WO2005061712A1 - Muteins of fibroblast growth factor 21 - Google Patents

Muteins of fibroblast growth factor 21 Download PDF

Info

Publication number
WO2005061712A1
WO2005061712A1 PCT/US2004/037200 US2004037200W WO2005061712A1 WO 2005061712 A1 WO2005061712 A1 WO 2005061712A1 US 2004037200 W US2004037200 W US 2004037200W WO 2005061712 A1 WO2005061712 A1 WO 2005061712A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutein
leucine
fgf
glycine
arginine
Prior art date
Application number
PCT/US2004/037200
Other languages
French (fr)
Inventor
John Michael Beals
Christopher Carl Frye
Wolfgang Glaesner
Shun Li
Radhakrishnan Rathnachalam
Jing Shang
Beth Ann Strifler
Radmila Micanovic
Original Assignee
Eli Lilly And Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eli Lilly And Company filed Critical Eli Lilly And Company
Priority to CA002549249A priority Critical patent/CA2549249A1/en
Priority to AU2004303783A priority patent/AU2004303783A1/en
Priority to EA200601121A priority patent/EA200601121A1/en
Priority to US10/579,510 priority patent/US7491697B2/en
Priority to JP2006543822A priority patent/JP4477013B2/en
Priority to BRPI0416683-3A priority patent/BRPI0416683A/en
Priority to EP04810531A priority patent/EP1702067A1/en
Publication of WO2005061712A1 publication Critical patent/WO2005061712A1/en
Priority to IL175736A priority patent/IL175736A0/en
Priority to NO20062662A priority patent/NO20062662L/en
Priority to US12/349,119 priority patent/US20090118190A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/16Central respiratory analeptics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to the identification of new muteins of fibroblast growth factor 21 that have improved pharmaceutical properties.
  • Fibroblast growth factors are large polypeptides widely expressed in developing and adult tissues (Baird et al., Cancer Cells, 3:239-243, 1991) and play crucial roles in multiple physiological functions including angiogenesis, mitogenesis, pattern formation, cellular differentiation, metabolic regulation and repair of tissue injury (McKeehan et al., Prog. Nucleic Acid Res. Mol. Biol. 59:135-176, 1998).
  • the FGF family now consists of at least twenty-three members, FGF-1 to FGF- 23 (Reuss et al, Cell Tissue Res. 313:139-157 (2003).
  • Fibroblast growth factor 21 has been reported to be preferentially expressed in the liver (Nishimura et al., Biochimica et Biophysica Ada, 1492:203-206, (2000); WOOl/36640; and WO01/18172) and described as a treatment for ischemic vascular disease, wound healing, and diseases associated with loss of pulmonary, bronchia or alveolar cell function and numerous other disorders.
  • FGF-21 has been shown to stimulate glucose-uptake in mouse 3T3-L1 adipocytes in the presence and absence of insulin, and to decrease fed and fasting blood glucose, triglycerides, and glucagon levels in ob/ob and db/db mice and 8 week old ZDF rats in a dose-dependant manner, thus, providing the basis for the use of FGF-21 as a therapy for treating diabetes and obesity (WO03/011213).
  • FGF-21 has been shown to be effective in reducing the mortality and morbidity of critically ill patients (WO03/059270).
  • a significant challenge in the development of protein pharmaceuticals, such as FGF-21 is to cope with their physical and chemical instabilities.
  • compositional variety and characteristics of proteins define specific behaviors such as folding, conformational stability, and unfolding/denaturation. Such characteristics must be addressed to stabilize proteins when developing pharmaceutical formulation conditions utilizing aqueous protein solutions (Wang, W., Int. J. of Pharmaceutics, 18, (1999).
  • anti-microbial preservative agents such as phenol, m-cresol, methylparaben, resorcinol, and benzyl alcohol are necessary in parenteral pharmaceutical formulations that are intended to be a sterile, multi-use formulation.
  • these compounds often adversely affect the stability of the protein product, triggering association and aggregation, in particular (Maa et a , Int. J.
  • FGF-21 will likely be utilized as a multi-use, sterile pharmaceutical formulation. However, it has been determined that preservatives, i.e. w-cresol, have an adverse affect on its stability under these conditions. Clearly, there is a need to develop a stable aqueous protein formulation for the therapeutic protein FGF-21.
  • the present invention overcomes the significant hurdles of physical instabilities with the invention of muteins of FGF-21 that are more stable than wild-type FGF-21 under pharmaceutical formulation conditions.
  • the muteins of FGF-21 of the present invention provide stable pharmacological protein formulations that are useful for the treatment of type 2 diabetes, obesity, metabolic syndrome, and in reducing the mortality and morbidity of critically ill patients.
  • the present invention provides muteins of human fibroblast growth factor 21, or a biologically active peptide thereof, comprising the substitution with a charged and/or polar but uncharged amino acid for one or more of the following: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161, serine 163, glycine 170, or serine 172 wherein the numbering of the amino acids is based on SEQ ID NO:l.
  • a second aspect of the present invention provides muteins of human fibroblast growth factor 21, or a biologically active peptide thereof, comprising the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, lutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, proline 90, alanine 92, serine 94,
  • a third aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution with any charged and/or polar but uncharged amino acid at any of the amino acid positions indicated in the first embodiment of the present invention in combination with the substitution of a cysteine at two or more amino acid positions indicated in the second embodiment of the invention.
  • Other embodiments are drawn to polynucleotides encoding the muteins of the first, second, and third embodiments, a vector containing said polynucleotides and a host cell carrying said vector.
  • Another embodiment is drawn to processes to produce a polypeptide, to produce cells capable of producing said polypeptide and to produce a vector containing DNA encoding said polypeptide.
  • Yet another embodiment is drawn to methods of treating a patient exhibiting one or more of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome comprising administering to said patient in need of such treatment a therapeutically effective amount of a human FGF-21 mutein of the first, second, or third embodiment or a pharmaceutical composition thereof.
  • FGF-21 is a 208 amino acid polypeptide containing a 27 amino acid leader sequence.
  • Human FGF-21 has ⁇ 79% amino acid identity to mouse FGF-21 and -80% amino acid identity to rat FGF-21.
  • Human FGF-21 is the preferred polypeptide template for the muteins of the present invention but it is recognized that one with skill in the art could readily make muteins based on an alternative mammalian FGF-21 polypeptide sequence.
  • the amino acid positions of the muteins of the present invention are determined from the mature human 181 amino acid FGF-21 polypeptide as shown below (SEQ ID
  • a human FGF-21 mutein is defined as comprising human FGF-21 in which at least one amino acid of the wild-type mature protein has been substituted by another amino acid.
  • a mutein possesses some modified property, structural or functional, of the wild-type protein.
  • the mutein may have enhanced or improved physical stability in concentrated solutions (e.g., less hydrophobic mediated aggregation), while maintaining a favorable bioactivity profile.
  • the mutein may possess increased compatibility with pharmaceutical preservatives (e.g., -cresol, phenol, benzyl alcohol), thus enabling the preparation of a preserved pharmaceutical formulation that maintains the physiochemical properties and biological activity of the protein during storage. Accordingly, muteins with enhanced pharmaceutical stability when compared to wild-type FGF-21, have improved physical stability in concentrated solutions under both physiological and preserved pharmaceutical formulation conditions, while maintaining biological potency. As used herein, these terms are not limiting, it being entirely possible that a given mutein has one or more modified properties of the wild-type protein.
  • a "biologically active peptide" is defined as a peptide of a mutein of the present invention that maintains the modified property(s) and the biological potency of the mutein.
  • a “therapeutically-effective amount” is the minimal amount of an active agent necessary to impart therapeutic benefit to a patient.
  • a “therapeutically- effective amount” to a patient exhibiting, suffering or prone to suffer or to prevent it from suffering from type 2 diabetes, obesity, or metabolic syndrome is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression, physiological conditions associated with or resistance to succumbing to the afore mentioned disorders.
  • a "subject” or “patient” is preferably a human, but can also be an animal, more specifically, a companion animal (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like).
  • a companion animal e.g., dogs, cats, and the like
  • farm animals e.g., cows, sheep, pigs, horses, and the like
  • laboratory animals e.g., rats, mice, guinea pigs, and the like.
  • “Type 2 diabetes” is characterized by excess glucose production in spite of the availability of insulin, and circulating glucose levels remain excessively high as a result of inadequate glucose clearance.
  • Glucose intolerance can be defined as an exceptional sensitivity to glucose.
  • “Hyperglycemia” is defined as an excess of sugar (glucose) in the blood.
  • Hypoglycemia also called low blood sugar, occurs when your blood glucose level drops too low to provide enough energy for your body's activities.
  • Hyperinsulinemia is defined as a higher-than-normal level of insulin in the blood.
  • Insulin resistance is defined as a state in which a normal amount of insulin produces a subnormal biologic response.
  • Olesity in terms of the human subject, can be defined as that body weight over 20 percent above the ideal body weight for a given population (R.H. Williams, Textbook of Endocrinology, 1974, p.904-916).
  • Methodabolic syndrome can be defined as a cluster of at least three of the following signs: abdominal fat — in most men, a 40-inch waist or greater; high blood sugar — at least 110 milligrams per deciliter (mg/dl) after fasting; high triglycerides — at least 150 mg/dL in the bloodstream; low HDL — less than 40 mg/dl; and, blood pressure of 130/85 or higher.
  • the critically ill patients encompassed by the present invention generally experience an unstable hypermetabolic state. This unstable metabolic state is due to changes in substrate metabolism, which may lead to relative deficiencies in some nutrients. Generally there is an increased oxidation of both fat and muscle. Moreover, critically ill patients are preferably patients that experience systemic inflammatory response syndrome or respiratory distress.
  • a reduction in morbidity means reducing the likelihood that a critically ill patient will develop additional illnesses, conditions, or symptoms or reducing the severity of additional illnesses, conditions, or symptoms.
  • reducing morbidity may correspond to a decrease in the incidence of bacteremia or sepsis or complications associated with multiple organ failure.
  • Systemic inflammatory response syndrome describes an inflammatory process associated with a large number of clinical conditions and includes, but is not limited to, more than one of the following clinical manifestations: (1) a body temperature greater than 38°C or less than 36°C; (2) a heart rate greater than 90 beats per minute; (3) tachypnea, manifested by a respiratory rate greater than 20 breaths per minute, or hyperventilation, as indicated by a PaCO 2 of less than 32 mm Hg; and (4) an alteration in the white blood cell count, such as a count greater than 12,000/cu mm, a count less than 4,000/cu mm, or the presence of more than 10% immature neutrophils.
  • SIRS Systemic inflammatory response syndrome
  • SIRS a SIRS arising from infection.
  • Noninfectious pathogenic causes of SIRS may include pancreatitis, ischemia, multiple trauma and tissue injury, i.e. crushing injuries or severe burns, hemorrhagic shock, immune-mediated organ injury, and the exogenous administration of such putative mediators of the inflammatory process as tumor necrosis factor and other cytokines.
  • Septic shock and multi-organ dysfunction are major contributors to morbidity and mortality in the ICU setting.
  • Sepsis is associated with and mediated by the activation of a number of host defense mechanisms including the cytokine network, leukocytes, and the complement cascade, and coagulation/fibrinolysis systems including the endothelium.
  • Disseminated intravascular coagulation (DIG) and other degrees of consumption coagulopathy associated with fibrin deposition within the micro vasculature of various organs are manifestations of sepsis/septic shock.
  • DIG Disseminated intravascular coagulation
  • MODS multiple organ dysfunction syndrome
  • Respiratory distress denotes a condition wherein patients have difficulty breathing due to some type of pulmonary dysfunction. Often these patients exhibit varying degrees of hypoxemia that may or may not be refractory to treatment with supplemental oxygen. Respiratory distress may occur in patients with impaired pulmonary function due to direct lung injury or may occur due to indirect lung injury such as in the setting of a systemic process. In addition, the presence of multiple predisposing disorders substantially increases the risk, as does the presence of secondary factors such as chronic alcohol abuse, chronic lung disease, and a low serum pH.
  • Some causes of direct lung injury include pneumonia, aspiration of gastric contents, pulmonary contusion, fat emboli, near drowning, inhalation injury, high altitude and reperfusion pulmonary edema after lung transplantation or pulmonary embolectomy.
  • Some causes of indirect lung injury include sepsis, severe trauma with shock and multiple transfusions, cardiopulmonary bypass, drug overdose, acute pancreatitis, and transfusions of blood products.
  • One class of pulmonary disorders that causes respiratory distress are associated with the syndrome known as Cor Pulmonale. These disorders are associated with chronic hypoxemia resulting in raised pressure within the pulmonary circulation called pulmonary hypertension. The ensuing pulmonary hypertension increases the work-load of the right ventricle, thus leading to its enlargement or hypertrophy.
  • Cor Pulmonale generally presents as right heart failure defined by a sustained increase in right ventricular pressures and clinical evidence of reduced venous return to the right heart.
  • COPDs Chronic obstructive pulmonary diseases
  • COPDs which include emphysema and chronic bronchitis also cause respiratory distress and are characterized by obstruction to air flow. COPDs are the fourth leading cause of death and claim over 100,000 lives annually.
  • ARDS acute respiratory distress syndrome
  • ARDS is generally progressive and characterized by distinct stages. The syndrome is generally manifested by the rapid onset of respiratory failure in a patient with a risk factor for the condition.
  • Arterial hypoxemia that is refractory to treatment with supplemental oxygen is a characteristic feature.
  • the first preferred aspect of the invention comprises muteins of human FGF-21 in which substitution means that any charged and/or polar but uncharged amino acid replaces at least one of the following: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161 serine 163, glycine 170, or serine 172, wherein the numbering of the amino acids is based on SEQ ID NO:l.
  • a charged amino acid is defined as a positively or negatively charged amino acid.
  • a positively charged amino acid is defined to include histadine, lysine, arginine, and non-naturally occurring analogs thereof (e.g., gamma aminobutyric acid, ornithine, etc.).
  • a negatively charged amino acid is defined to included aspartate, glutamate, and non-naturally occurring analogs thereof (e.g., aminoadipic acid).
  • a polar but uncharged amino acid is defined to include serine, threonine, asparagine, glutamine, and non-naturally occurring analogs thereof.
  • the most preferred muteins of the first embodiment are Gln54Glu, Leul39Glu, Alal45Glu,
  • the second aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, lutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, le
  • cysteines cysteine 75 and cysteine 93
  • cysteine 75 and cysteine 93 could also be utilized as loci to introduce a novel disulfide bond that may impart improved properties.
  • a cysteine substitution at serine 85 or phenylalanine 73 coupled with a concomitant change at either cysteine 93 or cysteine 75, respectively, wherein the latter sites are replaced with any other amino acid.
  • Naturally occurring disulfide bonds, as provided by cysteine residues generally increase thermodynamic stability of proteins.
  • thermodynamic stability As measured in increase of the melting temperature, are multiple disulfide-bonded mutants of the enzymes T4 lysozyme (Matsumura, et al., PNAS 86:6562-6566 (1989)) and barnase (Johnson et al., J. Mol. Biol. 268:198-208 (1997)).
  • An aspect of the present invention is the premise that constraining the flexibility of the 118- 134 amino acid loop of FGF-21 by disulfide bonds enhances the physical stability of
  • FGF-21 in the presence of a preservative, presumably by limiting access of the preservative to the hydrophobic core of the protein.
  • Muteins of FGF-21 with engineered disulfide bonds are as follows: Gln76Cys-Serl09Cys, Cys75-Ser85Cys, Cys75-Ala92Cys, Phe73Cys-Cys93, Serl23Cys-Hisl25-Cys, Aspl02Cys-Tyrl04Cys, Aspl27Cys-Glyl32Cys, Ser94Cys-Glul lOCys, Prol l5Cys-Hisl l7Cys, Asnl21Cys- Aspl27Cys, LeulOOCys-Aspl02Cys, Phe95Cys-Tyrl07Cys, Argl9
  • Leu66Cys Ile35Cys-Gly67Cys, Gly67Cys-Arg72Cys, Ile35Cys-Gly84Cys, Arg72Cys- Gly84Cys, or Arg77Cys-Ala81Cys, wherein the numbering of the amino acids is based on SEQ ID NO:l.
  • Preferred muteins with engineered disulfide bonds are Tyr22Cys- Leul39Cys; Asp24Cys-Argl35Cys; Leull8Cys-Glyl32Cys; Hisll7Cys-Prol30Cys; • Hisl 17Cys-Alal29Cys; Leu82Cys-Prol 19Cys; Gly80Cys-Alal29Cys; Gly43Cys- Prol24Cys; Gly42Cys-Argl26Cys; Gly42Cys-Prol24Cys; Gln28Cys-Prol24Cys; Gln27Cys-Serl23Cys; Ala26Cys-Lysl22Cys; or Asp25Cys-Lysl22Cys.
  • muteins with engineered disulfide bonds are Leul 18Cys-Alal34Cys; Leu21Cys- Leu33Cys; Ala26Cys-Lysl22Cys; Leu21Cys-Leu33Cys/Leull8Cys-Alal34Cys
  • the third aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising a substitution of any charged and/or polar but uncharged amino acid at any of the amino acid positions indicated in the first embodiment of the present invention combined with the substitution of a cysteine at two or more amino acid positions indicated in the second embodiment of the invention.
  • an embodiment of the present invention is to enhance physical stability of concentrated solutions, while maintaining chemical stability and biological potency, under both physiological and preserved formulation conditions. It is thought that association and aggregation may result from hydrophobic interactions, since, at a given protein concentration, temperature, and ionic strength have considerable impact on physical stability. For the most part, non-conserved, presumed surface exposed amino acid residues were targeted. The local environment of these residues was analyzed and, those that were not deemed structurally important were selected for mutagenesis. One method to initiate specific changes is to further decrease the pi of the protein by introducing glutamic acid residues ("glutamic acid scan").
  • the biological potency of the muteins of the present invention is defined by the ability of the muteins to affect glucose uptake as measured in the in vitro 3T3-L1 cell assay (Example 4) and/or the lowering of plasma glucose levels, as well as, plasma triglycerides, as measured in vivo in the ob/ob mouse assay (Example 5).
  • the muteins of FGF-21 administered according to this invention may be generated and/or isolated by any means known in the art.
  • the most preferred method for producing the mutein is through recombinant DNA methodologies and is well known to those skilled in the art. Such methods are described in Current Protocols in Molecular Biology (John Wiley & Sons, Inc.), which is incorporated herein by reference.
  • the preferred embodiments include a biologically active peptide derived from the mutein described herein.
  • a biologically active peptide derived from the mutein described herein.
  • Such a peptide will contain at least one of the substitutions described and the mutein will possess biological activity.
  • the peptide may be produced by any and all means known to those skilled in the art, examples of which included but are not limited to enzymatic digestion, chemical synthesis or recombinant DNA t methodologies. It is established in the art that fragments of peptides of certain fibroblast growth factors are biologically active. See for example, Baird et al., Proc. Natl. Acad. Sci (USA) 85:2324-2328 (1988), andJ Cell. Phys. Suppl. 5:101-106 (1987).
