and binds to the ligand binding moiety on the paramagnetic beads.
  • the probes are designed so that each contains generic sequences (i.e., not target nucleic acid specific) and specific sequences complementary to a nucleotide sequence in the target nucleic acid.
  • the specific sequences of the probes are complementary to adjacent regions of the target nucleic acid, and thus do not overlap one another.
  • the two probes are joined together using a ligating agent to form a contiguous ligated amplification sequence.
  • the ligating agent may be an enzyme, e ⁇ , DNA ligase or a chemical. Following washing and removal of unbound reactants and other materials in the sample, the detection of the target nucleic acid in the original sample is determined by detection of the ligated amplification sequence.
  • the ligated amplification sequence may be directly detected if a sufficient amount (e.g., 10 6 - 19 7 molecules) of target nucleic acid was present in the original sample. If an insufficient amount of target nucleic acid ( ⁇ 10 ⁇ molecule) was present in the sample, the ligated amplification sequence (not the target nucleic acid) may be amplified using suitable amplification techniques, e.g., PCR, for detection. Alternatively, capture and amplification functions may be performed by separate and independent probes. For example, two amplification probes may be ligated to form a contiguous sequence to be amplified. Unligated probes, as well as the target nucleic acid, are not amplified in this technique.
  • suitable amplification techniques e.g., PCR
  • Yet another altemative is a single amplification probe that hybridizes to the target such that its 3' and 5' ends are juxtaposed. The ends are then ligated by DNA ligase to form a covalently linked circular probe that can be identified by amplification.
  • the present invention further provides methods for general amplification of total genomic DNA or mRNA expressed within a cell.
  • the use of such methods provides a means for generating increased quantities of DNA and/or mRNA from small numbers of cells.
  • Such amplified DNA and/or mRNA may then be used in techniques developed for detection of infectious agents, and detection of normal and abnormal genes.
  • the invention provides a novel differential display ligation dependent RAM method for identifying differentially expressed mRNAs within different types of cells.
  • the invention provides methods wherein the capture/amplification probe can be designed to bind to an antibody.
  • one antibody can be attached to a capture/amplification probe and the other antibody can be attached to a target sequence. In this instance only if both antibodies are bound to the same antigen will ligation occur.
  • This technique can be used for ELISA in a liquid phase RAM reaction or in situ in a solid phase RAM reaction.
  • Fig. 1 is a generic schematic diagram showing the various components used in the present method of capture, ligation-dependent amplification and detection of a target nucleic acid.
  • Fig. 2 is a schematic flow diagram generally showing the various steps in the present method.
  • Fig. 3 is an autoradiograph depicting the detection of a PCR amplified probe that detects HIV-1 RNA.
  • Lane A is the ligated amplification sequence according to the invention;
  • Lane B which is a control, is PCR amplified nanovariant DNA, that does not contain any HIV-1 -specific sequences.
  • Fig. 4 is a schematic diagram of an embodiment of the present invention showing the various components used for capture and ligation-dependent detection of a target nucleic acid, e ⁇ HCV RNA, and subsequent amplification of its sequences, employing two capture/amplification probes containing a bound biotin moiety and two ligation-dependent amplification probes.
  • Fig. 5 is a schematic flow diagram showing magnetic isolation, target specific ligation and PCR amplification for the detection of HCV RNA using a single capture/amplification probe and two amplification probes.
  • Fig. 6 is a schematic diagram showing the various components used to amplify and detect a target nucleic acid e *, HCV RNA, employing two capture/amplification probes, each containing a bound biotin moiety, and a single amplification probe.
  • Fig. 7 is a schematic diagram showing various components used to detect a target nucleic acid ej*.
  • HCV RNA employing two capture/amplification probes, each containing a bound biotin moiety, and a single amplification probe that circularizes upon hybridization to the target nucleic acid and ligation of free termini.
  • Fig. 8 is a photograph of ethidium bromide stained DNA depicting PCR amplified probes used to detect HCV RNA in a sample. The amount of HCV RNA in the sample is determined by comparing sample band densities to those of standard serial dilutions of HCV transcripts.
  • Fig. 9 is a photograph of ethidium bromide stained DNA depicting PCR amplified single, full length ligation-dependent and circularizable probes used to detect HCV
  • RNA in a sample is determined by comparing sample band densities to those of standard serial dilutions of HCV transcripts.
  • Fig. 10 is a schematic diagram illustrating the capture and detection of a target nucleic acid by the hybridization signal amplification method (HSAM).
  • HSAM hybridization signal amplification method
  • Figs. 12A and B are schematic diagrams illustrating RNA-protein crosslinks formed during formalin fixation.
  • Fig. 12A depicts the prevention of primer extension due to the crosslinks in the method of reverse transcription PCR (RT-PCR).
  • Fig. 12B illustrates that hybridization and ligation of the probes of the present invention are not prevented by protein-
  • Fig. 13 is a schematic diagram of multiplex PCR. Two set of capture/amplification probes, having specificity for HIV-1 and HCV, respectively, are used for target capture, but only one pair of generic PCR primers is used to amplify the ligated probes. ⁇ ie presence of each target can be determined by the size of the amplified product or by enzyme-linked immunosorbent assay.
  • Fig. 14 is a schematic diagram of HSAM using a circular target probe and three circular signal probes.
  • AB, CD and EF indicate nucleotide sequences in the linker regions that are complementary to the 3' and 5' nucleotide sequences of a circular signal probe.
  • AB', CD' and EF' indicate the 3' and 5' nucleotide sequences of the signal probes that have been juxtaposed by binding to the complementary sequences of the linker regions of another circular signal probe.
  • Fig. 15 is a schematic diagram of HSAM utilizing a circular target probe and linear signal probes.
  • Fig. 16 is a schematic diagram of amplification of a circularized probe by primer-extension/displacement and PCR.
  • Fig. 17 is a schematic diagram of an embodiment of RAM in which a T3 promoter has been incorporated into Ext-primer 2, allowing amplification of the circular probe by transcription.
  • Fig. 18 provides a polyacrylamide gel depicting the amplification of a circular probe by extension of Ext-primer 1.
  • Fig. 19 is a schematic diagram of amplification of a circularized probe by the ramification-extension amplification method (RAM).
  • Fig. 20 is a diagram of amplification of a circularized probe by the ramification extension amplification method using a molecular "zipper" associated with a signal generating moiety.
  • Fig. 21A-B is a diagram an anchoring primer extension amplification methods using hybridization probes associated with ligand binding moieties.
  • Fig. 21C-D is a diagram of primer extension amplification methods using hybridization probes.
  • Fig. 22 is a graph of real-time detection of EBV-targets (100,000, 1 ,000 and
  • Fig. 25 depicts a RAM assay in the presence of 1, 2 and 3 primers.
  • Fig. 26 depicts a RAM assay with serial dilutions of target DNA.
  • Fig. 27 depicts a RAM assay where target sequences of increased lengths are amplified.
  • Fig. 30 depicts the genetic amplification of genomic DNA using adaptor molecules.
  • Fig. 31 is a diagram of the detection of an antigen using an antibody conjugated to an Anchoring oligonucleotide.
  • Fig. 32 is a schematic depiction of RAM amplification using molecular zipper probes.
  • Fig. 34A is a graph illustrating the requirement of circular probe formation.
  • Fig. 34B is a graph illustrating the denaturation curves of the molecular zipper probes following RAM amplification, in the presence and absence of ligase.
  • Fig. 34C is graph of real-time detection of targets using a molecular zipper in conjunction with a RAM reaction.
  • Fig. 34D is a graph illustrating the linear relationship between threshold times (Rt values) and initial copy number of the C-probe.
  • the present invention is directed towards simplified sample preparation and generic amplification systems for use in clinical assays to detect and monitor pathogenic microorganisms in a test sample, as well as to detect abnormal genes in an individual.
  • Generic amplification systems are described for clinical use that combine magnetic separation techniques with ligation/amplification techniques for detecting and measuring nucleic acids in a sample.
  • the separation techniques may be combined with most amplification systems, including inter alia, PCR, LCR and SDA amplification techniques.
  • the present invention further provides alternative amplification systems referred to as ramification-extension amplification method (RAM) and hybridization signal amplification (HSAM) that are useful in the method of the present invention.
  • RAM ramification-extension amplification method
  • HSAM hybridization signal amplification
  • the advantages of the present invention include (1) suitability for clinical laboratory settings, (2) ability to obtain controlled and consistent (standardizable) results, (3) ability to quantitate nucleic acids in a particular sample, (4) ability to simultaneously detect and quantitate multiple target nucleic acids in a test sample, (5) ability to sensitively and efficiently detect nucleic acids in serum samples and in situ, and (6) ability to detect a single mutation in a target.
  • the complete protocol of the presently disclosed method may be easily automated, making it useful for routine diagnostic testing in a clinical laboratory setting. With the use of RAM and HSAM, an isothermal amplification can be achieved.
  • the present invention incorporates magnetic separation, utilizing paramagnetic particles, beads or spheres that have been coated with a ligand binding moiety that recognizes and binds to ligand present on an oligonucleotide capture probe, described below, to isolate a target nucleic acid (DNA or RNA) from a clinical sample in order to facilitate its detection.
  • a target nucleic acid DNA or RNA
  • Magnetic separation is a system that uses paramagnetic particles or beads coated with a ligand binding moiety to isolate a target nucleic acid (RNA or DNA) (Lomeli et aL Gin. Chem. 35:1826, 1989) from a sample.
  • the principle underscoring this method is one of hybrid formation between a capture probe containing a ligand, and a target nucleic acid through the specific complementary sequence between the probe and target.
  • Hybridization is carried out in the presence of a suitable chaotropic agent, e.g., guanidine thiocyanate (GnSCN) which facilitates the specific binding of the probe to complementary sequences in the target nucleic acid.
  • GnSCN guanidine thiocyanate
  • ligand refers to any component that has an affinity for another component termed here as "ligand binding moiety.”
  • the binding of the ligand to the ligand binding moiety forms an affinity pair between the two components.
  • affinity pairs include, inter alia, biotin with avidin/streptavidin, antigens or haptens with antibodies, heavy metal derivatives with thiogroups, various polynucleotides such as homopolynucleotides as poly dG with poly dC, poly dA with poly dT and poly dA with poly U.
  • Any component pairs with strong affinity for each other can be used as the affinity pair, ligand-ligand binding moiety.
  • Suitable affinity pairs are also found among ligands and conjugates used in immunological methods.
  • the preferred ligand-ligand binding moiety for use in the present invention is the biotin/streptavidin affinity pair.
  • the present invention provides for the capture and detection of a target nucleic acid as depicted in Fig. 1, which provides a schematic depiction of the capture and detection of a target nucleic acid.
  • Fig. 1 provides a schematic depiction of the capture and detection of a target nucleic acid.
  • the target nucleic acid is hybridized simultaneously to a pair of oligonucleotide amplification probes, e., a first nucleotide probe (also referred to as a capture/amplification probe) and a second nucleotide probe (also referred to as an amplification probe), designated in Fig.
  • probes may be either oligodeoxyribonucleotide or oligoribonucleotide molecules, with the choice of molecule type depending on the subsequent amplification method.
  • Reference to "probe” herein generally refers to multiple copies of a probe.
  • the capture/amplification probe is synthesized so that its 3' generic sequence (d) is the same for all systems, with the 5' specific sequence (e) being specifically complementary to a target nucleic acid of an individual species or subspecies of organism or an abnormal gene, e.g. the gene(s) responsible for cystic fibrosis or sickle cell anemia.
  • the 5' specific portion of the capture/amplification probe be specifically complementary to the nucleotide sequence of a target nucleic acid of a particular strain of organism.
  • Capture/ Amp-probe- 1 further contains a ligand (c) at the 3' end of the probe (d), which is recognized by and binds to the ligand binding moiety (b) coated onto the paramagnetic beads (a).
  • the second or amplification probe, Le,, Amp-probe-2 in Fig. 1 contains a 3' sequence (f) that is complementary and hybridizes to a portion of the nucleotide sequence of a target nucleic acid immediately adjacent to (but not overlapping) the sequence of the target that hybridizes to the 5' end of Capture/ Amp-probe- 1.
  • Amp-probe-2 also contains a 5' generic sequence (g) which is neither complementary nor hybridizable to the target nucleic acid, to which may be optionally attached at the 5' end thereof a label or signal generating moiety (***).
  • signal generating moieties include, inter alia, radioisotopes, e.g..
  • fluorescent molecules e.g., fluorescein and chromogenic molecules or enzymes, e.g., peroxidase.
  • fluorescent molecules e.g., fluorescein and chromogenic molecules or enzymes, e.g., peroxidase.
  • Such labels are used for direct detection of the target nucleic acid and detects the presence of Amp-probe-2 bound to the target nucleic acid during the detection step.
  • 32 P is preferred for detection analysis by radioisotope counting or autoradiography of electrophoretic gels.
  • Chromogenic agents are preferred for detection analysis, e.g., by an enzyme linked chromogenic assay.
  • the probes are ligated together (at the site depicted by the vertical arrow in Fig. 1) using a ligating agent to form a contiguous single-stranded oligonucleotide molecule, referred to herein as a ligated amplification sequence.
  • the ligating agent may be an enzyme, e.g., a DNA or RNA ligase, or a chemical joining agent, e ⁇ , cyanogen bromide or a carbodiimide (Sokolova et aL, FEBS Left. 232:153-155, 1988).
  • the ligated amplification sequence is hybridized to the target nucleic acid (either an RNA or DNA) at the region of the ligated amplification sequence that is complementary to the target nucleic acid (iig., (e) and (f) in Fig. 1).
  • target nucleic acid e.g. 10 6 - 10 7 molecules
  • detection of the target nucleic acid can be achieved without any further amplification of the ligated amplification sequence, e ⁇ , by detecting the presence of the optional signal generating moiety of at the 5' end of Amp-probe-2.
