CN110791517A

CN110791517A - Preparation, purification and crystallization of fibroblast growth factor 21

Info

Publication number: CN110791517A
Application number: CN201810860308.1A
Authority: CN
Inventors: 任发政; 刘静文; 张昊; 郭慧媛
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2018-08-01
Filing date: 2018-08-01
Publication date: 2020-02-14

Abstract

The invention provides a construct. The construct comprises: a 29-209 FGF21 gene fragment and an expression vector carrying a purification tag, wherein the 5 'end of the purification tag is connected with the 3' end of the 29-209 FGF21 gene fragment. After the construct is introduced into a host cell, the expression level of FGF21 is high, the purification is simple, FGF21 protein can be purified to more than 95%, and the expressed FGF21 protein has the activity of relieving insulin resistance.

Description

Preparation, purification and crystallization of fibroblast growth factor 21

Technical Field

The invention relates to the field of biology, in particular to a constructed body, a recombinant strain and a preparation method thereof, a method for preparing FGF21 protein by using escherichia coli, a method for preparing FGF21 protein crystal, FGF21 protein crystal, a pharmaceutical composition and a pharmaceutical combination thereof.

Background

FGF21 is one member of the fibroblast growth factor family, whose main physiological function is regulation of cell proliferation, differentiation and metabolism.22 members of the family have certain homology in their primary amino acid sequence and similarity in biological function and play an important role in promoting embryonic development, tissue formation or repair, variant cell growth, inflammation or thrombosis, for example, the family proteins have a pro-proliferative and dividing effect on fibroblasts, epithelial cells and vascular endothelial cells.FGF family proteins exert biological effects by binding to the membrane surface receptors of target cells, which are mainly classified into two different forms, in which binding to Fibroblast Growth Factor Receptors (FGFR) by heparin sulfate anchoring to regulate cell differentiation and proliferation is the most classical pathway of the family members.FGF family proteins can be classified into 7 subfamilies, in which fibroblast growth factor 21 (21) belongs to one subfamily with FGF19 and 23, in which the other subfamilies act in a signaling manner with other subfamilies, and the three other subfamilies act by assisting the cell membrane surface receptors of Kloth β to activate the cell membrane.

The amino acid composition of human FGF21 is 209, the N-end has a signal peptide consisting of 28 amino acids, and the relative molecular mass is 22.3 kDa. Consistent with other FGF family members, FGF21 also has its specific site of expression, with expression in liver, adipose tissue, and pancreas, with liver being its most prominent site of expression. To date, 5 of the co-discovered FGF receptors, all tyrosine kinase receptors, have been identified, with FGF21 being able to stimulate tyrosine phosphorylation in FGFR1, FGFR2 and FGFR 4.

At present, the preparation of FGF21 at home and abroad is mainly carried out by using an inclusion body renaturation method in a prokaryotic system, namely, the protein is obtained by using prokaryotic expression, but most of expression products exist in the inclusion body, and the target protein can be obtained by a plurality of processes such as protein denaturation and renaturation. FGF21 protein purified in this way is low in yield, weak in protein activity, and has isomeric impurities. Recently, researchers have modified proteins or prepared FGF21 protein by using a eukaryotic expression system, such as Wang Hui rock and the like, wherein recombinant FGF21 is directly fused with a small ubiquitin-related modified protein and then expressed in Escherichia coli to realize soluble expression of the protein, but the expression level and the activity of the method are relatively low; the plant virus vector is utilized by the P-metaqi and the like to express, separate and purify the FGF21 protein in tobacco plants, but the non-fused FGF21 gene cannot be instantaneously expressed at a high level in the tobacco plants, and the cost of a eukaryotic expression system is higher than that of a prokaryotic expression system. In addition, some researchers have co-expressed FGF21 with molecular chaperones by fusion expression, but the FGF21 prepared by this method has heterogeneity at the N-terminus, which affects its biological activity.

Thus, the preparation, purification and crystallization of FGF21 remain to be developed and improved.

Disclosure of Invention

In the prior art, FGF21 is mainly prepared by using an inclusion body renaturation method in a prokaryotic system, namely, protein is obtained by using prokaryotic expression, but most of expression products exist in the inclusion body, and the target protein can be obtained only by a plurality of processes such as protein denaturation and renaturation. FGF21 protein purified in this way is low in yield, weak in protein activity, and has isomeric impurities. In addition, no research on the crystallization technology and crystals of FGF21 has been conducted in the prior art, and the inventors found that the crystallization conditions of FGF19 and FGF23 in the prior art are not suitable for obtaining FGF21 crystals.

Based on the knowledge and discovery of the facts and the problems, the inventor provides a novel method for expressing FGF21 gene by using a prokaryotic system, constructs a method for expressing FGF21 at a high level by using a prokaryotic system (such as escherichia coli) through introducing a purification tag, overcomes the defects of protein preparation by inclusion body renaturation, obtains FGF21 protein with the purity of more than 95% by using a plurality of purification modes, and proves that the FGF21 obtained by the expression of the method has the activity of relieving insulin resistance through experiments, and also provides the crystallization condition of FGF21 for the first time, obtains FGF21 protein crystals for the first time, lays a foundation for analyzing the space configuration of FGF21 and clarifying the mechanism of the bioactivity of FGF21, and lays a foundation for the FGF21 as a medicinal substance.

In a first aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises: a 29-209 FGF21 gene fragment and an expression vector carrying a purification tag, wherein the 5 'end of the purification tag is connected with the 3' end of the 29-209 FGF21 gene fragment. It is known to those skilled in the art that the expression level of a fusion protein composed of a target protein and a purification tag protein is improved relative to the expression level of the target protein, but the inventors have found unexpectedly in experiments that, in the preparation of soluble target protein FGF21, three protein fragments 29-138, 29-149 and 29-209 are selected and fused with purification tags (His tag or GST tag), respectively, the expression level of a fusion protein obtained by fusing only the protein fragment 29-209 with the purification tag is improved, while the expression level of a fusion protein of the protein fragment 29-138, 29-149 with the purification tag is still low. Therefore, the construct according to the embodiment of the invention is a construct which is unexpectedly found by the inventor in experiments to be capable of remarkably and highly expressing FGF21, after the construct according to the embodiment of the invention is introduced into a host cell, the expression level of FGF21 is high, the purification is simple, the FGF21 protein can be purified to more than 95%, and the expressed FGF21 protein has the activity of relieving insulin resistance.

According to an embodiment of the present invention, the above-mentioned construct may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, the expression vector is a prokaryotic expression vector.

According to the embodiment of the invention, the prokaryotic expression vector is pET-28a-TEV and pGEX-4T-2. Wherein pET-28a-TEV is obtained by pET-28a modification, and carries His label, and pGEX-4T-2 carries GST label. Thus, a purification tag can be incorporated into the fusion protein.

According to the embodiment of the invention, the FGF21 gene 29-209 fragment has the nucleotide sequence shown in SEQ ID NO. 1.

cacccgattccggattcctctcagtcctctcctgcaattcgggggccaagtccggcagcggtacctctacacagatgatgcccagcagacagaagcccacctggagatcagggaggatgggacggtggggggcgctgctgaccagagccccgaaagtctcctgcagctgaaagccttgaagccgggagttattcaaatcttgggagtcaagacatccaggttcctgtgccagcggccagatggggccctgtatggatcgctccactttgaccctgaggcctgcagcttccgggagctgcttcttgaggacggatacaatgtttaccagtccgaagcccacggcctcccgctgcacctgccagggaacaagtccccacaccgggaccctgcaccccgaggaccagctcgcttcctgccactaccaggcctgccccccgcactcccggagccacccggaatcctggccccccagccccccgatgtgggctcctcggaccctctgagcatggtgggaccttcccagggccgaagccccagctacgcttcctga(SEQ ID NO:1)。

According to an embodiment of the invention, the purification tag comprises at least one selected from His and GST. The inventor finds that the introduction of the tag of at least one of His and GST can avoid the appearance of inclusion bodies in a prokaryotic expression system by increasing the water solubility of the fusion protein, thereby improving the yield of FGF 21. When the constructs according to the embodiments of the present invention were introduced into host cells, the amount of His-tagged expressed FGF21 protein was 1.49 mg/L bacterial suspension, and the amount of GST-tagged expressed protein was 1.026 mg/L bacterial suspension.

According to an embodiment of the invention, the construct has the nucleotide sequence shown in SEQ ID NO 2.

atgggcagcagccatcatcatcatcacagcagcggcgaaacctgtattttcagggcatatcacccgattccggattcctctcagtcctctcctgcaattcgggggccaagtccggcagcggtacctctacacagatgatgcccagcagacagaagcccacctggagatcagggaggatgggacggtggggggcgctgctgaccagagccccgaaagtctcctgcagctgaaagccttgaagccgggagttattcaaatcttgggagtcaagacatccaggttcctgtgccagcggccagatggggccctgtatggatcgctccactttgaccctgaggcctgcagcttccgggagctgcttcttgaggacggatacaatgtttaccagtccgaagcccacggcctcccgctgcacctgccagggaacaagtccccacaccgggaccctgcaccccgaggaccagctcgcttcctgccactaccaggcctgccccccgcactcccggagccacccggaatcctggccccccagccccccgatgtgggctcctcggaccctctgagcatggtgggaccttcccagggccgaagccccagctacgcttcctgactcgagcaccaccaccaccaccac(SEQ ID NO:2)。

In a second aspect of the invention, the invention proposes a recombinant strain. According to an embodiment of the invention, the recombinant strain contains the construct described above. The inventor finds out through experiments that the recombinant strain containing the above-mentioned construct has high expression amount of FGF21, the FGF21 protein is simple to purify, the FGF21 protein can be purified to more than 95%, and the FGF21 protein finally expressed by the recombinant strain has the activity of relieving insulin resistance.

According to an embodiment of the present invention, the recombinant strain may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, the recombinant strain is escherichia coli. The Escherichia coli is easy to culture and low in production cost.