  • DPP-IV dipeptidyl peptidase IV
  • HisProIlePro The N-terminus of FGF-21 contains two dipeptides that could potentially be substrates to DPP-IV, resulting in a fragment of FGF-21 truncated at the N-terminus by 4 amino acids.
  • muteins of the present invention truncated at the N-terminus by up to 4 amino acids, is an embodiment of the present invention.
  • the present invention also encompasses polynucleotides encoding the above- described muteins that may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded.
  • the coding sequences that encode the muteins of the present invention may vary as a result of the redundancy or degeneracy of the genetic code.
  • the polynucleotides that encode for the muteins of the present invention may include the following: only the coding sequence for the mutein, the coding sequence for the mutein and additional coding sequence such as a functional polypeptide, or a leader or secretory sequence or a pro-protein sequence; the coding sequence for the mutein and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mutein.
  • polynucleotide encoding a mutein encompasses a polynucleotide that may include not only coding sequence for the mutein but also a polynucleotide, which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the described polynucleotides that encode for fragments, analogs and derivatives of the polypeptide that contain the indicated substitutions.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the human FGF-21 sequence, a non-naturally occurring variant, or a truncated variant as described above.
  • the present invention also includes polynucleotides encoding the muteins described above, as well as variants of such polynucleotides, which variants encode for a fragment, derivative or analog of the disclosed mutein.
  • nucleotide variants include deletion variants, substitution variants, truncated variants, and addition or insertion variants as long as at least one of the indicated amino acid substitutions of the first or second embodiments is present.
  • the polynucleotides of the present invention will be expressed in hosts after the sequences have been operably linked to (i.e., positioned to ensure the functioning of) an expression control sequence.
  • These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
  • expression vectors will contain selection markers, e.g., tetracycline, neomycin, and dihydrofolate reductase, to permit detection of those cells transformed with the desired DNA sequences.
  • the FGF-21 mutein can be expressed in mammalian cells, insect, yeast, bacterial or other cells under the control of appropriate promoters. Cell free translation systems can also be employed to produce such proteins using RNAs derived from DNA constructs of the present invention.
  • E. coli is a prokaryotic host useful particularly for cloning the polynucleotides of the present invention.
  • Other microbial hosts suitable for use include Bacillus subtilus, Salmonella typhimurium, and various species of Serratia, Pseudomonas, Streptococcus, and Staphylococcus, although others may also be employed as a matter of choice.
  • expression vectors which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication).
  • any of a number of well-known promoters may be present, such as the lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from phages lambda or T7.
  • the promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation.
  • methionine or methionine-arginine sequence can be introduced at the N-terminus of the mature sequence (S ⁇ Q ID NO: 1) for expression in E. coli and are contemplated within the context of this invention.
  • muteins of the present invention expressed in E. coli have a methionine sequence introduced at the N-terminus.
  • Other microbes, such as yeast or fungi, may also be used for expression.
  • Pichia pastoris Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Pichia angusta are examples of preferred yeast hosts, with suitable vectors having expression control sequences, such as promoters, including 3-phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences and the like as desired.
  • Aspergillus niger, Trichoderma reesei; and Schizophyllum commune are examples of fungi hosts, although others may also be employed as a matter of choice.
  • Mammalian tissue cell culture may also be used to express and produce the polypeptides of the present invention.
  • Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting intact muteins have been developed in the art, and include the CHO cell lines, various COS cell lines, NSO cells, Syrian Hamster Ovary cell lines, HeLa cells, or human embryonic kidney cell lines (i.e. HEK293, HEK293EBNA).
  • Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
  • Preferred expression control sequences are promoters derived from SN40, adenovirus, bovine papilloma virus, cytomegalovirus, Raus sarcoma virus, and the like.
  • Preferred polyadenylation sites include sequences derived from SN40 and bovine growth hormone.
  • the vectors containing the polynucleotide sequences of interest e.g., the muteins of FGF-21 and expression control sequences
  • the purification step(s) selected will depend, for example, on the nature of the production process used for the muteins of FGF-21.
  • the FGF-21 mutein-containing compositions should be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the patient, the site of delivery of the FGF-21 mutein composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "therapeutically effective amount" of the FGF-21 mutein for purposes herein is thus determined by such considerations
  • the pharmaceutical compositions of the FGF-21 muteins and of the present invention may be administered by any means that achieve the generally intended purpose: to treat type 2 diabetes, obesity, metabolic syndrome, or critically ill patients.
  • parenteral refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous, and intraarticular injection and infusion.
  • the dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • compositions within the scope of the invention include all compositions wherein an FGF-21 mutein is present in an amount that is effective to achieve the desired medical effect for treatment type 2 diabetes, obesity, or metabolic syndrome. While individual needs may vary from one patient to another, the determination of the optimal ranges of effective amounts of all of the components is within the ability of the clinician of ordinary skill.
  • the muteins of FGF-21 of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions.
  • a desired formulation would be one that is a stable lyophilized product that is reconstituted with an appropriate diluent or an aqueous solution of high purity with optional pharmaceutically acceptable carriers, preservatives, excipients or stabilizers [Remington 's Pharmaceutical Sciences 16th edition (1980)].
  • the muteins of the present invention may be combined with a pharmaceutically acceptable buffer, and the pH adjusted to provide acceptable stability, and a pH acceptable for administration.
  • the FGF-21 muteins are formulated generally by mixing one or more of them at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • one or more pharmaceutically acceptable anti-microbial agents may be added. Phenol, r ⁇ -cresol, and benzyl alcohol are preferred pharmaceutically acceptable antimicrobial agents.
  • one or more pharmaceutically acceptable salts may be added to adjust the ionic strength or tonicity.
  • One or more excipients may be added to further adjust the isotonicity of the formulation.
  • Glycerin, sodium chloride, and mannitol are examples of an isotonicity adjusting excipient.
  • Those skilled in the art can readily optimize pharmaceutically effective dosages and administration regimens for therapeutic compositions comprising an FGF-21 mutein, as determined by good medical practice and the clinical condition of the individual patient.
  • a typical dose range for the FGF-21 muteins of the present invention will range from about 0.01 mg per day to about 1000 mg per day for an adult.
  • the dosage ranges from about 0.1 mg per day to about 100 mg per day, more preferably from about 1.0 mg/day to about 10 mg/day. Most preferably, the dosage is about 1-5 mg/day.
  • the appropriate dose of an FGF-21 mutein administered will result in lowering blood glucose levels and increasing energy expenditure by faster and more efficient glucose utilization, and thus is useful for treating type 2 diabetes, obesity and metabolic syndrome.
  • hyperglycemia and insulin resistance are common in critically ill patients given nutritional support, some ICUs administer insulin to treat excessive hyperglycemia in fed critically ill patients.
  • muteins of FGF-21 for use as a medicament for the treatment of type 2 diabetes, obesity, metabolic syndrome, or critically ill patients is contemplated.
  • the bacterial expression vector pET30a is used for bacterial expression in this example. (Novagen, Inc., Madison, Wisconsin)). pET30a encodes kanamycin antibiotic resistance gene and contains a bacterial origin of replication ("ori"), a strong T7 phage- IPTG inducible promoter, a ribosome binding site ("RBS”), and suitable MCS with a number of unique resrtiction endonuclease cleavage sites. Conveniently for purification purpose, the vector can encode His- and S-tags for N-terminal peptide fusions, as well as, a C-terminal His-tag fusion.
  • ori bacterial origin of replication
  • RBS ribosome binding site
  • the cDNA encoding FGF-21 variants is inserted between restriction sites Ndel and BamHI, respectively, and the resulting construct does not take advatrage of either of the described tags.
  • the nucleic acid sequence encoding the FGF-21 mutein, lacking the leader sequence but substituted with a methionine residue, is amplified from a cDNA clone using PCR oligonucleotide primers, which anneal to the 5' and 3' ends of the open reading frame. Additional nucleotides, containing recognition sites for restriction enzymes Ndel and BamHI, are added to the 5' and 3' sequences, respectively.
  • the 5' forward and 3' reverse PCR primers have nucleotides corresponding or complementary to a portion of the coding sequence of the FGF-21 mutein-encoding nucleic acid according to methods known in the art.
  • primers One of ordinary skill in the art would appreciate that the point in a polynucleotide sequence where primers begin can be varied.
  • the amplified nucleic acid fragments and the vector pET30a are digested with Ndel and BamHI restriction enzymes and the purified digested DNA fragments are then ligated together.
  • Insertion of FGF-21 mutein-encoding DNA into the restricted pET30a vector places the FGF-21 mutein polypeptide coding region including its associated stop codon downstream from the IPTG-inducible promoter and in-frame with an initiating ATG codon.
  • the associated stop codon, TAG prevents translation of the six-histidine codons downstream of the insertion point.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures such as those described in Current Protocols in Molecular Biology (John
  • Transformation reactions are plated on LB/Kanamycin plates and after an overnight growth transformants are picked for plasmid preparations or lysed in situ for screening by PCR. Positive recombinant plasmids, containing desired FGF-21 variant inserts, are identified by restriction analysis followed by DNA sequence analysis. Those plasmids are subsequently used to transform expression strains and protein production. E. coli strains BL21(D ⁇ 3), BL21(DE3)STAR or BL21(DE3) RP, are used for expressing FGF-21 muteins. These strains, which are only some of many that are suitable for expressing FGF-21 muteins, are available commercially from Novagen, Inc.,
  • Transformants are identified by their ability to grow on LB plates in the presence of kanamycin. .
  • Clones containing the desired constructs are grown overnight (o/n) in liquid culture in LB media supplemented with kanamycin (30 ⁇ g/ml). The o/n culture is used to inoculate a large culture, at a dilution of approximately 1 :25 to 1 :250. The cells are grown to an optical density of 0.6 ("OD600”) at 600 nm. Isopropyl-b-D- thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor.
  • IPTG Isopropyl-b-D- thiogalactopyranoside
  • FGF-21 muteins are expressed in the insoluble fraction i.e inclusion bodies (or granules) of E. coli. Although the expression level may vary from variant-to- variant, a typically observed level for the wild-type (WT) FGF-21 protein is 50 mg/L.
  • WT wild-type
  • the granules are solubilzed in 50 mM Tris, pH 9.0, 7M Urea and 1 mM DTT through a pH ramp to pH 11.0, at room temperature for 1 hour with stirring.
  • the protein is then captured on a Q-Sepharose column using the same buffer described above, and eluted with a linear gradient of 0-400 mM NaCl.
  • the Q-Sepharose pool is then treated with 10 mM DTT, for two hours, at RT, to reduce all disulfide bonds.
  • the pool is then diluted 10-fold so that the buffer concentration is as follows: 50 mM Tris, pH 9.0, 7 M Urea, 10 mM Cysteine, 1 mM DTT with a protein concentration of approximately 250-500 ⁇ g/ml.
  • the pool is then dialyzed into 20 mM glycine, pH 9.0 for approximately 48 hours so that the correct disulfide bonds can be formed. Reversed-phase HPLC chromatography, on a Vydac C 18 column and 0.1% TFA/
  • 0-50% CH 3 CN as a mobile phase is used as an initial purification step.
  • This column is used to concentrate FGF-21 or the FGF-21 muteins and removes contaminating endotoxin.
  • the following purification step is size exclusion chromatography on a Superdex 35/600 column performed in IX PBS buffer, pH7.4. At this step FGF-21 muteins are ⁇ 95% pure.
  • the last step involves MonoQ chromatography in 50 mM Tris, pH 8.0 and elution with a linear gradient of 0-300 mM NaCl, which usually yields > 97% pure protein.
  • the above described 4-column step purification scheme was used for all the FGF-21 muteins and produced stable preparations.
  • FGF-21 muteins can be produced in a mammalian cell expression system such as HEK293EBNA cells (EdgeBiosystems, Gaiethersburg, MD). FGF-21 muteins are subcloned in the proprietary expression vector representing a modification of commercially available pEAKlO, between Nhel and Xbal restriction sites in the MCS. The cDNA sequence encoding mature FGF-21 is fused in frame with the Ig ⁇ leader sequence to enhance secretion of the desired product in the tissue culture media. The expression is driven by the strong viral CMV promoter.
  • HEK293EBNA cells are transiently transfected using a standard transfection reagent such as Fugene (Roche Diagnostics, Indianapolis, IN) and the appropriate amount of recombinant plasmid, either as a monolayer or suspension culture, at the adequate cell density. Cells are incubated at 37 C and 5 % C0 2 , in serum free media, and collections are made every day for 5 days. Typically the expression level in the HEK239EBNA suspension culture is ⁇ 30 mg/L. The expression of human FGF-21 in mammalian cells yields the natural N-terminus sequence of HPIP, i.e. without a methionine residue at the N-terminus.
  • Example 3 Expression and Purification of FGF-21 Muteins in Yeast
  • yeast such as Pichia pastor is, Pichia methanolica or Saccharomyces cerevisiae.
  • Pichia pastor is, Pichia methanolica or Saccharomyces cerevisiae.
  • Pichia pastor is a commercially available system (Invitrogen, Carlsbad, CA) uses vectors with the powerful AOX1 (alcohol oxidase) promoters to drive high-level expression of recombinant proteins.
  • vectors that use the promoter from the GAP gene are available for high level constitutive expression.
  • the multi-copy Pichia expression vectors allows one to obtain strains with multiple copies of the gene of interest integrated into the genome. Increasing the number of copies of the gene of interest in a recombinant Pichia strain can increase protein expression levels.
  • Yet another yeast expression system is Saccharomyces cerevisiae.
  • Expression vectors contain the promoter and enhancer sequences from the GALl gene.
  • the GALl promoter is one of the most widely used yeast promoters because of its strong transcriptional activity upon induction with galactose.
  • Analytical characterization indicates that the FGF-21 expressed in Pichia pastoris is truncated (up to four amino acid removal [HisProIlePro] at the N-terminus, designated hereinafter as des-EPlV).
  • des-EPlV amino acid removal
  • GM growth medium
  • DM differentiation medium
  • Glucose Transport Assay Hexose uptake, as assayed by the accumulation of 0.1 mM 2-deoxy-D-[ 14 C]glucose, is measured as follows: 3T3-L1 adipocytes in 12-well plates are washed twice with KRP buffer (136 mM NaCl, 4.7 mM KC1, 10 mM NaPO 4 , 0.9 mM CaCl 2 , 0.9 mM MgSO 4 , pH 7.4) warmed to 37 °C and containing 0.2% BSA, incubated in Leibovitz's L-15 medium containing 0.2% BSA for 2 h at 37°C in room air, washed twice again with KRP containing, 0.2% BSA buffer, and incubated in KRP, 0.2% BSA buffer in the absence (Me SO only) or presence of wortmanninfor 30 min at 37 °C in room air.
  • KRP buffer 136 mM NaCl, 4.7 mM KC1, 10
  • Insulin is then added to a final concentration of 100 nM for 15 min, and the uptake of 2-deoxy-D-[ 14 C]glucose is measured for the last 4 min.
  • Nonspecific uptake measured in the presence of 10 ⁇ M cytochalasin B, is subtracted from all values. Protein concentrations are determined with the Pierce bicinchoninic acid assay. Uptake is measured routinely in triplicate or quadruplicate for each experiment.
  • In vitro potency is normalized to the in vitro activity of wild-type FGF-21, which is given a designation of 1.0 and used as a positive control.
  • the in vitro potency of muteins of FGF-21 of the present invention is compared to wild-type FGF-21 in Table 1. As indicated in Table 1, the muteins of the present invention maintained biological potency to various degrees compare to wild-type FGF-21.
  • Example 5 Ob/ob Mouse Model A study in an obesity model using male ob/ob mice was done to monitor plasma glucose levels and triglyceride levels after treatment with FGF-21, compared to vehicle and insulin control groups.
  • the test groups of male ob/ob mice (7 weeks old) were injected with vehicle alone (0.9% NaCl), or FGF-21 mutein (0.125 mg/kg) subcutaneously (0.1 mL, once daily) for seven days. Blood was collected by tail clip bleeding on day 7, one hour after the last compound injection and plasma glucose levels were measured using a standard protocol.
  • Table 2 The ability of the FGF-21 muteins to lower plasma glucose levels as compared to the vehicle control is shown in Table 2.
  • the data in Table 2 indicates that muteins of the present invention lowered plasma glucose levels as compared to vehicle control.
  • the ability of the FGF-21 muteins to lower triglyceride levels as compared to the vehicle control is shown in Table 3. Table 2
  • Example 6 Pharmaceutical Stability of FGF-21 Muteins
  • the stability of the FGF-21 muteins of the present invention was analyzed under simulated physiological and pharmaceutical formulation conditions. To simulate physiological conditions, the mutein was analyzed for stability in PBS at room temperature (RT) at a target protein concentration of 10 mg/ml, pH 7.4. Solubility/physical stability of the muteins in PBS is considered satisfactory if recovery of protein following preparation resulted in >90% recovery at RT as determined by size- exclusion and/or reversed-phase chromatography.
  • the muteins of the present invention indicated in Tables 4 and 5 meet this criteria.
  • the extent of aggregation as measured by DLS (dynamic light scattering) at 37°C is shown as the average diameter of particles in the presence of m-cresol after two hours, compared to wild-type FGF-21.
  • a larger average diameter corresponds to an increased degree protein association and/or aggregation.
  • the preservative compatibility (as a function average diameter of particulates) of the muteins of the first and second embodiments of the present invention compared to wild-type FGF-21 is shown in Table 4. All muteins were expressed in E. coli. Muteins of the present invention that are stable in PBS and compatible with preservative are designated to have enhanced or improved pharmaceutical properties as compared to wild-type FGF-21.
  • the preferred muteins of the present invention that have enhanced pharmaceutical properties as compared to wild-type FGF-21 are L139E, A145E, L146E, I152E, Q156E, [I152E, S163E], S163E, Q54E, [L21C-L33C, L118C-A134C], L21C-L33C, A26C-K122C, and L118C-A134C.
  • Table 4
  • Average Particulate diameter represents a protein solution at a target cone, of 10 mg/ml, m-cresol at 3 mg/ml, after 2 hours incubation at 37 C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Obesity (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Emergency Medicine (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • Pain & Pain Management (AREA)
  • Physics & Mathematics (AREA)
  • Child & Adolescent Psychology (AREA)
  • Communicable Diseases (AREA)
  • Plant Pathology (AREA)
  • Pulmonology (AREA)