  • the ligated amplification sequence formed as described above by the ligation of Capture/Amp-probe-1 and Amp-probe-2 may be amplified for detection as described below.
  • a capture/amplification probe preferably between 70-90 nucleotides in length, can be synthesized to contain two ligand moities: one located at the 5' end and the other located approximately 50 nucleotides downstream of the 5' end.
  • a second circular probe, designated AMP-probe-2 is also synthesized.
  • the linker region of the AMP- probe-2 is complementary to the capture/primer between nucleotide 1-50.
  • the capture/amplification probe can bind to a ligand binding moiety conjugated to a support matrix, through a ligand/ligand binding interaction.
  • Ligands include biotin, antigens, antibodies, heavy metal derivatives and polynucleotides.
  • Ligand binding moieties include strepavidin, avidin, antibodies, antigens, thio groups, and polynucleotides.
  • Support matrices include, for example magnetic beads although other types of supports may be used, including but not limited to, slides or microtitre plates.
  • the AMP-probe-2 will bind to the capture/amplification probe through the complementary region.
  • the 3' end of the capture/amplification probe is designed to loop back and bind to 5' end of the linker region of the AMP-probe-2 and serves as a primer for extension.
  • the target can bind to the AMP-probe-2 through complementary regions thereby permitting capture onto a matrix, such as magnetic beads for example, as depicted in Fig. 28.
  • Ligation will join the 3' and the 5' end of the AMP-probe-2 and form a covalently linked circular probe. Bound probe allows for extensive stringent washes, thereby decreasing the background resulting from non-specific capturing.
  • Extension from the capture/amplification probe along the C-probe will generate a multi-unit ssDNA which can then be amplified by either primer extension or RAM by addition of RAM primers as described above.
  • a double ligation can be performed, where two probes, each consisting of half of the AMP- probe-2, are used.
  • the capture/amplification probe can be designed to bind to an antibody.
  • the AMP-probe-2 as described above will target to the capture region of the capture/amplification probe (Fig. 29).
  • a primer extension or RAM reaction is carried out as described above.
  • one antibody can be attached to a capture/amplification probe and the other antibody can be attached to a target sequence. In this instance only if both antibodies are bound to the same antigen will ligation occur.
  • This technique can be used for ELIS A in a liquid phase RAM reaction or in situ in a solid phase RAM reaction.
  • FITC-labeled dUTP or dig-labeled dUTP can be used to detect the RAM products.
  • the ligated amplification sequence can be detected without nucleic acid amplification of the ligated sequence by the use of a hybridization signal amplification method (HSAM).
  • HSAM is illustrated in Fig. 10.
  • the target specific nucleic acid probe e.g., Amp-probe-2
  • the ligand is a molecule that can be bound to the nucleic acid probe, and can provide a binding partner for a ligand binding molecule that is at least divalent.
  • the ligand is biotin or an antigen, for example digoxigenin.
  • the nucleic acid probe can be labeled with the ligand by methods known in the art.
  • the probe is labeled with from about 3 to about 10 molecules of ligand, preferably biotin or digoxigenin.
  • ligand preferably biotin or digoxigenin.
  • the ligating agent is added to ligate the probes as described above.
  • the ligation of the target specific probe to the capture probe results in retention of the target specific probe on the beads.
  • an excess of ligand binding moiety is added to the reaction.
  • the ligand binding moiety is a moiety that binds to and forms an affinity pair with the ligand.
  • the ligand binding moiety is at least divalent for the ligand.
  • the ligand is biotin and the ligand binding moiety is streptavidin.
  • the ligand is an antigen and the ligand binding molecule is an antibody to the antigen. Addition of ligating agent and ligand binding molecule results in a complex comprising the target specific probe covalently linked to the capture probe, with the ligand-labeled target specific probe having ligand binding molecules bound to the ligand.
  • a signal probe is then added to the reaction mixture.
  • the signal probe is a generic nucleic acid that is internally labeled with a ligand that binds to the ligand binding molecule.
  • the ligand is the same ligand that is used to label the target specific amplification probe.
  • the signal probe has a generic sequence such that it is not complementary or hybridizable to the target nucleic acid or the other probes.
  • the signal probe contains from about 30 to about 100 nucleotides and contains from about 3 to about 10 molecules of ligand.
  • the complex is then detected. Detection of the complex is indicative of the presence of the target nucleic acid.
  • the HSAM method thus allows detection of the target nucleic acid in the absence of nucleic acid amplification.
  • the complex can be detected by methods known in the art and suitable for the selected ligand and ligand binding moiety. For example, when the ligand binding moiety is streptavidin, it can be detected by immunoassay with streptavidin antibodies. Alternately, the ligand binding molecule may be utilized in the present method as a conjugate that is easily detectable.
  • the ligand may be conjugated with a fluorochrome or with an enzyme that is detectable by an enzyme-linked chromogenic assay, such as alkaline phosphatase or horseradish peroxidase.
  • the ligand binding molecule may be alkaline phosphatase-conjugated streptavidin, which may be detected by addition of a chromogenic alkaline phosphatase substrate, e& . , nitroblue tetrazolium chloride.
  • the HSAM method may also be used with the circularizable amplification probes described hereinbelow.
  • the circularizable amplification probes contain a 3' and a 5' region that are complementary and hybridizable to adjacent but not contiguous sequences in the target nucleic acid, and a linker region that is not complementary nor hybridizable to the target nucleic acid.
  • the 3' and 5' regions are juxtaposed. Linkage of the 3' and 5' regions by addition of a linking agent results in the formation of a closed circular molecule bound to the target nucleic acid.
  • the target/probe complex is then washed extensively to remove unbound probes.
  • ligand molecules are incorporated into the linker region of the circularizable probe, for example during probe synthesis.
  • the HSAM assay is then performed as described hereinabove and depicted in Fig. 15 by adding ligand binding molecules and signal probes to form a large complex, washing, and then detecting the complex.
  • Nucleic acid detection methods are known to those of ordinary skill in the art and include, for example, latex agglutination as described by Essers, et aL (1980), J. Clin. Microbiol. 12:641.
  • the use of circularizable probes in conjunction with HSAM is particularly useful for in situ hybridization.
  • HSAM is also useful for detection of an antibody or antigen.
  • a ligand- containing antigen or antibody is used to bind to a corresponding antibody or antigen, respectively. After washing, excess ligand binding molecule is then added with ligand- labeled generic nucleic acid probe. A large complex is generated and can be detected as described hereinabove.
  • the ligand is biotin and the ligand binding molecule is streptavidin.
  • the present methods may be used with routine clinical samples obtained for testing purposes by a clinical diagnostic laboratory.
  • Clinical samples that may be used in the present methods include, inter alia, whole blood, separated white blood cells, sputum, urine, tissue biopsies, throat swabbings and the like, Le ⁇ , any patient sample normally sent to a clinical laboratory for analysis.
  • the present ligation-dependent amplification methods are particularly useful for detection of target sequences in formalin fixed, paraffin embedded (FFPE) specimens, and overcomes deficiencies of the prior art method of reverse transcription polymerase chain reaction (RT-PCR) for detection of target RNA sequences in FFPE specimens.
  • RT-PCR has a variable detection sensitivity, presumably because the formation of RNA-RNA and RNA- protein crosslinks during formalin fixation prevents reverse transcriptase from extending the primers.
  • the probes can hybridize to the targets despite the crosslinks, reverse transcription is not required, and the probe, rather than the target sequence, is amplified. Thus the sensitivity of the present methods is not compromised by the presence of crosslinks.
  • the advantages of the present methods relative to RT-PCR are depicted schematically in Fig. 12.
  • Fig. 2 provides a general diagrammatic description of the magnetic separation and target-dependent detection of a target nucleic acid in a sample
  • this aspect of the present method involves the following steps:
  • the first step is the capture or isolation of a target nucleic acid present in the sample being analyzed, e_ ⁇ , serum.
  • a suitable sample size for analysis that lends itself well to being performed in a micro-well plate is about lOO ⁇ l.
  • the use of micro-well plates for analysis of samples by the present method facilitates automation of the method.
  • the sample, containing a suspected pathogenic microorganism or virus or abnormal gene is incubated with an equal volume of lysis buffer, containing a chaotropic agent (i.e., an agent that disrupts hydrogen bonds in a compound), a stabilizer and a detergent, which provides for the release of any nucleic acids and proteins that are present in the sample.
  • a chaotropic agent i.e., an agent that disrupts hydrogen bonds in a compound
  • a suitable lysis buffer for use in the present method comprises 2.5 - 5M guanidine thiocyanate (GnSCN), 10% dextran sulfate, lOOmM EDTA, 200mM Tris-HCl (pH 8.0) and 0.5% NP-40 (Nonidet P-40, a nonionic detergent, N-lauroylsarcosine, Sigma Chemical Co., St. Louis, MO).
  • GnSCN guanidine thiocyanate
  • NP-40 Nonidet P-40, a nonionic detergent, N-lauroylsarcosine, Sigma Chemical Co., St. Louis, MO.
  • the concentration of GnSCN, which is a chaotropic agent, in the buffer also has the effect of denaturing proteins and other molecules involved in pathogenicity of the microorganism or virus. This aids in preventing the possibility of any accidental infection that may occur during subsequent manipulations of samples containing pathogens.
  • Paramagnetic particles or beads coated with the ligand binding moiety are added to the sample, either simultaneous with or prior to treatment with the lysis buffer.
  • the paramagnetic beads or particles used in the present method comprise ferricoxide particles (generally ⁇ 1 um in diameter) that possess highly convoluted surfaces coated with silicon hydrides.
  • the ligand binding moiety is covalently linked to the silicon hydrides.
  • the paramagnetic particles or beads are not magnetic themselves and do not aggregate together. However, when placed in a magnetic field, they are attracted to the magnetic source. Accordingly, the paramagnetic particles or beads, together with anything bound to them, may be separated from other components of a mixture by placing the reaction vessel in the presence of a strong magnetic field provided by a magnetic separation device.
  • Suitable paramagnetic beads for use in the present method are those coated with streptavidin, which binds to biotin.
  • Such beads are commercially available from several sources, e ⁇ , Streptavidin MagneSphere ® paramagnetic particles obtainable from Promega Corporation and Streptavidin-Magnetic Beads (catalog #MBOO2) obtainable from American Qualex, La Mirada, CA.
  • a pair of oligonucleotide amplification probes is added to the lysed sample and paramagnetic beads.
  • the probes and paramagnetic beads may be added at the same time.
  • the two oligonucleotide probes are a first probe or capture/amplification probe (designated Capture/ Amp-probe- 1 in Fig. 1) containing a ligand at its 3' end and a second probe or amplification probe (designated Amp-probe-2 in Fig. 1).
  • the first probe is preferably a 3'-biotinylated capture/amplification probe.
  • the probes may be synthesized from nucleoside triphosphates by known automated oligonucleotide synthetic techniques, e.g., via standard phosphoramidite technology utilizing a nucleic acid synthesizer. Such synthesizers are available, e.g., from Applied Biosystems, Inc. (Foster City, CA).
  • the target nucleic acid specific portions of the probes, ijs ⁇ , the 5' end of the first capture/amplification probe and the 3' end of the second amplification probe complementary to the nucleotide sequence of the target nucleic acid are each approximately 15-60 nucleotides in length, preferably about 18-35 nucleotides, which provides a sufficient length for adequate hybridization of the probes to the target nucleic acid.
  • the generic nucleotide sequence of an oligodeoxynucleotide capture/amplification probe comprises at least one and, preferably two to four, restriction endonuclease recognition sequences(s) of about six nucleotides in length, which can be utilized, if desired, to cleave the ligated amplification sequence from the paramagnetic beads by specific restriction endonucleases, as discussed below.
  • a ternary complex comprising the target nucleic acid and hybridized probes is formed, which is bound to the paramagnetic beads through the binding of the ligand (e.g., biotin) on the capture/amplification probe to the ligand binding moiety (e.g., streptavidin) on the paramagnetic beads.
  • the method is carried out as follows: [0092] (a) The complex comprising target nucleic acid-probes-beads is then separated from the lysis buffer by means of a magnetic field generated by a magnetic device, which attracts the beads.
  • the magnetic field is used to hold the complex to the walls of the reaction vessel, e.g., a micro-well plate or a microtube, thereby allowing for the lysis buffer and any unbound reactants to be removed, e.g., by decanting, without any appreciable loss of target nucleic acid or hybridized probes.
  • the complex is then washed 2-3 times in the presence of the magnetic field with a buffer that contains a chaotropic agent and detergent in amounts that will not dissociate the complex.
  • a suitable washing buffer for use in the present method comprises about 1.0 - 1.5M GnSCN, lOmM EDTA, lOOmM Tris-HCl (pH 8.0) and 0.5%) NP-40 (Nonidet P-40, nonionic detergent, Sigma Chemical Co., St. Louis, MO). Other nonionic detergents, e.g., Triton X-100, may also be used.
  • the buffer wash removes unbound proteins, nucleic acids and probes that may interfere with subsequent steps.
  • the washed complex may be then washed with a solution of KC1 to remove the GnSCN and detergent and to preserve the complex.
  • a suitable concentration of KC1 is about 100 to 500mM KC1.
  • the KC1 wash step may be omitted in favor of two washes with ligase buffer.
  • a ligated amplification sequence This serves to join the 5' end of the first oligonucleotide probe to the 3' end of the second oligonucleotide probe (capture/amplification probe and amplification probe, respectively) to fo ⁇ n a contiguous functional single-stranded oligonucleotide molecule, referred to herein as a ligated amplification sequence.
  • the ligated amplification sequence serves as the template for any of various amplification systems, such as PCR or SDA.
  • Capture/amplification and amplification oligodeoxynucleotide probes may be ligated using a suitable ligating agent, such as a DNA or RNA ligase.
  • the ligating agent may be a chemical, such as cyanogen bromide or a carbodiimide (Sokolova et aL, FEBS Lett. 232:153-155, 1988).