In a third aspect of the invention, the invention proposes a method for preparing a recombinant strain as described above. According to an embodiment of the invention, the construct described above is introduced into a host cell. As described above, the recombinant strain FGF21 provided by the embodiment of the invention has high expression level and simple purification, FGF21 protein can be purified to more than 95%, and the expressed FGF21 protein has the activity of relieving insulin resistance.

According to an embodiment of the present invention, the method may further include at least one of the following additional technical features:

according to an embodiment of the invention, the host cell is E.coli. The Escherichia coli is easy to culture and low in production cost.

In a fourth aspect of the present invention, the present invention provides a method for preparing FGF21 protein using E.coli. According to an embodiment of the invention, the method comprises: culturing the recombinant strain described above or a recombinant strain obtained according to the method described above under conditions suitable for the expression of the FGF21 protein, so as to obtain the FGF21 protein. As described above, the FGF21 obtained by the method of the embodiments of the present invention has high expression level, is simple to purify, and can purify FGF21 protein to more than 95%, and the FGF21 protein expressed by the method of the embodiments of the present invention has activity of alleviating insulin resistance.

according to an embodiment of the present invention, the method further comprises subjecting the FGF21 protein to a first purification treatment.

According to an embodiment of the present invention, the first purification treatment is performed by at least one of affinity chromatography, tag excision, ion exchange chromatography, and gel filtration chromatography.

According to an embodiment of the present invention, the method further comprises subjecting the purified product to an enzymatic cleavage process to remove the purification tag.

According to an embodiment of the invention, the enzymatic digestion is carried out with TEV enzymatic digestion.

According to the embodiment of the invention, the method further comprises a second purification treatment on the enzyme digestion treatment product.

According to an embodiment of the present invention, the second purification treatment is performed by at least one of affinity chromatography, tag excision, ion exchange chromatography, and gel filtration chromatography.

According to the embodiments of the present invention, the above purification treatment can be performed according to the conventional technical means in the art, unless otherwise specified.

In a fifth aspect of the invention, the invention provides a method for preparing FGF21 protein crystals. According to an embodiment of the invention, the method comprises: (1) FGF21 protein was prepared according to the methods described previously; (2) subjecting the protein obtained in the step (1) to crystallization treatment under the conditions of 60% Tacsimate, 0.1M buffer, pH7.0, and temperature 4 ℃ to obtain FGF21 protein crystals. It is well known to those skilled in the art that adding a precipitant to reduce the mobility of water during protein crystallization, increasing the effective concentration of protein is an important process in protein crystallization, the selection and optimization of precipitant is critical to crystal formation, and common precipitants include salts and polymers. In the crystallization conditions of the prior art, the condition that polyethylene glycol is used as a precipitating agent accounts for 60%, FGF19 forms crystals under the condition that the precipitating agent is polyethylene glycol, FGF23 crystallizes under the condition of ammonium sulfate, and the inventor finds through experiments that the common precipitating agent cannot enable FGF21 to form crystals when the FGF21 crystallization conditions are preliminarily screened, and only the precipitating agent Tacsimate (a mixture of sodium malonate, sodium acetate, trisodium citrate, succinic acid, DL-malic acid, sodium formate and disodium tartrate) can enable FGF21 to form crystals. Under the above conditions, needle-shaped crystals of FDF21 protein were obtained, and the obtained FGF21 protein crystals had an insulin resistance-relieving function.

According to an embodiment of the present invention, the method may further include one of the following additional technical features:

according to an embodiment of the invention, the buffer is Bis-Tris propane, Tris or MOPS. The inventor finds through experiments that the protein crystallization is not improved by adding detergent, small molecules or metal ions in the crystallization conditions, and the protein precipitation is generated; changing the precipitant concentration and pH also has no significant effect on the optimization of protein crystal conditions; and the crystallization condition of the FGF protein can be improved by changing the types of the buffer solution. According to the method provided by the embodiment of the invention, the FGF21 protein with better crystallization state can be obtained under the condition that the buffer solution is Bis-Tris propane, Tris or MOPS.

According to an embodiment of the invention, the buffer is Tris or MOPS. The inventor finds out through experiments that the crystallization condition of FGF21 protein can be obviously improved by replacing 0.1M Tris-Tris propane with 0.1M Tris or MOPS. According to the method provided by the embodiment of the invention, the FGF21 protein with better crystallization state can be obtained under the condition that the buffer solution is Tris or MOPS.

In a sixth aspect of the invention, the invention provides a FGF21 protein crystal. According to an embodiment of the present invention, the FGF21 protein crystal is prepared by the method described above. The FGF21 protein crystal according to the embodiment of the invention is needle-shaped and has the function of relieving insulin resistance.

In a seventh aspect of the invention, the invention provides the use of the FGF21 protein crystal described above in the preparation of a medicament. According to an embodiment of the invention, the medicament is for the treatment or prevention of type 2 diabetes. As mentioned above, the FGF21 protein crystal has the function of relieving insulin resistance, and a medicament prepared from the FGF21 protein crystal also has the function of relieving insulin resistance, and can treat or prevent type 2 diabetes.

In an eighth aspect of the invention, a pharmaceutical composition is provided. According to an embodiment of the present invention, the pharmaceutical composition comprises the FGF protein prepared according to the method described above and/or the crystal of FGF21 protein described above. As described above, both the FGF21 protein and the FGF21 protein crystal have the function of alleviating insulin resistance, and a pharmaceutical composition comprising the FGF21 protein and/or the FGF21 protein crystal also has the function of alleviating insulin resistance.

According to the embodiment of the invention, the FGF21 protein prepared by the method and/or the FGF21 protein crystal prepared by the method and other medicaments for treating or preventing type 2 diabetes mellitus comprise biguanide hypoglycemic substances, insulin secretagogues, α -glucosidase inhibitor substances, insulin sensitizers, insulin and insulin analogs, glucagon-like peptide 1, sodium-glucose cotransporter 2 inhibitors or dipeptide carnosine 4 inhibitors.

According to some embodiments of the present invention, the pharmaceutical composition for treating type 2 diabetes of the present invention may further include a pharmaceutically acceptable carrier, and the dosage form of the pharmaceutical composition is not particularly limited. For oral administration, the pharmaceutically acceptable carrier may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants and flavoring agents. For formulations for topical administration, pharmaceutically acceptable carriers may include bases, excipients, lubricants and preservatives. The pharmaceutical composition of the present invention may be prepared in various dosage forms in combination with the above pharmaceutically acceptable carrier. For example, for oral administration, the pharmaceutical compositions may be prepared as tablets, troches, capsules, elixirs, suspensions, syrups or wafers. The pharmaceutical compositions may also be formulated as solutions, suspensions, tablets, pills, capsules and depot preparations.

Among the carriers suitable for pharmaceutical formulations, according to some specific examples of the present invention, are excipients and diluents that may include: lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

According to other embodiments of the present invention, fillers, anticoagulants, lubricants, moisturizers, fragrances, and preservatives may also be included in the pharmaceutical compositions of the present invention.

According to an embodiment of the present invention, the pharmaceutical composition of the present invention can be used for alleviating insulin resistance. Thus, the pharmaceutical composition of the present invention can treat type 2 diabetes.

The term "administering" as used herein means introducing a predetermined amount of a substance into a patient by some suitable means. The drug of the present invention can be administered by a usual route as long as it can reach the desired tissue. In addition, the pharmaceutical compositions of the present invention may be administered using a specific device that delivers the active ingredient to the target cells.

The administration frequency and dose of the pharmaceutical composition of the present invention can be determined by a number of relevant factors, including the type of disease to be treated, the administration route, the age, sex, body weight and severity of the disease of the patient and the type of drug as an active ingredient. According to some embodiments of the invention, the daily dose may be divided into 1, 2 or more doses in a suitable form for

administration

1, 2 or more times over the entire period, as long as a therapeutically effective amount is achieved.

The term "therapeutically effective amount" refers to an amount of a compound sufficient to significantly ameliorate some of the symptoms associated with a disease or condition, i.e., to provide a therapeutic effect for a given condition and administration regimen. For example, a drug or compound that reduces, prevents, delays, inhibits or arrests any symptom of a disease or disorder in type 2 diabetes should be therapeutically effective. A therapeutically effective amount of a drug or compound need not cure a disease or condition, but will provide treatment for a disease or condition such that the onset of the disease or condition in an individual is delayed, prevented or prevented, or the symptoms of the disease or condition are alleviated, or the duration of the disease or condition is altered, or the disease or condition becomes less severe, or recovery is accelerated, for example.

The term "treatment" is used to refer to obtaining a desired pharmacological and/or physiological effect. The effect may be prophylactic in terms of complete or partial prevention of the disease or symptoms thereof, and/or may be therapeutic in terms of a partial or complete cure for the disease and/or adverse effects resulting from the disease. As used herein, "treatment" encompasses treatment of a disease (primarily type 2 diabetes) in a mammal, particularly a human, including: (a) preventing the onset of a disease (e.g., preventing type 2 diabetes) or condition in an individual who is susceptible to the disease but has not yet been diagnosed with the disease; (b) inhibiting a disease, e.g., arresting disease progression; or (c) alleviating the disease, e.g., alleviating symptoms associated with the disease. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, alleviate, ameliorate, reduce, or inhibit a disease in the individual, including, but not limited to, administering to an individual in need thereof a composition comprising an FGF21 protein and/or an FGF protein crystal as described herein.

According to embodiments of the present invention, the medicament or pharmaceutical composition of the present invention may be used in combination with conventional treatment methods and/or therapies, or may be used separately from conventional treatment methods and/or therapies. When the drugs or pharmaceutical compositions of the present invention are administered in combination therapy with other drugs, they may be administered to the individual sequentially or simultaneously. Alternatively, the pharmaceutical composition of the present invention may comprise a combination of the FGF21 protein and/or FGF21 protein crystal of the present invention, a pharmaceutically acceptable carrier or pharmaceutically acceptable excipient, and other therapeutic or prophylactic agents known in the art.