Abstract

The present invention relates to novel muteins of human fibroblast growth factor 21 with improved pharmaceutical properties. Both protein and the respective encoding nucleic acid species are disclosed. The invention also embodies vectors and host cells for the propagation of said nucleic acid sequences and the production of said muteins. Also disclosed are methods for treating type 2 diabetes, obesity, metabolic syndrome, and in reducing the mortality and morbidity of critically ill patients.

Description

MUTEINS OF FIBROBLAST GROWTH FACTOR 21
BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to the identification of new muteins of fibroblast growth factor 21 that have improved pharmaceutical properties.
Description of the Related Art Fibroblast growth factors are large polypeptides widely expressed in developing and adult tissues (Baird et al., Cancer Cells, 3:239-243, 1991) and play crucial roles in multiple physiological functions including angiogenesis, mitogenesis, pattern formation, cellular differentiation, metabolic regulation and repair of tissue injury (McKeehan et al., Prog. Nucleic Acid Res. Mol. Biol. 59:135-176, 1998). According to the published literature, the FGF family now consists of at least twenty-three members, FGF-1 to FGF- 23 (Reuss et al, Cell Tissue Res. 313:139-157 (2003). Fibroblast growth factor 21 (FGF-21) has been reported to be preferentially expressed in the liver (Nishimura et al., Biochimica et Biophysica Ada, 1492:203-206, (2000); WOOl/36640; and WO01/18172) and described as a treatment for ischemic vascular disease, wound healing, and diseases associated with loss of pulmonary, bronchia or alveolar cell function and numerous other disorders. More recently, FGF-21 has been shown to stimulate glucose-uptake in mouse 3T3-L1 adipocytes in the presence and absence of insulin, and to decrease fed and fasting blood glucose, triglycerides, and glucagon levels in ob/ob and db/db mice and 8 week old ZDF rats in a dose-dependant manner, thus, providing the basis for the use of FGF-21 as a therapy for treating diabetes and obesity (WO03/011213). In addition, FGF-21 has been shown to be effective in reducing the mortality and morbidity of critically ill patients (WO03/059270). A significant challenge in the development of protein pharmaceuticals, such as FGF-21, is to cope with their physical and chemical instabilities. The compositional variety and characteristics of proteins define specific behaviors such as folding, conformational stability, and unfolding/denaturation. Such characteristics must be addressed to stabilize proteins when developing pharmaceutical formulation conditions utilizing aqueous protein solutions (Wang, W., Int. J. of Pharmaceutics, 18, (1999). Specifically, in pharmaceutical protein development, anti-microbial preservative agents such as phenol, m-cresol, methylparaben, resorcinol, and benzyl alcohol are necessary in parenteral pharmaceutical formulations that are intended to be a sterile, multi-use formulation. Unfortunately, these compounds often adversely affect the stability of the protein product, triggering association and aggregation, in particular (Maa et a , Int. J. of Pharmaceutics 140:155-168 (1996); Lam et al, Pharm. Res. 14(6):725- 729 (1997)). FGF-21 will likely be utilized as a multi-use, sterile pharmaceutical formulation. However, it has been determined that preservatives, i.e. w-cresol, have an adverse affect on its stability under these conditions. Clearly, there is a need to develop a stable aqueous protein formulation for the therapeutic protein FGF-21. The present invention overcomes the significant hurdles of physical instabilities with the invention of muteins of FGF-21 that are more stable than wild-type FGF-21 under pharmaceutical formulation conditions. Thus, the muteins of FGF-21 of the present invention provide stable pharmacological protein formulations that are useful for the treatment of type 2 diabetes, obesity, metabolic syndrome, and in reducing the mortality and morbidity of critically ill patients.
Summary of the Invention In a first aspect, the present invention provides muteins of human fibroblast growth factor 21, or a biologically active peptide thereof, comprising the substitution with a charged and/or polar but uncharged amino acid for one or more of the following: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161, serine 163, glycine 170, or serine 172 wherein the numbering of the amino acids is based on SEQ ID NO:l. A second aspect of the present invention provides muteins of human fibroblast growth factor 21, or a biologically active peptide thereof, comprising the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, lutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, proline 90, alanine 92, serine 94, phenylalanine 95, leucine 100, aspartate 102, tyrosine 104, tyrosine 107, serine 109, glutamate 110, proline 115, histidine 117, leucine 118, proline 119, asparagine 121, lysine 122, serine 123, proline 124, histidine 125, arginine 126, aspartate 127, alanine 129, proline 130, glycine 132, alanine 134, arginine 135, leucine 137, proline 138, or leucine 139, wherein the numbering of the amino acids is based on SEQ ID NO:l. A third aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution with any charged and/or polar but uncharged amino acid at any of the amino acid positions indicated in the first embodiment of the present invention in combination with the substitution of a cysteine at two or more amino acid positions indicated in the second embodiment of the invention. Other embodiments are drawn to polynucleotides encoding the muteins of the first, second, and third embodiments, a vector containing said polynucleotides and a host cell carrying said vector. Another embodiment is drawn to processes to produce a polypeptide, to produce cells capable of producing said polypeptide and to produce a vector containing DNA encoding said polypeptide. Yet another embodiment is drawn to methods of treating a patient exhibiting one or more of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome comprising administering to said patient in need of such treatment a therapeutically effective amount of a human FGF-21 mutein of the first, second, or third embodiment or a pharmaceutical composition thereof.
Detailed Description of the Invention For purposes of the present invention, as disclosed and claimed herein, the following terms are as defined below. FGF-21 is a 208 amino acid polypeptide containing a 27 amino acid leader sequence. Human FGF-21 has ~79% amino acid identity to mouse FGF-21 and -80% amino acid identity to rat FGF-21. Human FGF-21 is the preferred polypeptide template for the muteins of the present invention but it is recognized that one with skill in the art could readily make muteins based on an alternative mammalian FGF-21 polypeptide sequence. The amino acid positions of the muteins of the present invention are determined from the mature human 181 amino acid FGF-21 polypeptide as shown below (SEQ ID
NO:l):
1 10 20
His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 30 40
Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr 50 60
Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro 70 80
Gly Val He Gin lie Leu Gly Nal Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 90 100 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 110 120
Glu Asp Gly Tyr Asn Nal Tyr Gin Ser Glu Ala His Gly Leu Pro Leu His Leu Pro Gly 130 140
Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro 150 160
Gly Leu Pro Pro Ala Leu Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp Nal 170 . 180
Gly Ser Ser Asp Pro Leu Ser Met Nal Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala
Ser The corresponding DΝA sequence coding for the mature human 181 amino acid FGF-21 polypeptide is (SEQ ID ΝO:2):
CACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTCGGGGGCCAAGTCCGGCA GCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCACCTGGAGATC
AGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAAGTCTC CTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGA CATCCAGGTTCCTGTGCCAGCGGCCAGATGGGGCCCTGTATGGATCGCTCCAC TTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAA TGTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAG TCCCCACACCGGGACCCTGCACCCCGAGGACCAGCTCGCTTCCTGCCACTACC AGGCCTGCCCCCCGCACTCCCGGAGCCACCCGGAATCCTGGCCCCCCAGCCC CCCGATGTGGGCTCCTCGGACCCTCTGAGCATGGTGGGACCTTCCCAGGGCCG AAGCCCCAGCTACGCTTCC One skilled in the art of expression of proteins will recognize that methionine or methionine-arginine sequence can be introduced at the N-terminus of the mature sequence (SEQ ID NO: 1) for expression in E. coli and are contemplated within the context of this invention. Amino acids are identified using the three-letter code or alternatively could be designated using the standard one letter code. Mutations are designated by the three-letter code for the original amino acid, followed by the amino acid number, followed by the three-letter code for the replacement amino acid. The numerical designations of each mutein is based on the 181 amino acid sequence of mature, wild-type, human FGF-21. For example, a substitution for leucine at position 139 (i.e. Leul39) with the negatively charged amino acid, glutamate (Glu) is designated as Leul39Glu or L139E. In a similar fashion, the double substitution for isoleucine at position 152 and serine at position 163 (Ilel52, Serl63) with the negatively charged amino acid, glutamate (Glu) is designated as Ilel52Glu Serl63Glu, I152E/S163E or I152E-S163E. A human FGF-21 mutein is defined as comprising human FGF-21 in which at least one amino acid of the wild-type mature protein has been substituted by another amino acid. Generally speaking, a mutein possesses some modified property, structural or functional, of the wild-type protein. For example, the mutein may have enhanced or improved physical stability in concentrated solutions (e.g., less hydrophobic mediated aggregation), while maintaining a favorable bioactivity profile. The mutein may possess increased compatibility with pharmaceutical preservatives (e.g., -cresol, phenol, benzyl alcohol), thus enabling the preparation of a preserved pharmaceutical formulation that maintains the physiochemical properties and biological activity of the protein during storage. Accordingly, muteins with enhanced pharmaceutical stability when compared to wild-type FGF-21, have improved physical stability in concentrated solutions under both physiological and preserved pharmaceutical formulation conditions, while maintaining biological potency. As used herein, these terms are not limiting, it being entirely possible that a given mutein has one or more modified properties of the wild-type protein. A "biologically active peptide" is defined as a peptide of a mutein of the present invention that maintains the modified property(s) and the biological potency of the mutein. A "therapeutically-effective amount" is the minimal amount of an active agent necessary to impart therapeutic benefit to a patient. For example, a "therapeutically- effective amount" to a patient exhibiting, suffering or prone to suffer or to prevent it from suffering from type 2 diabetes, obesity, or metabolic syndrome is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression, physiological conditions associated with or resistance to succumbing to the afore mentioned disorders. For the purposes of the present invention a "subject" or "patient" is preferably a human, but can also be an animal, more specifically, a companion animal (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like). "Type 2 diabetes" is characterized by excess glucose production in spite of the availability of insulin, and circulating glucose levels remain excessively high as a result of inadequate glucose clearance. "Glucose intolerance" can be defined as an exceptional sensitivity to glucose. "Hyperglycemia" is defined as an excess of sugar (glucose) in the blood. "Hypoglycemia", also called low blood sugar, occurs when your blood glucose level drops too low to provide enough energy for your body's activities. "Hyperinsulinemia" is defined as a higher-than-normal level of insulin in the blood. "Insulin resistance" is defined as a state in which a normal amount of insulin produces a subnormal biologic response. "Obesity", in terms of the human subject, can be defined as that body weight over 20 percent above the ideal body weight for a given population (R.H. Williams, Textbook of Endocrinology, 1974, p.904-916). "Metabolic syndrome" can be defined as a cluster of at least three of the following signs: abdominal fat — in most men, a 40-inch waist or greater; high blood sugar — at least 110 milligrams per deciliter (mg/dl) after fasting; high triglycerides — at least 150 mg/dL in the bloodstream; low HDL — less than 40 mg/dl; and, blood pressure of 130/85 or higher. The critically ill patients encompassed by the present invention generally experience an unstable hypermetabolic state. This unstable metabolic state is due to changes in substrate metabolism, which may lead to relative deficiencies in some nutrients. Generally there is an increased oxidation of both fat and muscle. Moreover, critically ill patients are preferably patients that experience systemic inflammatory response syndrome or respiratory distress. A reduction in morbidity means reducing the likelihood that a critically ill patient will develop additional illnesses, conditions, or symptoms or reducing the severity of additional illnesses, conditions, or symptoms. For example reducing morbidity may correspond to a decrease in the incidence of bacteremia or sepsis or complications associated with multiple organ failure. "Systemic inflammatory response syndrome (SIRS)" as used herein describes an inflammatory process associated with a large number of clinical conditions and includes, but is not limited to, more than one of the following clinical manifestations: (1) a body temperature greater than 38°C or less than 36°C; (2) a heart rate greater than 90 beats per minute; (3) tachypnea, manifested by a respiratory rate greater than 20 breaths per minute, or hyperventilation, as indicated by a PaCO2 of less than 32 mm Hg; and (4) an alteration in the white blood cell count, such as a count greater than 12,000/cu mm, a count less than 4,000/cu mm, or the presence of more than 10% immature neutrophils. These physiologic changes should represent an acute alteration from baseline in the absence of other known causes for such abnormalities, such as chemotherapy, induced neutropenia, and leukopenia. "Sepsis" as used herein is defined as a SIRS arising from infection. Noninfectious pathogenic causes of SIRS may include pancreatitis, ischemia, multiple trauma and tissue injury, i.e. crushing injuries or severe burns, hemorrhagic shock, immune-mediated organ injury, and the exogenous administration of such putative mediators of the inflammatory process as tumor necrosis factor and other cytokines. Septic shock and multi-organ dysfunction are major contributors to morbidity and mortality in the ICU setting. Sepsis is associated with and mediated by the activation of a number of host defense mechanisms including the cytokine network, leukocytes, and the complement cascade, and coagulation/fibrinolysis systems including the endothelium. Disseminated intravascular coagulation (DIG) and other degrees of consumption coagulopathy associated with fibrin deposition within the micro vasculature of various organs are manifestations of sepsis/septic shock. The downstream effects of the host defense response on target organs is an important mediator in the development of the multiple organ dysfunction syndrome (MODS) and contributes to the poor prognosis of patients with sepsis, severe sepsis, and sepsis complicated by shock. "Respiratory distress" as used herein denotes a condition wherein patients have difficulty breathing due to some type of pulmonary dysfunction. Often these patients exhibit varying degrees of hypoxemia that may or may not be refractory to treatment with supplemental oxygen. Respiratory distress may occur in patients with impaired pulmonary function due to direct lung injury or may occur due to indirect lung injury such as in the setting of a systemic process. In addition, the presence of multiple predisposing disorders substantially increases the risk, as does the presence of secondary factors such as chronic alcohol abuse, chronic lung disease, and a low serum pH. Some causes of direct lung injury include pneumonia, aspiration of gastric contents, pulmonary contusion, fat emboli, near drowning, inhalation injury, high altitude and reperfusion pulmonary edema after lung transplantation or pulmonary embolectomy. Some causes of indirect lung injury include sepsis, severe trauma with shock and multiple transfusions, cardiopulmonary bypass, drug overdose, acute pancreatitis, and transfusions of blood products. One class of pulmonary disorders that causes respiratory distress are associated with the syndrome known as Cor Pulmonale. These disorders are associated with chronic hypoxemia resulting in raised pressure within the pulmonary circulation called pulmonary hypertension. The ensuing pulmonary hypertension increases the work-load of the right ventricle, thus leading to its enlargement or hypertrophy. Cor Pulmonale generally presents as right heart failure defined by a sustained increase in right ventricular pressures and clinical evidence of reduced venous return to the right heart. "Chronic obstructive pulmonary diseases" (COPDs), which include emphysema and chronic bronchitis also cause respiratory distress and are characterized by obstruction to air flow. COPDs are the fourth leading cause of death and claim over 100,000 lives annually. "Acute respiratory distress syndrome" (ARDS) is generally progressive and characterized by distinct stages. The syndrome is generally manifested by the rapid onset of respiratory failure in a patient with a risk factor for the condition. Arterial hypoxemia that is refractory to treatment with supplemental oxygen is a characteristic feature. There may be alveolar filling, consolidation, and atelectasis occurring in dependent lung zones; however, non-dependent areas may have substantial inflammation. The syndrome may progress to fibrosing alveolitis with persistent hypoxemia, increased alveolar dead space, and a further decrease in pulmonary compliance. Pulmonary hypertension, which results from damage to the pulmonary capillary bed, may also develop. The first preferred aspect of the invention comprises muteins of human FGF-21 in which substitution means that any charged and/or polar but uncharged amino acid replaces at least one of the following: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161 serine 163, glycine 170, or serine 172, wherein the numbering of the amino acids is based on SEQ ID NO:l. A charged amino acid is defined as a positively or negatively charged amino acid. A positively charged amino acid is defined to include histadine, lysine, arginine, and non-naturally occurring analogs thereof (e.g., gamma aminobutyric acid, ornithine, etc.). A negatively charged amino acid is defined to included aspartate, glutamate, and non-naturally occurring analogs thereof (e.g., aminoadipic acid). A polar but uncharged amino acid is defined to include serine, threonine, asparagine, glutamine, and non-naturally occurring analogs thereof. The most preferred muteins of the first embodiment are Gln54Glu, Leul39Glu, Alal45Glu,