  • Preferred DNA Hgases mclude T 4 DNA ligase and the thermostable Taq DNA ligase, with the latter being most preferable, for probes being subjected to amplification using PCR techniques.
  • the third step in the process is detection of the ligated amplification sequence, which indicates the presence of the target nucleic acid in the original test sample. This may be performed directly if sufficient target nucleic acid (about 10 6 - 10 7 molecules) is present in the sample or following amplification of the ligated amplification sequence, using one of the various amplification techniques, e.g., PCR or SDA.
  • PCR PCR or SDA.
  • direct detection may be used to detect HIV- 1 RNA in a serum sample from an acutely infected AIDS patient. Such a serum sample is believed to contain about 10 6 copies of the viral RNA/ml.
  • an oligonucleotide detection probe of approximately 10-
  • the Amp-probe-2 itself may be optionally labeled at its 5' end with a signal generating moiety, e.g., 32 P.
  • the signal generating moiety will then be incorporated into the ligated amplification sequence following ligation of the Capture/ Amp-probe- 1 and Amp-probe-2.
  • direct detection of the ligated amplification sequence to indicate the presence of the target nucleic acid, can be carried out immediately following ligation and washing.
  • an amplification system is used to amplify the ligated amplification sequence for detection.
  • PCR methodology can be employed to amplify the ligated amplification sequence, using known techniques (see, e.g., PCR Technology, H.A. Erlich, ed., Stockton Press, 1989, Sambrook et aL, Molecular Cloning - A Laboratory Manual, 2d Edit., Cold Spring Harbor Laboratory, 1989.
  • primers When using PCR for amplification, two primers are employed, the first of the primers being complementary to the generic 3' end of Capture/Amp-probe-1 region of the ligated amplification sequence and the second primer corresponding in sequence to the generic 5' end of Amp-probe-2 portion of the ligated amplification sequence.
  • These primers like the sequences of the probes to which they bind, are designed to be generic and may be used in all assays, irrespective of the sequence of the target nucleic acid.
  • first primer is designed to anneal to the generic sequence at the 3' end of the ligated amplification sequence and the second primer corresponds in sequence to the generic sequence at the 5' end of the ligated amplification sequence
  • generic primers maybe utilized to amplify any ligated amplification sequence.
  • 3' end of the Capture/AMP- probe- 1 region of the ligated amplification sequence and the generic 5' end of the AMP-probe-2 portion of the ligated amplification sequence may be used to amplify ligated amplification sequence together with the sequence between both ends.
  • increasing the number of primers was demonstrated to significantly increase the amplification efficiency thereby increasing the sensitivity of DNA detection.
  • a generic pair of PCR oligonucleotide primers for use in the present method may be synthesized from nucleoside triphosphates by l ⁇ iown automated synthetic techniques, as discussed above for synthesis of the oligonucleotide probes.
  • the primers may be 10-60 nucleotides in length.
  • Preferably the oligonucleotide primers are about 18-35 nucleotides in length, with lengths of 12-21 nucleotides being most preferred.
  • the pair of primers are designated to be complementary to the generic portions of the first capture/amplification probe and second amplification probe, respectively and thus have high G-C content.
  • Annealing of the primers to the ligated amplification sequence is carried out at about 37-50°C; extension of the primer sequence by Taq polymerase in the presence of nucleoside triphosphates is carried out at about 70-75°C; and the denaturing step to release the extended primer is carried out at about 90-95°C.
  • the annealing and extension steps may both be carried at about 60-65°C, thus reducing the length of each amplification cycle and resulting in a shorter assay time.
  • a suitable three temperature PCR amplification (as provided in
  • PCR Polymerase chain reactions
  • Reactions are incubated at 94°C for 1 minute, about 37 to 55°C for 2 minutes (depending on the identity of the primers), and about 72°C for 3 minutes and repeated for 30-40, preferably 35, cycles.
  • a 4 ⁇ l-aliquot of each reaction is analyzed by electrophoresis through a 2% agarose gel and the DNA products in the sample are visualized by staining the gel with ethidium-bromide.
  • the two temperature PCR technique differs from the above only in carrying out the annealing/extension steps at a single temperature, e ⁇ , about 60-65°C for about 5 minutes, rather than at two temperatures.
  • oligodeoxyribonucleotide releasing primer synthesized generally as described above, is added to the paramagnetic bead-bound ligated amplification sequence.
  • the releasing primer may or may not be but, preferably, will be the same as the first PCR primer discussed above.
  • the releasing primer is designed to hybridize to the generic 3' end of the Capture/ Amp-probe- 1 portion of the ligated amplification sequence, which, as discussed above, comprises a nucleotide sequence recognized by at least one, and preferably two-four, restriction endonucleases to form at least one, and preferably two-four, double-stranded restriction enzyme cleavage site, e.g., a EcoRI, Smal and/or Hindlll site(s).
  • the Capture/Amp-probe-1 be synthesized with at least one, and preferably two to four nucleotide sequences recognized by a restriction enzyme located at the 3' end of the probe. This provides the nucleotide sequences to which the releasing primer binds to form double-stranded restriction enzyme cleavage site(s). [00110] After ligating the first and second probes to form the ligated amplification sequence, the releasing primer is hybridized to the ligated amplification sequence.
  • At least one restriction enzyme ej*., Ec ⁇ RI, Smal and/or Hindlll
  • the ligated amplification sequence is released from the beads by cleavage at the restriction enzyme, e.g., EcoRI site.
  • the restriction enzyme e.g., EcoRI site.
  • the ligated amplification sequence is serially diluted and then quantitatively amplified via the DNA Taq polymerase using a suitable PCR amplification technique, as described above.
  • Quantitation of the original target nucleic acid in the sample may be performed by a competitive PCR method to quantitatively amplify the ligated amplification sequence, as provided, e.g., in Sambrook et aL, Molecular Cloning - A Laboratory Manual, 2d Edit., Cold Spring Harbor Laboratory, 1989.
  • the method involves co-amplification of two templates: the ligated amplification sequence and a control (e.g., the generic portions of the ligated amplification sequence or the generic portions that have interposed thereto a nucleotide sequence unrelated to the sequence of the target nucleic acid) added in l ⁇ iown amounts to a series of amplification reactions. While the control and ligated amplification sequence are amplified by the same pair of generic PCR primers, the control template is distinguishable from the ligated amplification sequence, e ⁇ , by being different in size.
  • a control e.g., the generic portions of the ligated amplification sequence or the generic portions that have interposed thereto a nucleotide sequence unrelated to the sequence of the target nucleic acid
  • control and ligated amplification sequence templates are present in the same amplification reaction and use the same primers, the effect of a number of variables which can effect the efficiency of the amplification reaction is essentially nullified.
  • variables included, inter alia: (1) quality and concentration of reagents (Taq DNA polymerase, primers, templates, dNTP's), (2) conditions used for denaturation, annealing and primer extension, (3) rate of change of reaction temperature and (4) priming efficiency of the oligonucleotide primers.
  • the relative amounts of the two amplified products ⁇ j ⁇ e., ligated amplification sequence and control template reflect the relative concentrations of the starting templates.
  • the quantitative PCR method may be generally carried out as follows:
  • a control template e.g., a DNA sequence corresponding to nanovariant RNA, a naturally occurring template of Q ⁇ replicase (Schafiher et aL, J. Mol. Biol. 117:877-907,
  • a series of tenfold dilutions (in TE Buffer) containing from 10 ng/ml to 1 fg/ml of the control template is made and stored at -70°C until use.
  • the reaction products may then be subject to agarose gel electrophoresis and autoradiography to separate the two amplified products (of different sizes).
  • the amplified bands of the control and ligated amplification sequence are recovered from the gel using suitable techniques and radioactivity present in each band is determined by counting in a scintillation counter.
  • the relative amounts of the two products are calculated based on the amount of radioactivity in each band.
  • the amount of radioactivity in the two samples must be corrected for the differences in molecular weights of the two products.
  • the reactions may be repeated using a narrower range of concentration of control template to better estimate the concentration of ligated amplification sequence.
  • more than the two probes i.e.
  • one or more amplification probes are utilized such that each probe contains sequences that are specifically complementary to and hybridizable with the target nucleic acid.
  • the 5' end of one amplification probe e.g. Amp-probe-2 (HCV A) in Fig. 4 contains a sequence complementary to a distinct portion in the target nucleic acid.
  • the 3' end of the second amplification probe e.g. Amp-probe-2A (HCV A) in Fig. 4, contains a specific sequence complementary to a region of the target nucleic acid that is immediately adjacent to that portion of the target hybridizable to the first amplification probe.
  • the multiple capture/amplification probes may target, for example, all strains of a particular pathogen, e.g. the Hepatitis C Virus
  • HCV HCV
  • amplification probes may be tailored to detect and further identify individual
  • two capture/amplification probes are utilized, e.g. as depicted in Fig. 4.
  • This provides a total specific sequence of the capture/amplification probes complementary and hybridizable to the target nucleic acid that can be twice as long as that of a single capture/amplification probe, thereby affording an even higher capture efficiency.
  • the pair of capture/amplification probes e.g. as shown in Fig. 4, may each have a 3' sequence complementary to the target nucleic acid, and a biotin moiety at its 5' terminus capable of interacting with streptavidin coated paramagnetic beads.
  • the pair of capture/amplification probes may each have a 5' sequence complementary to the target nucleic acid, and a biotin moiety at its 3' terminus capable of interacting with streptavidin coated paramagnetic beads.
  • the PCR products may also be identified by an enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • the PCR product may be labeled during amplification with an antigen, for example digoxigenin.
  • the labeled PCR product is then captured on a microtiter plate having thereon a nucleic acid probe that hydridizes to the target specific region of the amplification probe, which region is present in the amplified product.
  • the labeled captured product may then be detected by adding an enzyme conjugated antibody against the antigen label, for example horseradish peroxidase anti-digoxigenin antibody, and a color indicator to each well of the microtiter plate.
  • the optical density of each well provides a measure of the amount of PCR product, which in rum indicates the presence of the target nucleic acid in the original sample.
  • the present invention may utilize a single amplifiable "full length probe” and one or more capture/amplification probes as shown in Fig. 6.
  • the hybridized nucleic acid duplex comprising of the target nucleic acid, for example, HCV RNA, and the capture/amplification probes and full length amplification probes, also referred to as amplification sequences, can be released from the magnetic beads by treating the hybridized duplex molecule with RNAase H.
  • a still further aspect of the present invention utilizes one or more capture/amplification probes, each containing a biotin moiety, and a single amplification probe, also referred to as an amplification sequence, that hybridizes to the target nucleic acid and circularizes upon ligation of its free termini, as shown in Fig. 7.
  • SSL-DOCSl 140 2 363vl may be designed so that complementary regions (see e.g. the region shown in bold in Fig. 7) of the probe that are hybridizable to the target nucleic acid sequence are located at each end of the probe (as described in Nilsson et al., 1994, Science 265:2085-2088).
  • a linking agent such as a ligase enzyme.
  • This circular molecule may then serve as a template during an amplification step, e.g. PCR, using primers such as those depicted in Fig. 7.
  • the circular molecule may also be amplified by RAM, as described hereinbelow, or detected by a modified HSAM assay, as described hereinbelow.
  • the probe can be used to detect different genotypes of a pathogen, e.g. different genotypes of HCV from serum specimens.
  • Genotype specific probes can be designed, based on published HCV sequences (Stuyver et al., 1993, J. Gen. Virol. 74: 1093-1102), such that a mutation in the target nucleic acid is detectable since such a mutation would interfere with (1) proper hybridization of the probe to the target nucleic acid and (2) subsequent ligation of the probe into a circular molecule. Because of the nature of the circularized probe, as discussed below, unligated probes may be removed under stringent washing conditions.
  • Another embodiment of the present invention provides a method of reducing carryover contamination and background in amplification methods utilizing circular probes.
  • the present ligation-dependent amplification methods involve amplification of the ligated probe(s) rather than the target nucleic acid.
  • the ligated probe is a closed circular molecule, it has no free ends susceptible to exonuclease digestion.
  • probe ligation i.e. circularization
  • treatment of the reaction mixture with an exonuclease provides a "cleanup" step and thus reduces background and carryover contamination by digesting unligated probes or linear DNA fragments but not closed circular molecules.
  • the covalently linked circular molecules remain intact for subsequent amplification and detection.
  • the use of exonuclease to eliminate single stranded primers or carryover DNA fragments poses the risk that target nucleic acid will also be degraded.
  • the present invention does not suffer this risk because target nucleic acid is not amplified.
  • the exonuclease is exonuclease III, exonuclease VII, mung bean nuclease or nuclease BAL-31. Exonuclease is added to the reaction after ligation and prior to amplification, and incubated, for example at 37°C for thirty minutes.
  • SSL-DOCSl 1402363vl the order of the legations can be controlled. This embodiment is particularly useful to identify two nearby mutations in a single target.
  • the circularized probe can also be amplified and detected by the generation of a large polymer.
  • the polymer is generated through the rolling circle extension of primer 1 along the circularized probe and displacement of downstream sequence. This step produces a single stranded DNA containing multiple units which serves as a template for subsequent PCR, as depicted in Figs. 9 and 16.
  • primer 2 can bind to the single stranded DNA polymer and extend simultaneously, resulting in displacement of downstream primers by upstream primers. By using both primer-extension/displacement and PCR, more detectable product is produced with the same number of cycles.
  • the circularized probe may also be detected by a modification of the HSAM assay.
  • the circularizable amplification probe contains, as described hereinabove, 3'- and 5' regions that are complementary to adjacent regions of the target nucleic acid.
  • the circularizable probes further contain a non-complementary, or generic linker region.
  • the linker region of the circularizable probe contains at least one pair of adjacent regions that are complementary to the 3' and 5' regions of a first generic circularizable signal probe (CS-probe).
