CN118063586A

CN118063586A - Preparation method of human basic fibroblast growth factor

Info

Publication number: CN118063586A
Application number: CN202410401413.4A
Authority: CN
Inventors: 董群; 戴斌
Original assignee: Dubu Wuqi Biomedical Technology Jiangsu Co ltd
Current assignee: Dubu Wuqi Biomedical Technology Jiangsu Co ltd
Priority date: 2024-04-03
Filing date: 2024-04-03
Publication date: 2024-05-24

Abstract

The invention discloses a preparation method of human basic fibroblast growth factor, which comprises the following steps: culturing host cells expressing human basic fibroblast growth factors, inducing the host cells to express the human basic fibroblast growth factors, crushing the cells and collecting precipitates to obtain crude proteins, and purifying the crude proteins to recover the human basic fibroblast growth factors; the purification comprises sequentially performing a first chromatography and a second chromatography, wherein the filler of the first chromatography comprises phenyl sepharose and the like, and the filler of the second chromatography comprises DEAE sepharose and the like. The invention designs a brand new fermentation and purification process aiming at human basic fibroblast growth factor, effectively improves the purity of target protein, reduces the endotoxin content to more than 95%, has the endotoxin content lower than 10EU/mg, and is suitable for large-scale industrial production.

Description

Preparation method of human basic fibroblast growth factor

Technical Field

The invention belongs to the technical field of biology, and relates to a preparation method of human basic fibroblast growth factor.

Background

Basic fibroblast growth factor (basic fibroblast growth factor, bFGF) is a member of the fibroblast growth factor (fibroblast growth factors, FGFs) family, and Abraham obtained the primary structure and cDNA sequence of bFGF in 1986. The human genome has only one copy of the bFGF gene, and is located on chromosome 4q 26-27. The gene is about 40kb in size, and the coding sequence consists of 3 exons separated by two introns. The upstream selective initiation codon CUG initiates isoforms having a translational molecular weight ranging from 18kD to 25 kD. bFGF in the 18kD form is distributed in the cytoplasm, mediates cell migration and integrin α5, α6 and β1 expression. And the 22 kD-25 kD form is positioned in the nucleus to promote the growth of cells. The precursor after bFGF translation consists of 155 amino acid residues, the molecular weight is 18kD, the mature peptide contains 146 amino acid residues, a large number of basic amino acid residues are contained, and the isoelectric point pI is 9.6. The secondary structure of bFGF consists of 12 β -sheets, with 4 cysteine residues, but no intramolecular disulfide bonds. bFGF is an important regulator of cell growth and differentiation, has pro-angiogenic, cell proliferation, cell chemotaxis, cell migration, etc., and plays an important role in cell differentiation and body development.

BFGF can be expressed in prokaryotic expression systems, but the solubility of bFGF in escherichia coli is not high, because bFGF is easily degraded and mostly exists in the form of inclusion bodies, so that the large-scale preparation of bFGF becomes cumbersome and expensive, which limits the wide application of the protein to a certain extent, and in addition, prokaryotic protein expression systems are represented by escherichia coli expression systems, which have disadvantages such as lack of processing mechanism after protein translation, such as disulfide bond formation, protein glycosylation and correct folding, and complicated separation and purification of expression products, the probability of obtaining a protein with biological activity is small, renaturation is required, the cost is high, and the period is long. The endotoxin generated after ultrasonic crushing needs a special process for removal, the purity and activity of the protein can be influenced while the endotoxin is removed, and the purification process has high requirements.

In view of the above, developing an effective method for preparing basic fibroblast growth factor is of great importance to the application of basic fibroblast growth factor.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the invention provides a preparation method of human basic fibroblast growth factor, so as to realize the efficient preparation of the human basic fibroblast growth factor (wild type or recombinant) with high purity, high activity and low endotoxin content.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method for preparing a human basic fibroblast growth factor, the method comprising:

Culturing host cells expressing human basic fibroblast growth factors, inducing the host cells to express the human basic fibroblast growth factors, crushing the cells and collecting precipitates to obtain crude proteins, and purifying the crude proteins to recover the human basic fibroblast growth factors; the purification comprises sequentially performing a first chromatography and a second chromatography, wherein the filler of the first chromatography comprises any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose, and the filler of the second chromatography comprises any one or a combination of at least two of DEAE sepharose, Q sepharose or QAE sepharose.

In the invention, the purification process of human basic fibroblast growth factor is skillfully designed, and the two steps of chromatography such as phenyl sepharose gel filler chromatography and DEAE sepharose gel filler are cooperatively matched, so that the method can realize the remarkable improvement of protein purity, effectively reduce endotoxin content and is suitable for the process amplification from laboratory process to industrial production level; the used chromatographic packing has the advantages of high loading capacity, high flow speed, simple packing, high column efficiency, easy cleaning, disinfection and regeneration, long service life of the packing and suitability for large-scale industrial production.

It will be appreciated that the invention is directed to a cell culture and purification process designed for human basic fibroblast growth factor, and can be applied to the methods of the invention for any wild-type or recombinant human basic fibroblast growth factor, and host cells capable of expressing human basic fibroblast growth factor in the art, such as E.coli, etc., without any particular limitation.

It will be appreciated that Phenyl Sepharose and DEAE Sepharose and the like described in the present invention are known in the art as Sepharose (agarose) type chromatographic fillers, such as Phenyl Sepharose ^TM FF (HS) (Cytiva, 17097303) and DEAE Sepharose ^TM FF (Cytiva, 17070905) and the like, and that the person skilled in the art is able to know and select commercially available types of chromatographic fillers.

Preferably, the purification further comprises a renaturation step.

Preferably, the renaturation comprises performing a third chromatography, the packing of which comprises SP sepharose XL.

In the invention, a renaturation method aiming at human alkaline fibroblast growth factor is further designed, and SP agarose gel XL filler is used for chromatography, so that the formation of protein polymers in the general renaturation process is avoided, the renaturation yield is higher, and meanwhile, the purity (more than 95 percent) of target protein can be further improved, and the endotoxin content (less than 10 EU/mg) is reduced.

Preferably, the first chromatography specifically includes:

any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose is used for assembling the chromatographic column, the chromatographic column is washed by using a first balance buffer solution, the sample is loaded, the mixed protein is washed until the baseline is stable by using a first elution buffer solution and a second elution buffer solution, and then the target protein is eluted by using the first elution buffer solution and the second elution buffer solution.

Preferably, the first equilibration buffer contains Tris, urea (Urea), EDTA, naCl, and ammonium sulfate.

Preferably, the first equilibration buffer contains a final concentration of 40-60 mM Tris, a final concentration of 5-7M urea; the final concentration is 4-6 mM EDTA, 400-600 mM NaCl and 400-600 mM ammonium sulfate.

Preferably, the first elution buffer contains arginine, tris, urea and EDTA.

Preferably, the first elution buffer contains arginine at a final concentration of 170-230 mM, tris at a final concentration of 40-60 mM, EDTA at a final concentration of 3-9 mM, and urea at a final concentration of 5-7M.

Preferably, the second elution buffer contains arginine, tris, urea, EDTA and NaCl.

Preferably, the second elution buffer contains arginine at a final concentration of 170-230 mM, tris at a final concentration of 40-60 mM, EDTA at a final concentration of 3-9 mM, urea at a final concentration of 5-7M, and NaCl at a final concentration of 0.8-1.2M.

Preferably, the washing the hybrid protein comprises mixing 15-25% of the first elution buffer and 75-85% of the second elution buffer by volume percentage of 100%.

Preferably, the elution comprises mixing 65% to 75% by volume of the first elution buffer and 25% to 35% by volume of the second elution buffer.

Preferably, the second chromatography specifically includes:

and (3) assembling the chromatographic column by using any one or a combination of at least two of DEAE agarose gel, Q agarose gel and QAE agarose gel, flushing the chromatographic column by using a second balance buffer, loading, flushing the hybrid protein by using a third elution buffer and a fourth elution buffer to be stable until the baseline is stable, and then mixing and eluting the target protein by using the third elution buffer and the fourth elution buffer.

Preferably, the second equilibration buffer contains Tris and urea.

Preferably, the second equilibration buffer contains a final concentration of 40-60 mM Tris, final concentration of 5-7M urea.

Preferably, the third elution buffer contains Tris and urea.

Preferably, the third elution buffer contains Tris at a final concentration of 40-60 mM and urea at a final concentration of 5-7M.

Preferably, the fourth elution buffer contains Tris, urea and NaCl.

Preferably, the fourth elution buffer contains 40-60 mM Tris, 5-7M urea and 0.8-1.2M NaCl.

Preferably, the washing the hybrid protein comprises mixing 80-90% of the third elution buffer and 10-20% of the fourth elution buffer by volume percentage of 100%.

The elution comprises the step of mixing 60-70% of a third elution buffer and 30-40% of a fourth elution buffer by volume percentage of 100%.

Preferably, the third analysis specifically includes:

And (3) loading the chromatographic column by using SP agarose gel XL, flushing the chromatographic column by using a third balance buffer solution, loading samples, carrying out renaturation flushing by using a renaturation buffer solution, flushing the hybrid protein by using a fifth elution buffer solution and a sixth elution buffer solution until the baseline is stable, and then mixing and eluting the target protein by using the fifth elution buffer solution and the sixth elution buffer solution.