Drawings

FIG. 1 is a PCR electrophoresis image of FGF21 gene clone according to an embodiment of the present invention;

FIG. 2 is an electrophoresis diagram showing the expression levels of different protein fragments according to an embodiment of the present invention, wherein A is an electrophoresis diagram of a His-tagged protein eluted with imidazole after affinity chromatography, B is an electrophoresis diagram of a GST-tagged protein eluted with 10mM GSH after affinity chromatography, the buffer is 20mM Tris, 1M NaCl, pH8.0, and lane M is a standard protein molecular weight Marker;

FIG. 3 is an electrophoretogram after elution of FGF21 affinity chromatography according to an embodiment of the present invention, wherein A is a His-tagged protein electrophoretogram eluted with imidazole, B is a GST-tagged protein electrophoretogram eluted with 10mM GSH, 20mM Tris, 1M NaCl, pH8.0 as a buffer, and lane M is a standard protein molecular weight Marker;

FIG. 4 is an SDS-PAGE of TEV cleaved FGF21 protein according to an embodiment of the present invention, re-applied to a Ni affinity column (His-tag), in which lane FT shows the breakthrough after TEV cleaved the His-tag and applied to the Ni column, Buffer shows the Buffer elution, and 20mM, 40mM and 400mM imidazole elution are used as eluents;

FIG. 5 is an SDS-PAGE of a TEV digested FGF21 protein according to an embodiment of the present invention, re-applied to a Ni affinity column (GST tag), lane M is a standard protein molecular weight Marker, B is a TEV digested fragment, A is a TEV digested fragment, FT is a permeate of the TEV digested fragment after stripping the GST tag from the Ni affinity column, buffer is a buffer for elution, and eluents are 20mM, 40mM and 400mM imidazole;

FIG. 6 is a SDS-PAGE image (His-tag) after anion exchange chromatography purification of FGF21 according to an embodiment of the present invention, wherein lane M is a standard protein molecular weight Marker, FT is a penetrant, and the eluent is a buffer containing 100mM, 200mM, 300mM, 400mM, 600mM, 800mM, 900mM and 1M NaCl, the buffer is 20mM Tris, 0M NaCl, pH 8.0;

FIG. 7 is a SDS-PAGE image (GST tag) of FGF21 after anion exchange chromatography purification, wherein lane M is a standard protein molecular weight Marker, FT is a permeant, and the eluate is a buffer containing 100mM, 200mM, 300mM, 400mM, 600mM, 800mM, 900mM and 1M NaCl, the buffer is 20mM Tris, 0M NaCl, pH8.0, according to an embodiment of the invention;

FIG. 8 is a graph of FGF21 molecular sieve gel filtration chromatography purification (His-tag) according to an embodiment of the present invention, wherein the abscissa of the graph is elution volume and the ordinate is the UV absorption value of protein, and the interpolated electropherogram is the penetrant electrophoresis of 12-22mL molecular sieves in lanes 1-11, respectively, and lane M is standard protein molecular weight Marker;

FIG. 9 is a gel filtration chromatography purification (GST tag) of FGF21 molecular sieves, wherein the abscissa of the figure is elution volume and the ordinate is ultraviolet absorption value of protein, and the interpolated electropherogram is the penetrant electrophoresis pattern of 13-23mL molecular sieves in lanes 1-11, respectively, and lane M is standard protein molecular weight Marker;

FIG. 10 is an insulin resistance model of hyperinsulinemic established HepG2 cells according to an embodiment of the present invention;

FIG. 11 is a graph of the effect of different concentrations of FGF21 on glucose uptake by HepG2 cells, wherein panel A is the effect of different doses of FGF21 on cell viability and panel B is the effect on glucose uptake by HepG2 cells, according to an embodiment of the invention;

FIG. 12 is a study on the mechanism of alleviating insulin resistance by FGF21, wherein FIG. A shows the effect on GLUT1 expression and FIG. B shows the effect on p-Erk1/2 expression, according to an embodiment of the present invention;

FIG. 13 is a graph of the effect of FGF19 and FGF23 on HepG2 cell activity and glucose uptake, according to an embodiment of the invention;

FIG. 14 is a comparison of primary structures of FGF21, FGF19 and FGF23 according to an embodiment of the present invention, in which AAQ89444.1, AAQ88669.1 and AAG9917.1 represent FGF21(208 amino acids), FGF19(216 amino acids) and FGF23(251 amino acids), respectively;

FIG. 15 is a comparison of secondary structures of FGF19, FGF21 and FGF23 according to an embodiment of the present invention, wherein FIGS. A, B and C show schematic secondary structures of FGF19, FGF21 and FGF23, respectively;

FIG. 16 is a bubble-like (A) or dark shadow (B) occurring under some conditions according to embodiments of the present invention;

FIG. 17 is a diagram showing the state of crystals of FGF21 after primary screening for 12 days according to an embodiment of the present invention, wherein A, B, C, D is needle-shaped crystals, dense fine crystals, irregularly shaped crystals, and radioactive crystals, respectively; and

fig. 18 is a crystal after FGF21 optimization according to an embodiment of the present invention, wherein panel a is a crystal with buffer replaced with Tris and panel B is a crystal with buffer replaced with MOPS.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

The following acronyms are used throughout the invention:

embodiments of the present invention will be described in detail below.

EXAMPLE 1 prokaryotic preparation of FGF21 protein

1. Experimental materials and instruments

(1) Experimental strains

Escherichia coli JM109 was selected as a strain required for cloning, and Escherichia coli BL21(DE3) was selected as a strain required for protein expression.

(2) Experiment carrier

pET-28a-TEV (modified by pET-28 a) and pGEX-4T-2 vector are selected.

(3) Chromatography media

Mainly comprises Bio-Rad image Ni-charged Resin, GE Glutathione Sepharose, GE NiSepharose 6Fast Flow, GE Superdex 20010/300 and GE Mono Q ^TM5/50GL。

(4) Laboratory apparatus

The instrumentation used in the present invention is shown in Table 1.

Table 1: main instrument and equipment for FGF21 pronucleus preparation experiment

2. Experimental reagent

(1) Enzyme

The Taq DNA polymerase and TEV protease required for this example were obtained by expression and purification in this laboratory, and other enzyme reagents used were purchased from Takara et al.

(2) Chemical reagent

The main experimental reagents used in this study are shown in table 2.

Table 2: main experimental reagent for FGF21 expression and purification experiment

(3) Preparation of other commonly used reagents

Antibiotic solution: 2.5g ampicillin or kanamycin solid was weighed, dissolved in 50mL ultrapure water, and stored at-20 ℃ for further use.

LB culture medium: weighing 10g tryptone, 10g NaCl and 5g yeast extract, dissolving in 1L ultrapure water, sterilizing at 121 deg.C for 20min, and storing at 4 deg.C for use.

5 × TBS buffer: 54.5g Tris and 27.8g boric acid were weighed out and dissolved in 1L ultrapure water.

50 × TAE electrophoresis buffer: 242g Tris, 37.2g Na were weighed₂EDTA-2H₂Dissolving O in 800mL of ultrapure water, adding 57.1mL of glacial acetic acid after completely dissolving, and metering to 1L.

5 × protein loading buffer: 3.025g Tris, 0.5g bromophenol blue, 10g SDS, 5g mercaptoethanol and 50mL glycerol were weighed and dissolved in 100mL ultrapure water.

3. Vector construction

(1)PCR

The PCR primers are shown in Table 3.

Table 3: PCR primer List

Primer name	5 'primer sequence 3'
		FGF21 29BamH I	gc ggatcc CACCCGATTCCGGATTCCTCTC
FGF21 209Xhol	gc ctcgag TCA GCTTGCGTAGCTCGGGCTGCG
		FGF21 29NDEI	act catatg CACCCGATTCCGGATTCCTCTC
FGF21 146Xhol	gc ctcgag TCA CAGATGCAGCGGCAGACCATG
		FGF21 138Xhol	gc ctcgag TCA TTCAGACTGGTACACGTTGTAG

Three fragments of FGF21 target gene (29-138, 29-146, and 29-209) were obtained by Polymerase Chain Reaction (PCR) amplification using FGF21cDNA as a template.

PCR reaction (20. mu.L):

the PCR reaction program is:

(the above 3 steps were performed for 30 cycles)

72℃ 10min

Keeping the temperature at 4 DEG C

(2) Gel recovery of DNA fragments

The DNA fragments were subjected to agarose gel electrophoresis, and then immersed in EB for color development, and the gel strips containing the desired DNA were cut from the gel pieces. Adding a proper amount of sol solution into a centrifuge tube, and then carrying out warm bath at 55 ℃, and turning upside down and uniformly mixing until the gel strip is dissolved in the centrifuge tube. After the sol solution is cooled to room temperature, 600 mu L of the solution is added into an adsorption column in batches, the mixture is kept stand at room temperature for 2min after each addition, and then 10000g of the mixture is centrifuged for 1min to pass through the column. After the sol solution was passed through the column for 3 times, 700. mu.L of rinsing solution was added to the adsorption column, and the column was rinsed by centrifugation at 10000g for 1min and then rinsed again. After discarding the rinsing solution, the centrifuge tube was centrifuged at 10000g for 2 min. Subsequently, the adsorption column was transferred to a sterilized 1.5mL centrifuge tube and blown dry under a clean bench. Adding 40 μ L of eluate treated by 55 deg.C warm bath into the center of the filter membrane of the adsorption column, incubating in 37 deg.C incubator for 5min, centrifuging for 2min with 10000g to recover target DNA, and storing at-20 deg.C.

(3) Double enzyme digestion reaction

And carrying out double enzyme digestion reaction on the recovered DNA fragment and the vector, wherein the enzyme digestion system is 20.0 mu L:

after addition, the reaction was carried out at 37 ℃ for 4 hours for the DNA fragment and 1 hour for the vector.

(4) Ligation of DNA

The FGF21 target gene after double enzyme digestion is connected with prokaryotic expression vectors pET-28a-TEV and pGEX-4T-2 for 5 hours at the temperature of 16 ℃, and a connection reaction system (10 mu L) is as follows:

the solution was added and pipetted well, followed by high speed centrifugation and overnight reaction for transformation.