  • the first CS- probe contains, in its 3' and 5' regions, sequences that are complementary to the adjacent regions of the linker region of the circularizable amplification probe. Binding of the circularizable amplification probe to the target nucleic acid, followed by ligation, results in a covalently linked circular probe having a region in the linker available for binding to the 3' and 5' ends of a first CS-probe. The addition of the first CS-probe results in binding of its 3' and 5' regions to the complementary regions of the linker of the circular amplification probe. The 3' and 5' regions of the CS-probe are joined by the ligating agent to form a closed circular CS-probe bound to the closed circular amplification probe. The first CS-probe
  • SSL-DOCSl 1402363vl further contains a linker region containing at least one pair of adjacent contiguous regions designed to be complementary to the 3' and 5' regions of a second CS-probe.
  • the second CS-probe contains, in its 3' and 5' regions, sequences that are complementary to the adjacent regions of the linker region of the first CS-probe. The addition of the second CS-probe results in binding of its 3' and 5' regions to the complementary regions of the linker of the first CS-probe.
  • the 3' and 5' regions of the second CS-probe are joined by the ligating agent to fo ⁇ n a closed circular CS-probe, which is in turn bound to the closed circular amplification probe.
  • each of the CS-probes has one pair of complementary regions that are complementary to the 3' and 5' regions of a second CS-probe, and another pair of complementary regions that are complementary to the 3' and 5' regions of the third CS-probe.
  • the target nucleic acid is then detected by detecting the cluster of chained molecules.
  • the chained molecules can be easily detected by digesting the complex with a restriction endonuclease for which the recognition sequence has been uniquely incorporated into the linker region of each CS-probe. Restriction endonuclease digestion results in a linearized monomer that can be visualized on a polyacrylamide gel.
  • Other methods of detection can be effected by incorporating a detectable molecule into the CS- probe, for example digoxigenin, biotin, or a fluorescent molecule, and detecting with anti- digoxinin, streptavidin, or fluorescence detection.
  • Latex agglutination as described for example by Essers et al. (1980) J. Clin. Microbiol. 12, 641, may also be used. Such nucleic acid detection methods are l ⁇ iown to one of ordinary skill in the art.
  • the amplification probes and/or amplification sequences as described above can be used for in situ LD-PCR assays. In situ PCR may be utilized for the direct localization and visualization of target viral nucleic acids and may be further useful in co ⁇ elating viral infection with histopathological finding.
  • Current methods assaying for target viral RNA sequences have utilized RT
  • PCR techniques for this purpose (Nuovo et al., 1993, Am. J. Surg. Pathol. 17(7 :683-690).
  • cDNA obtained from target viral RNA by in situ reverse transcription, is amplified by the PCR method.
  • Subsequent intracellular localization of the amplified cDNA can be accomplished by in situ hybridization of the amplified cDNA with a labeled probe or by the incorporation of labeled nucleotide into the DNA during the amplification reaction.
  • the RT PCR method suffers drawbacks which are overcome by the present invention.
  • various tissue fixatives used to treat sample tissues effect the crosslinking of cellular nucleic acids and proteins, e.g.
  • RNA-RNA complexes and hinder reverse transcription, a key step in RT-PCR.
  • secondary structures in target RNA may also interfere with reverse transcription.
  • the application of multiplex PCR to RT PCR for the detection of multiple target sequences in a single cell can present significant problems due to the different efficiencies of each primer pair.
  • amplification probes according to the present invention may be designed such that there are common primer-binding sequences within probes detecting different genotypic variants of a target pathogen. This enables the assay to detect multiple targets in a single sample.
  • the assay may utilize two or more amplification probes according to this method to detect HCV RNA and ⁇ -actin
  • primer-binding sequences in the probe may be designed to
  • the amplification probe circularizes after binding to target nucleic acid to become a circular molecule, multimeric products may be generated during polymerization, so that amplification products are easily detectable, as described above, as shown in Figs. 9 and 16.
  • the sections may be washed with xylene and ethanol to remove the paraffin.
  • the sections may then be treated with a proteolytic enzyme, such as trypsin, to increase membrane permeability.
  • the sections may be further treated with RNAase-free DNAase to eliminate cellular DNA.
  • An amplification probe may be suspended in a suitable buffer and added to the sample sections on the slide and allowed to hybridize with the target sequences.
  • the PCR reaction mixture containing the amplification primers and one or more labeled nucleotides is now added to the sample on the slide for the amplification of the target sequences.
  • the label on the nucleotide(s) may be any signal generating moiety, including, inter alia, radioisotopes, e ⁇ g., 32 P or 3 H, fluorescent molecules, ej ⁇ , fluorescein and chromogenic molecules or enzymes, ej ⁇ , peroxidase, as described earlier.
  • Chromogenic agents are prefe ⁇ ed for detection analysis, e.g., by an enzyme linked chromogenic assay.
  • digoxinin-labeled nucleotides are utilized.
  • the PCR product, tagged with digoxinin-labeled nucleotides is detectable when incubated with an antidigoxinin antibody-alkaline phosphatase conjugate.
  • the alkaline phosphatase-based colorimetric detection utilizes nitroblue tetrazolium, which, in the presence of 5-Bromo-4-chloro-3-indolylphosphate, yields a purple-blue precipitate at the amplification site of the probe.
  • the target nucleic acid sequence may be directly detected using the various amplification probes and/or amplification sequences described above, without amplification of these sequences.
  • the amplification probes and/or amplification sequences may be labeled so that they are detectable.
  • the RAM amplification method described herein may be used in a gel matrix format or slide format combined with fluorescent primers to detect aneusomy or gene mutation in situ in a single cell. Embedding single cells in a gel matrix allows for enzymatic manipulation of the cell, i.e., proteinase digestion to release DNA, without the lose of genomic material. The gel matrix also protects the DNA from shearing damage and allows for maintenance of the cell's original three dimensional configuration.
  • a method is provided wherein nucleic acid molecules or proteins are embedded within a matrix for in situ detection of target molecules.
  • the method of the invention provides a means for maintaining the signal in a particular location and may be used in DNA and protein a ⁇ ay technology in conjunction with the amplification methods described herein, i.e., RAM and HSAM.
  • a ligand moiety is linked to a gel matrix material. Such linkage may be provided by interactions between the ligand moiety and chemical groups or proteins within the matrix.
  • C-probe linked to a ligand binding moiety is then added to the gel matrix resulting in binding of the C-probe to the matrix through interaction between the ligand and ligand binding moiety.
  • C-probe will bind to the target nucleic acid molecule through complementary sequences.
  • Addition of ligase results in formation of closed C-probe that is subsequently amplified by rolling circle amplification or RAM.
  • the C-probe can be linked to the gel matrix through either direct linkage to the gel matrix or through binding to a ligand previously linked to the gel matrix.
  • the target nucleic acid molecule is then hybridized to a primer and primer extension is carried out for amplification and detection of the target nucleic acid molecule.
  • ligand/ ligand binding moiety pairs include biotin with avidin/streptavidin, antigens or haptens with antibodies, heavy metal derivatives with thiogroups, various polynucleotides such as homopolynucleotides as poly dG with poly dC, poly dA with poly dT and poly dA with poly U. Any component pairs with strong affinity for each other can be used as the affinity pair, ligand-ligand binding moiety. Suitable affinity pairs are also found among ligands and conjugates used in immunological methods.
  • the prefe ⁇ ed ligand-ligand binding moiety for use in the present invention is the biotin/streptavidin affinity pair.
  • labeled nucleotides may be used during amplification to detect the amplified products.
  • labels include but are not limited to fluorescent, chemiluminescent or radioactive labels.
  • an oligonucleotide probe can be fixed on a solid support, such as for example glass or nitrocellulose membranes, followed by an overlay of a gel matrix material. Following addition of C-probe to the gel matrix, target nucleic acid molecules are added to the matrix and an amplification reaction is carried out thereby allowing the signal to be retained in situ.
  • a solid support such as for example glass or nitrocellulose membranes
  • the matrix material may be prepared as a bead fo ⁇ n, i.e., sepharose, cellulose or nanoparticles, in which ligand/ ligand binding moieties have been embedded.
  • a protein, antibody or antigen may be embedded within a gel matrix. Such protein, antibody or antigen is then detected by addition of a "binding partner" having an affinity for such molecules.
  • the binding partner is linked to a nucleic acid molecule which can then be detected using the amplification methods described herein, i.e., HSAM and RAM and rolling circle amplification.
  • the probe hybridization, ligation, and amplification may be carried out in a gel matrix such as polyacrylamide or agarose (See, for example, Dubiley S. et al., 1999, Nucleic Acids Research 27:i-iv).
  • the large mutimeric amplicons generated by primer extension amplification and/or subsequent ramification amplification can be A sualized with a fluorescent microscope. Because the gel matrix prevents diffusion, any positive signal will appear as distinct "dots".
  • the bound RAM probe can be detected using the hybridization signal amplification method (HSAM).
  • the resulting circular molecule may be conveniently amplified by the ramification-extension amplification method (RAM), as depicted in Fig. 19.
  • RAM ramification-extension amplification method
  • Amplification of the circularized probe by RAM adds still further advantages to the methods of the present invention by allowing up to a million-fold amplification of the circularized probe under isothermal conditions.
  • RAM is illustrated in Fig. 19.
  • the single, full length, ligation dependent circularizable probe useful for RAM contains regions at its 3' and 5' termini that are hybridizable to adjacent but not contiguous regions of the target molecule.
  • the circularizable probe is designed to contain a 5' region that is complementary to and hybridizable to a portion of the target nucleic acid, and a 3' region that is complementary to and hybridizable to a portion of the target nucleic acid adjacent to the portion of the target that is complementary to the 5' region of the probe.
  • the 5' and 3' regions of the circularizable probe may each be from about 20 to about 35 nucleotides in length. In a prefe ⁇ ed embodiment, the 5' and 3' regions of the circularizable probe are about 25 nucleotides in length.
  • the circularizable probe further contains a region designated as the linker region. In a prefe ⁇ ed embodiment the linker region is from about 30 to about 60 nucleotides in length.
  • the linker region is composed of a generic sequence that is neither complementary nor hybridizable to the target sequence.
  • the circularizable probe suitable for amplification by RAM is utilized in the present method with one or more capture/amplification probes, as described hereinabove. Wlien the circularizable probe hybridizes with the target nucleic acid, its 5' and 3' termini become juxtaposed. Ligation with a linking agent results in the formation of a closed circular molecule.
  • Amplification of the closed circular molecule is effected by adding a first extension primer (Ext-primer 1) to the reaction.
  • Ext-primer 1 is complementary to and hybridizable to a portion of the linker region of the circularizable probe, and is preferably from about 15 to about 30 nucleotides in length.
  • Ext-primer 1 is extended by adding sufficient concentrations of dNTPs and a DNA polymerase to extend the primer around the closed circular molecule. After one revolution of the circle, Le., when the DNA polymerase reaches the Ext-primer 1 binding site, the polymerase displaces the primer and its extended sequence. The polymerase thus continuously "rolls over" the closed circular probe to produce a long single strand DNA, as shown in Figure 19.
  • DNA of repeating units having a sequence complementary to the sequence of the circularizable probe may be up to 10Kb, and for example may contain from about 20 to about 100 units, with each unit equal in length to the length of the circularizable probe, for example about 100 bases.
  • detection may be performed at this step if the target is abundant or the single stranded DNA is long.
  • the long single stranded DNA may be detected at this stage by visualizing the resulting product as a large molecule on a polyacrylamide gel.
  • Ext- primer 2 is a second extension primer (Ext- primer 2) is added.
  • Ext-primer 2 is preferably from about 15 to about 30 nucleotides in length.
  • Ext-primer 2 is identical to a portion of the linker region that does not overlap the portion of the linker region to which Ext-primer 1 is complementary.
  • each repeating unit of the long single stranded DNA contains a binding site to which Ext-primer 2 hybridizes. Multiple copies of the Ext-primer 2 thus bind to the long single stranded DNA, as depicted in Fig. 19, and are extended by the DNA polymerase.
  • the RAM extension products differ in size depending upon the number of units extended from the closed circular DNA, the RAM products appear as a smear or ladder when electrophoresed.
  • the circularizable probe is designed to contain a unique restriction site, and the RAM products are digested with the co ⁇ esponding restriction endonuclease to provide a large amount of a single sized fragment of one unit length i.e., the length of the circularizable probe.
  • the fragment can be easily detected by gel electrophoresis as a single band.
  • a ligand such as biotin or digoxigenin can be incorporated during primer extension and the ligand-labeled single stranded product can be detected as described I hereinabove.
  • RNA can be detected by methods known to one of ordinary skill in the art, for example, polyaciylamide gel electrophoresis, radioactive or nonradioactive labeling and detection methods (Boehringer Mannheim), or the Sharp detection assay (Digene, Md.). Detection of the RNA indicates the presence of the target nucleic acid.
  • Ext-primer 1 and the co ⁇ esponding part of the linker region of the circular probe are designed to have a DNA-dependent RNA polymerase promoter sequence incorporated therein.
  • a functional promoter is formed and the circularized probe acts as a template for RNA transcription upon the addition of RNA polymerase and rNTPs.
  • the downstream primer and its RNA sequence are displaced by the RNA polymerase, and a large RNA polymer can be made.
  • the RNA polymer may be detected as described hereinabove.
  • the circular probe can be cleaved into a single stranded DNA by adding a restriction enzyme such as EcoRI. The restriction site is incorporated into the 5' end of extension primer 1, as shown in Fig. 24.
  • an oligonucleotide primer pair is designed to provide a signal in the presence of circular probe specific RAM amplification.
  • the first primer of the pair comprises a first sequence that is complementary to the circular probe and serves as a primer for RAM mediated amplification and a second sequence which is complementary to the second primer.
  • the first primer is labeled with a signal generating moiety which is detectable in the presence of the first sequence generated from the circular probe by primer extension.
  • the primer is labeled at its 5' end with the signal generating moiety.