Preferably, the third equilibration buffer contains sodium acetate, arginine and urea.

Preferably, the third equilibration buffer contains a final concentration of 90-110 mM sodium acetate, 90-110 mM arginine and 7-9M urea.

Preferably, the renaturation buffer contains EDTA, sodium acetate, polyethylene glycol, arginine and 2-cyclohexylaminoethanesulfonic acid.

Preferably, the renaturation buffer contains EDTA at a final concentration of 0.5-2 mM, sodium acetate at 20-80 mM, polyethylene glycol 2000 at 3-8 g/L, arginine at 100-200 mM, CHES (2-cyclohexylaminoethanesulfonic acid) at 100-200 mM.

Preferably, the fifth elution buffer contains sodium acetate and arginine.

Preferably, the fifth elution buffer contains sodium acetate and arginine at a final concentration of 20-40 mM.

Preferably, the sixth elution buffer contains sodium acetate, arginine and NaCl.

Preferably, the sixth elution buffer contains sodium acetate at a final concentration of 20-40 mM, arginine at a final concentration of 90-110 mM, and NaCl at a final concentration of 0.8-1.2M.

Preferably, the washing the hybrid protein comprises mixing 80-90% of the fifth elution buffer and 10-20% of the sixth elution buffer by volume percentage of 100%.

Preferably, the eluting comprises mixing 40% to 60% fifth eluting buffer and 40% to 60% sixth eluting buffer by volume percent 100%.

Preferably, the culturing includes strain resuscitating and fermentation culturing.

Preferably, the strain recovery comprises sequentially performing primary seed culture and secondary seed culture.

Preferably, the medium for the secondary seed culture contains tryptone, yeast powder and NaCl.

Preferably, the conditions of the fermentation culture include:

the temperature is 36-38 ℃, the pH value is 6.8-7.2, the DO series rotation speed is maintained to be more than or equal to 30%, when the OD ₆₀₀ is more than 7, the dissolved oxygen rising speed (DO Spike) and the pH rising speed is more than or equal to 0.1 unit/min, feeding is carried out, the 1h flow rate is 95-105 mL/h, then the flow rate is regulated to be 100-200 mL/h, and the ventilation quantity is automatically regulated to maintain the DO of 30-40%.

The invention designs high-density fermentation culture conditions, which is helpful for improving the protein preparation amount.

Preferably, the conditions of the fermentation culture include:

The culture is set at 37 ℃, the stirring speed is 100-300 rpm, the aeration rate is automatically adjusted to about 30L/min, the pH value is adjusted by automatically feeding ammonia water or 2M H ₂SO₄ into the system, and the pH value of the culture system is maintained to about 7.0. The temperature step control is carried out for 0-5h at 37.00+0.05 ℃, the pH value is 7.0+0.05, the tank pressure is 0.05MPa, the ventilation rate is 20-40L/min, the DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30 percent, and the DO is kept constant until the fermentation is finished after the rotation speed reaches 600 rpm. The DO is about 30% before fermentation, when OD ₆₀₀ is above 7 at the moment, DO Spike is increased to be more than or equal to 0.1 unit/min after fermentation for 5 hours, feeding is started, at the moment, the carbon source in the culture medium is basically exhausted, the 1h flow rate is 100mL/h, then the flow rate is regulated to be 100-200 mL/h according to the growth condition of thalli, and the ventilation quantity is automatically regulated to maintain 30-40% dissolved oxygen.

Preferably, the basal medium for fermentation contains 16g/L tryptone, 10g/L yeast powder, 6g/L NaCl, 40g/L glucose 、2g/L KH₂PO₄、4g/L K₂HPO₄、7g/L Na₂HPO₄·12H₂O、1.2g/L(NH₄)₂SO₄、0.2g/L NH₄Cl、1g/L MgSO₄·7H₂O.

Preferably, the feed medium contains 70g/L glucose, 83g/L yeast, 83g/L tryptone and 6.7g/L MgSO ₄·7H₂ O.

Preferably, the medium for the secondary seed culture contains 10 to 20g/L tryptone (more preferably 13 to 17), 5 to 11g/L yeast powder (more preferably 9 to 11) and 3 to 7g/L NaCl (more preferably 4 to 6).

The invention designs a specific secondary seed culture medium, which can obviously improve the production speed of the strain and realize rapid recovery.

Preferably, the inducing agent for induction comprises isopropyl- β -D-thiogalactoside (IPTG).

Preferably, the working concentration of isopropyl-beta-D-thiogalactoside is 1-25 mM, preferably 1-3 mM, more preferably 0.8-1.2 mM, preferably 1mM.

In the invention, the IPTG concentration is set to improve the yield and save the cost.

Preferably, the induction is initiated at a time of 18h of fermentation culture.

Preferably, the temperature of the induction is 36 to 43 ℃, preferably 37 to 42 ℃, further preferably 41.5 to 42.5 ℃, preferably 42 ℃.

In the invention, the specific temperature is controlled during the re-induction, so that the bacterial growth can be maintained for a long time, and the biomass accumulation is facilitated.

Preferably, the induction time is 2 to 5 hours, for example, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, or the like.

Preferably, the collecting the precipitate further comprises a step of extracting inclusion bodies.

Preferably, extracting the inclusion body comprises mixing the collected precipitate with inclusion body dissolution liquid, and collecting supernatant to obtain inclusion body solution.

According to the invention, inclusion bodies are extracted by utilizing inclusion body dissolving liquid containing guanidine hydrochloride, and then the protein expression quantity of the inclusion body dissolving liquid obtained after high-speed centrifugation is about 50% of the total protein quantity, and the purity is greatly improved after simple centrifugation treatment, so that the method is suitable for large-scale production and practical operation.

Preferably, the inclusion body lysate contains Tris, naCl, EDTA and guanidine hydrochloride.

Preferably, the inclusion body lysate contains 50mM Tris, 500mM NaCl, 5mM EDTA and 6M guanidine hydrochloride.

As a preferred technical scheme, the preparation method of the human basic fibroblast growth factor comprises the following steps:

(1) Taking a host cell expressing the human basic fibroblast growth factor to perform primary seed culture and secondary seed culture and fermentation culture, and inducing the host cell to express the human basic fibroblast growth factor by utilizing isopropyl-beta-D-thiogalactoside;

(2) Crushing cells, collecting precipitates, mixing the precipitates with inclusion body dissolution liquid, collecting supernatant to obtain crude protein, performing first chromatography on the crude protein, using any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose to assemble a chromatographic column, flushing the chromatographic column by using a first balance buffer solution, loading, flushing the hybrid protein by using a first elution buffer solution and a second elution buffer solution until the baseline is stable, and then mixing and eluting the target protein by using the first elution buffer solution and the second elution buffer solution; the inclusion body dissolving solution contains Tris, naCl, EDTA and guanidine hydrochloride, the first balance buffer solution contains Tris, urea, EDTA, naCl and ammonium sulfate, the first elution buffer solution contains arginine, tris, urea and EDTA, and the second elution buffer solution contains arginine, tris, urea, EDTA and NaCl;

(3) Performing second chromatography on the product collected in the step (2), using any one or a combination of at least two of DEAE agarose gel, Q agarose gel and QAE agarose gel to assemble a chromatographic column, flushing the chromatographic column by using a second balance buffer, loading the sample, flushing the hybrid protein until the baseline is stable by using a third elution buffer and a fourth elution buffer, and then eluting the target protein by using the third elution buffer and the fourth elution buffer, wherein the second balance buffer contains Tris and urea, the third elution buffer contains Tris and urea, and the fourth elution buffer contains Tris, urea and NaCl;

(4) And (3) carrying out third chromatography on the product collected in the step (3), filling the chromatographic column by using SP agarose gel XL, washing the chromatographic column by using a third balance buffer, loading, carrying out renaturation washing by using a renaturation buffer, mixing and washing the hybrid protein to be stable to a base line by using a fifth elution buffer and a sixth elution buffer, and mixing and eluting the target protein by using the fifth elution buffer and the sixth elution buffer, wherein the third balance buffer contains sodium acetate, arginine and urea, the renaturation buffer contains EDTA, sodium acetate, polyethylene glycol, arginine and 2-cyclohexylamine-based ethane sulfonic acid, the fifth elution buffer contains sodium acetate and arginine, and the sixth elution buffer contains sodium acetate, arginine and NaCl.

Compared with the prior art, the invention has the following beneficial effects:

The invention designs brand new fermentation and purification processes aiming at human basic fibroblast growth factors, comprises the steps of designing high-density fermentation conditions, realizing high-density fermentation, controlling induction conditions, further improving protein yield and saving cost, and designing two-step synergistic purification processes and specific renaturation processes, thereby effectively improving the purity of target protein, reducing endotoxin content, saving production cost and being suitable for process amplification from laboratory processes to industrial production levels; is suitable for large-scale industrial production.