(5) Preparation of competent cells of Escherichia coli

The competent strain BL21(DE3) was streaked on a non-resistant LB plate medium and cultured at 37 ℃ for 12 hours. Subsequently, single colonies were picked and placed in LB medium containing the corresponding antibiotic and placed in a shaker at 37 ℃ for overnight culture with shaking at 200 rpm. After overnight, 1mL of the culture was transferred to 100mL of LB medium and placed in a shaker at 37 ℃ with shaking at 200rpm until OD₆₀₀The value reached 0.5.

Transferring the cultured bacterial liquid into a 50mL centrifuge tube, and placing the centrifuge tube in an ice bath for cooling. The cells were collected by centrifugation at 2500g for 5min at 4 ℃ and the supernatant discarded. 30mL of pre-chilled 0.1M CaCl was added to each tube₂The solution was added and the tube was gently rotated in the same direction to suspend the cells evenly. Then, the centrifuge tube was placed in an ice bath for 10min, and centrifuged at 2500g at 4 ℃ for 10min to collect the cells. Discarding the supernatant, adding precooled 0.1M CaCl again₂The solution gently resuspended the cells. And then adding 1.5mL of DMSO, gently mixing, standing on ice for 10min, quickly subpackaging the bacterial liquid into a cooled sterile centrifuge tube, quickly freezing with liquid nitrogen, and storing at-80 ℃.

(6) Transformation of competent cells of Escherichia coli by heat shock method

After thawing 100. mu.L of E.coli competent cells on ice, 10. mu.L of the ligation product was added in a clean bench and mixed gently, followed by ice-bath for 30 min. The mixture was heated in a metal bath at 42 ℃ for 90 seconds, immediately placed on ice and cooled for 5 min. Then 500. mu.L of non-resistant LB medium was added and incubated in a 37 ℃ incubator for 40 min. And then, spreading the incubated bacterial liquid on an LB plate with corresponding resistance, placing the LB plate on an ultra-clean bench for air drying, and after carrying out inverted culture at 37 ℃ for 12 hours, picking out a single colony for identification.

(7) Small quantity extraction plasmid by alkali cracking method

Single colonies were picked up in 2mL LB medium with the corresponding resistance and cultured overnight at 37 ℃ on a shaker at 200 rpm. The next day, the bacterial solution was poured into a 2mL centrifuge tube, centrifuged at 10000g for 1min, and the supernatant was discarded to collect the cells. Subsequently, 150. mu.L of solution I (25mM Tris-HCl pH8.0 plus 10mM EDTA pH8.0) was added to allow the cells to be fully suspended; then 200. mu.L of newly prepared solution II (0.2M NaOH plus 1% SDS) is added and mixed gently up and down for 6 times to ensure that the solution fully contacts the thalli. Thereafter, 150. mu.L of the pre-cooled solution III (3M KAc pH 4.6) was added thereto, gently mixed up and down 6 times, and then centrifuged at 16000g for 10 min. Sucking the supernatant into a new 1.5mL centrifuge tube, adding 800. mu.L of absolute ethanol, mixing, and freezing at-20 deg.C for 30 min. Subsequently, the precipitate was centrifuged at 16000g for 10min, the supernatant was discarded, 500. mu.L of 75% ethanol was added, the precipitate was washed once by centrifugation at 16000g for 3min, the supernatant was discarded (the liquid was sucked dry as much as possible), and the precipitate was dried in an ultraclean bench. Finally, the plasmid was dissolved in 50. mu.L of sterile water containing RNase A (10. mu.g/. mu.L) for use.

(8) Plasmid identification

The plasmid identification is carried out by adopting a restriction enzyme digestion method and PCR, and the plasmid with correct identification and DNA sequencing is transformed into the expression competent cells.

4. Prokaryotic expression of FGF21 protein

(1) Small-scale expression of the protein of interest FGF21

Single colonies were picked and inoculated into finger tubes containing 2mL of LB liquid medium with the corresponding resistance and cultured in a shaker at 37 ℃ at 200 rpm. OD of bacterial liquid₆₀₀When the value reaches 1.0, adding 1.0mL of bacterial liquid into a 1.5mL centrifuge tube, centrifuging at 14800rpm for 1min, discarding the supernatant, performing instant separation at high speed, absorbing the supernatant, adding 20 μ L of 5 × loading buffer, performing boiling water bath for 10min, and centrifuging at 10000rpm for 10min for later use (a sample before induction); meanwhile, IPTG is added into the remaining 1mL of bacterial liquid in the finger-shaped tube until the final concentration is 1mM so as to induce protein expression, at the moment, the finger-shaped tube is placed at 18 ℃ and cultured for 3h at 200rpm, then the bacterial liquid is moved into a 1.5mL centrifuge tube, the sample obtained after induction is treated by the same operation, and the sample difference before and after induction is observed through SDS-PAGE electrophoresis so as to judge the expression effect.

(2) Mass expression of the protein of interest

Selecting single colony, inoculating into 2mL LB culture medium, performing small-scale culture, transferring into 1L LB culture medium after 8 hr, performing large-scale culture, culturing at 37 deg.C for 12 hr, and measuring absorbance OD at 600nm₆₀₀After reaching 0.7, IPTG was added to a final concentration of 0.2mM, and protein expression was induced at 18 ℃ for 12 hours.

5. Purification of FGF21 protein

(1) Affinity chromatography

The induced bacterial liquid is collected and poured into two 500mL centrifuge bottles, and centrifuged for 10min at 4 ℃ and 4000g to recover the bacteria, and the supernatant is discarded. The cells were resuspended in 40mL of solution A (20mM Tris-HCl pH8.0, 1M NaCl). To the His-tagged protein suspension, 1mM final concentration of protease inhibitor PMSF, 0.1% Triton and 20mM imidazole were added. Adding 1mM protease inhibitor PMSF with final concentration and 0.1% Triton into the protein bacterial liquid with GST tag. Subsequently, the bacterial cells were disrupted by sonication in an ice-salt bath (2 sec for 4sec, 15min for the total time). The disrupted cell suspension was centrifuged at 20000g for 30min at 4 ℃ and the supernatant was filtered through a 0.22 μm filter.

Subsequently, for the His-tagged protein, the protein supernatant was loaded into a Bio-Rad Ni affinity column at 4 ℃ using a constant flow pump at a flow rate of 0.5mL/min while collecting the transudate with a beaker, and this procedure was repeated twice. For proteins containing GST tags, the Ni affinity column was replaced with GST column, and the Ni affinity column or GST column was washed with 20mL of solution A. After the Ni affinity column chromatography, the Ni affinity column was subjected to gradient elution sequentially with 10mL of solutions A containing different imidazole concentrations, with imidazole concentrations being in the range of 20, 60, 100 and 400 mM. After affinity chromatography on the GST column, the GST column was eluted with 10mL of 10mM reduced GSH-containing solution A.

(2) TEV enzyme digestion removal of His tag and GST tag

And (3) removing imidazole or GSH from the target protein obtained after the affinity chromatography elution by using an ultrafiltration tube, wherein the main method is a repeated dilution method of concentration-solution addition-concentration-solution addition circulation. Subsequently, the protein and TEV enzyme were mixed in a molar ratio of 10:1 and spun at 4 ℃ overnight for cleavage. The next day, the digested protein mixture was purified with a Ni affinity column (His-tagged protein) or with a GST column followed by a Ni affinity column (GST-tagged protein), and the permeate was collected, and the Ni affinity column was eluted stepwise with a solution A containing 20mM, 40mM and 400mM imidazole, while for the GST column, 10mL of a solution A containing 10mM GSH was eluted and the eluate was collected.

(3) Ion exchange chromatography

Ion exchange chromatography is performed by GE Mono Q ^TM5/50GL packing a manually packed anion exchange column (Q column). First, the Q column was washed with high salt solution (20mM Tris-HCl pH8.0, 1M NaCl) for 2 column volumes and then equilibrated with salt-free solution (20mM Tris-HCl pH8.0) for 4 column volumes. Secondly, the target protein sample is diluted with a salt-free solution after concentration so that the final NaCl concentration is not more than 100 mM. The target protein solution was passed through the Q column, and then the Q column was eluted sequentially with 10mL of a buffer solution containing NaCl at a different concentration (NaCl concentration gradually increased from 100mM to 1000mM, prepared with a high-salt and salt-free solution), and the permeation liquid and the eluate were collected.

(4) Gel filtration chromatography

Gel filtration chromatography was performed at 4 ℃ on a Bio-Rad FPLC instrument using Superdex 20010/300 from GE. 1 column volume was first equilibrated with 24mL (20mM Tris-HCl pH8.0, 150mM NaCl) of buffer solution for gel filtration chromatography, followed by concentration of the protein sample to 1mL load, adjusted to a flow rate of 0.3-0.4 mL/min.

6. Protein concentration determination

The Bradford method was chosen to determine protein concentration, with Coomassie brilliant blue G250 alone appearing in a brownish red color with a maximum absorption peak at 465nm, and when bound to a protein, a blue colored compound was produced with a maximum absorption peak at 595 nm. Within a certain range, the absorbance of the Coomassie brilliant blue G250-protein complex at 595nm is in a linear relation with the protein concentration, so that the protein concentration can be calculated by detecting the absorbance^[49]。

The specific operation method is as follows, firstly adding BSA with different concentration gradients into a quartz cuvette, and then adding 1mL of Bio-Rad Protein Assay Protein quantitative detection solution into each tube. Then mixing the solution uniformly, waiting for 5min, and measuring its light absorption value OD at 595 wavelength₅₉₅Triplicate runs were made for each concentration sample. Then, the absorbance OD at 595 wavelength was plotted on the abscissa with BSA concentration₅₉₅A standard curve is plotted for the ordinate. Then, the concentration of the protein to be tested (mg/mL) is 19.542 XOD₅₉₅V (test protein) -1.4126, wherein V (test protein) represents the volume (. mu.L) of test protein, OD₅₉₅Is the light absorption value of the sample to be detected at the wavelength of 595 nm.