  • signal generating moieties mclude but are not limited to fluorescent, chemiluminescent or enzymes. Examples include but are not limited to luciferase and fluorescein and quantum dots.
  • the third primer may comprise a sequence that is complementary to the first primer and is labeled with an inhibitory or quenching moiety.
  • the quenching moiety may be located on either the 5' or 3' end of the third primer, so long as when the first, second and third primers are bound to one another the signal generating moiety and the quenching moiety are adjacent to or in close proximity to each other so as to inhibit the signal from being emitted.
  • the first and second primers Upon completion of the RAM amplification the first and second primers will be displaced, thus allowing a signal to be emitted from the signal generating moiety.
  • primers conjugated to signal generating and inhibitory moieties may be used to amplify and detect target nucleic acid molecules using a variety of different amplification methods including but not limited to RAM, polymerase chain reaction, transcription mediated assay (Sa ⁇ azin C. et al., 2001, J Gin Microbiol. 39:2850-5) and strand displacement amplification assay (Nadeau et al., 1999, Anal. Biochem. 276:177-87).
  • amplification method results in the spatial separation of the signal generating moiety and the inhibitory moiety.
  • Such amplification methods are well known to those of skill in the art.
  • the present invention provides a method for detection of a target nucleic acid in a sample comprising contacting the nucleic acid with a hybridization probe which comprises a single stranded oligonucleotide having (i) a region that is complementary to the target nucleic acid and (ii) a region complementary to the circular probe.
  • a hybridization probe which comprises a single stranded oligonucleotide having (i) a region that is complementary to the target nucleic acid and (ii) a region complementary to the circular probe.
  • the target nucleic acid is contacted with a circular probe comprising a single stranded oligonucleotide having (i) a region that is complementary to the target nucleic acid and a region complementary to the hybridization probe, wherein said hybridization probe acts as a primer for amplification of the circular probe in the presence of the target nucleic acid.
  • the hybridization probe is then extended by addition of DNA polymerase followed by amplification of the circular
  • a method for detection of a target nucleic acid in a sample comprising contacting said nucleic acid with a first hybridization probe linked to a solid support wherein said hybridization probe comprises a single stranded oligonucleotide having (i) a region that is complementary to the target nucleic acid; and (ii) a circular probe bound by complementary sequences to said-second hybridization probe.
  • said first hybridization probe and second hybridization probe are adjacent to one another thereby permitting ligation of the first hybridization probe to the second hybridization probe following addition of ligase.
  • RAM amplification is used to amplify the probe.
  • modification of the design of the Amp-probe-2 may be used to amplify target sequences.
  • the 3' and 5' end of the Amp-probe-2 are separated by the target sequences that are intended to be amplified (Fig. 27).
  • the sequences may range in size from a few nucleotides to several thousand nucleotides.
  • the gap between the 3' end and the 5' end of the probe will be filled using a DNA polymerase which lacks 5'-3' exonuclease and displacement activities.
  • the amp-probe is designed to contain multiple primer sites that will be used to RAM amplify the genomic DNA. In instances where multiple restriction endonucleases are used to digest the DNA, multiple Amp-probes will be added with protruding sites complimentary to the different restriction sites. After annealing the amp-probes, ligase is added to the reaction to ligate the amp-probe sequences to the fragmented genomic DNA. This process may be repeated a number of times to ensure complete digestion of genomic DNA. (Fig. 30)
  • a first strand amp-probe may be added to the reaction containing the digested genomic DNA followed by ligation of the first strand amp-probe to the genomic DNA.
  • a second strand amp- probe which will hybridize to the complementary sequences of the first strand amp-probe, is added.
  • Ligase is added to the reaction a second time, resulting in genomic DNA fragments containing double stranded amp-probes ligated to each end.
  • RAM primers designed to bind to sequences within the amp-probe are added.
  • DNA polymerase and dNPTs are added to the reaction and RAM mediated amplification is initiated.
  • the DNA polymerase to be used in the amplification reaction is preferably one with a strong displacement activity and high processivity, such as, for example, ⁇ 29 or Bst DNA polymerase.
  • a second dsDNA AMP-probe-2 is ligated to the 5' end of the cDNA.
  • the resulting total cDNA is then amplified as described above for genomic DNA.
  • the present invention also provides a novel method for analyzing differential mRNA expression patterns between cells, refe ⁇ ed to herein as differential display RAM (DD-RAM).
  • a single probe may be designed to comprise a 5' anchor sequence and a 5' arbitrary sequence.
  • the probe may be labeled with a binding moiety, such as biotin, to facilitate isolation of the hybrid molecules from the reaction mixture (for example, using streptavidin beads).
  • a reverse transcriptase reaction is ca ⁇ ied out to extend the region between both ends of the primer followed by ligation to fo ⁇ n closed circular molecules which can be subsequently amplified by RAM. After digestion with a restriction endonuclease, the resulting products can be examined on a sequencing gel.
  • each mRNA has only one co ⁇ esponding RAM product because only the first available 3' Arbitrary/Amp-probe will be ligated to the extended sequence, therefore, reducing the redundant presentation of the same mRNA; (ii) all ligated probes are amplified by the same pair of primers, therefore, minimizing different primer amplification efficiencies; and (iii) with the addition of a subtraction step, housekeeping and/or structural mRNAs are eliminated from the reaction, thus increasing assay sensitivity and specificity.
  • the DD-RAM techniques described herein can be utilized to identify mRNAs that are differentially expressed within different cell types. For example, the technique will permit rapid screening of large numbers of tumor cells at different stages of tumorgenesis thereby providing a method for the identification of important genes that are closely related to tumorogenesis.
  • kits for use in practicing the present invention may be provided individually or may be packaged in kit fonn.
  • kits might be prepared comprising one or more first, ejj., capture/amplification-1 probes and one or more second, e.g., amplification-probe-2 probes, preferably also comprising packaged combinations of appropriate generic primers.
  • Kits may also be prepared comprising one or more first, e.g.. capture/amplification-1 probes and one or more second, full length, ligation-independent probes, ,., amplification-probe-2.
  • kits may be prepared comprising one or more first, e.g., capture/amplification-1 probes and one or more second, full length, ligation- dependent circularizable probes, e.g., amplification-probe-2.
  • Such kits may preferably also comprise packaged combinations of appropriate generic primers.
  • other reagents required for ligation e.g., DNA ligase
  • Additional reagents also may be included for use in quantitative detection of the amplified ligated amplification sequence, e ⁇ g., control templates such as an oligodeoxyribonucleotide co ⁇ esponding to nanovariant RNA.
  • kits may include reagents for the in situ detection of target nucleic acid sequences e ⁇ *. in tissue samples.
  • the kits containing circular probes may also include exonuclease for carryover prevention.
  • reagents within containers of the kit will depend on the specific reagents involved. Each reagent can be packaged in an individual container, but various combinations may also be possible.
  • nucleotides 41-46, 46-5 1 and 52-57 are recognition sequences for Smal (CCCGGG), EcoRI (GAATTC) and Hindlll (AAGCTT) at nucleotides 41-46, 46-5 1 and 52-57, respectively.
  • the 5' portion of the sequence comprising nucleotides 1-23 is complementary and hybridizes to a portion of the gag region of HIV-1 RNA.
  • Amp-probe-2 is a 92 nucleotide oligodeoxyribonucleotide which has the following sequence (also listed below as S ⁇ Q ID NO. 2): 1 11 21 31 41 5' - GGGTTGACCC GGCTAGATCC GGGTGTGTCC TCTCTAACTTTCGAGTAGAG
  • nucleotides at positions 71 -92 comprise the 3' specific portion of this probe, complementary and hybridizable to a portion of the gag region of HIV-1 RNA immediately adjacent to the portion of the gag region complementary to nucleotides 1-23 of Capture/Amp-probe-1 (HIV).
  • Nucleotides 1-70 comprise the generic 5' portion of Amp- probe-2 (HIV).
  • This ligated amplification sequence is 151 nucleotides long, which provides an ideal sized template for PCR.
  • the generic nucleotide sequences of the ligated amplification sequence comprising nucleotides 116-135 (derived from nucleotides 24-43 of Capture/Amp-probe-1 (HIV)) and nucleotides 1-70 (derived from nucleotides 1-70 of Amp-probe-2 (HIV)) co ⁇ espond in sequence to nucleotides 1-90 of the (-) strand of the WSI nanovariant RNA described by Schaffner et aL, J. Molec. Biol. 117:877-907 (1977).
  • WSI is one of a group of three closely related 6 S RNA species, WSI, WSII and WSIII, which arose in Q ⁇ replicase reactions without added template.
  • Schaffher et aL termed the three molecules
  • WSI (-) strand has the following sequence (also listed below as SEQ ID NO. 4):
  • Primer- 1 which has a length of 21 nucleotides, is complementary to the 3' sequence of Capture/Amp-probe-1 (HIV) (nucleotides 38-58) and has the sequence (also listed below as SEQ ID NO. 5):
  • Primer-2 which has a length of 20 nucleotides, co ⁇ esponds in sequence to the
  • HIV Amp-probe-2
  • Target HIV-1 RNA (100 ⁇ l) is dissolved in an equal volume of lysis buffer comprising SM GnSCN, lOOmM EDTA, 200mM Tris-HCl (pH 8.0), 0.5% NP-40 (Sigma Chemical Co., St. Louis, MO), and 0.5% BSA in a 1.5 ml microfuge tube.
  • lysis buffer comprising SM GnSCN, lOOmM EDTA, 200mM Tris-HCl (pH 8.0), 0.5% NP-40 (Sigma Chemical Co., St. Louis, MO), and 0.5% BSA in a 1.5 ml microfuge tube.
  • HW 3'- biotinylated Capture/Amp-probe-1
  • HTV Amp-probe-2
  • a functional ligated amplification sequence (SEQ ID NO. 3), which can serve as a template for PCR amplification.
  • the ligation reaction was ca ⁇ ied out in the presence of a 1 X ligation buffer comprising a 1:10 dilution of 10X T 4 DNA ligase ligation buffer (660mM Tris-HCl, 50mM MgCl 2 , lOmM dithioeryritol, lOmM ATP - pH 7.5 at 20°C) obtained from Boehringer Manheim.
  • IX T 4 DNA ligase ligation buffer IX T 4 DNA ligase ligation buffer
  • 20 ⁇ l of bead suspension was removed for the ligation reaction.
  • 2 ⁇ l T 4 DNA ligase was added to the reaction mixture, which was incubated at 37°C for 60 minutes.
  • PCR amplification of the bound ligated amplification sequence 80 ⁇ l of a PCR reaction mixture comprising Taq DNA polymerase, the two generic PCR primers (SEQ ID NOS. 5 and 6), a mixture of deoxynucleoside triphosphates and 32 P-dCTP was added to the ligation reaction.
  • a two temperature PCR reaction was carried out for 30 cycles in which hybrid formation and primer extension was carried out at 65 °C for 60 seconds and denaturation was carried out at 92°C for 30 seconds.
  • 10 p.1 of the reaction mixture was subjected to electrophoresis in a 10% polyacrylamide gel and detected by autoradiography (Fig. 3, Lane A).
  • nanovariant DNA SEQ ID NO. 4
  • HAV ligated amplification sequence
  • Fig. 3 Lane B the amplified ligated amplification sequence (HIV) migrated in a single band (151 nucleotides) at a slower rate than the amplified nanovariant DNA (90 nucleotides).
  • the results also indicated that unligated first and second probes were either not amplified or detected.
  • RNA in a sample was also determined.
  • the probes used in this Example are the same as in Example 1 (SEQ ID NOS. 1 and 2).
  • Amp-probe-2 (HIV) (SEQ ID NO. 2) was labeled at its 5' end with 32 P by the T 4 phosphokinase reaction using 32 P- ⁇ -ATP.
  • the various reaction mixtures were as follows: 1. Streptavidin-coated paramagnetic beads, 3 '-biotinylated Capture/Amp- probe-1 (HIV) (SEQ ID NO. 1), Amp-probe-2 (HIV) (SEQ ID NO. 2) 5'( 32 P), HIV-1 RNA transcript. 2.
  • Streptavidin-coated paramagnetic beads 3 '-biotinylated Capture/Amp- probe-1 (HIV), Amp-probe-2 (HIV) 5 '( 32 P). 3. Streptavidin-coated paramagnetic beads, Amp-probe-2 (HIV) 5'( 32 P), HIN- 1 R ⁇ A transcript.
  • Hybridizations using each of the above three reaction mixtures, were carried out in 20 ⁇ l of a IM GnSC ⁇ buffer comprising IM GnSC ⁇ , 0.5% ⁇ P-40 (Nonidet P-40, N- lauroylsarcosine, Sigma Chemical Co., St Louis, MO), 80mM EDTA, 400mM Tris HCI (pH 7.5) and 0.5% bovine serum albumin.
  • IM GnSC ⁇ buffer comprising IM GnSC ⁇ , 0.5% ⁇ P-40 (Nonidet P-40, N- lauroylsarcosine, Sigma Chemical Co., St Louis, MO), 80mM EDTA, 400mM Tris HCI (pH 7.5) and 0.5% bovine serum albumin.
  • reaction mixtures were incubated at 37°C for 60 minutes. After incubation, the reaction mixtures were subjected to a magnetic field as described in Example 1 and washed (200p.l/wash) two times with iM GnSCN buffer and three times with a 300mM KC1 buffer comprising 300mM KCL, 50mM Tris-HCl (pH 7.5), 0.5% NP-40 and ImM BDTA.
  • the amount of 32 P - labeled Amp-probe-2 (HIV) that was retained on the paramagnetic beads after washing is reported in Table 1 as counts-per-minute (CPM).