Drawings

FIG. 1 is a graph showing the fermentation growth of cells;

FIG. 2 is a SDS-PAGE gel of the mycoproteins induced at different temperatures;

FIG. 3 is a SDS-PAGE gel of mycoproteins induced by different concentrations of inducer;

FIG. 4 is a schematic diagram of a high density fermentation and purification operation;

FIG. 5 is a SDS-PAGE gel of bacterial proteins of the strain before and after induction;

FIG. 6 is a SDS-PAGE gel of inclusion body lysate and sonicated cells;

FIG. 7 is a diagram of a chromatographic process using Phenyl Sepharose ^TM FF;

FIG. 8 is a SDS-PAGE gel of proteins obtained using Phenyl Sepharose ^TM FF chromatography;

FIG. 9 is a diagram of a chromatography procedure using DEAE Sepharose ^TM FF in example 5;

FIG. 10 is a SDS-PAGE gel of proteins obtained in example 5 using DEAE Sepharose ^TM FF chromatography;

FIG. 11 is a graph showing the results of the purity and endotoxin content of the proteins obtained in the first and second purification steps of example 5;

FIG. 12 is a SDS-PAGE gel of the proteins obtained in comparative example 2 using DEAE Sepharose ^TM FF chromatography;

FIG. 13 is a chart of a chromatography process using SP Sepharose XL;

FIG. 14 is a SDS-PAGE gel of proteins obtained using SP Sepharose XL chromatography;

FIG. 15 is a graph comparing results of different renaturation methods;

FIG. 16 is a SDS-PAGE gel of the final recovered protein;

FIG. 17 is a protein map after lyophilization.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.

The apparatus used in the specific examples of the present invention is shown in table 1.

TABLE 1

In the specific embodiment of the invention, the E.coli BL21 (DE 3) expressing recombinant human basic fibroblast growth factor is taken as an example, and the preparation method of the invention is verified.

The amino acid and nucleic acid sequences of the recombinant human basic fibroblast growth factor (designated CBDbFGF, theoretical isoelectric point 9.69, theoretical molecular weight 19271.99) are shown below:

M G T K K T L R T G T G S A G S A A G S G G V D A A G S I T T L P A L P E D G G S G A F P P G H F K D P K R L Y C K N G G F F L R I H P D G R V D G V R E K S D P H I K L Q L Q A E E R G V V S I K G V C A N R Y L A M K E D G R L L A S K C V T D E C F F F E R L E S N N Y N T Y R S R K Y T S W Y V A L K R T G Q Y K L G S K T G P G Q K A I L F L P M S A K S;

atgggtactaagaaaaccctgcgtactggtaccggtagcgcgggcagtgctgcgggttctggcggtgtcgacgcagccgggagcatcaccacgctgcccgccttgcccgaggatggcggcagcggcgccttcccgcccggccacttcaaggaccccaagcggctgtactgcaaaaacgggggcttcttcctgcgcatccaccccgacggccgagttgacggggtccgggagaagagcgaccctcacatcaagctacaacttcaagcagaagagagaggagttgtgtctatcaaaggagtgtgtgctaaccgttacctggctatgaaggaagatggaagattactggcttctaaatgtgttacggatgagtgtttcttttttgaacgattggaatctaataactacaatacttaccggtcaaggaaatacaccagttggtatgtggcactgaaacgaactgggcagtataaacttggatccaaaacaggacctgggcagaaagctatactttttcttccaatgtctgctaagagctga.

Example 1

Seed bacteria preparation

1. Glycerol species: e.coli BL21 (DE 3) glycerol strain expressed CBDbFGF at-80℃was thawed at 25℃and stored in 15% glycerol to prepare glycerol-deposited strain, which was frozen at-80 ℃.

2. Plate monoclonal: three-step streaking was used to inoculate LB-kanamycin plates and overnight grown monoclonal at 37 ℃.

3. First-stage seed: the plate was inoculated with 10mL of 2YT (kanamycin 50. Mu.g/mL), cultured at 37℃and 200rpm for 13 hours.

4. Secondary seed: the 7% primary seed strain was inoculated with 100mL of 2YT medium (kanamycin 50. Mu.g/mL), cultured at 37℃and 200rpm for 13 hours

(Reagent 1) seed bacteria culture medium formula: 1L of preparation amount is prepared, and 15g of tryptone, 10g of yeast powder and 5g of NaCl are weighed; adding about 800mL of deionized water, and fully stirring for dissolution; dripping 1N KOH, and regulating the pH value to 7.0; adding deionized water to fix the volume of the culture medium to 1L; and (5) preserving at normal temperature after high temperature and high pressure.

Optimization of the formula of the seed bacterium culture medium:

The formula composition and the dosage of the formula 1L of the A-type seed bacteria culture medium are as follows: 15g of tryptone, 10g of yeast powder and 5g of NaCl, and sterilizing by water dissolution.

The formula composition and the dosage of the formula of the seed bacteria culture medium 1L are as follows: 15g of tryptone, 10g of yeast powder and 15g of NaCl, and sterilizing by water dissolution.

The formula composition and the dosage of the C-type seed bacterium culture medium 1L are as follows: 10g of tryptone, 5g of yeast powder and 10g of NaCl, and sterilizing by water dissolution.

The formula composition and the dosage of the formula 1L of the seed bacteria culture medium are as follows: 10g of tryptone, 5g of yeast powder and 5g of NaCl, and sterilizing by water dissolution.

The OD ₆₀₀ values of the secondary seeds at different time points in the 4 seed bacteria media were examined. Note that the data at each time point is obtained from an average of 3 parallel samples, and the results are shown in table 2, with type a seed culture medium promoting faster bacterial growth, whereas type B, C, D seed culture medium is relatively slow, so type a seed culture medium is preferred.

TABLE 2

	0.5h	3h	6h	9h	12h	15h
							A	0.121	0.234	0.538	0.954	1.641	2.193
B	0.119	0.258	0.465	0.845	1.218	1.657
							C	0.130	0.263	0.499	0.876	1.306	1.792
D	0.127	0.229	0.329	0.624	0.847	1.324

Example 2

Fermentation tank preparation

1. Sterilizing a fermentation tank: the total volume is 14L, the liquid loading amount is 8L, 1mL of defoamer and a pH electrode correction are added before sterilization, the electrified polarization pH and DO electrode before preparation are more than or equal to 6h, the calibration pH is 6.86-4.01 (the slope is about 1.0), and the DO zero point is calibrated after power failure.

2. Before preparation, the pH value of the electrified polarization and the DO electrode are more than or equal to 6 hours, the calibration pH value is 6.86-4.01 (the slope is about 1.0), and the DO zero point is calibrated after the power failure.

3. The flow rates of 2M H ₂SO₄ feed bottle-acid pump and ammonia feed bottle-base pump were calibrated.

4. The components of the minimal medium were dissolved in 7.5L of water, pH adjusted to 6.8, fixed to 8L, transferred to a fermenter, and 1mL of an antifoaming agent was added.

5. The electrode, the air filter, the air supply conduit and the tail gas conduit (16 layers of gauze and 4 layers of newspaper are wrapped at the tail end) are installed, the tank cover, the feed supplement port, the air supply conduit and the sampling tube are sealed, the electrode joint and the rotating shaft are waterproof by tinfoil paper, and the tank is extinguished at 121 ℃ for 20 minutes.

After cooling to 25 ℃, the fermentation tank is sequentially supplied with air, condensate water and electricity (a motor, a temperature probe, a pH electrode and a DO electrode), the rotating speed is set to 200rpm, the temperature is kept at 37 ℃, and an acid/alkali feeding bottle is connected and the fermentation tank is exhausted.

At 6.37℃and 200rpm, 5L/min ventilation and a pot pressure of 0.05MPa, the pH was adjusted with acid/base to 6.80+0.05, the saturated DO was calibrated, the slope was < 5, and the smaller the deviation was the smaller.

(Reagent 2) minimal Medium (1L):

Weighing 16g of tryptone, 10g of yeast powder, 6g of NaCl and 40g of glucose 、2g KH₂PO₄、4g K₂HPO₄、7g Na₂HPO₄·12H₂O、1.2g(NH4)₂SO₄、0.2g NH₄Cl、1g MgSO₄·7H₂O,, adding about 800mL of deionized water, and fully stirring for dissolution; dripping 1N KOH, and regulating the pH value to 7.0; adding water ion water to fix the volume of the culture medium to 1L; and (5) preserving at normal temperature after high temperature and high pressure.

(Reagent 3) 1L of feed medium comprises the following components in percentage by weight: 70g glucose, 83g yeast, 83g tryptone, 6.7g MgSO ₄·7H₂ O.

Example 3

The present example designs the induction conditions.

Selection of the Induction temperature

Inoculating the second-level seed bacteria into a fermentation tank according to an inoculation amount of 8%, adding 10mL of kanamycin (the final concentration is 50 mu g/mL) before inoculation, and performing aseptic operation in the whole process; the fermentation tank is cultivated at 37 ℃, the stirring speed is 100-300 rpm, the ventilation rate is about 30L/min, the pH is regulated by automatically feeding ammonia water or 2M H ₂SO₄ into the system, and the pH value of the cultivation system is maintained at about 7.0. The temperature is controlled at 37.00+0.05 ℃ for 0-5 h, the pH value is 7.0+0.05, the tank pressure is 0.05MPa, and the ventilation rate is 20-40L/min. DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30% until the rotation speed reaches 600rpm and then the rotation speed is constant until the fermentation is finished. The DO is about 30% before fermentation, when OD ₆₀₀ is above 7 at the moment, DO Spike is increased to be more than or equal to 0.1 unit/min after fermentation for 5 hours, feeding is started, at the moment, the carbon source in the culture medium is basically exhausted, the 1h flow rate is 100mL/h, then the flow rate is regulated to be 100-200mL/h according to the growth condition of thalli, the ventilation quantity is automatically regulated to maintain 30-40% dissolved oxygen, and the defoamer is added at regular time. The log phase is approximately from 6h to 18h end, during which DO is adjusted to around 40%. After 16h of fermentation, OD ₆₀₀ was above 50. According to the cell fermentation growth curve shown in FIG. 1, after 18 hours, the bacterial growth enters a lag phase, is no longer in a logarithmic growth phase, the bacterial activity is reduced, the number of dead bacteria is increased, and the cell density begins to gradually decrease. Since the cell density has a large influence on the protein expression level, the induction efficiency is required to be the highest when the cell density is maintained at a high level, and the induction time is preferably 4 hours. Meanwhile, the inventors found that the appropriate elevation of the culture temperature is helpful for the increase of the expression level of the target protein while keeping the high density of the cells.