Leul46Glu, Ilel52Glu, Glnl56Glu, Serl63Glu, and Ilel52Glu-Serl63Glu. The second aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, lutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, proline 90, alanine 92, serine 94, phenylalanine 95, leucine 100, aspartate 102, tyrosine 104, tyrosine 107, serine 109, glutamate 110, proline 115, histidine 117, leucine 118, proline 119, asparagine 121, lysine 122, serine 123, proline 124, histidine 125, arginine 126, aspartate 127, alanine 129, proline 130, glycine 132, alanine 134, arginine 135, leucine 137, proline 138, or leucine 139, wherein the numbering of the amino acids is based on SEQ ID NO:l. One skilled in the art will also recognize that the native cysteines, cysteine 75 and cysteine 93, could also be utilized as loci to introduce a novel disulfide bond that may impart improved properties. Specifically contemplated is the introduction of a cysteine substitution at serine 85 or phenylalanine 73, coupled with a concomitant change at either cysteine 93 or cysteine 75, respectively, wherein the latter sites are replaced with any other amino acid. Naturally occurring disulfide bonds, as provided by cysteine residues, generally increase thermodynamic stability of proteins. Successful examples of increased thermodynamic stability, as measured in increase of the melting temperature, are multiple disulfide-bonded mutants of the enzymes T4 lysozyme (Matsumura, et al., PNAS 86:6562-6566 (1989)) and barnase (Johnson et al., J. Mol. Biol. 268:198-208 (1997)). An aspect of the present invention is the premise that constraining the flexibility of the 118- 134 amino acid loop of FGF-21 by disulfide bonds enhances the physical stability of
FGF-21 in the presence of a preservative, presumably by limiting access of the preservative to the hydrophobic core of the protein. Muteins of FGF-21 with engineered disulfide bonds, in addition to the naturally occurring one at Cys75-Cys93, are as follows: Gln76Cys-Serl09Cys, Cys75-Ser85Cys, Cys75-Ala92Cys, Phe73Cys-Cys93, Serl23Cys-Hisl25-Cys, Aspl02Cys-Tyrl04Cys, Aspl27Cys-Glyl32Cys, Ser94Cys-Glul lOCys, Prol l5Cys-Hisl l7Cys, Asnl21Cys- Aspl27Cys, LeulOOCys-Aspl02Cys, Phe95Cys-Tyrl07Cys, Argl9Cys-Prol38Cys, Tyr20Cys-Leul39Cys, Tyr22Cys-Leul37Cys, Arg77Cys-Asp79Cys, Pro90Cys- Ala92Cys, Glu50Cys-Lys69Cys, Thr23Cys-Asp25Cys, Ala31Cys-Gly43Cys, Gln28Cys- Gly43Cys, Thr23Cys-Gln28Cys, Val41 Cys-Leu82Cys, Leu58Cys-Val62Cys, Gln54Cys-
Leu66Cys, Ile35Cys-Gly67Cys, Gly67Cys-Arg72Cys, Ile35Cys-Gly84Cys, Arg72Cys- Gly84Cys, or Arg77Cys-Ala81Cys, wherein the numbering of the amino acids is based on SEQ ID NO:l. Preferred muteins with engineered disulfide bonds are Tyr22Cys- Leul39Cys; Asp24Cys-Argl35Cys; Leull8Cys-Glyl32Cys; Hisll7Cys-Prol30Cys; Hisl 17Cys-Alal29Cys; Leu82Cys-Prol 19Cys; Gly80Cys-Alal29Cys; Gly43Cys- Prol24Cys; Gly42Cys-Argl26Cys; Gly42Cys-Prol24Cys; Gln28Cys-Prol24Cys; Gln27Cys-Serl23Cys; Ala26Cys-Lysl22Cys; or Asp25Cys-Lysl22Cys. Most preferred muteins with engineered disulfide bonds are Leul 18Cys-Alal34Cys; Leu21Cys- Leu33Cys; Ala26Cys-Lysl22Cys; Leu21Cys-Leu33Cys/Leull8Cys-Alal34Cys The third aspect of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising a substitution of any charged and/or polar but uncharged amino acid at any of the amino acid positions indicated in the first embodiment of the present invention combined with the substitution of a cysteine at two or more amino acid positions indicated in the second embodiment of the invention. It is well known in the art that a significant challenge in the development of protein pharmaceuticals is to deal with the physical and chemical instabilities of proteins. This is even more apparent when a protein pharmaceutical formulation is intended to be a multiple use, injectable formulation requiring a stable, concentrated and preserved solution, while maintaining a favorable bioactivity profile. Detailed biophysical characterization of wild-type FGF-21 established that a concentrated protein solution (> 5 mg/ml), when exposed to stress conditions, such as high temperature or low pH, lead to accelerated association and aggregation (i. e., poor physical stability and biopharmaceutical properties). Exposure of a concentrated protein solution of FGF-21 to pharmaceutical preservatives (e.g., m-cresol) also had a negative impact on physical stability. Therefore, an embodiment of the present invention is to enhance physical stability of concentrated solutions, while maintaining chemical stability and biological potency, under both physiological and preserved formulation conditions. It is thought that association and aggregation may result from hydrophobic interactions, since, at a given protein concentration, temperature, and ionic strength have considerable impact on physical stability. For the most part, non-conserved, presumed surface exposed amino acid residues were targeted. The local environment of these residues was analyzed and, those that were not deemed structurally important were selected for mutagenesis. One method to initiate specific changes is to further decrease the pi of the protein by introducing glutamic acid residues ("glutamic acid scan"). It is hypothesized that the introduction of charged substitutes would inhibit hydrophobic-mediated aggregation via charge-charge repulsion and potentially improve preservative compatibility. In addition, one skilled in the art would also recognize that with sufficient degree of mutagenesis the i could be shifted into a basic pH range by the introduction of positive charge with or without concomitant decrease in negative charge, thus allowing for charge-charge repulsion. Although the embodiments of the present invention concern the physical and chemical stability under both physiological and preserved pharmaceutical formulation conditions, maintaining the biological potency of the muteins as compared to wild-type FGF-21 is an important factor of consideration as well. Therefore, the biological potency of the muteins of the present invention is defined by the ability of the muteins to affect glucose uptake as measured in the in vitro 3T3-L1 cell assay (Example 4) and/or the lowering of plasma glucose levels, as well as, plasma triglycerides, as measured in vivo in the ob/ob mouse assay (Example 5). The muteins of FGF-21 administered according to this invention may be generated and/or isolated by any means known in the art. The most preferred method for producing the mutein is through recombinant DNA methodologies and is well known to those skilled in the art. Such methods are described in Current Protocols in Molecular Biology (John Wiley & Sons, Inc.), which is incorporated herein by reference. Additionally, the preferred embodiments include a biologically active peptide derived from the mutein described herein. Such a peptide will contain at least one of the substitutions described and the mutein will possess biological activity. The peptide may be produced by any and all means known to those skilled in the art, examples of which included but are not limited to enzymatic digestion, chemical synthesis or recombinant DNA t methodologies. It is established in the art that fragments of peptides of certain fibroblast growth factors are biologically active. See for example, Baird et al., Proc. Natl. Acad. Sci (USA) 85:2324-2328 (1988), andJ Cell. Phys. Suppl. 5:101-106 (1987). Therefore, the selection of fragments or peptides of the mutein is based on criteria known in the art. For example, it is known that dipeptidyl peptidase IV (DPP-IV) is a serine type protease involved in inactivation of neuropeptides, endocrine peptides, and cytokines (Damme et al. Chem. Immunol. 72: 42-56, (1999)). The N-terminus of FGF-21 (HisProIlePro) contains two dipeptides that could potentially be substrates to DPP-IV, resulting in a fragment of FGF-21 truncated at the N-terminus by 4 amino acids. Unexpectedly, this fragment of wild-type FGF-21 has been demonstrated to retain biological activity (Table 1), thus, muteins of the present invention truncated at the N-terminus by up to 4 amino acids, is an embodiment of the present invention. The present invention also encompasses polynucleotides encoding the above- described muteins that may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded. The coding sequences that encode the muteins of the present invention may vary as a result of the redundancy or degeneracy of the genetic code. The polynucleotides that encode for the muteins of the present invention may include the following: only the coding sequence for the mutein, the coding sequence for the mutein and additional coding sequence such as a functional polypeptide, or a leader or secretory sequence or a pro-protein sequence; the coding sequence for the mutein and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mutein. Thus the term "polynucleotide encoding a mutein" encompasses a polynucleotide that may include not only coding sequence for the mutein but also a polynucleotide, which includes additional coding and/or non-coding sequence. The present invention further relates to variants of the described polynucleotides that encode for fragments, analogs and derivatives of the polypeptide that contain the indicated substitutions. The variant of the polynucleotide may be a naturally occurring allelic variant of the human FGF-21 sequence, a non-naturally occurring variant, or a truncated variant as described above. Thus, the present invention also includes polynucleotides encoding the muteins described above, as well as variants of such polynucleotides, which variants encode for a fragment, derivative or analog of the disclosed mutein. Such nucleotide variants include deletion variants, substitution variants, truncated variants, and addition or insertion variants as long as at least one of the indicated amino acid substitutions of the first or second embodiments is present. The polynucleotides of the present invention will be expressed in hosts after the sequences have been operably linked to (i.e., positioned to ensure the functioning of) an expression control sequence. These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors will contain selection markers, e.g., tetracycline, neomycin, and dihydrofolate reductase, to permit detection of those cells transformed with the desired DNA sequences. The FGF-21 mutein can be expressed in mammalian cells, insect, yeast, bacterial or other cells under the control of appropriate promoters. Cell free translation systems can also be employed to produce such proteins using RNAs derived from DNA constructs of the present invention. E. coli is a prokaryotic host useful particularly for cloning the polynucleotides of the present invention. Other microbial hosts suitable for use include Bacillus subtilus, Salmonella typhimurium, and various species of Serratia, Pseudomonas, Streptococcus, and Staphylococcus, although others may also be employed as a matter of choice. In these prokaryotic hosts, one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication). In addition, any of a number of well-known promoters may be present, such as the lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from phages lambda or T7. The promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation. One skilled in the art of expression of proteins will recognize that methionine or methionine-arginine sequence can be introduced at the N-terminus of the mature sequence (SΕQ ID NO: 1) for expression in E. coli and are contemplated within the context of this invention. Thus, unless otherwise noted, muteins of the present invention expressed in E. coli have a methionine sequence introduced at the N-terminus. Other microbes, such as yeast or fungi, may also be used for expression. Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Pichia angusta are examples of preferred yeast hosts, with suitable vectors having expression control sequences, such as promoters, including 3-phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences and the like as desired. Aspergillus niger, Trichoderma reesei; and Schizophyllum commune, are examples of fungi hosts, although others may also be employed as a matter of choice. Mammalian tissue cell culture may also be used to express and produce the polypeptides of the present invention. Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting intact muteins have been developed in the art, and include the CHO cell lines, various COS cell lines, NSO cells, Syrian Hamster Ovary cell lines, HeLa cells, or human embryonic kidney cell lines (i.e. HEK293, HEK293EBNA). Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from SN40, adenovirus, bovine papilloma virus, cytomegalovirus, Raus sarcoma virus, and the like. Preferred polyadenylation sites include sequences derived from SN40 and bovine growth hormone. The vectors containing the polynucleotide sequences of interest (e.g., the muteins of FGF-21 and expression control sequences) can be transferred into the host cell by well- known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts. Various methods of protein purification may be employed and such methods are known in the art and described, for example, in Deutscher, Methods in En∑ymology 182: 83-9 (1990) and Scopes, Protein Purification: Principles and Practice, Springer- Verlag, ΝY (1982). The purification step(s) selected will depend, for example, on the nature of the production process used for the muteins of FGF-21. The FGF-21 mutein-containing compositions should be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the patient, the site of delivery of the FGF-21 mutein composition, the method of administration, the scheduling of administration, and other factors known to practitioners. The "therapeutically effective amount" of the FGF-21 mutein for purposes herein is thus determined by such considerations The pharmaceutical compositions of the FGF-21 muteins and of the present invention may be administered by any means that achieve the generally intended purpose: to treat type 2 diabetes, obesity, metabolic syndrome, or critically ill patients. The term "parenteral" as used herein refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous, and intraarticular injection and infusion. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. Compositions within the scope of the invention include all compositions wherein an FGF-21 mutein is present in an amount that is effective to achieve the desired medical effect for treatment type 2 diabetes, obesity, or metabolic syndrome. While individual needs may vary from one patient to another, the determination of the optimal ranges of effective amounts of all of the components is within the ability of the clinician of ordinary skill. The muteins of FGF-21 of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions. A desired formulation would be one that is a stable lyophilized product that is reconstituted with an appropriate diluent or an aqueous solution of high purity with optional pharmaceutically acceptable carriers, preservatives, excipients or stabilizers [Remington 's Pharmaceutical Sciences 16th edition (1980)]. The muteins of the present invention may be combined with a pharmaceutically acceptable buffer, and the pH adjusted to provide acceptable stability, and a pH acceptable for administration. For parenteral administration, in one embodiment, the FGF-21 muteins are formulated generally by mixing one or more of them at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. Preferably, one or more pharmaceutically acceptable anti-microbial agents may be added. Phenol, rø-cresol, and benzyl alcohol are preferred pharmaceutically acceptable antimicrobial agents. Optionally, one or more pharmaceutically acceptable salts may be added to adjust the ionic strength or tonicity. One or more excipients may be added to further adjust the isotonicity of the formulation. Glycerin, sodium chloride, and mannitol are examples of an isotonicity adjusting excipient. Those skilled in the art can readily optimize pharmaceutically effective dosages and administration regimens for therapeutic compositions comprising an FGF-21 mutein, as determined by good medical practice and the clinical condition of the individual patient. A typical dose range for the FGF-21 muteins of the present invention will range from about 0.01 mg per day to about 1000 mg per day for an adult. Preferably, the dosage ranges from about 0.1 mg per day to about 100 mg per day, more preferably from about 1.0 mg/day to about 10 mg/day. Most preferably, the dosage is about 1-5 mg/day. The appropriate dose of an FGF-21 mutein administered will result in lowering blood glucose levels and increasing energy expenditure by faster and more efficient glucose utilization, and thus is useful for treating type 2 diabetes, obesity and metabolic syndrome. In addition, because hyperglycemia and insulin resistance are common in critically ill patients given nutritional support, some ICUs administer insulin to treat excessive hyperglycemia in fed critically ill patients. In fact, recent studies document the use of exogenous insulin to maintain blood glucose at a level no higher than 110 mg per deciliter reduced morbidity and mortality among critically ill patients in the surgical intensive care unit, regardless of whether they had a history of diabetes (Van den Berghe, etal. NEnglJMed., 345(19):1359, (2001)). Thus, muteins of FGF-21 of the present invention are uniquely suited to help restore metabolic stability in metabolically unstable critically ill patients. Muteins of FGF-21 are unique in that they stimulate glucose uptake and enhances insulin sensitivity but do not induce hypoglycemia. In another aspect of the present invention, muteins of FGF-21 for use as a medicament for the treatment of type 2 diabetes, obesity, metabolic syndrome, or critically ill patients is contemplated. Having now described the present invention in detail, the same will be more clearly understood by reference to the following examples, which are included herewith for purposes of illustration only and are not intended to be limiting of the invention. All patents and publications referred to herein are expressly incorporated by reference.
Examnle 1 Expression and Purification of FGF-21 Muteins in E. coli The bacterial expression vector pET30a is used for bacterial expression in this example. (Novagen, Inc., Madison, Wisconsin)). pET30a encodes kanamycin antibiotic resistance gene and contains a bacterial origin of replication ("ori"), a strong T7 phage- IPTG inducible promoter, a ribosome binding site ("RBS"), and suitable MCS with a number of unique resrtiction endonuclease cleavage sites. Conveniently for purification purpose, the vector can encode His- and S-tags for N-terminal peptide fusions, as well as, a C-terminal His-tag fusion. However, for purposes of the present invention, the cDNA encoding FGF-21 variants is inserted between restriction sites Ndel and BamHI, respectively, and the resulting construct does not take advatrage of either of the described tags. The nucleic acid sequence encoding the FGF-21 mutein, lacking the leader sequence but substituted with a methionine residue, is amplified from a cDNA clone using PCR oligonucleotide primers, which anneal to the 5' and 3' ends of the open reading frame. Additional nucleotides, containing recognition sites for restriction enzymes Ndel and BamHI, are added to the 5' and 3' sequences, respectively. For cloning, the 5' forward and 3' reverse PCR primers have nucleotides corresponding or complementary to a portion of the coding sequence of the FGF-21 mutein-encoding nucleic acid according to methods known in the art. One of ordinary skill in the art would appreciate that the point in a polynucleotide sequence where primers begin can be varied. The amplified nucleic acid fragments and the vector pET30a are digested with Ndel and BamHI restriction enzymes and the purified digested DNA fragments are then ligated together. Insertion of FGF-21 mutein-encoding DNA into the restricted pET30a vector places the FGF-21 mutein polypeptide coding region including its associated stop codon downstream from the IPTG-inducible promoter and in-frame with an initiating ATG codon. The associated stop codon, TAG, prevents translation of the six-histidine codons downstream of the insertion point. The ligation mixture is transformed into competent E. coli cells using standard procedures such as those described in Current Protocols in Molecular Biology (John
Wiley & Sons, Inc.). Transformation reactions are plated on LB/Kanamycin plates and after an overnight growth transformants are picked for plasmid preparations or lysed in situ for screening by PCR. Positive recombinant plasmids, containing desired FGF-21 variant inserts, are identified by restriction analysis followed by DNA sequence analysis. Those plasmids are subsequently used to transform expression strains and protein production. E. coli strains BL21(DΕ3), BL21(DE3)STAR or BL21(DE3) RP, are used for expressing FGF-21 muteins. These strains, which are only some of many that are suitable for expressing FGF-21 muteins, are available commercially from Novagen, Inc.,
Invitrogen and Stratagen, respectively. Transformants are identified by their ability to grow on LB plates in the presence of kanamycin. . Clones containing the desired constructs are grown overnight (o/n) in liquid culture in LB media supplemented with kanamycin (30μg/ml). The o/n culture is used to inoculate a large culture, at a dilution of approximately 1 :25 to 1 :250. The cells are grown to an optical density of 0.6 ("OD600") at 600 nm. Isopropyl-b-D- thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor.
Cells subsequently are incubated further for 3 to 12hours. Cells are then harvested by centrifugation, pellets washed with 50 mM Tris buffer, pH 8.0 and stored at -20 C until purification. The FGF-21 muteins are expressed in the insoluble fraction i.e inclusion bodies (or granules) of E. coli. Although the expression level may vary from variant-to- variant, a typically observed level for the wild-type (WT) FGF-21 protein is 50 mg/L. The subsequent purification process starts with solubilization of the granules and refolding of the variants followed by four chromatographic steps. To purify the FGF-21 muteins from E coli, the granules are solubilzed in 50 mM Tris, pH 9.0, 7M Urea and 1 mM DTT through a pH ramp to pH 11.0, at room temperature for 1 hour with stirring. The protein is then captured on a Q-Sepharose column using the same buffer described above, and eluted with a linear gradient of 0-400 mM NaCl. The Q-Sepharose pool is then treated with 10 mM DTT, for two hours, at RT, to reduce all disulfide bonds. The pool is then diluted 10-fold so that the buffer concentration is as follows: 50 mM Tris, pH 9.0, 7 M Urea, 10 mM Cysteine, 1 mM DTT with a protein concentration of approximately 250-500 μg/ml. After another two-hour incubation under reducing conditions at RT, to obtain the protein in a free disulfide form, the pool is then dialyzed into 20 mM glycine, pH 9.0 for approximately 48 hours so that the correct disulfide bonds can be formed. Reversed-phase HPLC chromatography, on a Vydac C 18 column and 0.1% TFA/
0-50% CH3CN as a mobile phase is used as an initial purification step. This column is used to concentrate FGF-21 or the FGF-21 muteins and removes contaminating endotoxin. The following purification step is size exclusion chromatography on a Superdex 35/600 column performed in IX PBS buffer, pH7.4. At this step FGF-21 muteins are ~ 95% pure. The last step involves MonoQ chromatography in 50 mM Tris, pH 8.0 and elution with a linear gradient of 0-300 mM NaCl, which usually yields > 97% pure protein. The above described 4-column step purification scheme was used for all the FGF-21 muteins and produced stable preparations.
Example 2 Expression and Purification of FGF-21 Muteins in HEK293EBNA Cells Alternatively, FGF-21 muteins can be produced in a mammalian cell expression system such as HEK293EBNA cells (EdgeBiosystems, Gaiethersburg, MD). FGF-21 muteins are subcloned in the proprietary expression vector representing a modification of commercially available pEAKlO, between Nhel and Xbal restriction sites in the MCS. The cDNA sequence encoding mature FGF-21 is fused in frame with the Igκ leader sequence to enhance secretion of the desired product in the tissue culture media. The expression is driven by the strong viral CMV promoter. HEK293EBNA cells are transiently transfected using a standard transfection reagent such as Fugene (Roche Diagnostics, Indianapolis, IN) and the appropriate amount of recombinant plasmid, either as a monolayer or suspension culture, at the adequate cell density. Cells are incubated at 37 C and 5 % C02 , in serum free media, and collections are made every day for 5 days. Typically the expression level in the HEK239EBNA suspension culture is ~ 30 mg/L. The expression of human FGF-21 in mammalian cells yields the natural N-terminus sequence of HPIP, i.e. without a methionine residue at the N-terminus. It was discovered that enzymatically treating FGF-21 from HEK239EBNA cells with DPP-IV (porcine kidney, SIGMA St Louis) resulted in truncation of the N-terminus by four amino acids. When assayed in the mouse 3T3-L1 adipocyte assay (see Example 4), this truncated variant of FGF-21 stimulates glucose uptake at a comparable level to that of wild-type FGF-21 (Table 1).
Example 3 Expression and Purification of FGF-21 Muteins in Yeast Yet another expression system for production of FGF-21 muteins is yeast, such as Pichia pastor is, Pichia methanolica or Saccharomyces cerevisiae. For production in
Pichia pastor is a commercially available system (Invitrogen, Carlsbad, CA) uses vectors with the powerful AOX1 (alcohol oxidase) promoters to drive high-level expression of recombinant proteins. Alternatively, vectors that use the promoter from the GAP gene (glyceraldehyde-3 -phosphate dehydrogenase) are available for high level constitutive expression. The multi-copy Pichia expression vectors allows one to obtain strains with multiple copies of the gene of interest integrated into the genome. Increasing the number of copies of the gene of interest in a recombinant Pichia strain can increase protein expression levels. Yet another yeast expression system is Saccharomyces cerevisiae. Expression vectors contain the promoter and enhancer sequences from the GALl gene. The GALl promoter is one of the most widely used yeast promoters because of its strong transcriptional activity upon induction with galactose. Analytical characterization (mass spectrum analyses) indicates that the FGF-21 expressed in Pichia pastoris is truncated (up to four amino acid removal [HisProIlePro] at the N-terminus, designated hereinafter as des-EPlV). When assayed in the mouse 3T3-L1 adipocyte assay (see Example 4), this truncated variant of FGF-21 stimulates glucose uptake at the same level as wild-type FGF-21 (Table 1).
Example 4 Glucose Uptake in Mouse 3T3-L1 Adipocytes 3T3-L1 cells are obtained from the American Type Culture Collection (ATCC,
Rockville, MD). Cells are cultured in growth medium (GM) containing 10% iron- enriched fetal bovine serum inDulbecco's modified Eagle's medium. For standard adipocyte differentiation, two days after cells reached confluency (referred as day 0), cells are exposed to differentiation medium (DM) containing 10% fetal bovine serum, 10 μg/ml of insulin, 1 μM dexamethasone, and 0.5 μM isobutylmethylxanthine, for 48 h. Cells then are maintained in post differentiation medium containing 10% fetal bovine serum, and 10 μg/ml of insulin. Glucose Transport Assay— Hexose uptake, as assayed by the accumulation of 0.1 mM 2-deoxy-D-[14C]glucose, is measured as follows: 3T3-L1 adipocytes in 12-well plates are washed twice with KRP buffer (136 mM NaCl, 4.7 mM KC1, 10 mM NaPO4, 0.9 mM CaCl2, 0.9 mM MgSO4, pH 7.4) warmed to 37 °C and containing 0.2% BSA, incubated in Leibovitz's L-15 medium containing 0.2% BSA for 2 h at 37°C in room air, washed twice again with KRP containing, 0.2% BSA buffer, and incubated in KRP, 0.2% BSA buffer in the absence (Me SO only) or presence of wortmanninfor 30 min at 37 °C in room air. Insulin is then added to a final concentration of 100 nM for 15 min, and the uptake of 2-deoxy-D-[14C]glucose is measured for the last 4 min. Nonspecific uptake, measured in the presence of 10 μM cytochalasin B, is subtracted from all values. Protein concentrations are determined with the Pierce bicinchoninic acid assay. Uptake is measured routinely in triplicate or quadruplicate for each experiment. In vitro potency is normalized to the in vitro activity of wild-type FGF-21, which is given a designation of 1.0 and used as a positive control. The in vitro potency of muteins of FGF-21 of the present invention is compared to wild-type FGF-21 in Table 1. As indicated in Table 1, the muteins of the present invention maintained biological potency to various degrees compare to wild-type FGF-21.
Table 1
Figure imgf000023_0001
Figure imgf000024_0001
**enzymatically truncated by 4-amino acids at the N-terminus by DPP-IV, i.e. es-HPIP
Example 5 Ob/ob Mouse Model A study in an obesity model using male ob/ob mice was done to monitor plasma glucose levels and triglyceride levels after treatment with FGF-21, compared to vehicle and insulin control groups. The test groups of male ob/ob mice (7 weeks old) were injected with vehicle alone (0.9% NaCl), or FGF-21 mutein (0.125 mg/kg) subcutaneously (0.1 mL, once daily) for seven days. Blood was collected by tail clip bleeding on day 7, one hour after the last compound injection and plasma glucose levels were measured using a standard protocol. The ability of the FGF-21 muteins to lower plasma glucose levels as compared to the vehicle control is shown in Table 2. The data in Table 2 indicates that muteins of the present invention lowered plasma glucose levels as compared to vehicle control. The ability of the FGF-21 muteins to lower triglyceride levels as compared to the vehicle control is shown in Table 3. Table 2
Figure imgf000025_0001
Example 6 Pharmaceutical Stability of FGF-21 Muteins The stability of the FGF-21 muteins of the present invention was analyzed under simulated physiological and pharmaceutical formulation conditions. To simulate physiological conditions, the mutein was analyzed for stability in PBS at room temperature (RT) at a target protein concentration of 10 mg/ml, pH 7.4. Solubility/physical stability of the muteins in PBS is considered satisfactory if recovery of protein following preparation resulted in >90% recovery at RT as determined by size- exclusion and/or reversed-phase chromatography. The muteins of the present invention indicated in Tables 4 and 5 meet this criteria. It is anticipated that pharmaceutical formulation of a mutein of the present invention will likely be a preserved multi-use formulation, thus, compatibility with a common preservative was analyzed. To test for formulation compatibility, a preservative, -cresol, (3 mg/mL final concentration, a concentration usually sufficient to meet European Pharmacopia B criteria for preservative effectiveness under neutral pH conditions), was added at room temperature to a solution containing the mutein at approximately lOmg/ml in PBS, pH 7.4. Physical stability in the presence of preservative was initially accessed by determining protien recovery of the main chromato graphic peak after reversed-phase and size exclusion chromatography at RT. Furthermore, the extent of aggregation as measured by DLS (dynamic light scattering) at 37°C is shown as the average diameter of particles in the presence of m-cresol after two hours, compared to wild-type FGF-21. A larger average diameter corresponds to an increased degree protein association and/or aggregation. The preservative compatibility (as a function average diameter of particulates) of the muteins of the first and second embodiments of the present invention compared to wild-type FGF-21 is shown in Table 4. All muteins were expressed in E. coli. Muteins of the present invention that are stable in PBS and compatible with preservative are designated to have enhanced or improved pharmaceutical properties as compared to wild-type FGF-21. As shown in Table 4, the preferred muteins of the present invention that have enhanced pharmaceutical properties as compared to wild-type FGF-21 are L139E, A145E, L146E, I152E, Q156E, [I152E, S163E], S163E, Q54E, [L21C-L33C, L118C-A134C], L21C-L33C, A26C-K122C, and L118C-A134C. Table 4
Figure imgf000027_0001
*Average Particulate diameter represents a protein solution at a target cone, of 10 mg/ml, m-cresol at 3 mg/ml, after 2 hours incubation at 37 C.