7. Identification by mass spectrometry

(1) Protein in-gel enzymatic hydrolysis

First, a target strip was cut with a clean blade and cut into 1mm³Small square blocks. Reuse of 125mM NH₄HCO₃The gel block was washed three times with 50% acetonitrile until Coomassie Brilliant blue had stripped off. Subsequently, 10mM DTT/125mM NH was added₄HCO₃The solution was reacted in a 56 ℃ water bath for 30min to effect reduction. The supernatant was removed by centrifugation and 55mM IAM/125mM NH added₄HCO₃The solution was reacted for 30min, and care was taken to avoid light. The gel cake was then washed twice with 50% acetonitrile solution, vacuum dried, trypsin added at 25mM NH₄HCO₃Enzymatic hydrolysis at 37 ℃ overnight in pH8.0 solution. After the enzymolysis is finished, 0.5 percent formic acid/50 percent acetonitrile solution is added to extract the peptide fragment for three times, and the obtained extracts are combined and vacuumized.

(2) LC-MS/MS detection

Samples were mass-spectrometrically detected using a SCIEX TripleTOF 5600+ mass spectrometry system. The peptide fragments after enzymolysis are dissolved in a loading buffer solution of 2% acetonitrile/0.1% formic acid and are injected by an automatic sample injector, the peptide fragments are firstly combined on a C18Trap column (5 mu m, 100 mu m and 20mm), then are subjected to chromatographic separation by eluting to a C18 analytical column (3 mu m,75 mu m and 150mm) at the flow rate of 300nL/min, are eluted by gradually increasing the concentration of an organic phase, and enter a mass spectrum by utilizing electric spraying, the gradient time is 60min, and the mobile phases are an aqueous phase (2% acetonitrile/0.1% formic acid/98% water) and an organic phase (98% acetonitrile/0.1% formic acid/2% water). Mass spectrum data are acquired by using an IDA (information dependent acquisition) mode, in each cycle of scanning, a primary mass spectrum (ion accumulation time 250ms, scanning range 350-.

(3) Mass spectrometric data analysis

The mass spectrogram file was submitted to ProteinPilot 4.5 software (AB Sciex) and the database used the FGF21 protein sequence downloaded from uniprot. As a result of the identified protein, it was considered that the peptide fragment was authentic when the unused score >1.3 (confidence level 95% or more), and the protein including at least 1 unique peptide fragment was retained.

8. Activity verification of FGF21 in relieving insulin resistance

(1) Establishment of insulin resistance model

After HepG2 cells passed to third generation, according to 4X 10⁴The cells were seeded in 96-well plates at a density, cultured in DMEM medium containing 10% FBS, starved for 24h after 24h cell attachment by changing to serum-free medium, and then changed to 10^-6The culture medium of mol/L insulin is modeled for 12h,24h and 48h, and a DMEM culture medium without insulin is set as a normal control group. At each time point, cellular activity of HepG2 cells and cellular glucose uptake were examined to establish an endpoint for the cellular insulin resistance model that did not affect cellular activity and significantly reduced glucose uptake.

(2) Cell proliferation Rate determination

After HepG2 cells passed to third generation, according to 4X 10⁴Inoculating the cells into a 96-well plate at a density, culturing in a DMEM medium containing 10% FBS, after 24h of cell adherence, replacing the cells with a serum-free medium for starvation, continuing to culture for 24h, adding 1,10,100 and 1000nM of protein, arranging another control group (only adding the DMEM medium without any drug in the cell culture solution), setting 6 parallel groups for each concentration, after continuing to culture for 24h, adding 20 mu L of CCK-8 solution into each hole, placing the holes in an incubator for culturing for 1h, and measuring the absorbance of the sample at the wavelength of 450nM by using an enzyme-labeling instrument.

(3) Glucose uptake assay

Glucose uptake in HepG2 cells was determined using the 2-deoxyglucose fluorescent analogue (2-NBDG). HepG2 cells according to 4X 10⁴Inoculating to 96-well plate, culturing in DMEM medium containing 10% FBS, starving after 24 hr when cell is attached to wall, and continuously culturingCulturing for 24h, adding 10^-6After 24 hours of molding with mol/L insulin, the cells were replaced with a medium containing 0,1,10,100,1000nM protein, and a control group (DMEM medium without any drug in the cell culture medium) was added thereto at 6 concentrations in parallel, and the glucose uptake was measured after further 24 hours of culture. For the assay, the medium was decanted, replaced with medium containing 100nM insulin, stimulated with insulin for 10-20min, and the cells were washed twice with clean PBS. Then, PBS containing 100. mu.M 2-NBDG was added to the 96-well plate, and the plate was incubated in an incubator for 30min, where light shielding was required, and after completion, the plate was washed with PBS, and the fluorescence value of the sample was measured at 488nm excitation wavelength and 526nm emission wavelength.

(4) Signaling pathway study for FGF21 to exert Activity

In order to explore the mechanism of the FGF21 protein for relieving insulin resistance, the FGF21 protein 1000nM is added to incubate HepG2 cells for 30min, 1h, 1.5h, 6h, 8h, 16h, 24h and 30h, and the protein is proposed to carry out Western blot. The specific operation method comprises the following steps:

cell treatment: at 2X 10⁴/cm²The cells were seeded in 6-well plates and cultured for 24h, then starved for 24h with serum-free medium, and then a 1000nM FGF21 sample was added and cultured for various times and then removed.

And (3) extracting total cell protein: after washing the cells for three times with precooled PBS solution, adding 100 mul of Western cell lysate precooled in advance into each hole, gently mixing uniformly to enable the lysate to infiltrate into all the cells, and standing for 5 min. And then, scraping the cells by using a cell scraper, uniformly blowing the cells by using a pipette gun, transferring the cells into a precooling centrifuge tube, ultrasonically crushing the cells, centrifuging the cells for 10min at 12000rpm, and sucking the supernatant.

The extracted protein concentration was determined using the micro BCA protein assay kit: BCA working solution was prepared as described in a 10mL centrifuge tube and stored at room temperature. Diluting a 2mg/mL bovine serum albumin protein standard stock solution into protein standard series with different concentrations, wherein the diluent is consistent with a solution used for preparing the protein to be detected. The formulations of the protein standards gradient concentration solutions are shown in tables 2-4. Adding the A-I protein standard solution and a sample to be detected into a 96-well enzyme label plate, wherein each well is 10 mu L, and each sample is paralleled for three times. Then, 200 μ L of working solution is added into each hole of the ELISA plate, the mixture is shaken and mixed evenly for 1min on a micro oscillator, then the incubation is carried out for 30min under the condition of 37 ℃, and then the light absorption value under the wavelength of 570nm is measured. And (4) making a protein concentration-absorbance value standard curve according to the result, and calculating the concentration of the unknown cell protein sample.

Table 4: preparation of protein standard substance with different concentrations

SDS-PAGE electrophoresis: 10% separation gel and 4% concentrated gel with the thickness of 1cm are prepared. The loading amount is controlled to be 5-30 mug/hole during electrophoresis loading. And then, running electrophoresis under the condition of constant voltage of 80V for about 15min, and raising the voltage to 120V when the bromophenol blue runs to the interface of the separation gel until the bromophenol blue reaches the bottom of the separation gel.

Film transfer: after cutting, the gel strip was equilibrated with transfer buffer for 30 min. At this time, the PVDF membrane was immersed in methanol for 15 seconds to activate the membrane, and then immersed in ultrapure water for 2 minutes after activation. Subsequently, it was equilibrated for 10min in the transfer buffer together with the cut filter paper and the transfer module. Then, the sample and the PVDF membrane were placed, and after the sample and the PVDF membrane were clamped by a clamp, the whole was placed in a transfer bath, and the membrane was transferred in an ice-water bath for 2 hours (constant current 200 mA).

Antibody incubation: and (3) carrying out ponceau dyeing on the PVDF membrane transferred with the protein, and washing off the reversibly combined dye by using water after the complete transfer of the protein is determined. After blocking the membrane for 2h, add primary antibody diluent and incubate for 2 h. After incubation was complete, the cells were washed clean with PBST. Subsequently, the incubation was performed for another 1h using the secondary antibody dilution, and after completion of the incubation, PBST was washed clean.

Imaging: mixing A, B solutions with equal volume, reacting for 1min, coating with transparent plastic film after light emission is stable, placing into gel imager, adjusting exposure time according to brightness of automatic exposure image strip, and selecting the clearest image for storage.

9. Data statistics

The results of the experiment are presented as mean ± standard deviation and are statistically analyzed using SPSS 17.0 software (SPSS inc., Chicago, IL). When the significance difference of the two groups of data is compared, selecting t test; one way ANOVA was chosen for comparison between the data sets. Finally, p <0.05 was used as a criterion for significant differences.

10. Results and analysis of the experiments

(1) Expression of proteins

Since amino acids 1-28 of FGF21 are signal peptides, gene cloning is carried out from amino acid 29, in order to retain conserved secondary structure of FGF21 and ensure that the original spatial structure can be formed, protein fragments capable of forming α -helix and β -fold are selected and avoided during gene cloning, and finally, the cloning of three fragments 29-138, 29-146 and 29-209 is determined, and electrophoresis detection is utilized to find that target genes of the three fragments are successfully cloned after the three protein fragments of FGF21 are cloned (figure 1).

All constructed vectors were subjected to gene sequencing, and protein expression was performed only after ensuring that there were no mutations including frameshift mutations. The sequencing results in Table 5 show that all 6 plasmids constructed were successfully constructed. The 6 constructed plasmids are transferred into an escherichia coli expression strain BL21(DE3) for expression, and the result shows that only a 29-209 protein fragment in the three selected target protein fragments 29-138, 29-146 and 29-209 can be expressed in a large amount in an escherichia coli expression strain BL21(DE3) no matter the plasmid is provided with a His tag or a GST tag (FIG. 2).

After the target protein is expressed by IPTG induction, the target protein is identified to exist in the supernatant obtained after the thalli are crushed and centrifuged, which shows that the expression of the target protein is soluble and does not form insoluble inclusion bodies.