Scheme a: at the 17 th hour of fermentation, the temperature of the fermentation tank needs to be adjusted to be increased to 42 ℃, and the temperature is controlled to be 42.0+/-0.05 ℃. DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30% and is kept at constant rotation speed after the rotation speed reaches 600 rpm. After stabilizing for more than 0.5h, 1mM IPTG is added at 18h to induce protein expression, and after induction for 4h, the bacterial collection is finished. And after 18 hours, the growth speed of thalli entering the induction protein expression period is reduced, and the feeding speed is correspondingly reduced. Samples were taken every hour during the course of fermentation, biomass (OD ₆₀₀, wet weight, residual sugar content) was detected, 10-fold diluted fermentation broth was prepared as an electrophoresis sample and the expression level was detected electrophoretically after the fermentation was completed. The OD ₆₀₀ in the middle and later stages of the logarithm is above 60, the whole fermentation process can be completed within 24 hours, and biomass is accumulated to OD ₆₀₀ at the end of the fermentation process.

Scheme B: the 17 th hour of fermentation is that the temperature of the fermentation tank is not adjusted and kept at 37 ℃ continuously, and the temperature is controlled to be 37.0+/-0.05 ℃. DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30% and is kept at constant rotation speed after the rotation speed reaches 600 rpm. Protein expression was induced by adding 1mM IPTG at 18h, and after induction for 4h, the harvest was completed. And after 18 hours, the growth speed of thalli entering the induction protein expression period is reduced, and the feeding speed is correspondingly reduced. Samples were taken every hour during the course of fermentation, biomass (OD ₆₀₀, wet weight, residual sugar content) was detected, 10-fold diluted fermentation broth was prepared as an electrophoresis sample and the expression level was detected electrophoretically after the fermentation was completed. The OD ₆₀₀ in the middle and later stages of the logarithm is more than 40.

In the schemes A and B, a thallus sample in the tank body is taken once per hour in the whole fermentation process, OD ₆₀₀ is detected, and 24 hours of comparison results are continuously taken, as shown in figure 1, the growth rate of the thallus is found to be reduced for 18 hours, at the moment, the temperature of the fermentation tank is adjusted to be increased to 42 ℃ and is kept at 37 ℃ than the temperature of the tank, so that the thallus growth can be kept for a long time, and the accumulation of biomass is facilitated. The results in FIG. 1 show that the cell density of the in-tank sample after 18 hours of culture was higher than that of the cell density at 37℃at 42 ℃. After induction, whether the induction indicates that the protein expression amount in unit volume at 42 ℃ is greatly improved compared with the protein expression amount in unit volume of thalli at 37 ℃, and the SDS-PAGE gel diagram result analysis proves that the induction protein expression amount at 42 ℃ is obviously improved compared with the expression amount at 37 ℃, as shown in figure 2.

Screening for inducer concentration

At the 17 th hour of fermentation, the temperature of the fermentation tank needs to be adjusted to be increased to 42 ℃, and the temperature is controlled to be 42.0+/-0.05 ℃. DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30% and is kept at constant rotation speed after the rotation speed reaches 600 rpm. After stabilizing for more than 0.5h, 1mM IPTG is added at 18h to induce protein expression, and after induction for 4h, the bacterial collection is finished. After 18h, the induction protein expression phase is entered: we set four different dose points of 0.3mM, 1mM, 3mM, 10mM, 25 mM. By sampling from 15% SDS-PAGE gel, the expression level of the target protein of 0.3mM was slightly lower as shown in FIG. 3, and the differences between the dose spots of 1mM, 3mM, 10mM and 25mM were not obvious according to the result of the gel imager photograph analysis. Comprehensively considering the fact that the IPTG is relatively expensive, the principle of guaranteeing quality, saving cost and improving yield is adopted, and the optimal cost performance parameter is that the concentration of the IPTG is 1 mM.

Example 4

The high density fermentation and purification were carried out in this example, and the operation flow is shown in FIG. 4.

1. Inoculating: inoculating the second-level seed bacteria into an A-type seed bacteria culture medium according to the inoculation amount of 8%, adding 10mL of kanamycin (the final concentration is 50 mug/mL) before inoculation, and performing aseptic operation in the whole process;

2. Fermentation: the culture is set at 37 ℃, the stirring speed is 100-300 rpm, the aeration rate is automatically adjusted to about 30L/min, the pH value is adjusted by automatically feeding ammonia water or 2M H ₂SO₄ into the system, and the pH value of the culture system is maintained to about 7.0. The temperature step control is carried out for 0-5h at 37.00+0.05 ℃, the pH value is 7.0+0.05, the tank pressure is 0.05MPa, the ventilation rate is 20-40L/min, the DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30 percent, and the DO is kept constant until the fermentation is finished after the rotation speed reaches 600 rpm. The DO is about 30% before fermentation, when OD ₆₀₀ is above 7 at the moment, DO Spike is increased to be more than or equal to 0.1 unit/min after fermentation for 5 hours, feeding is started, at the moment, the carbon source in the culture medium is basically exhausted, the 1h flow rate is 100mL/h, then the flow rate is regulated to be 100-200 mL/h according to the growth condition of thalli, the ventilation quantity is automatically regulated to maintain 30-40% dissolved oxygen, and the defoamer is added at regular time. The log phase is approximately from 6h to 18h end, during which DO is adjusted to around 40%. After 16h of fermentation, OD ₆₀₀ was above 50. At the 17 th hour of fermentation, the temperature of the fermentation tank needs to be adjusted to be increased to 42 ℃, and the temperature is controlled to be 42.0+/-0.05 ℃. DO series rotation speed (200-600 rpm) is maintained to be more than or equal to 30% and is kept at constant rotation speed after the rotation speed reaches 600 rpm. After stabilizing for more than 0.5h, 1mM IPTG is added at 18h to induce protein expression, and after induction for 4h, the bacterial collection is finished. And after 18 hours, the growth speed of thalli entering the induction protein expression period is reduced, and the feeding speed is correspondingly reduced. Samples were taken every hour during the course of fermentation, biomass (OD ₆₀₀, wet weight, residual sugar content) was detected, 10-fold diluted fermentation broth was prepared as an electrophoresis sample and the expression level was detected electrophoretically after the fermentation was completed. The OD ₆₀₀ at the middle and later stages of the logarithm is above 60, the whole fermentation process can be completed within 24 hours, biomass is accumulated to OD ₆₀₀ at the end to be above 40, and the wet weight is more than or equal to 100g/L. The tail gas generated by fermentation is discharged after being filtered by a 0.22 mu m membrane, and the whole fermentation process has no environmental pollution problem.

3. And (5) fungus collection in a lower tank: after the fermentation, the fermentation broth was discharged by aseptic operation, and the cells were collected by centrifugation (8000 rpm, 4 ℃ C., 30 min). The cells were washed once with PBS buffer and centrifuged (8000 rpm, 4 ℃ C., 30 min).

(Reagent 4) feed medium 1L:70g glucose, 83g yeast, 83g tryptone, 6.7g MgSO ₄·7H₂ O, trace elements (1000X) 30mL.

(Reagent 5) 500mL sterile feeding bottle contains 200mL 25% -28% ammonia water.

(Reagent 6) dilute sulfuric acid 50mL concentrated sulfuric acid was slowly dissolved in 100mL water, and was prepared to 2M H ₂SO₄ mL by constant volume to 200mL, and contained in a 500mL sterile feeding bottle.

(Reagent 7) kanamycin (50 mg/mL concentration): filtering, sterilizing, sub-packaging into 5mL/15mL centrifuge tubes by aseptic operation, and freezing at-20 ℃.

(Reagent 8) IPTG (1M concentration): 23.8 g of the extract is dissolved in 100mL of water, filtered, sterilized, sub-packaged into 5mL/15mL centrifuge tubes by aseptic operation, and frozen at-20 ℃.

Seed testing

1. Shaking: the secondary seed bacteria were inoculated at 1:1000 into 1000mL Erlenmeyer flasks of 200mL2YT medium and cultured at 37℃for 10 hours at 200 rpm. Then the culture temperature is reduced to 30 ℃ for continuous culture for 10 hours.

2. Sample preparation: sampling the shake flask bacterial liquid to 30 mu L, uniformly mixing the shake flask bacterial liquid with a2 Xsample adding buffer solution (Loading Buffer) in an equal volume, and preparing an electrophoresis sample before induction; the fermentation broth of the fermentation tank before centrifugation was sampled and mixed with the same volume of 2 Xsample buffer to prepare an electrophoresis sample after induction.