Claims

What is Claimed is:
1. A mutein of human fibroblast growth factor 21 (FGF-21), or a biologically active peptide thereof, comprising the substitution of a charged and/or polar but uncharged amino acid for one or more of the following: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161, serine 163, glycine 170, or serine 172, wherein the numbering of the amino acids is based on SEQ ID NO:l.
2. The mutein of Claim 1 wherein the negatively charged amino acid is selected from the group consisting of aspartate, glutamate, and non-naturally occurring analogs thereof.
3. The mutein of Claim 1 wherein the polar but uncharged amino acid is selected from the group consisting of serine, threonine, asparagine, glutamine, and non-naturally occurring analogs thereof.
4. The mutein of Claim 1, wherein said mutein is selected from the group consisting of Leul39Glu, Alal45Glu, Leul46Glu, Ilel52Glu, Glnl56Glu, Serl63Glu, Ilel52Glu, Serl63Glu, and Gln54Glu.
5. The mutein of Claim 4 wherein said mutein is truncated at the N-terminus by up to 4 amino acids.
6. A polynucleotide encoding the mutein of Claim 1.
7. The polynucleotide of Claim 6, wherein said polynucleotide is DNA.
8. An expression vector containing the DNA of Claim 7.
9. A host cell comprising the expression vector of Claim 8.
10. The host cell of Claim 9 wherein said host cell is a yeast cell.
11. A process for producing a polypeptide comprising: (a) expressing said polypeptide from the host cell of Claim 10, and; (b) isolating said polypeptide.
12. A pharmaceutical composition comprising a therapeutically effective amount of the FGF-21 mutein of Claim 1 and an acceptable pharmaceutical carrier, wherein said composition is useful for treating a patient exhibiting one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome
13. A method for treating a patient comprising administering to said patient a therapeutically effective amount of the FGF-21 mutein of Claim 1, wherein said patient exhibits one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
14. The method of Claim 13 wherein said patient exhibits type 2 diabetes.
15. A mutein of human FGF-21, or a biologically active peptide thereof, comprising the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, glutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, proline 90, alanine 92, serine 94, phenylalanine 95, leucine 100, aspartate 102, tyrosine 104, tyrosine 107, serine 109, glutamate 110, proline 115, histidine 117, leucine 118, proline 119, asparagine 121, lysine 122, serine 123, proline 124, histidine 125, arginine 126, aspartate 127, alanine 129, proline 130, glycine 132, alanine 134, arginine 135, leucine 137, proline 138, or leucine 139, wherein the numbering of amino acids is based on SEQ ID NO:l.
16. The mutein of Claim 15, wherein said mutein is selected from the group consisting of Leu21Cys-Leu33Cys/Leul 18Cys-Alal34Cys, Leu21Cys/Leu33Cys,
Leul 18Cys/Alal34Cys, or Ala26Cys/Lysl22Cys.
17. The mutein of Claim 16 wherein said mutein is truncated at the N-terminus by up to 4 amino acids.
18. The mutein of Claim 17 wherein, said mutein is des-HPW- Leul l8Cys/Alal34Cys.
19. A polynucleotide encoding the mutein of Claim 15.
20. The polynucleotide of Claim 19, wherein said polynucleotide is DNA.
21. An expression vector containing the DNA of Claim 20.
22. A host cell comprising the expression vector of Claim 21.
23. The host cell of Claim 22 wherein said host cell is a yeast cell.
24. A process for producing a polypeptide comprising: (a) expressing said polypeptide from the host cell of Claim 23, and; (b) isolating said polypeptide.
25. A pharmaceutical composition comprising a therapeutically effective amount of the FGF-21 mutein of Claim 15 and an acceptable pharmaceutical carrier, wherein said composition is useful for treating a patient exhibiting one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
26. A method for treating a patient comprising administering to said patient a therapeutically effective amount of the FGF-21 mutein of Claim 15, wherein said patient exhibits one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
27. The method of Claim 26 wherein said patient exhibits type 2 diabetes.
28. A mutein of human FGF-21 , or a biologically active peptide thereof, comprising the substitution of a charged and/or polar but uncharged amino acid for one or more of the amino acids at positions: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131,leucine 139, alaninel45, leucine 146, isoleucine 152; alanine 154; glutamine 156, glycine 161,serine 163, glycine 170, or serine 172; in combination with the substitution of a cysteine for two or more of the amino acid at positions: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, lutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, proline 90, alanine 92, serine 94, phenylalanine 95, leucine 100, aspartate 102, tyrosine 104, tyrosine 107, serine 109, glutamate 110, proline 115, histidine 117, leucine 118, proline 119, asparagine 121, lysine 122, serine 123, proline 124, histidine 125, arginine 126, aspartate 127, alanine 129, proline 130, glycine 132, alanine 134, arginine 135, leucine 137, proline 138, or leucine 139, wherein the numbering of amino acids is based on SEQ ID NO:l.
29. A polynucleotide encoding the mutein of Claim 28.
30. The polynucleotide of Claim 29, wherein said polynucleotide is DNA.
31. An expression vector containing the DNA of Claim 30.
32. A host cell comprising the expression vector of Claim 31.
33. The host cell of Claim 32 wherein said host cell is a yeast cell.
34. A process for producing a polypeptide comprising: (a) expressing said polypeptide from the host cell of Claim 33, and; (b) isolating said polypeptide.
35. A pharmaceutical composition comprising a therapeutically effective amount of the FGF-21 mutein of Claim 28 and an acceptable pharmaceutical carrier, wherein said composition is useful for treating a patient exhibiting one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
36. A method for treating a patient comprising administering to said patient a therapeutically effective amount of the FGF-21 mutein of Claim 28, wherein said patient exhibits one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
37. The method of Claim 36 wherein said patient exhibits type 2 diabetes.
38. The mutein of Claim 28 wherein said mutein is truncated at the N-terminus by up to 4 amino acids.
39. The use of the FGF-21 mutein of Claim 1 for the manufacture of a medicament for the treatment of one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
40. The use of the FGF-21 mutein of Claim 15 for the manufacture of a medicament for the treatment of one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
41. The use of the FGF-21 mutein of Claim 28 for the manufacture of a medicament for the treatment of one or more of the indications from the group consisting of obesity, type 2 diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome.
PCT/US2004/037200 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21 WO2005061712A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA002549249A CA2549249A1 (en) 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21
AU2004303783A AU2004303783A1 (en) 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21
EA200601121A EA200601121A1 (en) 2003-12-10 2004-12-01 MUTEINS OF FIBROBLAST GROWTH FACTOR 21
US10/579,510 US7491697B2 (en) 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21
JP2006543822A JP4477013B2 (en) 2003-12-10 2004-12-01 Fibroblast growth factor 21 mutein
BRPI0416683-3A BRPI0416683A (en) 2003-12-10 2004-12-01 human 21 fibroblast growth factor mutant (fgf-21), or a biologically active peptide thereof, polynucleotide, expression vector, host cell, process for producing a polypeptide, pharmaceutical composition, method for treating a patient, and, use da muteìna fgf-21
EP04810531A EP1702067A1 (en) 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21
IL175736A IL175736A0 (en) 2003-12-10 2006-05-18 Muteins of fibroblast growth factor 21
NO20062662A NO20062662L (en) 2003-12-10 2006-06-09 Muteins of fibroblast growth factor 21
US12/349,119 US20090118190A1 (en) 2003-12-10 2009-01-06 Muteins of fibroblast growth factor 21

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52858203P 2003-12-10 2003-12-10
US60/528,582 2003-12-10

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/349,119 Division US20090118190A1 (en) 2003-12-10 2009-01-06 Muteins of fibroblast growth factor 21

Publications (1)

Publication Number Publication Date
WO2005061712A1 true WO2005061712A1 (en) 2005-07-07

Family

ID=34710086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/037200 WO2005061712A1 (en) 2003-12-10 2004-12-01 Muteins of fibroblast growth factor 21

Country Status (14)

Country Link
US (2) US7491697B2 (en)
EP (2) EP1702067A1 (en)
JP (1) JP4477013B2 (en)
KR (1) KR20060135648A (en)
CN (1) CN1890371A (en)
AR (1) AR046877A1 (en)
AU (1) AU2004303783A1 (en)
BR (1) BRPI0416683A (en)
CA (1) CA2549249A1 (en)
EA (1) EA200601121A1 (en)
IL (1) IL175736A0 (en)
NO (1) NO20062662L (en)
TW (1) TW200520772A (en)
WO (1) WO2005061712A1 (en)