Table 5: vector construction and protein expression profiles

Protein fragments	Label (R)	Plasmids	Sequencing identification results	Expression of the protein of interest
					29-138	His label	peT-28a	Sequence correction	Low expression level
29-146	His label	peT-28a	Sequence correction	Low expression level
					29-209	His label	peT-28a	Sequence correction	High-volume expression
29-138	GST tag	pGEX-4T-2	Sequence correction	Low expression level
					29-146	GST tag	pGEX-4T-2	Sequence correction	Low expression level
29-209	GST tag	pGEX-4T-2	Sequence correction	High-volume expression

(2) Purification of proteins

(a) Affinity chromatography purification

Since only FGF21 protein with 29-209 fragments can be expressed in E.coli in large quantities, the later protein purification is based on this. The His-tagged protein can be specifically bound to a Ni column, thereby separating from the hetero-protein. As can be seen from the electrophoresis of FIG. 3A after elution by affinity chromatography, after the protein was initially purified by Ni affinity column, by gradient elution with the buffer solution with increasing imidazole concentration, FGF21 protein was eluted at both 100mM and 400mM imidazole, but the protein content in the eluate eluted at 100mM imidazole was higher. Similarly, for proteins with GST tags, it can be seen from electrophoresis FIG. 3B that the protein of interest can be eluted by 10mM GSH following the standard GST-tag protein purification procedure.

The isoelectric point of FGF21 protein is 5.01, so the initially selected buffer solution is 20mM Tris, 500mM NaCl and pH 8.0. later experiments show that the precipitation phenomenon is very easy to occur in the process of removing imidazole by concentrating FGF21 protein by using an ultrafiltration tube, which is probably caused by nonspecific combination of the protein and nucleic acid in escherichia coli during prokaryotic expression, and the process is easy to cause polymerization and precipitation.

And for the protein with the His tag, collecting the protein eluted by 100mM imidazole eluent, carrying out TEV enzyme digestion to remove the His tag, and then loading the protein on a Ni affinity column again to remove the TEV enzyme, partial foreign protein and the target protein without cutting off the His tag. From the results in FIG. 4, it is clear that the target protein from which the tag has been cleaved is mainly in the eluate containing 20mM imidazole. The migration speed of the protein on SDS-PAGE gel after the tag is cut off is obviously higher than that before the tag is not cut off, which indicates that the His tag is cut off by the obtained protein.

And (4) collecting the eluate of the protein subjected to TEV enzyme GST tag digestion for SDS-PAGE detection. FIG. 5 shows that FGF21 protein is mainly present in the eluate containing 20mM imidazole, and that the amount of hetero-protein is small. After the tag is cut off, the migration speed of the FGF21 protein on SDS-PAGE gel is obviously higher than that before the tag is cut off, the molecular weight of the protein is reduced and is consistent with that of the FGF21 target protein, and the obtained protein is proved to have removed the GST tag. The GST tag was eluted at 400mM imidazole.

(b) Purifying by ion exchange chromatography

For the protein with the His label, because the target protein eluent obtained after the Ni column is reversely hung contains 1MNaCl and can not be directly subjected to ion exchange, the collected protein is concentrated by an ultrafiltration tube, salt ions are removed as much as possible, and then the protein is loaded on an anion exchange column which is manually filled, and the gradient elution is carried out by using a buffer solution with gradually increased salt ion concentration. SDS-PAGE analysis of the eluate showed that the target protein was eluted mainly in 100mM and 200mM NaCl eluents, while the hetero-protein was eluted at 300mM and 400mM salt concentrations, resulting in a better separation (FIG. 6).

Similarly, the GST-tagged cleaved protein was also subjected to further anion exchange chromatography. The eluate was collected, concentrated to 1mL by a concentration tube, diluted with a salt-free buffer (20mM Tris-HCl, pH8.0) to a final concentration of NaCl less than 50mM, and the diluted protein sample was further purified by an anion exchange column. The electrophoretic results after elution showed that the target protein was eluted mainly in 100mM NaCl eluate, while the hetero-protein was eluted at higher salt concentration (FIG. 7).

Therefore, FGF21 protein binds to the medium less strongly than the hetero-protein and can be eluted at lower salt ion concentrations.

(c) Purifying by gel filtration chromatography

For His-labeled protein, eluent containing 100mM NaCl and 200mM NaCl after anion exchange chromatography column purification is collected and used for further purification of molecular sieve gel chromatography, FGF21 protein is eluted at about 18mL and is a uniform protein single peak (figure 8), and 12-22mL protein in the collected peak volume is detected by SDS-PAGE, so that the purity of the target protein is over 95 percent, and the purification effect is good.

Similarly, for the GST-tagged protein, 100mM NaCl eluate was collected and used for further purification by molecular sieve gel chromatography, and FGF21 protein was found to be eluted at around 17mL and the protein peaks were uniform (FIG. 9). SDS-PAGE is utilized to detect the collected 13-23mL of protein, the purity of the target protein is found to reach more than 95%, and subsequent experiments can be carried out.

(3) Identification of proteins

All the purified FGF21 proteins were subjected to mass spectrometric identification, and the three proteins with the highest scores in the mass spectrometric result identification are listed in Table 6. According to the molecular weight of the identified protein, the Unique peptide fragment and the total PEP score, the prepared protein is FGF21 protein, and the hybrid protein is few. Caspase family proteins are often used as factors in the regulation of apoptosis, while triosephosphate isomerase is a key enzyme in the glycolysis pathway, and the expression of these two proteins may be related to the endogenous regulation of the E.coli expression system. Therefore, the detection results of SDS-PAGE electrophoresis and mass spectrometry identification show that FGF21 protein with the purity of more than 95% can be obtained after purification by various methods such as affinity chromatography, ion exchange chromatography and gel filtration chromatography.

Table 6: FGF21 mass spectrometric identification result

Molecular weight	Name of protein	Accesion database numbering	Peptide fragment of Unique	Total PEP score
					22.3kDa	FGF21	Q9NSA1	37	152.03
27.66kDa	Caspase enzymes	B2CIS9		4						31.79
					30.77kDa	Triose phosphate isomerase	P60174		2		13.62

(4) Production of protein

The method enables expression of FGF21 protein at high levels in terms of protein yield. The yield of FGF21 using His tag was 1.49mg protein per liter of bacterial suspension, while the yield of FGF21 protein using GST tag was 1.026mg protein. The introduction of the fusion tag is beneficial to increasing the expression amount of the protein, the fusion protein has stronger stability than the natural protein, the fusion of the tag has a protective effect on the protein, and the protein can be prevented from being degraded by hydrolase to a certain extent.

(5) Activity verification of FGF21 in relieving insulin resistance

The regulation of sugar metabolism of an organism is one of the most main physiological functions of FGF21, and the embodiment establishes an insulin resistant HepG2 cell model, simulates the cell sugar metabolism state under the condition of diabetes, thereby verifying whether the FGF21 protein obtained by purification has physiological activity. The HepG2 cell is derived from a human liver cancer cell, is a hepatoembryonic cancer cell line with extremely similar phenotype and liver cell, has no phenomenon of withering and fading of normal liver cells, and can meet the standard required by an insulin receptor through a high-affinity insulin receptor expressed on the surface, so that the HepG2 cell is widely applied to the establishment of an insulin resistance model.

When HepG2 was molded by the action of insulin, 10 is shown by the results of measurement of CCK-8 cell activity in FIG. 10^-6The mol/L insulin had no significant effect on HepG2 cell activity. At the same time, the results of glucose uptake showed no significant difference between the uptake at 12h and the normal group, but significant decreases (p) at both 24h and 48h<0.05), glucose uptake can be reduced by 27%. Therefore, the insulin concentration is 10^-6When HepG2 cells were treated at mol/L for 24h, the cells were impaired in glucose uptake and utilization, and the concentrations and times were suitable for establishing an insulin resistance model.

Following the establishment of the insulin resistance model, the activity of 1nM, 10nM, 100nM and 1000nM FGF21 was used for the verification of the activity of relieving insulin resistance. The cleaved proteins with the His tag and GST tag have no difference in exerting insulin resistance activity, and therefore, only the result of FGF21 protein obtained by purifying the His tag is described in the activity verification.

The glucose absorption detection method commonly used comprises the steps of directly detecting the glucose concentration difference in cell culture solution before and after the culture medium, a tritium-labeled 2-deoxyglucose detection method and the like. If the glucose concentration difference before and after culture is directly detected, although the method is simple and easy, the accuracy is poor, and the tritium-labeled glucose has high sensitivity, high cost and radiation damage. At present, 2-NBDG is gradually widely applied to detecting the glucose absorption of cells. The research shows that 2-NBDG has the functions of fast uptake, aggregation in cells and fluorescence excitation on HepG2 cells, and is in direct proportion to the fluorescence intensity in a certain dosage range. Therefore, when 2-NBDG is rapidly taken up by HepG2, the method is selected in this chapter for the detection of glucose uptake by quantifying the amount of 2-NBDG taken up by means of fluorescence intensity as a measure of the glucose uptake capacity of HepG 2.

As can be seen from the results of fig. 11, after these four doses had been applied to HepG2 cells for 24 hours, there was no effect on cell activity, and the subsequent experiments could be continued. FGF21 promoted glucose uptake by HepG2 cells from 1nM to 1000nM, with a significant difference (p <0.05) between the 10nM and 1000nM groups compared to the model group, and with a dose-response. At a dose of 1000nM FGF21, the glucose uptake increased most and the glucose uptake by the building block returned from 73% to 90%, with no statistical difference in glucose uptake compared to the normal group. This experiment demonstrates that purified FGF21 has biological activity in alleviating insulin resistance.

Next, the pathway of FGF21 to relieve insulin resistance was verified, and as can be seen from fig. 12, the GLUT1 expression levels of the hematopoietic and normal groups were low, and FGF 21-incubated HepG2 cells from 8h to 32h, with increased GLUT1 expression over time, and with significantly increased GLUT1 expression at 16h, 24h, and 32h (p < 0.05). The result of detecting the expression level of p-Erk1/2 by using Western blot shows that the expression level of the modeling group is obviously reduced compared with that of a normal group, the expression level of the protein can be enhanced by adding FGF21, and the effect is most obvious at 30min and 1 h.

Example 2 preliminary optimization of the conditions for crystallization of FGF21 protein

1. Main apparatus and equipment

The main equipment used in this example is shown in Table 7.