3. Electrophoresis: and (3) separating gel by 12%, spotting 5 mu L of gel in each lane, and electrophoresis until the gel is discharged from the front edge of bromophenol blue. And rinsing the gel with deionized water, dyeing with a quick dyeing liquid until the strip is clear, rinsing with deionized water to remove light blue background, and photographing to record an electrophoresis result. As shown in FIG. 5, SDS-PAGE detection shows that the post-induction sample expresses a distinct nascent band at about 19kD compared with the pre-induction sample, and the strain is qualified.

Ultrasonic crushing

Taking a certain amount of fermentation thalli, blowing and suspending the fermentation thalli with a lysis buffer solution according to a ratio of 1:100 (m/v), homogenizing the fermentation thalli for 5min by using a high-pressure homogenizer in an ice water bath, and crushing the thalli by using an ultrasonic crusher in the ice water bath, wherein ultrasonic crushing parameters (5 s work, 5s intermission, 120min and 1000 w) are adopted until the thalli are not sticky any more; after staining and smear, microscopic examination, after substantially no complete cells, the pellet was collected by centrifugation (12000 rpm, 4 ℃,30 min).

After 200mL of the inclusion body-dissolved solution using 6M guanidine hydrochloride was used to dissolve the precipitate, the solution was centrifuged (16℃at 12000rpm for 30 min) to obtain an inclusion body-dissolved solution, which was then filtered through 0.45. Mu.m, followed by 0.22. Mu.m. As shown in FIG. 6, lanes 1 and 2 show the sonicated cells, and lane 3 shows the inclusion body lysate, and it can be seen that the target protein expressed in an amount of about 20% to 30% of the total protein is stably present in the lysis buffer. And then the protein expression amount of the inclusion body dissolving solution obtained by dissolving 6M guanidine hydrochloride after high-speed centrifugation is about 50% of the total protein amount. The purity is greatly improved through simple centrifugal treatment, and the method is suitable for mass production and practical operation.

Lysis buffer: 50mM Tris, 200mM arginine, 5mM EDTA, 1mM PMSF; pH 8.3.

Inclusion body dissolution liquid: 50mM Tris,500mM NaCl,5mM EDTA,6M guanidine hydrochloride, pH 8.3.

Example 5

This example was purified.

Equipment model: the general purpose computer (GE company AKTApilot),A chromatography system, a UNICORN control system.

1. Purification step one

Chromatographic column 1 packing specification: the volume of the column bed is 1L, and the inner diameter of the column is 100mm.

Chromatography medium 1: phenyl Sepharose ^TM FF (HS) (Cytiva, 17097303).

Equilibration buffer 1-final concentration of 50mM Tris, final concentration of 6M Urea (Urea); final concentration 5mM EDTA;500mM NaCl;500mM ammonium sulfate pH 8.3.

Elution buffer A1: 200mM arginine, 50mM Tris, 5mM EDTA, 6M urea; pH 8.3.

Elution buffer B1: 200mM arginine, 50mM Tris, 5mM EDTA, 6M urea, 1.0M NaCl; pH 8.3.

Wash Buffer A1: final concentration of 50mM Tris, final concentration of 1.0M NaCl, final concentration of 8M urea; the pH was 9.0.

Wash buffer B1:50mM sodium acetate buffer, final concentration of 1.0M NaCl, final concentration of 8M urea; pH 4.0.

Washing buffer C1: the final concentration was 0.5M NaOH and the final concentration was 0.5M NaCl.

The first purification process designed in the invention has the advantages of high flow rate and high loading capacity, is tolerant to high salt, can directly load the extract onto the chromatographic column, and greatly shortens the process time by combining the target protein with the purification mode of flowing through the chromatographic column. The elution buffer A1 and the elution buffer B1 jointly carry out linear salt gradient elution, so that the target protein and the endotoxin are primarily separated, and 80% of the endotoxin can be removed. Effectively reduces the endotoxin content of target protein. But some endotoxins are eluted with the protein and cannot be removed. And the separation was monitored by measuring absorbance at 280nm and 490 nm.

The method comprises the following specific steps:

1.1, diluting 500mL of inclusion body solution after ultrasonic disruption of thalli to 2500mL by 2000mL of balance buffer;

1.2 washing the column 3000mL with equilibration buffer 1 for equilibration of the column in a suitable stable buffer system at a flow rate of 100mL/min;

1.3 applying the sample buffer solution to the column (1.2), wherein the flow rate of the sample buffer solution through the column is 100mL/min, and the application amount is 2000mLl + -100 mL.

1.4 The heteroprotein was washed with 80% (volume fraction) elution buffer b1+20% (volume fraction) elution buffer A1 using a flow rate of 20mL/min, 3 column volumes, until the effluent baseline was stationary.

1.5 Starting with a flow rate of 80% (volume fraction) elution buffer B1+20% (volume fraction) elution buffer A1 of 20mL/min, ending with 30% (volume fraction) elution buffer B1+70% (volume fraction) elution buffer A1, linearly flushing 1 column volume, eluting the target protein, starting to collect when the absorbance at 280nm of the ultraviolet peak graph exceeds 50mAU, stopping to collect when the detected peak falls back to the vicinity of the base line, eluting for 15min, and manually collecting the eluent to obtain the target protein, wherein the volume is about 300mL, and the chromatographic process is shown by a red arrow in FIG. 7. The purity of the target protein is more than 70% as shown in figure 8 by SDS-PAGE electrophoresis analysis result; and endotoxin of the collected protein is detected to be less than 200EU/mg by a limulus reagent gel method.

1.6 Post-column maintenance procedure: alternately flushing the chromatographic column 1 with a washing buffer A1 and a washing buffer B1 for 3 times (1.5 column volumes of the washing buffer A1, 1.5 column volumes of the washing buffer B1, 1.5 column volumes of the washing buffer A1, 1.5 column volumes of the washing buffer B1), flushing the affinity chromatographic column with the washing buffer C1 for more than 60min, 1.5 column volumes of the washing buffer C1, and stopping for 30min, and flushing 1.5 column volumes; washing 3 column volumes with water, washing 1.5 column volumes with 20% ethanol solution at a flow rate of 100mL/min, and ensuring stable and reliable column effect by the flow direction of the regeneration solution in the column opposite to the flow direction of the sample during loading and purification;

1.7 finally, 50L of sterile water was used to flush the affinity column and the various passages of the whole system at a low flow rate of 20mL/min, and finally, 20% ethanol was used to fill the affinity column and the whole equipment piping system.

2. Purification step two

Chromatography medium 2: DEAE Sepharose ^TM FF (Cytiva, 17070905).

The adopted weak anion exchange chromatographic column specification: the volume of the column bed is 1.0L, and the inner diameter of the column is 100mm

Equilibration buffer 2-50 mM Tris, 6M urea final concentration; PH8.3.

Elution buffer A2: final concentration of 50mM Tris, final concentration of 6M urea; pH 8.3.

Elution buffer B2: final concentration of 50mM Tris, final concentration of 6M urea and final concentration of 1M NaCl; pH 8.3.

Wash buffer A2: the final concentration was 1.0M NaOH aqueous solution.

Wash buffer B2:50mM sodium acetate buffer, final concentration of 1.0M NaCl, final concentration of 8M urea; pH4.0.

The specific operation is as follows:

2.1 the column was washed with 2000mL of equilibration buffer 2, 100mL/min flow rate to flush the baseline.

2.2 The sample collected in step 1.5 was diluted with equilibration buffer 2,1:3 (V/V), i.e.300 mL of sample from purification step one, thoroughly mixed with equilibration buffer 2, 900mL, during which loading was performed using a flow rate of 100 mL/min.

2.3 Washing impurities with a flow rate of 13% (volume fraction) elution buffer B2+87% (volume fraction) elution buffer A2 of 20mL/min, washing 1 column volume with a flow rate of 32% (volume fraction) elution buffer B2+68% (volume fraction) elution buffer A2, eluting the target protein, starting to collect when the absorbance at 280nm of the ultraviolet peak graph exceeds 50mAU, stopping collecting when the detected peak falls back to the vicinity of the base line, wherein the elution time is 20min, the manually collected eluent is the target protein, the volume is about 400mL, and the chromatographic process is shown in figure 9. As shown in FIG. 10, the purity of the target protein is more than 90% as a result of SDS-PAGE analysis; and endotoxin of the collected protein is detected to be less than 200EU/mg by a limulus reagent gel method.

2.4 Post-column maintenance procedure: using a flow rate of 100mL/min, flushing the chromatographic column with a washing buffer A2 to obtain 2,3 column volumes, washing the chromatographic column with a washing buffer B2 to obtain 3 column volumes), washing the chromatographic column with a washing buffer B2 to obtain 3 column volumes, washing the chromatographic column with 20% ethanol to obtain 1.5 column volumes, and using the flow rate of 100mL/min to obtain a regeneration liquid in the flow direction opposite to the flow direction of a sample during loading and purification so as to ensure stable and reliable column efficiency;

2.4 finally, 50L of sterile water was used to flush the affinity column and the various passages of the whole system at a low flow rate of 20mL/min, and finally, 20% ethanol was used to fill the affinity column and the whole equipment piping system.

The invention designs a second purification process, which is cooperated with the first purification process, and only needs to pass through DEAE Sepharose ^TM FF of the sample, so that the purity can be improved from 70% to 90%, and the endotoxin content of the protein is greatly reduced from more than 200EU/mg to 20EU/mg (figure 11).