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009543882A (en) * 2006-07-14 2009-12-10 ジェネンテック・インコーポレーテッド Refolding of recombinant proteins
WO2009149171A3 (en) * 2008-06-04 2010-03-11 Amgen Inc. Fgf21 mutants and uses thereof
WO2010065439A1 (en) * 2008-12-05 2010-06-10 Eli Lilly And Company Variants of fibroblast growth factor 21
WO2010084169A3 (en) * 2009-01-23 2011-02-17 Novo Nordisk A/S Fgf21 derivatives with albumin binder a-b-c-d-e- and their use
WO2011089203A1 (en) 2010-01-21 2011-07-28 Sanofi-Aventis Pharmaceutical composition for treating a metabolic syndrome
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8030275B2 (en) 1999-09-07 2011-10-04 Amgen Inc. Methods for treating obesity using fibroblast growth factor-like polypeptides
WO2012059873A2 (en) * 2010-11-05 2012-05-10 Covx Technologies Ireland, Ltd. Anti-diabetic compounds
WO2012066075A1 (en) * 2010-11-19 2012-05-24 Novartis Ag Methods of treating fgf21-associated disorders
US8188040B2 (en) 2009-05-05 2012-05-29 Amgen Inc. FGF21 mutants and uses thereof
US8324160B2 (en) 2009-06-17 2012-12-04 Amgen Inc. Chimeric polypeptides and uses thereof
EP2548570A1 (en) 2011-07-19 2013-01-23 Sanofi Pharmaceutical composition for treating a metabolic syndrome
US8372952B2 (en) 2009-12-02 2013-02-12 Amgen Inc. Binding proteins that bind to human FGFR1C, human β-klotho and both human FGFR1C and human β-klotho
WO2013052311A1 (en) 2011-10-04 2013-04-11 Eli Lilly And Company Fibroblast growth factor 21 variants
WO2013093720A2 (en) 2011-12-22 2013-06-27 Pfizer Inc. Anti-diabetic compounds
US8557769B2 (en) 2007-08-03 2013-10-15 Eli Lilly And Company Co-administration of FGF-21 and GLP-1 to treat diabetes and lower blood glucose
WO2013188182A1 (en) 2012-06-11 2013-12-19 Eli Lilly And Company Fibroblast growth factor 21 variants
US8741841B2 (en) 2012-06-11 2014-06-03 Eli Lilly And Company Fibroblast growth factor 21 proteins
US8906648B2 (en) 2005-12-22 2014-12-09 Genentech, Inc. Recombinant production of vascular endothelial growth factor
US9279013B2 (en) 2008-10-10 2016-03-08 Amgen Inc. FGF-21 mutants comprising polyethylene glycol and uses thereof
US9284378B2 (en) 2009-12-07 2016-03-15 Shaw-Fen Sylvia Hu Human antigen binding proteins that bind β-Klotho, FGF receptors and complexes thereof
WO2016065326A2 (en) 2014-10-24 2016-04-28 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US9458214B2 (en) 2011-09-26 2016-10-04 Novartis Ag Dual function fibroblast growth factor 21 proteins
US9493530B2 (en) 2009-05-05 2016-11-15 Amgen Inc. FGF21 mutants comprising a mutation at position 98, 171 and/or 180
US9517264B2 (en) 2010-04-15 2016-12-13 Amgen Inc. Human FGF receptor and β-Klotho binding proteins
AU2016203765B2 (en) * 2008-10-10 2017-04-13 Amgen Inc. FGF21 mutants and uses thereof
WO2017093465A1 (en) 2015-12-02 2017-06-08 Sanofi Fgf21 variants
US9744213B2 (en) 2014-12-23 2017-08-29 Novo Nordisk A/S FGF21 derivatives and uses thereof
WO2017220706A1 (en) * 2016-06-22 2017-12-28 Novo Nordisk A/S Pharmaceutical compositions of fgf21 derivatives and uses thereof
WO2018166461A1 (en) 2017-03-14 2018-09-20 Sunshine Lake Pharma Co., Ltd. Dual-target fusion proteins comprising the fc portion of an immunoglobulin
WO2019051073A1 (en) 2017-09-08 2019-03-14 Bristol-Myers Squibb Company Modified fibroblast growth factor 21 (fgf-21) for use in methods for treating nonalcoholic steatohepatitis (nash)
WO2020010117A2 (en) 2018-07-03 2020-01-09 Bristol-Myers Squibb Company Fgf21 formulations
WO2021142143A1 (en) 2020-01-08 2021-07-15 Bristol-Myers Squibb Company Fgf-21 conjugate formulations
WO2022032187A1 (en) 2020-08-07 2022-02-10 Bristol-Myers Squibb Company Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis
WO2022115597A1 (en) 2020-11-25 2022-06-02 Bristol-Myers Squibb Company Methods of treating liver diseases
US11752173B2 (en) 2017-12-19 2023-09-12 Beijing Jiyuan Biological Technology Co., Ltd. FGF21 and GLP1 double gene-modified mesenchymal stem cell and use in treating a metabolic disease
US11963999B2 (en) 2014-03-11 2024-04-23 Novartis Ag Methods of treating HIV-HAART induced partial lipodystrophy with FGF21 protein variant FC fusion proteins
RU2822001C1 (en) * 2020-04-29 2024-06-28 Уанджин Байотекнолоджи Инк. Novel protein conjugate and use thereof for preventing or treating non-alcoholic steatohepatitis, obesity and diabetes

Families Citing this family (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
EP1774017B1 (en) 2004-07-26 2013-05-15 Pfenex Inc. Process for improved protein expression by strain engineering
EP1789442B1 (en) * 2004-09-02 2009-09-30 Eli Lilly And Company Muteins of fibroblast growth factor 21
WO2006028714A1 (en) * 2004-09-02 2006-03-16 Eli Lilly And Company Muteins of fibroblast growth factor 21
WO2006065582A2 (en) * 2004-12-14 2006-06-22 Eli Lilly And Company Muteins of fibroblast growth factor 21
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9394571B2 (en) 2007-04-27 2016-07-19 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US20110015345A1 (en) * 2008-03-19 2011-01-20 Ambrx, Inc. Modified FGF-23 Polypeptides and Their Uses
WO2010142665A1 (en) * 2009-06-11 2010-12-16 Novo Nordisk A/S Glp-1 and fgf21 combinations for treatment of diabetes type 2
EP2558115B1 (en) 2010-04-16 2019-07-31 The Salk Institute for Biological Studies Methods for treating metabolic disorders using fgf
WO2012010553A1 (en) * 2010-07-20 2012-01-26 Novo Nordisk A/S N-terminal modified fgf21 compounds
WO2012121428A1 (en) * 2011-03-07 2012-09-13 주식회사 웰스킨 Fibroblast growth composition comprising a dipeptide as an active ingredient, and a product comprising the composition
DK2726511T3 (en) 2011-07-01 2019-09-23 Ngm Biopharmaceuticals Inc COMPOSITIONS, APPLICATIONS AND PROCEDURES FOR TREATING TREATMENT DISEASES AND DISORDERS
TWI593708B (en) * 2011-09-26 2017-08-01 諾華公司 Fusion proteins for treating metabolic disorders
US9475856B2 (en) 2012-03-02 2016-10-25 New York University Chimeric FGF21 proteins with enhanced binding affinity for β-klotho for the treatment of type II diabetes, obesity, and related metabolic disorders
US9464126B2 (en) * 2012-06-07 2016-10-11 New York University Chimeric fibroblast growth factor 21 proteins and methods of use
US9657075B2 (en) 2012-06-07 2017-05-23 New York University Chimeric fibroblast growth factor 23 proteins and methods of use
US9474785B2 (en) 2012-06-07 2016-10-25 New York University Chimeric fibroblast growth factor 19 proteins and methods of use
US9963494B2 (en) 2012-11-28 2018-05-08 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject
US9290557B2 (en) 2012-11-28 2016-03-22 Ngm Biopharmaceuticals, Inc. Compositions comprising variants and fusions of FGF19 polypeptides
US9273107B2 (en) 2012-12-27 2016-03-01 Ngm Biopharmaceuticals, Inc. Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
CN105008548B (en) 2012-12-27 2020-11-27 恩格姆生物制药公司 Methods for modulating bile acid homeostasis and treating bile acid disorders and diseases
WO2014130659A1 (en) 2013-02-22 2014-08-28 New York University Chimeric fibroblast growth factor 23 proteins and methods of use
WO2015057908A1 (en) 2013-10-18 2015-04-23 Novartis Ag Methods of treating diabetes and related disorders
WO2015061331A1 (en) 2013-10-21 2015-04-30 Salk Institute For Biological Studies Chimeric fibroblast growth factor (fgf) 2/fgf1 peptides and methods of use
EP3060238A4 (en) 2013-10-21 2017-06-07 Salk Institute for Biological Studies Mutated fibroblast growth factor (fgf) 1 and methods of use
KR102178945B1 (en) 2013-10-28 2020-11-13 엔지엠 바이오파마슈티컬스, 아이엔씨. Cancer models and associated methods
WO2015103782A1 (en) * 2014-01-13 2015-07-16 Wenzhou Medical College Biological Pharmaceuticals And Nature Products Ltd., Co Fgf21 mutant and conjugate thereof
SG10201806108TA (en) 2014-01-24 2018-08-30 Ngm Biopharmaceuticals Inc Binding proteins and methods of use thereof
US10398758B2 (en) 2014-05-28 2019-09-03 Ngm Biopharmaceuticals, Inc. Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions
CA2951153A1 (en) 2014-06-16 2015-12-23 Ngm Biopharmaceuticals, Inc. Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
CN104311656B (en) * 2014-10-14 2017-04-05 哈尔滨博翱生物医药技术开发有限公司 21 albumen of cFGF and its application in treatment rheumatoid arthritis
IL251834B2 (en) 2014-10-23 2023-09-01 Ngm Biopharmaceuticals Inc Pharmaceutical compositions comprising peptide variants and methods of use thereof
US10434144B2 (en) 2014-11-07 2019-10-08 Ngm Biopharmaceuticals, Inc. Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders
US10800843B2 (en) 2015-07-29 2020-10-13 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins
WO2017075260A1 (en) 2015-10-30 2017-05-04 Salk Institute For Biological Studies Treatment of steroid-induced hyperglycemia with fibroblast growth factor (fgf) 1 analogs
US10744185B2 (en) 2015-11-09 2020-08-18 Ngm Biopharmaceuticals, Inc. Methods of using variants of FGF19 polypeptides for the treatment of pruritus
US11370841B2 (en) 2016-08-26 2022-06-28 Ngm Biopharmaceuticals, Inc. Methods of treating fibroblast growth factor 19-mediated cancers and tumors
CN111148755A (en) * 2017-05-05 2020-05-12 特里福伊尔治疗公司 Recombinant modified fibroblast growth factor and therapeutic uses thereof
JP7475276B2 (en) 2018-02-08 2024-04-26 サンシャイン・レイク・ファーマ・カンパニー・リミテッド FGF21 variants, fusion proteins and their applications
CN110791517A (en) * 2018-08-01 2020-02-14 中国农业大学 Preparation, purification and crystallization of fibroblast growth factor 21
CN109836486B (en) * 2019-01-30 2020-09-08 北京双因生物科技有限公司 Fibroblast growth factor 21 variants, fusion proteins thereof, and uses thereof
CN114853908B (en) 2019-05-16 2024-06-07 浙江道尔生物科技有限公司 Fusion protein for treating metabolic diseases
US11542309B2 (en) 2019-07-31 2023-01-03 Salk Institute For Biological Studies Fibroblast growth factor 1 (FGF1) mutant proteins that selectively activate FGFR1B to reduce blood glucose
CN113728013B (en) 2020-01-11 2022-06-14 北京质肽生物医药科技有限公司 Conjugates of fusion proteins of GLP-1 and FGF21
CN115515641A (en) * 2020-04-29 2022-12-23 株式会社原真生物技术 Novel protein conjugate and use thereof for preventing or treating nonalcoholic steatohepatitis, obesity and diabetes
CN113633756A (en) * 2021-06-17 2021-11-12 温州医科大学 FGF21 temperature-sensitive slow-release carrier, gene modification method and preparation method thereof
CN118063586A (en) * 2024-04-03 2024-05-24 独步吾奇生物医疗科技(江苏)有限公司 Preparation method of human basic fibroblast growth factor

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001036640A2 (en) * 1999-11-18 2001-05-25 Chiron Corporation Human fgf-21 gene and gene expression products
WO2003011213A2 (en) * 2001-07-30 2003-02-13 Eli Lilly And Company Method for treating diabetes and obesity
WO2003059270A2 (en) * 2002-01-15 2003-07-24 Eli Lilly And Company Method for reducing morbidity and mortality in critically ill patients

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7408047B1 (en) * 1999-09-07 2008-08-05 Amgen Inc. Fibroblast growth factor-like polypeptides
US7459540B1 (en) 1999-09-07 2008-12-02 Amgen Inc. Fibroblast growth factor-like polypeptides
AU7368100A (en) 1999-09-10 2001-04-10 Curagen Corporation Fibroblast growth factor polypeptide and nucleic acids encoding same
WO2001032678A1 (en) 1999-11-05 2001-05-10 Smithkline Beecham Corporation sbgFGF-19a
US6716626B1 (en) * 1999-11-18 2004-04-06 Chiron Corporation Human FGF-21 nucleic acids
AU2631001A (en) 2000-01-05 2001-07-16 Zymogenetics Inc. Novel fgf homolog zfgf11
AU5056501A (en) 2000-03-31 2001-10-08 Nobuyuki Itoh Fibroblast growth factor-like molecules and uses thereof
CA2409342A1 (en) 2000-06-06 2001-12-13 Incyte Genomics, Inc. Extracellular messengers
US20050048507A1 (en) * 2001-01-11 2005-03-03 Mei Zhong Therapeutic polypeptides, nucleic acids encoding same, and methods of use
US7495540B2 (en) * 2004-09-13 2009-02-24 Cooper Technologies Company Fusible switching disconnect modules and devices

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001036640A2 (en) * 1999-11-18 2001-05-25 Chiron Corporation Human fgf-21 gene and gene expression products
WO2003011213A2 (en) * 2001-07-30 2003-02-13 Eli Lilly And Company Method for treating diabetes and obesity
WO2003059270A2 (en) * 2002-01-15 2003-07-24 Eli Lilly And Company Method for reducing morbidity and mortality in critically ill patients

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
JOHNSON ET AL., J. MOL. BIOL., vol. 268, 1997, pages 198 - 208
LAM ET AL., PHARM. RES., vol. 14, no. 6, 1997, pages 725 - 729
MAA ET AL., INT. J. OFPHARMACEUTICS, vol. 140, 1996, pages 155 - 168
MATSUMURA ET AL., PNAS, vol. 86, 1989, pages 6562 - 6566
VAN DEN BERGHE ET AL., N ENGL J MED., vol. 345, no. 19, 2001, pages 1359
WANG, W., INT. J. OFPHARMACEUTICS, vol. 18, 1999