  • CPM counts-per-minute
  • rRNA is an essential constituent of bacterial ribosomes; 2) comparative analysis of rRNA sequences reveals some stretches of highly conserved sequences and other stretches having a considerable amount of variability; 3) rRNA is present in large copy numbers, e ⁇ . 103 to 10 4 molecules per cell, thus facilitating the development of sensitive detection assays; 4) the nucleotide sequence of 16S rRNA can be rapidly dete ⁇ nined without any cloning procedures and the sequence of most Mycobacterial 16S rRNAs are l ⁇ iown.
  • Three pairs of Capture/Amp-probe-1 and Amp-probe-2 probes are prepared by automated oligonucleotide synthesis (as above), based on the 16S rRNA sequences published by Boddinghaus et aL, and Rogall et aL
  • the first pair of probes (MYC) is generic in that the specific portions of the first and second probes are hybridizable to 16S RNA of all Mycobacteria spp; this is used to detect the presence of any mycobacteria in the specimen.
  • the second pair of probes (MAV) is specific for the 16S rRNA of M. avium
  • the third pair of probes (MIN) is specific for the 16S rRNA of M ' intracellulaire.
  • the extremely specific ligation reaction of the present method allows the differentiation of these two species at a single nucleotide level.
  • the probes that may be used for generic detection of all Mycobacter spp. comprise a first and second probe as in Example 1.
  • the first probe is a 3' biotinylated - Capture/Amp-probe-1 (MYC), an oligodeoxyribonucleotide of 54 nucleotides in length with the following sequence (also listed below as SEQ ID NO. 7):
  • Nucleotides 1-18, at the 5' end of the probe are complementary to a common portion of Mycobacterial 16S rRNA, Le., a 16S rRNA sequence which is present in all Mycobacteria spp.
  • the 3' portion of the probe, comprising nucleotides 19-54 is identical in sequence to the 36 nucleotides comprising the generic portion of Capture/Amp-probe-1 (HIV) of Example 1.
  • the second probe is Amp-probe-2 (MYC), an oligodeoxyribonucleotide of 91 nucleotides in length, with the following sequence (also listed below as SEQ ID NO. 8):
  • Nucleotides 71-91 at the 3' end of the probe are complementary to a common portion of 16S rRNA adjacent the region complementary to nucleotides 1 -18 or Capture/Amp-probe-1 (MYC) disclosed above, common to all Mycobacteria spp.
  • Nucleotides 1-70 at the 5' end of the probe comprise the same generic sequence set forth for Amp-probe-2 (HIV) in Example 1.
  • End to end ligation of the two probes provides ligated amplification sequence (MYC), 145 nucleotides in length, for detection of all Mycobacteria spp., having the following sequence (also listed below as SEQ ID NO. 9):
  • the first probe is a 3' biotinylated-Capture/Amp-probe- 1 (MAV), an oligodeoxyribonucleotide of 56 nucleotides in length with the following sequence (also listed below as SEQ ID NO. 10): 1 11 21 31
  • Nucleotides 1-20 at the 5' - end are complementary to a portion of 16S rRNA specific for M. avium. Nucleotides 21-56 comprise the same generic sequence, as above.
  • the second probe is Amp-probe-2 (MAV), an oligodeoxyribonucleotide of 90 nucleotides in length, with the following sequence (also listed below as SEQ ID NO. 11):
  • Nucleotides 7 1-90 at the 3' end of the probe comprise the specific nucleotide sequence complementary to a region of 16S rRNA specific for M. avium, adjacent the specific sequence recognized by Capture/Amp-probe-1 (MAV). Nucleotides 1-70 comprise the same generic sequence as above.
  • End to end ligation of the two probes provides a 146 nucleotide long ligated amplification sequence (MAV) for detection of M. avium having the following sequence (also listed below as SEQ ID NO. 12):
  • the first probe is a 3' - biotinylated Capture/Amp-probe-1 (MIN), an oligonucleotide of 56 nucleotides in length with the following sequence (also listed below as MIN), an oligonucleotide of 56 nucleotides in length with the following sequence (also listed below as MIN), an oligonucleotide of 56 nucleotides in length with the following sequence (also listed below as
  • Nucleotides 1-20 at the 5' end are complementary to a portion of 16S rRNA specific for M. intracellulaire. Nucleotides 21-56 comprise the same generic sequence as above.
  • the second probe is Amp-probe-2 (MIN), an oligodeoxyribonucleotide or 90 nucleotides in length, with the following sequence (also listed below as SEQ ID NO. 14):
  • Nucleotides 7 1-90 at the 3' end of the probe comprise the specific nucleotide sequence complementary to a region of M. intracellulaire 16S rRNA adjacent the specific sequence recognized by Capture/Amp-probe-1 (MIN).
  • MIN Capture/Amp-probe-1
  • a direct detection is made by measuring radioactivity representing 32 P-5 '-AMP-probe-2 captured on the magnetic beads. After the unbound radioactively-labeled Amp-probe-2 is removed by extensive washing, the target 16S rRNA molecules that are present in concentrations of more than 10 6 /reaction is detectable. Target 16S rRNA that cannot be detected directly is subjected to PCR amplification of the ligated amplification sequences as per Example 1.
  • the primers for use in amplification are the same two generic primers of Example 1 (SEQ ID NOS. 5 and 6). EXAMPLE 4 DETECTION OF HCV RNA IN A SAMPLE.
  • HCV Hepatitis C virus
  • RINA virus an RINA virus
  • HCV has been found to be distantly related to flavivirus and pestivirus and thus its genome has a 5' and a 3' untranslated region (UTR) and encodes a single large open reading frame (Lee et aL, J. Gin. Microbiol. 30:1602-1604, 1992).
  • UTR untranslated region
  • the present method is useful for detecting the presence of HCV in a sample.
  • a pair of oligodeoxynucleotide probes designated Capture/Amp-probe-1
  • HCV Hydrophilicity-sensitive virus
  • HCV Amp-probe-2
  • Capture/Amp-probe-i which is biotinylated at the 3' end, is a 55 nucleotide long oligodeoxyribonucleotide having the following nucleotide sequence (also listed below as SEQ ID NO. 16):
  • Nucleotides 1-19 at the 5' end of Capture/Amp-probe-1 comprise a specific sequence complementary to a portion of the 5' UTR of the HCV genome.
  • Nucleotides 20-5 5 at the 3' end of the probe comprise the same 36 nucleotide generic sequence as in Capture/Amp-probe-1 (HIV) of Example 1.
  • Amp-probe-2 is a 90 nucleotide long oligodeoxyribonucleotide having the following nucleotide sequence (also listed below as SEQ ID NO. 17): 1 11 21 31
  • Nucleotides 7 1-90 comprise the 3' specific portion of the probe, complementary and hybridizable to a portion of the HCV 5' UTR immediately adjacent to the portion of the HCV genome hybridizable to nucleotides 1-19 of Capture/ Amp-probe-2 (HCV).
  • Nucleotides 1-70 comprise the same generic sequence as in Amp-probe-2 (HIV) of Example 1.
  • HCV long ligated amplification sequence
  • the ligated amplification sequence (HCV) is amplified using a two temperature PCR reaction as in Example 1.
  • the PCR primers used for amplification are the same two generic primers (SEQ ID NOS. 5 and 6) of Example 1.
  • EXAMPLE 5 USE OF MULTIPLE CAPTURE AND AMPLIFICATION PROBES TO DETECT HCV RNA IN A SAMPLE.
  • a pair of amplication probes and two capture/amplification probes were used to assay for and detect HCV RNA in a sample, thereby increasing the capture efficiency of the assay.
  • Capture/Amp-probe-1 (HCV A) (all oligomers described in this Example are designated “(HCV A)" to distinguish from the probes "(HCV)” of Example 4) having SEQ ID NO. 22 and Capture/Amp-probe-1 A (HCV
  • A) having SEQ ID NO. 23 are designed and synthesized such that their 5' tennini are biotinylated and the 3' region of the probes comprises sequences complementary to and hybridizable with sequences in the 5'UTR of HCV RNA (Fig. 4).
  • the generic nucleotide sequence at the 5' region of the probes that are not hybridizable to the target nucleic acid sequence are designed and synthesized to have random sequences and a GC content of, at least, 60%, and such that they exhibit minimal secondary structure e ⁇ hairpin or foldback structures.
  • Capture/Amp-probe-1 (HCV A) which is biotinylated at the 5' terminus, is a
  • nucleotide DNA oligomer such that nucleotides 5 to 45 in the 3' region, are complementary to and hybridizable with sequences in the 5'UTR of the target HCV RNA, and that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO:
  • Capture/Amp-probe-iA which is also biotinylated at the 5' terminus, is also a 45 nucleotide DNA oligomer, such that nucleotides 5 to 45 in the 3' region are complementary to and hybridizable with sequences in the 5'UTR of HCV RNA that are immediately adjacent to the region of the 5'UTR of the HCV RNA hybridizable with Capture/Amp-probe-1 (HCV A) and such that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO. 23):
  • HCV A each contain a nucleotide sequence complementary to and hybridizable with the conserved 5'UTR of HCV RNA.
  • Amp-probe-2 (HCV A) is a 51 nucleotide oligomer such that nucleotides 1 to
  • PCR primer-3 and such that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO. 24):
  • Amp-probe-2A (HCV A) is a 69 nucleotide oligomer such that nucleotides 40 to 69 in the 3' region are complementary to and hybridizable with sequences in the 5'UTR of
  • oligomer 36 at the 5' te ⁇ ninus bind to and hybridize with PCR primer-5, and such that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO. 25):
  • End to end ligation of the two probes provides a 120 nucleotide ligated product, the ligation-amplification sequence (HCV A) that serves as a detectable sequence for
  • HCV as well as a template for amplification reactions, and has the sequence (also listed below as SEQ ID NO. 26):
  • Primer-4 used for the first series of PCR amplification of the ligated amplification sequence (HCV A), SEQ ID NO. 26, and which has a length of 18 nucleotides, is complementary to the sequence comprising nucleotides 1-18 at the 5' terminus of the Amp- probe-2A (HCV A), and is, therefore, also complementary to the sequence comprising nucleotides 1 to 18 of the ligated amplification sequence, SEQ ID NO. 26 (HCV A), and has the sequence (also listed below as SEQ ID NO. 28):
  • hybridization buffer [0.5%> bovine serum albumin, 80mM EDTA, 400 nvM Tris-HCl (pH 7.5), 0.5% Nonidet-P40] with 10 ° molecules each of amplification probes, Amp-probe-2 (HCV A) and Amp-probe-2A (HCV A) oligomers, and 10 u molecules each of capture/amplification probes, Capture/Amp-probe-1 A (HCV A) and Capture/Amp-probe-1 A (HCV A).
  • the addition of the hybridization buffer reduced the concentration of the guanidium isothiocyanate (GnSCN) from 5M to 2M to allow the hybridization to occur.
  • GnSCN guanidium isothiocyanate
  • the mixture was incubated at 37°C for 1 hour to let the various probes hybridize with the target RNA, whereupon 30 ⁇ l of streptavidin-coated paramagnetic beads (Promega) were added to the hybridization mixture before incubation at 37° C for 20 minutes to allow ligand binding.
  • the beads were washed with 150 ⁇ l of 2M GnSCN to eliminate any free probes, proteins, extraneous nucleic acids and potential PCR inhibitors from the hybridization mixture; this was followed by the removal of the GnSCN by washing twice with 150 ⁇ l ligase buffer [66mM Tris-HCl (pH 7.5) ImM DTT, ImM ATP, 0.5% Nonidet P-40 and lmM MnG 2 ].
  • lO ⁇ l of the ligated mixture, including the beads was added to 20 ⁇ l of PCR mixture [0.06 ⁇ .M each of Primer-3 and Primer-4, 1.5 Units Taq DNA Polymerase, 0.2 mM each of dATP, dCTP, dGTP and dTTP, 1.5 mM MgCl 2 , lOmM Tris-HCl (pH 8.3) 50mM KC1] and the mixture incubated at 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 1 minute, for 35 cycles.
  • PCR mixture [0.06 ⁇ .M each of Primer-3 and Primer-4, 1.5 Units Taq DNA Polymerase, 0.2 mM each of dATP, dCTP, dGTP and dTTP, 1.5 mM MgCl 2 , lOmM Tris-HCl (pH 8.3) 50mM KC1] and the mixture incubated at 95°C for 30 seconds, 55°C for 30 seconds
  • the assay is quantitative over, at least, a range of 10 2 to 10 5 target molecules.
  • HCV A Capture/Amp-probe-1
  • HCV A Capture/Amp-probe-1 A
  • Example 1 An alternative approach to that set forth in Example 1 uses a capture/amplification probe and a pair of amplication probes to detect the presence of HIV-1 RNA.
  • Amp- probe-2 (HIV A) (all oligomers described in this Example are designated "(HIV A)" to distinguish from the probes "(HIV)" of Example 1) (SEQ ID NO. 19) and Amp-probe-2A (HIV A), (SEQ ID NO. 20), are utilized such that the generic nucleotide sequences of the ligated amplification sequence (HIV A) (SEQ ID NO.
  • nucleotides 1-26 derived from nucleotides 1-26 of Amp-probe-2 (HIV A) and nucleotides 86-112 derived from nucleotides 40-65 of Amp-probe-2A (HIV A) are designed and synthesized to have random sequences and a GC content of, at least, 60%, and such that they exhibit minimal secondary structure e_g. hairpin or foldback structures.
  • Amplification probe Amp-probe-2 (HIV A) is a 47 nucleotide DNA oligomer such that nucleotides 27 to 47 in the 3' region, are complementary to and hybridizable with sequences in the gag region of the target HIV-1 RNA, and that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO. 19):
  • Amplification probe Amp-probe-2A (HIV A) is a 65 nucleotide DNA oligomer such that nucleotides 1 to 39 in the 5' region, are complementary to and hybridizable with sequences in the gag region of the target HP/-1 RNA, immediately adjacent to the portion of the HP/-1 RNA genome hybridizable to nucleotides 27-47 of the Amp- probe-2 (HIV A) and that the oligomer has the following nucleotide sequence (also listed below as SEQ ID NO. 20):
  • End to end ligation of the two amplification probes provides a 112 nucleotide ligated amplification sequence (HIV A) such that the sequence serves as a detectable sequence for HP/-1 RNA as well as a template for amplification reactions, and has the following sequence (also known as SEQ ID NO. 21)
  • PCR primers used for amplification are the same primers- 3, 4 and 5 (SEQ ID ⁇ OS. 27, 28 and 29) of Example 5.