Example 6

This example was purified.

Compared to example 5, the only difference is that:

chromatography medium 1: butyl sepharose (Cytiva, 17097803).

Equilibration buffer 1-final concentration of 40mM Tris, final concentration of 7M Urea (Urea); final concentration of 6mM EDTA;400mM NaCl;600mM ammonium sulfate.

Elution buffer A1: 170mM arginine, 40mM Tris, 3mM EDTA, 5M urea;

elution buffer B1: 230mM arginine, 40mM Tris, 9mM EDTA, 5M urea, 0.8M NaCl;

The elution buffer B1+25% (volume fraction) elution buffer A1 was used in step 1.4 at a flow rate of 20mL/min to flush the hetero-protein, 3 column volumes, until the effluent baseline was stationary.

In step 1.5, the elution buffer B1 and the elution buffer A1 are used at a flow rate of 20mL/min of 75% (volume fraction), the elution buffer B1 and 25% (volume fraction) are started, the elution buffer B1 and the elution buffer A1 at a flow rate of 35% (volume fraction) are ended, and 1 column volume is flushed linearly to elute the target protein.

Chromatography medium 2: QAE agarose gel (Cytiva, 17019003)

Equilibration buffer 2-final concentration 40mM Tris, final concentration 7M urea;

elution buffer A2: final concentration of 40mM Tris, final concentration of 5M urea;

Elution buffer B2: final concentration of 60mM Tris, final concentration of 7M urea and final concentration of 1.2M NaCl;

In step 2.3, 20% (volume fraction) elution buffer B2+80% (volume fraction) elution buffer A2 was used to wash impurities at a flow rate of 20mL/min, 40% (volume fraction) elution buffer B2+60% (volume fraction) elution buffer A2 was used to wash 1 column volume, and the protein of interest was eluted.

The chromatography and purification results were similar to those of example 5.

Example 7

This example was purified.

Compared to example 5, the only difference is that:

Chromatography medium 1: n-butane based agarose gel (Cytiva, 17098004).

Equilibration buffer 1-final concentration of 60mM Tris, final concentration of 5M Urea (Urea); final concentration of 4mM EDTA;600mM NaCl;400mM ammonium sulfate.

Elution buffer A1: 230mM arginine, 40mM Tris, 9mM EDTA, 7M urea;

elution buffer B1: 170mM arginine, 60mM Tris, 3mM EDTA, 7M urea, 1.2M NaCl;

The elution buffer B1+15% (volume fraction) elution buffer A1 was used in step 1.4 at a flow rate of 85% (volume fraction) of 20mL/min to flush the heteroprotein, 3 column volumes, until the effluent baseline was stationary.

In step 1.5, the elution buffer B1 with a flow rate of 20mL/min of 85% (volume fraction) is used for starting with the elution buffer B1+15% (volume fraction), the elution buffer B1 with a flow rate of 25% (volume fraction) is used for ending with the elution buffer A1, and 1 column volume is linearly flushed for eluting the target protein.

Chromatography medium 2: q sepharose (Cytiva, 17051004)

Equilibration buffer 2 with a final concentration of 60mM Tris and a final concentration of 5M urea;

elution buffer A2: final concentration of 60mM Tris, final concentration of 7M urea;

elution buffer B2: final concentration of 40mM Tris, final concentration of 5M urea and final concentration of 0.8M NaCl;

In step 2.3, the impurities are washed with 20mL/min of 10% (volume fraction) elution buffer B2+90% (volume fraction) elution buffer A2, and 1 column volume is washed with 30% (volume fraction) elution buffer B2+70% (volume fraction) elution buffer A2, thereby eluting the target protein.

The chromatography and purification results were similar to those of example 5.

Comparative example 1

This comparative example differs from example 5 only in that the purification step two was chromatographed using Sephadex ^TM G-25 instead of DEAE Sepharose ^TM FF.

Purification step one

Reference is made to example 5.

Purification step two

Chromatography medium: sephadex ^TM G-25 (Cytiva, 17508702).

The elution buffer G contained KH ₂PO₄ at a final concentration of 0.27G/L, na ₂HPO₄·12H₂ O at a concentration of 1.42G/L, KCl at a concentration of 0.2G/L and NaCl at a concentration of 8.8G/L, and was adjusted to pH 7.3 with phosphoric acid.

Wash buffer A3: the final concentration was 1.0M NaOH aqueous solution.

1. Pump A eluted 5 column volumes with 200mL/min of elution buffer G, and leveled off its baseline.

2. Pump B was used at a flow rate of 200mL/min, and the sample was 50mL of the target protein sample obtained in the purification step one.

3. And (3) eluting the target protein by using a flow rate of 200mL/min of eluting buffer solution G by a pump A, detecting that the ultraviolet wavelength is higher than 50mAU when the ultraviolet peak is at a peak position according to an ultraviolet peak diagram, stopping collecting when the detected peak falls back to the vicinity of 50mAU, and obtaining the collected eluent as the target protein.

The purity of the target protein is more than 70% through SDS-PAGE electrophoresis analysis results; and endotoxin of the collected protein is detected to be less than 200EU/mg by a limulus reagent gel method.

Comparative example 2

This comparative example differs from example 5 only in that the purification step one uses Sephadex ^TM G-25 instead of Phenyl Sepharose ^TM 6FF.

Purification step one

Chromatography medium: sephadex ^TM G-25 (Cytiva, 17508702).

Wash buffer A3: the final concentration was 1.0M NaOH aqueous solution.

2. Pump B was used at a flow rate of 200mL/min, and the sample (inclusion body solution) loading was 50mL.

Purification step two

Reference example 5

As shown in FIG. 12, lane 1 is a cell ultrasonic lysate; lane 2 shows the purified sample, with a target protein purity of about 75%; and endotoxin of the collected protein is detected to be less than 300EU/mg by a limulus reagent gel method.

As can be seen from the comparison of the data in Table 3, the samples purified by using the chromatographic fillers Phenyl and Sephadex ^TM G-25 and DEAE and Sephadex ^TM G-25 respectively have lower purity and higher endotoxin residues, while the invention is specially designed, and the purification is carried out by adopting the two-step combination of the chromatographic fillers Phenyl and DEAE, so that the endotoxin content is greatly reduced, and the purity of the samples can be improved to more than 90%.

TABLE 3 Table 3

	Purity of sample	Endotoxin content
			DEAE, G-25 two-step purification	75％	Less than 300EU/mg
Two-step purification of Phenyl, G-25	70％	Less than 200EU/mg
			Two-step purification of Phenyl and DEAE	90％	Less than 20EU/mg

Example 8

This example carries out the purification step three (renaturation) on the basis of the two-step purification of example 5.

Cation exchange chromatography medium 3: SP Sepharose XL (Cytiva, 17507304)

The adopted cation exchange chromatographic column has the specification: the volume of the column bed is 1.0L, and the inner diameter of the column is 100mm.

Equilibration buffer 3: final concentration was 100mM sodium acetate buffer, 100mM arginine, 8M urea; the pH was 5.7.

Elution buffer A3: final concentration was 30mM sodium acetate buffer, 100mM arginine; the pH was 5.7.

Elution buffer B3: 30mM sodium acetate buffer, 100mM arginine, 1M NaCl; pH 5.7

Wash buffer A3: the final concentration was 1.0M NaOH aqueous solution.

Wash buffer B3:50mM sodium acetate buffer, final concentration of 1.0M NaCl, final concentration of 8M urea; pH 4.0.

Renaturation buffer system: final concentration 1mM EDTA,50mM sodium acetate buffer, 5g/L polyethylene glycol 2000, 100mM arginine, 150mM CHES (2-cyclohexylaminoethanesulfonic acid); the pH was 5.7.

The specific operation is as follows:

3.1 the column was first washed with equilibration buffer 3 at 3000mL at a flow rate of 100mL/min to flush the baseline.

3.2 The buffer sample collected in example 5, 2.3, was adjusted to pH 5.7 with equilibration buffer 3 to a total volume of approximately 1000mL.

3.3 Loading was performed on the 3.2 step samples using a flow rate of 100 mL/min.

3.4 Washing the column 1000mL with equilibration buffer 3 for equilibration of the column in a proper stable buffer system at a flow rate of 100mL/min;

3.5 using balance buffer 3 and renaturation buffer system to flush the cation exchange chromatography medium column continuously with linear gradient from 0 to 100%, flow rate of 10mL/min,1.5 column volume, and further flushing 1000mL with renaturation buffer system flow rate of 10mL/min, so that the baseline of the column is flushed, and the total renaturation liquid volume is about 2L.

3.6 Washing the hybrid protein with a flow rate of 100mL/min of 15% (volume fraction) elution buffer B3+85% (volume fraction) elution buffer A3 for 15min without collection; washing target protein by using 50% (volume fraction) elution buffer B3 and 50% (volume fraction) elution buffer A3 with the flow rate of 100mL/min, eluting 1000mL, eluting the target protein, detecting the ultraviolet wavelength of 280nm at the time of peak starting to be higher than 50mAU according to an ultraviolet peak diagram, stopping collecting when the detected peak falls back to the vicinity of 50mAU, eluting for 3min, and manually collecting the eluent, wherein the volume of the eluent is about 200mL; the elution buffer B3 was used to flush the hetero-protein at a flow rate of 100mL/min (volume fraction), 3 column volumes, eluting the hetero-protein, without collection, and stopping the elution when the detected peak falls back near the baseline. The whole flow is shown in fig. 13; the purity of the target protein of the obtained sample is 98% as shown in FIG. 14 by SDS-PAGE electrophoresis analysis result; and endotoxin of the collected protein was detected by the limulus reagent gel method to be 5EU/mg.