Table 7: laboratory apparatus and device

Device name	Model number	Manufacturer of the product
			Full-automatic crystallization workstation	Gryphon-LCP	Bioray Co Ltd
Crystal observation microscope	CrysScore	Art Robbins Instruments Inc
			Crystal incubator	Made in China	Made in China
Vortex mixer	MS2	IKA, Germany
			Desk type low-temperature centrifuge	Centrifuge 5418R	Eppendorf China Co Ltd
Electronic analytical balance	AR1140	Mettlerlatio instruments (Shanghai) Co Ltd
			Ultra-low temperature refrigerator (-80 ℃ C.)	DW-HL 668	Mike Mitsubishi Low temperature science and technology Co Ltd
PH meter	DELTA 320	Mettler-Tollido instruments (Shanghai) Co
			Spectrophotometer	UV-2800	Yoneco instruments Ltd
24-hole hanging drop plate	BR-PC1041	Bioray Co Ltd
			48-hole crystal plate	HR3-180	Hampton Corp
96 deep hole crystal plate	GSK09602	Bioray Co Ltd

2. Primary reagent

The main experimental reagents used in this example are shown in table 8.

Table 8: main experimental reagent for FGF21 crystallization experiment

Name of reagent	Reagent manufacturer
		Crystal Screen kit	Hampton Corp
Detergent Screen	Hampton Corp
		Additive Screen	Hampton Corp
100％Tascimate pH 7.0	Hampton Corp
		PEG Rx kit	Hampton Corp
PEG/Ion kit	Hampton Corp
		Salt Rx kit	Hampton Corp
Index kit	Hampton Corp
		Wizard Classic Tubes Suite	Rigaku corporation
Glycerol	Sigma Co Ltd
		Bis-tris propane	Sigma Co Ltd
2-CAlcohol(s)	Sigma Co Ltd
		Hepes sodium	Sigma Co Ltd
Natrix kit	Hampton Corp
		Structure Screen kit	MD Ltd
3D Structure Screen kit	MD Ltd
		PACT Screen box kit	MD Ltd
JCSG plus kit	MD Ltd
		FGF19 protein (human source, purity 95%)	R&D Systems
FGF23 protein (human source, purity 95%)	R&D Systems
		Tris hydroxymethyl aminomethane (Tris base)	Sigma Co Ltd

3. Research on FGF21 superfamily protein relieving insulin resistance

To investigate whether FGF19 and FGF23 belonging to the same subfamily also have the function of alleviating insulin resistance, glucose uptake assays were performed using the same protein concentration gradient as FGF 21. The specific assay is shown in example 1.

4. Structural comparison of FGF21 and its cognate subfamily protein

The primary sequences of FGF21, FGF19, and FGF23 were downloaded from the NCBI database and aligned using T-coffee software, whereas the alignment of protein secondary structures was performed in the psicred protein sequence analysis software.

5. Primary screening of FGF21 protein crystallization conditions

The primary screening of protein crystals is carried out by the sitting-drop vapor phase diffusion method, and the Crystal growth screening kit used comprises Crystal Screen Kits, Wizard, Index kit, PEG/Ion Screen, PEG/Rx Screen, SaltRx, Structure Screen 1/2, 3D Structure Screen, PACT Screen box1, JCSG plus, Natrix1/2 and the like. The specific operation is as follows: adding 40 mu L of crystal screening reagent solution into a bottom liquid storage tank of a 96 deep-hole crystal growth plate, mixing 1 mu L of FGF21 protein (with high enough purity and concentration of 10mg/mL) with 1 mu L of bottom tank liquid, placing the crystal growth plate in a sitting hole, sealing with transparent adhesive tape, waiting for crystal growth at 4 ℃ and 18 ℃, avoiding vibration and temperature fluctuation as much as possible, observing the growth condition of the protein crystal every 3 days, and recording.

6. Optimization of FGF21 protein crystallization conditions

The crystal optimization is carried out by adopting a 24-hole hanging drop plate and a 48-hole crystal plate, and the adopted methods comprise five methods of adding a detergent, adding metal ions or small molecules, optimizing the concentration of a precipitator, optimizing the pH value and optimizing the type of a pool buffer solution.

For the addition of detergent, metal ions or small molecules, 100. mu.L of crystal screening reagent solution was added to the bottom reservoir of the 48-well crystal growth plate, and then 0.8. mu.L of FGF21 protein (sufficiently pure and at a concentration of 10mg/mL) and 0.2. mu.L of detergent (metal ions or small molecules) were mixed with 1. mu.L of the bottom reservoir and spotted into the well and sealed with transparent tape.

For the optimization of the concentration of the precipitant, the optimization of the pH value and the optimization of the type of the buffer solution of the pool liquid, a 24-hole hanging drop plate is utilized, 200 mu L of the pool liquid is added into a bottom liquid storage pool, FGF21 and the bottom pool liquid are mixed on a glass slide, the adding amount is 1 mu L of protein adding pool liquid and 1 mu L of protein adding pool liquid, and then a cover glass is placed on the pool liquid in an inverted mode by silica gel to provide a closed environment. After treatment according to different optimization modes, the crystal growth plate is placed at 4 ℃ and 18 ℃ to wait for crystal growth, vibration and temperature fluctuation are avoided as much as possible, the growth condition of the protein crystal is observed once every 3 days, and the record is made.

7. Results and analysis of the experiments

(1) Effect of FGF21 superfamily proteins on insulin resistance

Differences in function from FGF21 were determined by measuring the effects of FGF19 and FGF23 on HepG2 cell activity and glucose uptake. As can be seen from the results of CCK-8 in FIG. 13, FGF19 and FGF23 acting on HepG2 cells also had no significant effect on the activity of the cells at 24 h. However, from the results of glucose absorption, FGF19 and FGF23 did not increase glucose absorption, and the experimental group and the modeling group were not significantly different from each other, and failed to achieve the effect of alleviating insulin resistance.

(2) Structural difference analysis of FGF21, FGF19 and FGF23

The structure of FGF family proteins is strongly conserved in the central core region, and FGF21, FGF19 and FGF23, which belong to autocrine proteins, exert their physiological functions without the involvement of heparin sulfate, but by forming a complex with FGFR and β Klotho.

From the comparison of the primary sequences (FIG. 14), the three proteins differ greatly in primary structure, with homology of only 35%, but have a high degree of similarity in the middle 60-150 amino acid portion, which is related to the conservation of the FGF family proteins in the core region.

From the comparison of the secondary structure with FIG. 15, it can be seen that the similarity of the secondary structure of three proteins is strong, mainly β -strand is used as the main amino acid among 40-160, which is consistent with the clover structure of the middle core region of the FGF family protein, and the homology is consistent with the comparison of the primary structure, indicating that the amino acid folding at the part forms the space structure specific to the FGF family protein.

(3) Protein crystal concentration and buffer determination

In order to compare the differences among FGF21, FGF19, and FGF23 from the perspective of spatial structure and elucidate the reasons why these different functions are exerted, the spatial structure of FGF21 was analyzed by selecting a protein crystal form. FGF19 was crystallized under 100mM Tris-HCl (pH 8.5),200mM sodiucetate, 15% (v/v) polyethylene glycol 4000, FGF23 was crystallized under 100mM Tris-HCl (pH 8.5),1.0M (NH)₄)₂SO₄,10mM[Co(NH₃)₆]Cl₃. The FGF21 protein was treated using these two crystallization conditions and no crystal growth was found.

To investigate the effect of protein concentration, buffer conditions and culture temperature on protein stability to obtain conditions for crystal growth of FGF21, 24 conditions in table 9 were selected for protein stability determination.

In terms of the selection of the tags, the protein stability determination and the subsequent crystal condition screening optimization are carried out on the proteins obtained by the His tag and the GST tag because different tags have influence on the folding and arrangement of the proteins in the expression process. Three high-concentration protein solutions of 10mg/ml, 15mg/ml and 20mg/ml are selected for determination, because the high concentration of the protein is favorable for the accumulation of crystal forms in the protein crystallization process. After standing for 24 hours, a solution having a protein concentration of 20mg/ml may have a fine granular protein precipitate generated, but during the protein crystallization, there may be a case where the precipitate gradually disappears during the culture and grows into crystals, and therefore, the inventors continuously observed for 7 days to judge an appropriate protein concentration.

The buffer and incubation temperature also have a large effect on the growth of protein crystals. The formation of crystal nuclei and the continuous growth of crystals depend on various conditions of medium conditions, Tris and Hepes are selected as buffers based on the stability of FGF21 protein, pH is selected to be 8.0 and 7.5 away from the isoelectric point of the protein, and the culture temperature is 18 ℃ and 4 ℃.

After culturing the 24-conditioned protein crystals for 7 days, it was found that there was still a significant precipitate in the 20mg/ml protein solution, indicating that the protein properties were unstable at this concentration. The tag type, incubation temperature and pH had no significant effect on the growth of the protein solution under the naked eye.

Table 9: protein concentration and buffer selection

(4) Preliminary screening results for protein crystallization conditions

Except the conditions corresponding to 20mg/ml protein, the following kits were screened for the proteins under the other 16 screening conditions by the mini sitting-drop gas phase diffusion method: crystal Screen Kits, Wizard, Index kit, PEG/IonScreen, PEG/Rx Screen, Salt Rx, Structure Screen 1/2, 3D Structure Screen, PACTSCREEN box1, JCSG plus, Natrix1/2, SGC kit and MD kit, for a total of 1248 primary screening conditions. Protein crystal growth is a slow process, FGF21 protein requires culturing for many months to obtain more stable protein crystals, and the crystals appear to be different over time.

No protein crystals were produced when the crystals were cultured for 3 days, 6 days, and 9 days under a microscope. Further, under some conditions, bubble-like objects or shadows appeared in the mixture (fig. 16), and thus it was found that the crystallization of the target protein was not suitable under these conditions, but the experiment was repeated 2 times to confirm that the unsuitable crystallization conditions were excluded because the sealing was not tight enough and the crystals were not grown due to gas leakage.

After 12 days of crystal growth, the protein was observed to have a crystal form by microscopy. In these conditions, needle-like crystals, dense fine crystals, irregularly shaped crystals and radioactive crystals (shown in FIG. 17) were present, and further observation was required.

After the crystals are cultured for one month, the crystals under two conditions disappear under the four conditions of the initial long crystals, which shows that the target protein has unstable crystal properties and is easy to decompose for a long time under the two conditions; the crystal in the radioactive state does not continue to grow and remains unchanged; only the morphology of the needle-like crystals had grown further. The growth conditions for this crystal were Salt Rx No. 96.

Thus, in the preliminary screening, the final more stable protein crystallization conditions were determined to be number 96 in the Salt Rx kit, with the specific conditions being 60% v/v taccimate pH7.0, 0.1M Bis-Tris propane pH 7.0; the protein for growing the crystal is protein with His label concentration of 15mg/ml, the buffer is Tris (pH8.0), and the culture temperature is 4 ℃.

(5) Optimization of protein crystallization conditions

Next, further optimization screening, including 5 crystal optimization, was performed according to the protein crystallization conditions selected in the preliminary screening. The details are shown in Table 10 below.

Table 10: protein crystal condition optimization results

All conditions of the five optimization modes are subjected to crystal condition optimization screening according to the addition method, and the growth condition of the protein crystal is observed every 3 days. The optimization results show that the protein crystal conditions are not improved and the protein crystals no longer grow and a large amount of precipitate is produced with the addition of detergents, metal ions or small molecules. For the optimized precipitant, the protein state is unstable under the condition of high-concentration precipitant, and precipitation is generated. Optimization of the pH did not significantly improve the growth of the crystals. Therefore, the crystal growth state was changed only by changing the pool buffer, and the crystal growth was improved in both cases of 0.1M Tris pH7.0 and 0.1M MOPS pH7.0 (FIG. 18). Finally, FGF21 formed well-formed crystals at 60% v/v TACSIMATE pH7.0, 0.1M Tris/MOPS pH7.0, 4 deg.C

Precipitating agents are added during protein crystallization to reduce the mobility of water, increasing the effective concentration of protein is an important process in protein crystallization, the selection and optimization of precipitating agents is critical for crystal formation, and common precipitating agents include salts and polymers. Among the crystallization conditions reported, the conditions with polyethylene glycol as precipitant account for 60%. FGF19 was crystallized in the presence of polyethylene glycol as the precipitating agent and FGF23 was crystallized in the presence of ammonium sulfate, however, none of these common precipitating agents were found to be capable of crystallizing FGF21 when the conditions for FGF21 crystallization were initially screened. The FGF21 precipitant obtained from the final screening was taccimate, a mixture of sodium malonate, sodium acetate, trisodium citrate, succinic acid, DL-malic acid, sodium formate, and disodium tartrate. The precipitant contains a large amount of electrolyte small molecules, and the concentration of salt ions and the precipitant concentration in the process of forming protein crystals are regulated, so that the formation of FGF21 crystallization conditions is closely related to the type of the precipitant and the existence of the small molecules.

This example 2 can conclude at least one of the following:

(1) FGF19 and FGF23 proteins belonging to a subfamily with FGF21 have no significant influence on the activity of HepG2 cells under the dosage of 10nM to 1000nM, but have no function of relieving insulin resistance, the homology of a primary structure of the protein to FGF21 is only 35%, the regional similarity of a middle core of a secondary structure is high, and the amino acid residues and conformations of an N-end and a C-end are greatly different.

(2) The FGF21 crystal condition obtained by primary screening is No. 96 in a Salt Rx kit, and the specific conditions are 60% v/v taccimate pH7.0 and 0.1M Bis-Tris propane pH 7.0; the protein for growing the crystal was His-tag concentration of 15mg/ml, the buffer was Tris (pH8.0), and the incubation temperature was 4 ℃. Under the condition, the protein crystal is needle-shaped.

(3) The addition of detergents, small molecules or metal ions did not improve protein crystallization and was accompanied by protein precipitation. Changing the precipitant concentration and pH also has no significant effect on the optimization of protein crystal conditions. And the crystallization condition of FGF21 protein can be obviously improved by changing the type of the buffer solution in the pool liquid and replacing 0.1M Bis-Tris propane with 0.1M Tris or MOPS. Finally, FGF21 formed well-formed crystals at 60% v/v TACSIMATE pH7.0, 0.1M Tris/MOPSpH7.0, 4 ℃.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> university of agriculture in China

<120> preparation, purification and crystallization of fibroblast growth factor 21

<130>PIDC3182559

<160>2

<170>PatentIn version 3.3

<210>1

<211>550

<212>DNA

<213>Artificial

<220>

<223> nucleotide sequence of 29-209 fragment of FGF21 gene

<400>1

cacccgattc cggattcctc tcagtcctct cctgcaattc gggggccaag tccggcagcg 60

gtacctctac acagatgatg cccagcagac agaagcccac ctggagatca gggaggatgg 120

gacggtgggg ggcgctgctg accagagccc cgaaagtctc ctgcagctga aagccttgaa 180

gccgggagtt attcaaatct tgggagtcaa gacatccagg ttcctgtgcc agcggccaga 240

tggggccctg tatggatcgc tccactttga ccctgaggcc tgcagcttcc gggagctgct 300

tcttgaggac ggatacaatg tttaccagtc cgaagcccac ggcctcccgc tgcacctgcc 360

agggaacaag tccccacacc gggaccctgc accccgagga ccagctcgct tcctgccact 420

accaggcctg ccccccgcac tcccggagcc acccggaatc ctggcccccc agccccccga 480

tgtgggctcc tcggaccctc tgagcatggt gggaccttcc cagggccgaa gccccagcta 540

cgcttcctga 550

<210>2

<211>634

<212>DNA

<213>Artificial

<220>

<223> nucleotide sequence of construct

<400>2

atgggcagca gccatcatca tcatcacagc agcggcgaaa cctgtatttt cagggcatat 60

cacccgattc cggattcctc tcagtcctct cctgcaattc gggggccaag tccggcagcg 120

gtacctctac acagatgatg cccagcagac agaagcccac ctggagatca gggaggatgg 180

gacggtgggg ggcgctgctg accagagccc cgaaagtctc ctgcagctga aagccttgaa 240

gccgggagtt attcaaatct tgggagtcaa gacatccagg ttcctgtgcc agcggccaga 300

tggggccctg tatggatcgc tccactttga ccctgaggcc tgcagcttcc gggagctgct 360

tcttgaggac ggatacaatg tttaccagtc cgaagcccac ggcctcccgc tgcacctgcc 420

agggaacaag tccccacacc gggaccctgc accccgagga ccagctcgct tcctgccact 480

accaggcctg ccccccgcac tcccggagcc acccggaatc ctggcccccc agccccccga 540

tgtgggctcc tcggaccctc tgagcatggt gggaccttcc cagggccgaa gccccagcta 600

cgcttcctga ctcgagcacc accaccacca ccac 634

Claims

1. A construct, comprising: a 29-209 FGF21 gene fragment and an expression vector carrying a purification tag, wherein the 5 'end of the purification tag is connected with the 3' end of the 29-209 FGF21 gene fragment.

2. The construct of claim 1, wherein the expression vector is a prokaryotic expression vector;

optionally, the prokaryotic expression vector is pET-28a-TEV and pGEX-4T-2;

optionally, the 29-209 fragment of the FGF21 gene has a nucleotide sequence shown as SEQ ID NO. 1;

optionally, the purification tag comprises at least one selected from His and GST;

optionally, the construct has a nucleotide sequence shown as SEQ ID NO. 2.

3. A recombinant strain comprising the construct of any one of claims 1 to 2;

optionally, the recombinant strain is escherichia coli.

4. A method for producing the recombinant strain of claim 3, wherein the construct of any one of claims 1 to 2 is introduced into a host cell;

optionally, the host cell is e.

5. A method for preparing FGF21 protein by using Escherichia coli, which comprises the following steps:

culturing said recombinant strain of claim 3 or obtained according to the method of claim 4 under conditions suitable for the expression of the FGF21 protein, so as to obtain said FGF21 protein;

optionally, the method further comprises subjecting the FGF21 protein to a first purification treatment;

optionally, the first purification treatment is performed by at least one of affinity chromatography, tag excision, ion exchange chromatography, and gel filtration chromatography;

optionally, the method further comprises subjecting the purified product to an enzymatic cleavage treatment to remove the purification tag;

optionally, the enzymatic digestion is performed under TEV enzymatic digestion;

optionally, further comprising a second purification treatment of the enzyme digestion treatment product;

optionally, the second purification treatment is performed by at least one of affinity chromatography, tag excision, ion exchange chromatography, and gel filtration chromatography.

6. A method for preparing FGF21 protein crystals,

(1) preparing an FGF21 protein according to the method of claim 5;

(2) subjecting the protein obtained in the step (1) to crystallization treatment so as to obtain FGF21 protein crystals, wherein the crystallization treatment is performed under the conditions of 60% TACSIMate, 0.1M buffer solution, pH7.0 and temperature of 4 ℃;

optionally, the buffer is Bis-Tris expand, Tris or MOPS;

preferably, the buffer is Tris or MOPS.

7. A crystal of FGF21 protein, wherein the crystal of FGF21 protein is prepared by the method of claim 6.

8. Use of the crystal of FGF21 protein of claim 7 in the preparation of a medicament for the treatment or prevention of type 2 diabetes.

9. A pharmaceutical composition comprising the FGF21 protein prepared by the process of claim 5 and/or the FGF21 protein crystal of claim 7.

10. A pharmaceutical combination comprising the FGF21 protein prepared by the process of claim 5 and/or the FGF21 protein crystal of claim 7 and other agents useful for the treatment or prevention of type 2 diabetes mellitus, wherein the other agents useful for the treatment or prevention of anti-type 2 diabetes mellitus comprise biguanide hypoglycemic agents, insulinotropic agents, α -glucosidase inhibitor agents, insulin sensitizers, insulin and insulin analogs, glucagon-like peptide 1, sodium-glucose cotransporter 2 inhibitors, or dipeptide-carnosine 4 inhibitors.