  • EXAMPLE 7 USE OF SEPARATE CAPTURE/AMPLIFICATION PROBES AND A LIGATION INDEPENDENT, SINGLE AMPLIFICATION PROBE TO DETECT HCV RNA IN A SAMPLE.
  • the assay employs a single ligation independent amplification probe and two capture/amplification probes to detect HCV RNA in a sample.
  • Capture/Amp-probe-1 A (HCV A) used in this method are the same as described in Example
  • Amp-probe-2 (HCV C) (all oligomers described in this
  • Example are designated "(HCV C)" to distinguish from the probes "(HCV)” of Example 4) that hybridizes to the target nucleic acid and circularizes upon ligation of its free termini as shown in Fig. 7.
  • Amp-probe-2 (HCV C) is a 108 nucleotide amplification probe, also refe ⁇ ed to as an amplification sequence, such that nucleotides 1-26 in the 5' terminus of the oligomer are complementary to and hybridizable to a sequence in the 5'UTR of the target HCV RNA (indicated by (a) in Fig. 7) and such that nucleotides 83-108 at the 3' terminus of the oligomer are complementary to and hybridizable to a sequence in the 5'UTR of the target HCV RNA (indicated by (b) in Fig. 7).
  • HCV C The sequence of Ampprobe-2 (HCV C) is given as follows (also listed as SEQ ID NO. 31):
  • Primer-3 (SEQ ID NO. 27), used for the first series of PCR amplification of the ligated and circularized Amp-probe-2 (HCV C), is an 18 nucleotide long oligomer that is complementary to the sequence comprising nucleotides 27 to 45 of Amp-probe-2 (HCV C).
  • the assay is significantly quantitative at least over a range of 10 4 to
  • PCR reverse transcriptase PCR
  • FFPE formalin fixed, paraffin embedded
  • liver specimens were stored at 4°C and sectioned within twelve hours.
  • the specimens were fixed in 10% buffered formalin for eight to twelve hours and routinely embedded in paraffin.
  • the FFPE specimens were stored at room temperature for a period of three months up to three years.
  • snap frozen liver tissues from thirteen of the twenty-two patients, stored at -70°C, were used to resolve discordance between LD-PCR and RT-PCR results.
  • FFPE specimens (approximately 2-4 cm 2 ) were sectioned on a microtome with a disposable blade to 10 ⁇ m in thickness, and each section was placed in a 1.5-ml microcentrifuge tube. To avoid cross contamination, the blades were changed and the holder was cleaned with 10% Chlorox solution between each sample. The sections were deparaffinized by incubating at 60°C for 10 minutes in the presence of 1 ml of xylene (Sigma). The xylene was removed by two washes with absolute ethanol. The specimens were then dried by vacuum centrifugation or by placing on a hot block at 65 °C for 30 min. [00297] For LD-PCR, the deparaffinized tissues were lysed by incubating at 100°C for
  • LD-PCR was performed as follows. Briefly, 80 ⁇ l of lysis mixture were added to 120 ⁇ l of hybridization buffer [0.5% bovine serum albumin, 80 mM EDTA, 400 Mm Tris-HCl (pH 7.5), and 0.5%> sodium-N-lauroylsarcosine], which contained 10 10 molecules of phosphorylated Amp-probe-2, 10 10 molecules of Amp-probe 2A and 10 ⁇ molecules of capture Amp-probe 1 and capture Amp probe 1A. (Probes are as described in Example 5). Addition of the hybridization buffer reduced the GnSCN concentration from 5 M to 2 M to allow hybridization to occur.
  • hybridization buffer 0.5% bovine serum albumin, 80 mM EDTA, 400 Mm Tris-HCl (pH 7.5), and 0.5%> sodium-N-lauroylsarcosine
  • the hybrids were then resuspended in 20 ⁇ l ligase solution [66 mM Tris HCI (pH 7.5), 1 mM dithiotlnreitol, 1 mM ATP, 1 mM MnCl , 5 mM MgCl 2 , and 5 units of T4 DNA ligase (Boehringer Mannheim)] and incubated at 37°C for one hour to covalently link the probes that are hybridized to adjacent positions on the RNA target, thus producing the ligated amplification probe described in Example 5.
  • 20 ⁇ l ligase solution 66 mM Tris HCI (pH 7.5), 1 mM dithiotlnreitol, 1 mM ATP, 1 mM MnCl , 5 mM MgCl 2 , and 5 units of T4 DNA ligase (Boehringer Mannheim)] and incubated at 37°C for one hour to covalently link the probes that
  • Ten ⁇ l of the ligation reaction mixture (including beads) were then transferred to 20 ⁇ l of a PCR mixture containing 0.66 ⁇ M of PCR primer 3 and 0.66 ⁇ M of PCR primer 4 as described in Examples, 1.5 units of Taq DNA polymerase, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, 1.5 mM MgCl 2 , 10 mM Tris-HCl (pH 8.3), and 50 mM KCl.
  • the first PCR reaction was incubated at 90°C for 30 sec, 55°C for 30 sec and 72°C for 1 min for 35 cycles in a GeneAmp PCR System 9600 Thermocycler (Perkin-Elmer, Norwalk, CT). After the first PCR, 5 ⁇ l of each reaction mixture were transfe ⁇ ed into a 30- ⁇ l second PCR mixture containing the same components except that 0.66 ⁇ M of PCR primer 3 and 0.66 ⁇ M of PCR primer 5 were used for semi-nested PCR. The second PCR reaction was performed by the same protocol as the first PCR reaction.
  • RT-PCR was performed according to the method of Abe et al. (1994)
  • RNA suspension of each specimen was used as template to detect HCV RNA and beta actin RNA.
  • the beta actin RNA was used internal positive control for cellular RNA.
  • the sequence of outer primers used for RT-PCR are, for HCV RNA, 5'-GCGACACTCCACCATAGAT-3' (sense) (SEQ ID NO : 32) and 5'-GCTCATGGTGCACGGTCTA-3' (antisense) (SEQ ID NO : 33) and for beta-actin RNA, 5'-CTTCTACAATGAGCTGCGTGTGGCT-3' (sense) (SEQ ID NO : 34) and 5'-CGCTCATTGCCAATGGTGATGACCT-3' (antisense) (SEQ ID NO: 35).
  • the first PCR reaction was combined with the reverse transcription step in the same tube containing 50 ⁇ l of reaction buffer prepared as follows: 20 units of Rnase inhibitor (Promega), 100 units of Moloney murine leukemia virus reverse transcriptase (Gibco BRL), 100 ng of each outer primer, 200 ⁇ M of each of the four deoxynucleotides, 1 unit of Taq DNA polymerae (Boehringer Maimheim) and IX Taq buffer containing 1.5 mM MgG 2 .
  • the thermocycler was programmed to first incubate the samples for 50 min at 37°C for the initial reverse transcription step and then to carry out 35 cycles consisting of 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min.
  • the second PCR 5 ⁇ l of the first PCR product was added to a tube containing the second set of each inner primer, deoxynucleotides, Taq DNA polymerase and Taq buffer as in the first PCR reaction, but without reverse transcriptase and Rnase inhibitor.
  • the second PCR reaction was perfo ⁇ ned with the same protocol as the first PCR reaction but without the initial 50 min incubation at 37°C. Twenty ⁇ l of the PCR products were examined by electrophoresis through a 2% agarose gel. Positive results of HCV RNA and beta-actin RNA were indicated by the presence of second PCR products as a 268- basepair and a 307-basepair band, respectively.
  • the results of LD-PCR and RT-PCR are set forth below in Table 2.
  • FFPE formalin fixed paraffin embedded liver tissues.
  • Unfixed snap frozen liver tissues of corresponding FFPE specimens.
  • c Number of FFPE specimens tested positive (+) or negative (-) by ligation-dependent PCR.
  • e Number of specimens confirmed by RT-PCR using unfixed frozen tissues. f Only 7 unfixed specimens were available for confirmatory RT-PCR test. g Only 7 unfixed specimens were available for confirmatory RT-PCR test.
  • Beta actin mRNA was detected in all co ⁇ esponding specimens, indicating minimal RNA degradation. These results confirmed the preservation of the HCV RNA during formalin-fixation, the heated paraffin embedding process, and up to three years of storage.
  • the overall sensitivity of RT-PCR on FFPE specimens was 23.8% (5/21) in this study while it was determined 58.6% and 84% in prior studies by El-Batonony et al. (1994) J. Med. Virol. 43: 380 and Abe et al. The gross difference in these values was due to the difference in the selection of specimens in these studies (eight RT-PCR negatives and five positives on FFPE tissues, were selected for this study).
  • HCC primary biliary ci ⁇ hosis
  • HBV hepatitis B vims
  • a Liver specimens from patients with various clinical diagnosis PBC ⁇ primary biliary cirrhosis, Alcoholic—alcoholic liver cirrhosis, HBV—positive for HBsAg, Cryptogenic— cryptogenic liver cirrhosis.
  • b FFPE formalin fixed paraffin embedded liver tissues.
  • c Unfixed snap frozen, unfixed liver tissues of corresponding FFPE specimens.
  • a synthetic DNA target was detected by mixing 10 12 molecules of phosphorylated circularizable probe having SEQ ID NO:31 with 10 13 molecules of synthetic HCV DNA target in 10 ⁇ l of IX ligation buffer, heating at 65°C for two minutes, and cooling to room temperature for ten minutes.
  • One ⁇ l of ligase was added to the mix and incubated at 37°C for one hour, followed by addition of 10 13 molecules of 32 P-labeled Ext- primer having SEQ ID NO:27. The mixture was heated to 100°C for five minutes and then cooled to room temperature for twenty minutes.
  • FFPE tissues were deparafinized by incubating at 60°C for 10 minutes with 1 ml xylene (Sigma), which was subsequently removed by two washes with absolute ethanol. These specimens were dried by placing on a hot block at 65°C for 30 minutes.
  • the sequences for capture probe 1 (SED ID NO : 40) and capture/amplification probe 2 (SEQ ID NO : 41) are shown in Table 4.
  • the circular amplification probe (SEQ ID NO : 42) was designed with 3' and 5' regions complementary to the chosen target sequence (Table 4). Interposed between these two regions is a noncomplementary linker sequence. This circular amplification probe circularized upon target hybridization in such a manner as to juxtapose the 5' and 3' ends. Seminested PCR was performed using primer pairs directed at this linker sequence, also shown in Table 4. [00309] TABLE 4
  • hybridization buffer reduced the GnSCN concentration from 5 M to 2 M to allow hybridization to occur.
  • This mixture was incubated for one hour to allow the formation of hybrids, consisting of two DNA capture/amplification probes and one DNA circular amplification probe hybridized on the target RNA.
  • Thirty ⁇ l of streptavidin-coated paramagnetic beads (Promega) were added to the mixture and incubated at 37°C for 20 minutes to allow the hybrids to bond to the bead surface.
  • EBER- 1 sequences were detected in six of eight parotid samples. Of the six pleomorphic adenomas studied, four were positive for EBER-1. Of the two cases in which EBER was not detected in the tumor, sequences were present within su ⁇ ounding parotid tissue. The detection of EBER-1 sequences within co ⁇ esponding formalin-fixed paraffin embedded tissue was considerably less sensitive - only two of eight specimens were positive.
  • Capture/Amp-probes are synthesized, each containing a nucleotide G, A, or C at the 3' teiinini. Adjacent to the terminal nucleotide is a oligo (dT) ⁇ which will serve as both a capture and anchoring sequence.
  • the 5' region of the Capture/ AMP-probes comprise multiple, i.e., 5-20, generic primer binding sequences with a biotin moiety at the 5' end. These multiple primer binding sites are designed for RAM amplification to ensure sensitivity.
  • Each 3' Arbitrary/Amp-probe contains a 5' arbitrary sequence, for example 10 nucleotides in length, and a 3' RAM primer binding sequence which may be 70-130 nucleotides in length.
  • the 5' end of each 3' Arbitrary/Amp- probe is phosphorylated by incubating with T4 DNA kinase in order for ligation to occur.
  • the 3' Arbitrary/Amp-probes are mixed in an equal molar ratio to a final concentration of 10 ⁇ molecules/ul. The concentration of each 3' Arbitrary/Amp-probe may be changed to achieve best differential display.
  • hybridization mixture is incubated at 37°C for one hour to allow the formation of hybrids, consisting of 5' Capture/Amp-probes and 3' Arbitrary/Amp-probes bound to their mRNA targets.
  • 30 ul of streptavidin-coated paramagnetic beads (1 mg/ml, Promega, Madison, WI) are added to the mixture and incubated at 37°C for 20 min to allow the hybrids to bind to the bead surface.
  • the beads are then washed twice with 180 ul of washing buffer [10 mM TrisHCl (pH 7.5), 50mM KCl, and 1.5 mM MgC12, and 0.5% Nonidet P-40 (Sigma)] to remove nonhybridized probes, as well as GTC, proteins, nucleic acids, and any potential ligation and RAM inhibitors.
  • washing buffer 10 mM TrisHCl (pH 7.5), 50mM KCl, and 1.5 mM MgC12, and 0.5% Nonidet P-40 (Sigma)] to remove nonhybridized probes, as well as GTC, proteins, nucleic acids, and any potential ligation and RAM inhibitors.
  • the gap between the arbitrary probe and extended sequence is ligated to form covalently linked circular probes that can be amplified by a RAM assay as described above.