3.7 The column was rinsed with sterile purified water at a flow rate of 100mL/min, 3000mL to flush the baseline. The washing buffer A3+50% by volume was used and the sterile purified water was rinsed for 60min at a flow rate of 100 mL/min. 5000mL was rinsed with 100% (volume fraction) sterile purified water to flush the baseline.

Washing buffer B3 was used at 100% (volume fraction) and washed at a flow rate of 100mL/min for 60min. 5000mL was rinsed with 100% (volume fraction) sterile purified water to flush the baseline. Finally, the mixture is stored in 20% ethanol solution.

In prokaryotic expression systems, usually inclusion body proteins are often dissolved in 6M guanidine hydrochloride or 8M urea, and denatured proteins need to be renatured to the natural conformation of the proteins to have biological functions. The process selects Sepharose gel filter packing (Phenyl Sepharose ^TM6FF、DEAE Sepharose^TM FF and SP Sepharose XL) with chemical stability to purify and renaturate under the denaturing condition. The process has the advantages that: the method avoids the formation of protein polymers in the general renaturation process, so that the renaturation yield is higher, a large amount of dilution samples are not needed, the renaturation and the purification are combined into a whole, the time is greatly saved, the recovery rate is improved, the method is suitable for industrialization, and the method is very suitable for the process amplification from a laboratory process to an industrial production level; secondly, the used chromatographic packing has the advantages of high loading capacity, high flow rate, simple packing, high column efficiency and easy cleaning, disinfection and regeneration, so the service life of the packing is very long. Therefore, the protein biological molecule obtained by purification by the method has extremely high cost performance and is suitable for large-scale industrial production.

Example 9

This example carries out the purification step three (renaturation) on the basis of the two-step purification of example 5. Compared with example 8, the only difference is that:

Equilibration buffer 3: final concentration 90mM sodium acetate buffer, 110mM arginine, 7M urea;

elution buffer A3: final concentration was 20mM sodium acetate buffer, 90mM arginine;

Elution buffer B3: final concentration 40mM sodium acetate buffer, 110mM arginine, final concentration 1.2M NaCl;

renaturation buffer system: final concentration of 0.5mM EDTA,20mM sodium acetate buffer, 8g/L polyethylene glycol 2000, 200mM arginine, 100mM CHES (2-cyclohexylaminoethanesulfonic acid);

In the step 3.6, eluting the hybrid protein by using an elution buffer B3 with a flow rate of 100mL/min and a volume fraction of 20 percent and an elution buffer A3 with a volume fraction of 80 percent, wherein the elution time is 15min, and collecting is not performed; the target protein was washed with 40% (volume fraction) elution buffer B3+60% (volume fraction) elution buffer A3 at a flow rate of 100mL/min, and 1000mL was eluted, eluting the target protein.

The chromatographic procedure and renaturation result were similar to those of example 8.

Example 10

equilibration buffer 3: final concentration 110mM sodium acetate buffer, 90mM arginine, 9M urea;

Elution buffer A3: final concentration 40mM sodium acetate buffer, 100mM arginine;

Elution buffer B3: final concentration of 20mM sodium acetate buffer, 90mM arginine, final concentration of 0.8M NaCl;

renaturation buffer system: final concentration of 2mM EDTA,80mM sodium acetate buffer, 3g/L polyethylene glycol 2000, 100mM arginine, 200mM CHES (2-cyclohexylaminoethanesulfonic acid);

In the step 3.6, eluting the hybrid protein by using an elution buffer B3 with a flow rate of 100mL/min and a volume fraction of 10 percent and an elution buffer A3 with a volume fraction of 90 percent, wherein the elution time is 15min, and collecting is not performed; the target protein was washed with 60% (volume fraction) elution buffer B3+40% (volume fraction) elution buffer A3 at a flow rate of 100mL/min, and 1000mL was eluted, eluting the target protein.

Example 11

In this example, the dilution renaturation method and the dialysis renaturation method are selected for renaturation.

Generally, the higher the purity of the inclusion body protein sample, the better the renaturation effect. Therefore, the sample collected in step 2.3 of example 5 was selected to have a volume of about 400mL, and if the sample was diluted 20 times again, about 8L of the renaturation solution was required. The production cost of the production link is increased by 4 times; and generally the time for renaturation by dilution method is about 5 days.

The dialysis renaturation method is adopted, and generally, the higher the purity of the inclusion body protein sample is, the better the renaturation effect is. The sample collected in step 2.3 of example 5 was selected using a renatured sample, which had a volume of about 400mL. Placing into dialysis bag, placing into 3600mL renaturation solution, changing the renaturation solution every 24h, and consuming 10.8L renaturation solution for 3 days. The production cost is about 5.5 times that of the Sepharose solid phase adsorption method, and the required time is 3 days.

Analysis was performed according to the experimental data results (solid phase adsorption renaturation method sample in lane 1, dilution renaturation method sample in lane 2, dialysis renaturation method sample in lane 3) of Table 3 and FIG. 15: the sample purity obtained by the Sepharose gel solid phase adsorption method is more than 90%, the required renaturation liquid is 2L, the required renaturation time is 1 day, and the method is far better than that of the sample obtained by the Sepharose gel solid phase adsorption method: the purity of the sample obtained by the dilution renaturation method is 75%, the required renaturation liquid is 8L, and the required renaturation time is 5 days; the purity of the sample obtained by the dialysis renaturation method is 80 percent, the required renaturation liquid is 10.8L, and the required renaturation time is 3 days. And the dilution renaturation method and the dialysis renaturation method also need to be purified by a chromatographic column again, and the process is more complex. Therefore, the Sepharose solid phase adsorption process has high renaturation specificity and two-in-one renaturation and purification aiming at the recombinant human basic fibroblast growth factor, and the renaturation efficiency and purity after purification by adopting the process are obviously improved, and the endotoxin content is reduced. Therefore, the solid-phase adsorption/renaturation method using Sepharose is the most preferable choice.

TABLE 4 Table 4

Example 12

In this example, the target protein was collected and stored frozen.

Instrument: tangential flow system device: CENTRAMATE ^TM (Millbore FS013K05 CLVC)

The sample collected in example 8 at 3.6 was replaced into the preservation buffer solution 4 using a tangential flow system.

Preservation buffer solution 4: KH ₂PO₄ with final concentration of 0.27g/L, na ₂HPO₄·12H₂ O with final concentration of 1.42g/L, KCl with final concentration of 0.2g/L, naCl with final concentration of 8.8g/L, LArg with final concentration of 10g/L, trehalose with final concentration of 10g/L, sucrose with final concentration of 20g/L, cysteine with final concentration of 1g/L, and pH adjusted by phosphoric acid to 7.3.

Wash buffer A4: final concentration was 100mM sodium acetate buffer, final concentration was 1.0M NaCl; pH 5.0.

Wash buffer B4: final concentration of 50mM Tris, final concentration of 1M NaCl, final concentration of 8M urea; the pH was 9.0.

Wash buffer C4: the final concentration was 1.0M NaOH solution.

4.1 Peristaltic pump line A4 was used at a flow rate of 50mL/min, all lines and tangential flow system equipment were purged with wash buffer C4, 2000mL, peristaltic pump line B4 was cycled, peristaltic pump line C4 was flowed.

4.2 Peristaltic pump line A4 was used at a flow rate of 100mL/min, all lines and tangential flow system equipment were purged with injection water, 2000mL, peristaltic pump line B4 was cycled, and peristaltic pump line C4 was flowed.

4.3 Peristaltic pump line A4 was used at a flow rate of 100mL/min, with preservation buffer solution 4, 500mL, all lines were purged and tangential flow system equipment, peristaltic pump line 4B was cycled, peristaltic pump line C4 was flowed.

4.3 Peristaltic pump line A4 circulates 200mL of 3.6 collected sample 200 mL+preservative buffer 4, 200mL, peristaltic pump line 4B, and peristaltic pump line C4 out of 200mL using a flow rate of 100 mL/min. After 8 cycles, the tangential flow system device was emptied to collect the sample. The purity of the target protein of the obtained sample is more than 95% as shown in figure 16 by SDS-PAGE electrophoresis analysis result; and endotoxin of the collected protein is less than 10EU/mg by a limulus reagent gel method.

4.4 Peristaltic pump line A4 was used at a flow rate of 100mL/min, all lines and tangential flow system equipment were purged with injection water, 2000mL, peristaltic pump line B4 was cycled, and peristaltic pump line C4 was flowed.

4.5 Peristaltic pump line A4 was flushed with wash buffer C4, 2000mL using a flow rate of 50mL/min, all lines and tangential flow system equipment, peristaltic pump line B4 was cycled, peristaltic pump line C4 was flowed.

4.6 Peristaltic pump line A4 was used at a flow rate of 100mL/min, all lines and tangential flow system equipment were purged with injection water, 2000mL, peristaltic pump line B4 was cycled, and peristaltic pump line C4 was flowed.

4.7 Peristaltic pump line A4 was purged with 20% ethanol solution, 800mL, using a flow rate of 100mL/min, all lines and tangential flow system equipment, peristaltic pump line B4 was cycled, peristaltic pump line C4 was flowed.

Freeze-drying preservation

5.1 Purifying the target protein obtained in step 4.3, detecting the concentration by lowrry method, and adjusting the protein concentration to 1mg/mL appropriately.

5.2 Split charging protein into 3mL penicillin bottles, pre-freezing at-80 ℃.

5.3 Freeze dryer laminate Pre-frozen for 5h at-40 DEG C

5.4 Freeze dryer Programming

Program 1: setting the temperature of the laminate to minus 40 ℃;

Program 2: the temperature of the laminate is-40 ℃, and a freeze-drying tray is placed on the laminate for 30min

Program 3: setting the temperature of the laminate at-40 ℃, setting the safety pressure at 0.220mbar, setting the vacuum degree at 0.100mbar, and setting the time at 10min;

program 4: slowly heating the laminate to-25deg.C, safety pressure of 0.220mbar, vacuum degree of 0.100mbar, and time of 5 hr;

program 5: the stable temperature of the laminate is-25 ℃, the safety pressure is 0.220mbar, the vacuum degree is 0.100mbar, and the time is 5 hours;

program 6: slowly heating the laminate to-20deg.C, safety pressure of 0.220mbar, vacuum degree of 0.100mbar, and time of 5 hr;

Program 7: the stable temperature of the laminate is-20 ℃, the safety pressure is 0.220mbar, the vacuum degree is 0.100mbar, and the time is 5 hours;

program 8: the stable temperature of the laminate is 0 ℃, the safety pressure is 0.220mbar, the vacuum degree is 0.100mbar, and the time is 10 hours;

Program 9: the stable temperature of the laminate is 0 ℃, the safety pressure is 0.220mbar, the vacuum degree is 0.010mbar, and the rubber plug is pressed.

5.5 Capping machine, stored at 4℃after capping, as shown in FIG. 17.

In summary, the invention designs a brand new fermentation and purification process aiming at human alkaline fibroblast growth factor, comprising the steps of designing high-density fermentation conditions, realizing high-density fermentation, controlling induction conditions, further improving protein yield and saving cost, and designing a two-step synergistic purification process and a specific renaturation process, thereby effectively improving the purity of target protein, reducing endotoxin content, wherein the purity can reach more than 95%, the endotoxin content is lower than 10EU/mg, saving production cost, and being suitable for process amplification from laboratory process to industrial production level; is suitable for large-scale industrial production.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims

1. A method for preparing human basic fibroblast growth factor, comprising:

Culturing host cells expressing human basic fibroblast growth factors, inducing the host cells to express the human basic fibroblast growth factors, crushing the cells and collecting precipitates to obtain crude proteins, and purifying the crude proteins to recover the human basic fibroblast growth factors;

the purification comprises sequentially performing a first chromatography and a second chromatography, wherein the filler of the first chromatography comprises any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose, and the filler of the second chromatography comprises any one or a combination of at least two of DEAE sepharose, Q sepharose or QAE sepharose.

2. The method of claim 1, wherein the purifying further comprises a renaturation step;

3. The method for preparing human basic fibroblast growth factor according to claim 1, wherein the first chromatography specifically comprises:

Any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose is used for assembling a chromatographic column, the chromatographic column is washed by a first balance buffer solution, the sample is loaded, the mixed protein is washed until the baseline is stable by mixing a first elution buffer solution and a second elution buffer solution, and then the target protein is eluted by mixing the first elution buffer solution and the second elution buffer solution;

preferably, the first equilibration buffer contains tris, urea, EDTA, naCl, and ammonium sulfate;

preferably, the first elution buffer contains arginine, tris, urea and EDTA;

preferably, the second elution buffer contains arginine, tris, urea, EDTA and NaCl;

Preferably, the washing of the hybrid protein comprises the use of 15-25% of a first elution buffer and 75-85% of a second elution buffer mixed according to the volume percentage of 100%;

4. The method for preparing human basic fibroblast growth factor according to claim 1, wherein the second chromatography specifically comprises:

Using any one or a combination of at least two of DEAE sepharose, Q sepharose or QAE sepharose to assemble a chromatographic column, flushing the chromatographic column by using a second balance buffer solution, loading, flushing the hybrid protein by using a third elution buffer solution and a fourth elution buffer solution to be stable to a base line, and then mixing and eluting the target protein by using the third elution buffer solution and the fourth elution buffer solution;

preferably, the second equilibration buffer contains tris and urea;

Preferably, the third elution buffer contains tris and urea;

preferably, the fourth elution buffer contains tris, urea and NaCl;

preferably, the flushing of the hybrid protein comprises mixing 80-90% of a third elution buffer and 10-20% of a fourth elution buffer by volume percentage of 100%;

Preferably, the elution comprises mixing 60% to 70% by volume of the third elution buffer with 30% to 40% by volume of the fourth elution buffer.

5. The method of producing human basic fibroblast growth factor according to claim 2, wherein said third chromatography specifically comprises:

Loading the SP agarose gel XL into a chromatographic column, flushing the chromatographic column by using a third balance buffer solution, loading a sample, performing renaturation flushing by using a renaturation buffer solution, mixing and flushing the impurity protein by using a fifth elution buffer solution and a sixth elution buffer solution until the baseline is stable, and mixing and eluting the target protein by using the fifth elution buffer solution and the sixth elution buffer solution;

preferably, the third equilibration buffer contains sodium acetate, arginine and urea;

preferably, the renaturation buffer contains EDTA, sodium acetate, polyethylene glycol, arginine and 2-cyclohexylaminoethanesulfonic acid;

Preferably, the fifth elution buffer contains sodium acetate and arginine;

preferably, the sixth elution buffer contains sodium acetate, arginine and NaCl;

Preferably, the washing of the hybrid protein comprises the steps of mixing 80-90% of a fifth elution buffer and 10-20% of a sixth elution buffer according to the volume percentage of 100%;

6. The method for preparing human basic fibroblast growth factor according to claim 1, wherein said culturing comprises strain resuscitation and fermentation culture;

Preferably, the strain recovery comprises sequentially carrying out primary seed culture and secondary seed culture;

Preferably, the medium for secondary seed culture contains tryptone, yeast powder and NaCl;

preferably, the conditions of the fermentation culture include:

The temperature is 36-38 ℃, the pH value is 6.8-7.2, the DO series rotation speed is maintained to be more than or equal to 30%, when the OD ₆₀₀ is more than 7, the dissolved oxygen rising speed and the pH rising speed are more than or equal to 0.1 unit/min, feeding is carried out, the flow rate at 1h is 95-105 mL/h, then the flow rate is regulated to be 100-200 mL/h, and the ventilation quantity is automatically regulated to maintain the DO of 30-40%.

7. The method for preparing human basic fibroblast growth factor according to claim 6, wherein the medium for secondary seed culture comprises 10-20 g/L tryptone, 5-11 g/L yeast powder and 3-7 g/LNaCl.

8. The method of preparing human basic fibroblast growth factor according to claim 1, wherein the induced inducer comprises isopropyl- β -D-thiogalactoside;

Preferably, the working concentration of the isopropyl-beta-D-thiogalactoside is 1-25 mM;

preferably, the temperature of the induction is 36-43 ℃;

Preferably, the induction time is2 to 5 hours.

9. The method for preparing human basic fibroblast growth factor according to claim 1, wherein the step of extracting inclusion bodies is further included after collecting the precipitate;

preferably, the extracting the inclusion body comprises mixing the collected precipitate with inclusion body dissolution liquid, and collecting supernatant to obtain inclusion body solution;

10. The method of preparing human basic fibroblast growth factor according to any of claims 1-9, characterized in that the method of preparing comprises the steps of:

(2) Crushing cells, collecting precipitates, mixing the precipitates with inclusion body dissolution liquid, collecting supernatant to obtain crude protein, performing first chromatography on the crude protein, using any one or a combination of at least two of phenyl sepharose, butyl sepharose, n-butane sepharose or n-octyl sepharose to assemble a chromatographic column, flushing the chromatographic column by using a first balance buffer solution, loading, flushing the hybrid protein by using a first elution buffer solution and a second elution buffer solution until the baseline is stable, and then mixing and eluting the target protein by using the first elution buffer solution and the second elution buffer solution; the inclusion body dissolution liquid contains tris (hydroxymethyl) aminomethane, naCl, EDTA and guanidine hydrochloride, the first balance buffer liquid contains tris (hydroxymethyl) aminomethane, urea, EDTA, naCl and ammonium sulfate, the first elution buffer liquid contains arginine, tris (hydroxymethyl) aminomethane, urea and EDTA, and the second elution buffer liquid contains arginine, tris (hydroxymethyl) aminomethane, urea, EDTA and NaCl;

(3) Performing second chromatography on the product collected in the step (2), using any one or a combination of at least two of DEAE agarose gel, Q agarose gel and QAE agarose gel to assemble a chromatographic column, flushing the chromatographic column by using a second balance buffer, loading the sample, flushing the hybrid protein until the baseline is stable by using a third elution buffer and a fourth elution buffer, and then eluting the target protein by using the third elution buffer and the fourth elution buffer, wherein the second balance buffer contains tris and urea, the third elution buffer contains tris and urea, and the fourth elution buffer contains tris and NaCl;