Cited By (108)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8030275B2 (en) 1999-09-07 2011-10-04 Amgen Inc. Methods for treating obesity using fibroblast growth factor-like polypeptides
US8053408B2 (en) 1999-09-07 2011-11-08 Amgen Inc. Methods for treating obesity using fibroblast growth factor-like polypeptides
US8906648B2 (en) 2005-12-22 2014-12-09 Genentech, Inc. Recombinant production of vascular endothelial growth factor
US9994612B2 (en) 2006-07-14 2018-06-12 Genentech, Inc. Refolding of recombinant proteins
JP2009543882A (en) * 2006-07-14 2009-12-10 ジェネンテック・インコーポレーテッド Refolding of recombinant proteins
US9200030B2 (en) 2006-07-14 2015-12-01 Genentech, Inc. Refolding of recombinant proteins
JP2013121362A (en) * 2006-07-14 2013-06-20 Genentech Inc Refolding of recombinant protein
KR101808787B1 (en) * 2007-03-30 2017-12-13 암브룩스, 인코포레이티드 Modified fgf-21 polypeptides and their uses
US10961291B2 (en) 2007-03-30 2021-03-30 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US9517273B2 (en) 2007-03-30 2016-12-13 Ambrx, Inc. Methods of treatment using modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10377805B2 (en) 2007-03-30 2019-08-13 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses
US8383365B2 (en) 2007-03-30 2013-02-26 Ambrx, Inc. Methods of making FGF-21 mutants comprising non-naturally encoded phenylalanine derivatives
US9079971B2 (en) 2007-03-30 2015-07-14 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally occurring amino acids
JP2015057404A (en) * 2007-03-30 2015-03-26 アンブルックス, インコーポレイテッドAmbrx, Inc. Modified fgf-21 polypeptides
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US11993637B2 (en) 2007-03-30 2024-05-28 Ambrx, Inc. Modified FGF-21 polypeptides with non-naturally encoded amino acids
US8557769B2 (en) 2007-08-03 2013-10-15 Eli Lilly And Company Co-administration of FGF-21 and GLP-1 to treat diabetes and lower blood glucose
KR101787300B1 (en) 2008-06-04 2017-10-18 암젠 인크 Fgf21 mutants and uses thereof
WO2009149171A3 (en) * 2008-06-04 2010-03-11 Amgen Inc. Fgf21 mutants and uses thereof
CN102143758B (en) * 2008-06-04 2015-11-25 安姆根有限公司 Fgf21 mutant and uses thereof
KR20110025810A (en) * 2008-06-04 2011-03-11 암젠 인크 Fgf21 mutants and uses thereof
TWI403519B (en) * 2008-06-04 2013-08-01 Amgen Inc Fgf21 mutants and uses thereof
EA024751B1 (en) * 2008-06-04 2016-10-31 Амген Инк. Fgf21 mutants and use thereof
US11072640B2 (en) 2008-06-04 2021-07-27 Amgen Inc. Methods of treating non-alcoholic steatohepatitis using FGF21 mutants
US10011642B2 (en) 2008-06-04 2018-07-03 Amgen Inc. Methods of treating of diabetes and obesity using FGF21 mutants
KR101651697B1 (en) 2008-06-04 2016-08-29 암젠 인크 Fgf21 mutants and uses thereof
US8361963B2 (en) 2008-06-04 2013-01-29 Amgen Inc. Uses of FGF21 polypeptides comprising two or more mutations
US8410051B2 (en) 2008-06-04 2013-04-02 Amgen Inc. FGF21 mutants and uses thereof
US9273106B2 (en) 2008-06-04 2016-03-01 Amgen Inc. FGF mutants with reduced proteolysis and aggregation
US11840558B2 (en) 2008-06-04 2023-12-12 Amgen Inc. Methods of treating non-alcoholic steatohepatitis using FGF21 mutants
US8034770B2 (en) 2008-06-04 2011-10-11 Amgen Inc. FGF21 polypeptides comprising two or more mutations
EA017690B1 (en) * 2008-06-04 2013-02-28 Амген Инк. Fgf21 mutants and uses thereof
US8642546B2 (en) 2008-06-04 2014-02-04 Amgen Inc. FGF21 mutant fusion polypeptides and uses thereof
EA024751B8 (en) * 2008-06-04 2020-01-31 Амген Инк. Fgf21 mutants and use thereof
AU2016203765B2 (en) * 2008-10-10 2017-04-13 Amgen Inc. FGF21 mutants and uses thereof
US9279013B2 (en) 2008-10-10 2016-03-08 Amgen Inc. FGF-21 mutants comprising polyethylene glycol and uses thereof
EP2358749B1 (en) * 2008-10-10 2018-07-18 Amgen, Inc Fgf21 mutants and uses thereof
WO2010065439A1 (en) * 2008-12-05 2010-06-10 Eli Lilly And Company Variants of fibroblast growth factor 21
WO2010084169A3 (en) * 2009-01-23 2011-02-17 Novo Nordisk A/S Fgf21 derivatives with albumin binder a-b-c-d-e- and their use
RU2525393C2 (en) * 2009-01-23 2014-08-10 Ново Нордиск А/С Fgf21 derivatives with albumin binding agent a-b-c-d-e- and their application
US9480753B2 (en) 2009-01-23 2016-11-01 Novo Nordisk A/S FGF21 derivatives with albumin binder A-B-C-D-E- and their use
US8618053B2 (en) 2009-05-05 2013-12-31 Amgen Inc. FGF21 mutants multimers and uses thereof
US8835385B2 (en) 2009-05-05 2014-09-16 Amgen Inc. FGF21 polypeptides comprising two or more mutations and uses thereof
US8795985B2 (en) 2009-05-05 2014-08-05 Amgen Inc. FGF 21 polypeptides comprising two or more mutations and uses thereof
TWI560197B (en) * 2009-05-05 2016-12-01 Amgen Inc Fgf21 mutants and uses thereof
US9493530B2 (en) 2009-05-05 2016-11-15 Amgen Inc. FGF21 mutants comprising a mutation at position 98, 171 and/or 180
US8188040B2 (en) 2009-05-05 2012-05-29 Amgen Inc. FGF21 mutants and uses thereof
KR101860572B1 (en) 2009-05-05 2018-05-24 암젠 인크 Fgf21 mutants and uses thereof
US8324160B2 (en) 2009-06-17 2012-12-04 Amgen Inc. Chimeric polypeptides and uses thereof
US8372952B2 (en) 2009-12-02 2013-02-12 Amgen Inc. Binding proteins that bind to human FGFR1C, human β-klotho and both human FGFR1C and human β-klotho
US10570205B2 (en) 2009-12-07 2020-02-25 Amgen, Inc. Human antigen binding proteins that bind β-Klotho, FGF receptors and complexes thereof
US12116413B2 (en) 2009-12-07 2024-10-15 Amgen Inc. Human antigen binding proteins that bind β-klotho, FGF receptors and complexes thereof
US9284378B2 (en) 2009-12-07 2016-03-15 Shaw-Fen Sylvia Hu Human antigen binding proteins that bind β-Klotho, FGF receptors and complexes thereof
US9493577B2 (en) 2009-12-07 2016-11-15 Amgen Inc. Human antigen binding proteins that bind β-klotho, FGF receptors and complexes thereof
EP3607964A1 (en) 2010-01-21 2020-02-12 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP3357503A1 (en) 2010-01-21 2018-08-08 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP2460527A1 (en) 2010-01-21 2012-06-06 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP2359843A1 (en) 2010-01-21 2011-08-24 Sanofi Pharmaceutical composition for treating a metabolic syndrome
US20130203651A1 (en) * 2010-01-21 2013-08-08 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP2754449A1 (en) 2010-01-21 2014-07-16 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP3216459A1 (en) 2010-01-21 2017-09-13 Sanofi Pharmaceutical composition for treating a metabolic syndrome
WO2011089203A1 (en) 2010-01-21 2011-07-28 Sanofi-Aventis Pharmaceutical composition for treating a metabolic syndrome
US9517264B2 (en) 2010-04-15 2016-12-13 Amgen Inc. Human FGF receptor and β-Klotho binding proteins
WO2012059873A2 (en) * 2010-11-05 2012-05-10 Covx Technologies Ireland, Ltd. Anti-diabetic compounds
WO2012059873A3 (en) * 2010-11-05 2012-06-28 Covx Technologies Ireland, Ltd. Anti-diabetic compounds
CN105837680A (en) * 2010-11-19 2016-08-10 诺华股份有限公司 Methods of treating FGF21-associated disorders
CN103328502B (en) * 2010-11-19 2016-06-08 诺瓦提斯公司 Methods of treating FGF 21-associated disorders
WO2012066075A1 (en) * 2010-11-19 2012-05-24 Novartis Ag Methods of treating fgf21-associated disorders
US9023791B2 (en) 2010-11-19 2015-05-05 Novartis Ag Fibroblast growth factor 21 mutations
EP3067364A3 (en) * 2010-11-19 2016-12-07 Novartis AG Methods of treating fgf21-associated disorders
WO2013010780A1 (en) 2011-07-19 2013-01-24 Sanofi Pharmaceutical composition for treating a metabolic syndrome
EP2548570A1 (en) 2011-07-19 2013-01-23 Sanofi Pharmaceutical composition for treating a metabolic syndrome
US9458214B2 (en) 2011-09-26 2016-10-04 Novartis Ag Dual function fibroblast growth factor 21 proteins
US10669323B2 (en) 2011-09-26 2020-06-02 Novartis Ag Methods of treating metabolic disorders with dual function fibroblast growth factor 21 proteins
US8541369B2 (en) 2011-10-04 2013-09-24 Eli Lilly And Company Fibroblast growth factor 21 variants having improved pharmacological potency and/or improved pharmaceutical stability
WO2013052311A1 (en) 2011-10-04 2013-04-11 Eli Lilly And Company Fibroblast growth factor 21 variants
US8883726B2 (en) 2011-10-04 2014-11-11 Eli Lilly And Company Fibroblast growth factor 21 variants
TWI461435B (en) * 2011-10-04 2014-11-21 Lilly Co Eli Fibroblast growth factor 21 variants
WO2013093720A2 (en) 2011-12-22 2013-06-27 Pfizer Inc. Anti-diabetic compounds
US9422353B2 (en) 2012-06-11 2016-08-23 Eli Lilly And Company Fibroblast growth factor 21 variant, composition , and uses thereof
US8927492B2 (en) 2012-06-11 2015-01-06 Eli Lilly And Company Fibroblast growth factor 21 proteins
WO2013188182A1 (en) 2012-06-11 2013-12-19 Eli Lilly And Company Fibroblast growth factor 21 variants
US8741841B2 (en) 2012-06-11 2014-06-03 Eli Lilly And Company Fibroblast growth factor 21 proteins
US11963999B2 (en) 2014-03-11 2024-04-23 Novartis Ag Methods of treating HIV-HAART induced partial lipodystrophy with FGF21 protein variant FC fusion proteins
US10377806B2 (en) 2014-10-24 2019-08-13 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof
WO2016065326A2 (en) 2014-10-24 2016-04-28 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US9631004B2 (en) 2014-10-24 2017-04-25 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US10189883B2 (en) 2014-10-24 2019-01-29 Bristol-Myers Squibb Company Therapeutic uses of modified FGF-21 polypeptides
EP3412302A1 (en) 2014-10-24 2018-12-12 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US11248031B2 (en) 2014-10-24 2022-02-15 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides
EP3909596A1 (en) 2014-10-24 2021-11-17 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US9895417B2 (en) 2014-12-23 2018-02-20 Novo Nordisk A/S FGF21 derivatives and uses thereof
US10124039B2 (en) 2014-12-23 2018-11-13 Novo Nordisk A/S FGF21 derivatives and uses thereof
US9744213B2 (en) 2014-12-23 2017-08-29 Novo Nordisk A/S FGF21 derivatives and uses thereof
WO2017093465A1 (en) 2015-12-02 2017-06-08 Sanofi Fgf21 variants
EP3693382A1 (en) 2015-12-02 2020-08-12 Sanofi Fgf21 variants
WO2017220706A1 (en) * 2016-06-22 2017-12-28 Novo Nordisk A/S Pharmaceutical compositions of fgf21 derivatives and uses thereof
WO2018166461A1 (en) 2017-03-14 2018-09-20 Sunshine Lake Pharma Co., Ltd. Dual-target fusion proteins comprising the fc portion of an immunoglobulin
US11642395B2 (en) 2017-09-08 2023-05-09 Bristol-Myers Squibb Company Modified fibroblast growth factor 21 (FGF-21) for use in methods for treating nonalcoholic steatohepatitis (NASH)
WO2019051073A1 (en) 2017-09-08 2019-03-14 Bristol-Myers Squibb Company Modified fibroblast growth factor 21 (fgf-21) for use in methods for treating nonalcoholic steatohepatitis (nash)
US11752173B2 (en) 2017-12-19 2023-09-12 Beijing Jiyuan Biological Technology Co., Ltd. FGF21 and GLP1 double gene-modified mesenchymal stem cell and use in treating a metabolic disease
WO2020010117A2 (en) 2018-07-03 2020-01-09 Bristol-Myers Squibb Company Fgf21 formulations
WO2021142143A1 (en) 2020-01-08 2021-07-15 Bristol-Myers Squibb Company Fgf-21 conjugate formulations
RU2822001C1 (en) * 2020-04-29 2024-06-28 Уанджин Байотекнолоджи Инк. Novel protein conjugate and use thereof for preventing or treating non-alcoholic steatohepatitis, obesity and diabetes
WO2022032187A1 (en) 2020-08-07 2022-02-10 Bristol-Myers Squibb Company Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis
WO2022115597A1 (en) 2020-11-25 2022-06-02 Bristol-Myers Squibb Company Methods of treating liver diseases

Also Published As

Publication number Publication date
TW200520772A (en) 2005-07-01
IL175736A0 (en) 2008-02-09
CA2549249A1 (en) 2005-07-07
US20070142278A1 (en) 2007-06-21
JP2007535306A (en) 2007-12-06
BRPI0416683A (en) 2007-01-30
AR046877A1 (en) 2005-12-28
US7491697B2 (en) 2009-02-17
JP4477013B2 (en) 2010-06-09
KR20060135648A (en) 2006-12-29
CN1890371A (en) 2007-01-03
US20090118190A1 (en) 2009-05-07
EP2270163A1 (en) 2011-01-05
NO20062662L (en) 2006-08-07
EP1702067A1 (en) 2006-09-20
EA200601121A1 (en) 2006-10-27
AU2004303783A1 (en) 2005-07-07

Similar Documents

Publication Publication Date Title
US7491697B2 (en) Muteins of fibroblast growth factor 21
EP1789442B1 (en) Muteins of fibroblast growth factor 21
US7622445B2 (en) Muteins of fibroblast growth factor 21
US7655627B2 (en) Muteins of fibroblast growth factor 21
US20090111742A1 (en) Use of fgf-21 and thiazolidinedione for treating type 2 diabetes
US7576190B2 (en) FGF-21 fusion proteins
EP2468858B1 (en) Fusion protein regulating plasma glucose and lipid, its preparation method and use
US20070265200A1 (en) Glycol Linked Fgf-21 Compounds
US20120238496A1 (en) Fusion protein regulating plasma glucose and lipid, its preparation method and use
MXPA06006616A (en) Muteins of fibroblast growth factor 21

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480035794.X

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004303783

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2007142278

Country of ref document: US

Ref document number: 10579510

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2004303783

Country of ref document: AU

Date of ref document: 20041201

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 175736

Country of ref document: IL

WWP Wipo information: published in national office

Ref document number: 2004303783

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2006543822

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: PA/a/2006/006616

Country of ref document: MX

Ref document number: 1020067011358

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2549249

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004810531

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200601121

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 1999/KOLNP/2006

Country of ref document: IN

WWP Wipo information: published in national office

Ref document number: 2004810531

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020067011358

Country of ref document: KR

ENP Entry into the national phase

Ref document number: PI0416683

Country of ref document: BR

WWP Wipo information: published in national office

Ref document number: 10579510

Country of ref document: US