  • Ten ul of the RT/ligation reaction mixture (including beads) is then transfe ⁇ ed to 40 ul of a RAM mixture containing 0.66 uM of RAM forward primers and 0.66 uM of RAM reverse primers, 90 ng of ⁇ 29 DNA polymerase (Boehringer Mannheim), 80 ⁇ M 32 P-dATP, SO ⁇ M dCTP, 80 ⁇ M dGTP, 80 ⁇ M dTTP, 5 mM MgCl 2 , and 66 mM Tris-HCl (pH 7.5).
  • the RAM reaction is incubated at 35°C for two hours.
  • EXAMPLE 14 ANCHORING RAM [00324] 10 13 molecules of C-probe containing four biotin molecules in the linker region were incubated with 10 14 molecules of synthetic DNA target for 5 minutes at 75 °C in IX ligation buffer followed by incubation at room temperature for 10 minutes to allow the C- probe to hybridize to the target. Ligase was added to the mixture and incubated at 37°C for one hour to link the two ends of the C-probe to fo ⁇ n a closed circular probe. 0.1 ⁇ l of avidin (Boehringer Manheim) was added to the reaction forming avidin/C-probe complexes.
  • Biotinylated signal probe comprising 40 nucleotides with 3 biotin molecules was added to the reaction.
  • the rolling circle reaction was initiated by addition of amplification primer and DNA polymerases.
  • the reaction is not inhibited when Bst DNA polymerase is used.
  • the reaction is inhibited when phi 29 DNA is used.
  • RAM primers are able to bind C-probe, even in the presence of large avidin molecules, and that Bst DNA polymerase is capable of bypassing the biotin-avidin complex and extend along the length of the C-probe Fig. 23.
  • EXAMPLE 15 REAL-TIME RAMIFICATION AMPLIFICATION WITH MOLECULAR ZIPPER [00325]
  • the zipper is composed of two probes with different lengths.
  • the longer one hybridizes with the shorter one, leaving a single-stranded tail at the 3 '-end of the longer probe.
  • the zipper binds to the complementary region in the loop region of the Circular Probe.
  • the 3 '-end of the tail also serves as one of the two primers in the RAM reaction.
  • the 5 '-end of the long probe is labeled with a fluorescein molecule.
  • DABCYL a quencher molecule is incorporated.
  • the two probes are no longer in close proximity to one another. Therefore the quenching action of the DABCYL is inhibited and light is emitted from the fluorescein molecule.
  • the Molecular Zipper probes were prepared as follows: The two probes were synthesized by Integrated DNA Technologist, Inc, Coralville, IA, were purified by gel electrophoresis and were mixed at 1:1 molar ratio.
  • Zipper probe 1 is a 38 nucleotide oligomer (also listed below as SEQ ID NO. 43), is the shorter one of the pair and is labeled with the DABCYL molecule on its 3' end.
  • Zipper probe 2 is a 61 nucleotide oligomer (also listed below as SEQ ID NO. 44), is the longer one of the pair and is labeled with the fluorescein molecule on its 5 'end.
  • Zipper Probe 1 SEQ ID NO. 43:
  • the mixture was heated up to 95°C for 5-10 min, and cooled down slowly to room temperature.
  • the concentration of the zipper probes was adjusted to 50 ⁇ M with water or lx TE buffer.
  • the RAM assay consisted of several steps including hybridization of the oligonucleotide probe (also listed below as SEQ ID NO. 45), and the capture probe (also listed below as SEQ ID NO. 46), to a target nucleic acid (also listed below as SEQ ID NO.
  • the oligonucleotide probe is 124 nucleotides long and contains sequences complementary to Chlamydia trachomatis elementary body, the target nucleic acid.
  • the capture probe is a 43 nucleotide oligomer with a biotin molecule at its 5' end.
  • the target nucleic acid molecule is from Chlamydia trachomatis elementary body and is 96 nucleotides long.
  • Oligonucleotide Probe SEQ ID NO. 45:
  • Capture Probe SEQ ID NO. 46:
  • Target Nucleic Acid Molecule (SEQ ID NO. 47): [00340] 5'-TCCGGAGCGA GTTACGAAGA CAAAACCTCT TCGTTGACCG
  • oligonucleotide probe/capture probe/target nucleic acid hybrid was then captured onto magnetic beads and washed to remove unbound probes and cellular components.
  • the 3' and 5' ends of the oligonucleotides probe were ligated to form a closed circular probe. Then amplification by primer extension, strand displacement, and ramification was performed.
  • Hybridization of the oligonucleotides probe, capture probe and target was carried out in 80 ⁇ l reaction containing 2 M GTC, 0.5% bovine serum albumin (Sigma), 80 mM EDTA, 400 M Tris-HCl (pH 7.5), 0.5% sodium-N-lauroylsarcosine (Sigma), 50 nM phosphorylated oligonucleotides probe, 2 ⁇ M capture probe, and various amount of targets (10 to 10 5 molecules). The reaction was incubated at 55°C for 2 hours to allow hybrid formation.
  • streptavidin-coated magnetic beads (10 mg/ml, Dynal, Lake Success, NY), 80 ⁇ l of 10 mM Tris-HCl (pH 7.5) with 1 mM EDTA, and 2 M NaCl were added to the hybridization mixture and incubated at room temperature for 20 minutes to allow the hybrids to be captured on the beads through the binding of biotin on the capture probe with streptavidin coated on the surface of the beads.
  • the beads with the bound complex were then washed twice with 400 ⁇ l of TE buffer (10 mM Tris-HCl (pH 8.0) and 1 mM EDTA) at room temperature to remove unhybridized oligonucleotides probes.
  • Twenty ⁇ l of ligase mixture containing 20 mM Tris- HCl (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 10 mM DDT, 1 mM NAD, 0.1% Triton X-100, and 12 units of Taq DNA ligase (New England Biolabs, MA) were added to the bead pellet and incubated at 60°C for 20 min. Ligation of the 3' and 5' ends of the oligonucleotides probe hybridized to the target nucleic acid allowed the formation of the closed circular probe that was locked on the target nucleic acid.
  • Fig. 33 A is a schematic representation of a molecular zipper probe comprising a double-stranded DNA molecule with a fluorescent moiety at the 5' end of one strand (positive) (SEQ ID NO: 43) and a quencher moiety at the 3' end of the opposite strand (negative) (SEQ ID NO: 44).
  • the positive strand of the molecular zipper also contained an additional sequence (24 nucleotides) at its 3' end, which was identical to a portion of the C- probe (SEQ ID NO: 45) and was used as a reverse primer for the RAM reaction.
  • the fluorophore of the negative strand was held in close proximity to the quencher of the positive strand, therefore, no light was emitted.
  • quenching was relieved and light was emitted.
  • Fig. 33B shows a typical denaturation curve (or unzipping) of a molecular zipper probe.
  • At temperatures below 70°C there was low background fluorescence, indicating that both strands were bound together thereby efficiently quenching the fluorophore.
  • Tm ⁇ 77°C the fluorescence above 72°C
  • a molecular zipper is a dsDNA molecule composed of a positive stiand (5'-Fluorescein-GCTGAGGACC CGGATGCGAA TGCGGATGCG GATGCCGAAC CAAGAGCAAC TACACGAATT C-3' (61 nt)(SEQ ID NO: 43)) and a negative strand (5'-TCGGCATCCG CATCCGCATT CGCATCCGGG TCCTCAGC-DABCYL-3' (38 nt)(SEQ ID NO: 44)), where the underlined nucleotides indicate the primer sequence. Both oligos were obtained from Integrated DNA Technology, Inc, Coralville, IA.
  • the sequence of the molecular zipper was designed with minimal secondary structure and a T m for the dsDNA portion of was ⁇ 77.5 °C, which is above the RAM reaction temperature (63°C).
  • the dsDNA molecular zipper was formed by mixing equal amounts (20 ⁇ M) of positive and negative strands in a buffer containing 100 mM Tris and 10 mM EDTA (pH 8.3), heating at 95°C for 5 min, and cooling slowly to room temperature.
  • the C-probe with sequence (5'-GGTTTTGTCT TCGTAACTCG CTCCGGATGT CTGTATCT GCTAACCAAG AGCAACTACA CGAA TCTCG ATTAGGTTAC TGCGATTAGC ACAAGCTCTA CAAGAGTACA TCGGTCAACG AAGA-3' (124 nt) (SEQ ID NO: 45)) was obtained from Genelink, Hawthorne, NY, where the single underlines indicate the target complementary regions at the 5' and 3' ends, the double underline indicates the forward primer binding site and the dotted underline indicates the reverse primer binding site.
  • the synthetic target DNA (5 '-TCCGGAGCGA GTTACGAAGA CAAAACCTCT TCGTTGACCG ATGTACTCTT GTAGAAAGTT ATAATAATCC TCTTTTCTGT CTGACGGTTC TTAAGC-3' (96 nt)(SEQ ID NO: 47)) also was obtained from Genelink, where the underlined nucleotides indicate the C-probe binding region.
  • the forward primer (5'-CTTGTGCTAA TCGCAGTAAC CTAAT-3' (25 nt)(SEQ ID NO: 48) was synthesized at the DNA Core Facility of Mount Sinai School of Medicine, New York, NY.
  • the reverse primer (5'-ACCAAGAGCA ACTACACGAA TTC- 3' (23 nt)(SEQ ID NO: 49) was synthesized at the DNA Core Facility of Mount Sinai School of Medicine, New York, NY.
  • the isothermal RAM reaction was performed in 50 ⁇ l containing 20 mM Tris-HCl (pH 8.8), 300 ⁇ M each of dATP, dCTP, dGTP and dTTP, 10 mM KCl, 10 mM (NH 4 ) 2 SO 4 , 2 mM MgSO 4 , 0.1% Triton X-100, 1.2 ⁇ M forward primer, 0.8 ⁇ M reverse primer, 0.4 ⁇ M molecular zipper, 6% Dimethylsulfoxide, and 6.4 units of exo " Bst DNA polymerase (large fragment) (New England Biolabs).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention a trait à des dosages et des trousses pour la réalisation desdits dosages en vue de la détection rapide et automatisée d'agents pathogènes infectieux et de gènes normaux et anormaux. La présente invention a également trait à des procédés pour l'amplification générale d'ADN génomique et d'ARNm entiers et pour l'analyse de l'expression différentielle d'ARNm mettant en oeuvre les procédés d'amplification de l'invention.
PCT/US2003/037199 2003-11-21 2003-11-21 Procedes d'amplification d'acides nucleiques WO2005061722A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/US2003/037199 WO2005061722A1 (fr) 2003-11-21 2003-11-21 Procedes d'amplification d'acides nucleiques
AU2003295732A AU2003295732A1 (en) 2003-11-21 2003-11-21 Nucleic acid amplification methods

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2003/037199 WO2005061722A1 (fr) 2003-11-21 2003-11-21 Procedes d'amplification d'acides nucleiques

Publications (1)

Publication Number Publication Date
WO2005061722A1 true WO2005061722A1 (fr) 2005-07-07

Family

ID=34709630

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/037199 WO2005061722A1 (fr) 2003-11-21 2003-11-21 Procedes d'amplification d'acides nucleiques

Country Status (2)

Country Link
AU (1) AU2003295732A1 (fr)
WO (1) WO2005061722A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9376711B2 (en) 2011-07-13 2016-06-28 Qiagen Mansfield, Inc. Multimodal methods for simultaneous detection and quantification of multiple nucleic acids in a sample
CN109136333A (zh) * 2018-09-20 2019-01-04 北京倍科为生物技术有限公司 鉴别eb病毒感染淋巴细胞亚群及被感染细胞占该亚群细胞比例的方法及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6569647B1 (en) * 1994-06-22 2003-05-27 Mount Sinai School Of Medicine Of New York University Nucleic acid amplification method: ramification-extension amplification method (RAM)

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6569647B1 (en) * 1994-06-22 2003-05-27 Mount Sinai School Of Medicine Of New York University Nucleic acid amplification method: ramification-extension amplification method (RAM)
US20030190604A1 (en) * 1994-06-22 2003-10-09 Zhang David Y. Nucleic acid amplification method: ramification-extension amplification method (RAM)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHANG ET AL: "Detection of Target Nucleic Acids and Proteins by Amplification of Circularizable Probes", EXPERT REV. MOL. DIAGN., vol. 3, no. 2, March 2003 (2003-03-01), pages 237 - 248 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9376711B2 (en) 2011-07-13 2016-06-28 Qiagen Mansfield, Inc. Multimodal methods for simultaneous detection and quantification of multiple nucleic acids in a sample
CN109136333A (zh) * 2018-09-20 2019-01-04 北京倍科为生物技术有限公司 鉴别eb病毒感染淋巴细胞亚群及被感染细胞占该亚群细胞比例的方法及其应用

Also Published As

Publication number Publication date
AU2003295732A1 (en) 2005-07-14

Similar Documents

Publication Publication Date Title
US8632999B1 (en) Nucleic acid amplification methods
US6569647B1 (en) Nucleic acid amplification method: ramification-extension amplification method (RAM)
US5876924A (en) Nucleic acid amplification method hybridization signal amplification method (HSAM)
US20070269799A9 (en) Nucleic acid amplification methods
AU2002220132A1 (en) Nucleic acid amplification methods
WO1998004746A9 (fr) Une methode d'amplification d'acide nucleique par ramification-extension: la ram
EP0717782A1 (fr) Amplification dependant de la liaison s'appliquant a la detection d'agents pathogenes infectieux et de genes anormaux
US7361489B2 (en) Nucleic acid amplification methods
USRE38442E1 (en) Nucleic acid amplification method hybridization signal amplification method (HSAM)
JP2001521765A (ja) 特異的かつ高感度な核酸検出方法
WO2005061722A1 (fr) Procedes d'amplification d'acides nucleiques
AU2002348438A1 (en) Nucleic acid amplification methods
JP3145169B2 (ja) 核酸検出法及びキット

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP